J Aqua Anim HLTH - 2021 - Bai - Characterization of Pathogenic Pseudomonas Alcaligenes Isolated From Koi Carp in China

Journal of Aquatic Animal Health 33:243–251, 2021
© 2021 American Fisheries Society

ISSN: 0899-7659 print / 1548-8667 online
DOI: 10.1002/aah.10141
ARTICLE
Characterization of Pathogenic Pseudomonas alcaligenes Isolated from

Koi Carp in China
Jie Bai, Yian Huo, Xiucai Hu, Aijun Lü,* and Jingfeng Sun
Tianjin Key Lab of Aqua-Ecology and Aquaculture, College of Fisheries, Tianjin Agricultural University, Tianjin 300384,
China,
Abstract
Pseudomonas alcaligenes infection is rare in aquaculture. In this study, we provide the first report on the charac-
terization of P. alcaligenes from koi (a variant of Common Carp Cyprinus carpio) in China. A gram-negative bac-
terium was isolated from the diseased koi and was named KCP-516. Morphological and biochemical tests as well as
phylogenetic tree analyses derived from 16S ribosomal RNA, gyrase subunit A, and gyrase subunit B gene sequencing
all strongly indicated that the isolate KCP-516 was P. alcaligenes. In liquid medium, the optimal growth conditions
were 25°C, 2.5% NaCl, and pH 8. The pathogenicity of the isolate was demonstrated in koi, with 7.0 × 104 CFU/g
fish weight identified as the dose lethal to 50% of test fish. The results will provide a scientific reference for the diag-
nosis and treatment of P. alcaligenes infection.
Pseudomonas alcaligenes is an aerobic, gram-negative Monopterus albus (Ma and Shu 2000) and Chinese Stur-
bacillus and mainly opportunistic pathogen in humans geon Acipenser sinensis (Xu et al. 2015). As an opportunis-
and animals (Bowman 2005). Generally, the characteriza- tic infection, P. alcaligenes is increasingly recognized as a
tion of P. alcaligenes has emerged as an important focus serious subhealth problem in aquaculture (Gopal and
for ecological research (Su et al. 2006; Bharathiraja et al. Gupta 2002; Suzuki et al. 2013). The prevalence of oppor-
2013; Wang et al. 2015). Recent studies have shown that tunistic pathogenic P. alcaligenes was rarely reported in
P. alcaligenes is useful as a microbial inoculant for fish populations under stressful conditions (Ma and Shu
biodegradation, and it is believed to be a pathogenic bac- 2000; Xu et al. 2015). Notably, water temperature is con-
terium (Flores-Carrero et al. 2016; Witkowska et al. sidered to be the most important environmental factor
2018). It is occasionally reported as an opportunistic affecting P. alcaligenes infection in cultured fish (Xu et al.
pathogen in a variety of species but is a frequent inhabi- 2015; Huang et al. 2019). However, no detailed investiga-
tant of soil and water (O’Mahony et al. 2006; Suzuki tion of P. alcaligenes in ornamental fish has been
et al. 2013; Xu et al. 2015). In humans, P. alcaligenes has reported.
been known as a rare opportunistic pathogen (Valenstein The koi (a variant of Common Carp Cyprinus carpio)
et al. 1983; Suzuki et al. 2013). To date, there has been lit- is cultivated as a pet fish and is a very popular ornamen-
tle investigation of the pathogenicity of P. alcaligenes iso- tal freshwater species (Lü et al. 2016; Song et al. 2017).
lated from patients (Valenstein et al. 1983; Suzuki et al. With high population densities of koi in intensive culture
2013; Flores-Carrero et al. 2016). In animals, an unusual systems, a high incidence of bacterial or viral diseases
case of keratitis caused by P. alcaligenes infection was pre- often causes great economic losses of cultured koi (Shen
viously reported (Utter and Wotman 2009). In fish, P. et al. 2014; Crossland et al. 2018; Liu et al. 2018). In
alcaligenes was isolated from diseased Asian Swamp Eel June 2017, a disease outbreak occurred at a koi farm in
*Corresponding author: lajand@126.com

Received September 30, 2019; accepted July 26, 2021
243
15488667, 2021, 4, Downloaded from https://afspubs.onlinelibrary.wiley.com/doi/10.1002/aah.10141 by Universidad de Vigo, Wiley Online Library on [01/04/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
244 BAI ET AL.
Tianjin, China; the bacterial strains were isolated from was 26 ± 2°C, and ammonia and nitrite content in the
the diseased fish after routine clinical examination and pond water was less than 0.02 mg/L. Healthy koi juve-
necropsy. On the basis of biochemical characteristics and niles (weight ~ 5 g/fish) with no history of disease were
16S ribosomal RNA (rRNA) gene sequence analysis, the provided by a local fish supplier and used in experimen-
isolates were identified as P. alcaligenes. In this article, tal challenges. Prior to infection, koi were acclimatized
we describe the growth characteristics and pathogenicity for 7 d in aquaria with aeration. A photoperiod of 12 h
of the bacterial isolates as well as the clinical findings on light : 12 h dark was maintained, and fish were given
the koi juveniles. These results will provide a scientific commercial feed (Tongwei, Shanghai, China) once daily.
reference for diagnosis and treatment of this bacterial All procedures conducted on the fish used during this
disease. study were approved by the Institutional Animal Care
and Use Committee at Tianjin Agricultural University
(TAU-IACUC-20170516).
METHODS Bacterial isolation.— To determine the presence or
Fish.— In June 2017, diseased koi (length = 10–15 cm) absence of pathogens, three representative symptomatic
were collected from a fish farm in Tianjin, northern fish were disinfected with 75% (volume/volume) alcohol
China; transported to the laboratory in oxygenated bags for 2 min and then immediately subjected to postmortem
at 0°C; and processed within 2 h. Two ponds of fish from examination under aseptic conditions. For bacterial isola-
the same fry supplier were affected after about 11 weeks tion and purification, samples of internal organs (liver,
of rearing in a static-water system with low aeration; kidney, and spleen) were collected from typical diseased
cumulative mortality levels of 80% were found in the fish and streaked onto separate Luria–Bertani (LB) and
absence of stressors, and mortality increased with water 5% sheep blood agar plates (BioMerieux, Shanghai,
temperature. The obvious clinical signs in diseased fish China) for each tissue under the aseptic environment and
included lethargy, appetite loss, petechial hemorrhages incubated at 28°C for 24 h according to previously
on the tail fin, and ulcers in the skin (Figure 1); upon described methods (Luo et al. 2015; Qian et al. 2020). All
postmortem examination, the fish mainly displayed bacterial colonies obtained in the original plates of exam-
ascites, lesions, and hemorrhages in internal organs, ined fish had identical morphology; they were then
including liver, spleen, and kidney. Additionally, the selected and restreaked at least three times to ensure pur-
stocking density was generally 75 fish/m3, temperature ity, and the dominant strain was named KCP-516. Pure
incubation was stored at −80°C with a final concentration
of 15% glycerol.
Additionally, the gills, body surface mucus, and inter-
nal tissues of the diseased fish were microscopically
examined to evaluate for the presence of fungal or para-
sitic infections (Leica Application Suite V4, Wetzlar,
Germany). The virological investigations of diseased fish
showed PCR-negative results for koi herpesvirus and
carp edema virus as described by our group (Liu et al.
2018).
Morphological, physiological, and biochemical tests.—
The gram staining test was conducted by the Hucker
method, and the morphological characteristics of three
colonies were observed under a microscope prior to physi-
ological and biochemical testing (Lü et al. 2017). Physio-
logical and biochemical tests for isolate KCP-516 were
performed using a commercial microbacteria biochemical
test system (Tianhe, Tianjin, China), including gelatinase
(enzyme number 3.4.24.24; IUBMB 1992), oxidase
(1.9.3.1), phenylalanine, citrate (Simmons), tartrate, malo-
nate, gluconate, starch, glucose, galactose, mannose,
xylose, fructose, sorbitol, mannitol, and inositol, among
FIGURE 1. Gross lesions observed in a diseased koi during the others. The microbacteria biochemical test tube was incu-
outbreak, including ulcerative skin (black arrow) and petechial bated at 28°C for 48 h. The results were evaluated after
hemorrhages in the tail fin (red circle). [Color figure can viewed at incubation according to the manufacturer’s instructions,
afsjournals.org.] and the testing process was repeated three times to
CHARACTERIZATION OF PSEUDOMONAS ALCALIGENES FROM KOI 245
TABLE 1. The PCR primers for 16S ribosomal RNA (rRNA), gyrase subunit A (gyrA*), and gyrase subunit B (gyrB*) genes with expected amplified
DNA fragments.
Gene Primer Nucleotide sequence (5'–3') Temperature (°C) Size (bp) Reference
16S rRNA 27F AGAGTTTGATCCTGGCTCAG 55 1,450 Weisburg et al. 1991
1492R ACGGCTACCTTGTTACGACTT
gyrA* F AGCATGTCTTTCAGGTTCAG 55 1,004 Present study
R AAACAGTCCTACCTCGACTA
gyrB* F ACTCAAAGGTCTGGATGCCG 60 1,498 Present study
R CAGCAACAGGGTACGGATGT
validate the conventional biochemical and physiological constructed using the neighbor-joining algorithm of
identification. MEGA7 software, with 1,000 bootstrap replicates.
Growth characteristics.— The growth characteristics of Experimental challenge.— Sixty apparently healthy koi
the isolate were determined as described earlier by our were used for challenge experiments. Experimental fish
group (Han et al. 2017). For these analyses, flasks con- were confirmed to be culture negative for bacterial infec-
taining 100 mL of liquid LB medium and 1 mL of bacte- tion by culturing liver and kidney samples from repre-
rial suspension (1.2 × 108 CFU/mL) were prepared. To sentative groups of fish on LB and blood agar plates,
analyze temperature effects, the flasks were incubated at respectively. Exponential-phase bacteria grown in shak-
20, 25, 30, and 35°C. To assess the effect of salinity, NaCl ing flasks at 28°C in LB broth were pelleted and resus-
was supplemented at a concentration of 0.0, 0.5, 1.5, 2.5, pended in sterile phosphate-buffered saline to achieve a
and 3.5% and the flasks were incubated at 25°C. To exam- final concentration of 1.2 × 108 CFU/mL. The bacterial
ine the effect of pH, the flasks were incubated at pH 5, 6, concentration (CFU/mL) was determined by plating 10
8, and 9, adjusted with 1.0-mol/L HCl or NaOH. All sam- µL of 10-fold serial dilutions onto LB agar plates (Lü
ples were repeated three times; samples were cultured in et al. 2017). Fish were infected by intraperitoneal injec-
shaking incubator at 120 rpm for 34 h, and the optical tion with 0.1 mL of the bacterial suspensions; the con-
density at 600 nm was measured every 2 h. trol fish were injected with 0.1 mL of sterile
Polymerase chain reaction amplification.— Total geno- physiological saline. The dose lethal to 50% of test fish
mic DNA of the isolate was extracted using the (LD50) was calculated based on the total cumulative
UNIQ-10 column genomic DNA extraction kit (Sangon mortality (Reed and Muench 1938). The experimental
Biotech, Shanghai, China). The primers of 16S rRNA challenge was allowed to run for 7 d, and data on clini-
and two housekeeping genes (gyrase subunits A and B cal signs, time of death, morbidity, and numbers of fish
[gyrA*, gyrB* (5.6.2.2)]) were synthesized by a com- dying were recorded. The same bacterial strain was
mercial company (Genewiz, Tianjin, China) and are reisolated and identified from artificially infected koi to
summarized in Table 1. The PCR amplification was fulfill Koch’s postulates (Camus et al. 2008).
performed as follows: initial denaturation at 94°C for
5 min; followed by 30 cycles of denaturation at 95°C
for 45 s, annealing at 55°C or 60°C for 30 s, and exten- RESULTS
sion at 72°C for 1 min; and a final extension at 72°C
for 10 min. The PCR products were evaluated by elec- Morphological, Physiological, and Biochemical
trophoresis in 1% agarose gel by staining with ethidium Characteristics
bromide. The PCR products were purified using a All isolates from the visceral organs of diseased koi
QIAquick PCR Purification Kit (Qiagen, Valencia, Cal- were the same strain, and those colonies were white,
ifornia) and cloned into pMD18-T vector (Takara, translucent, circular, slightly convex with an entire edge,
Tokyo, Japan) to transform Escherichia coli DH5α and 1.0–2.0 mm in diameter after a 24-h incubation per-
competent cells (Lü et al. 2017). The positive clones iod. Thus, the gram-negative, rod-shaped bacterium was
were sequenced in both directions by Genewiz. The tentatively named strain KCP-516. It was positive for oxi-
DNA sequence analysis was performed using the Basic dase and nitrate reductase but negative for gelatinase,
Local Alignment Search Tool (BLAST) in the National phenylalanine, tartrate, starch, glucose, and sorbitol
Center for Biotechnology Information database (http:// (Table 2), indicating that KCP-516 belongs to the genus
www.ncbi.nih.gov/BLAST/). Phylogenetic trees were Pseudomonas based on Bowman (2005).
246 BAI ET AL.
TABLE 2. Biochemical results for bacterial isolate KCP-516 from diseased koi (+ = positive; − = negative; ± = weak; d = differs among strains; n =
not given). Data for KCP-516 were obtained from the present study. Characteristics of Pseudomonas alcaligenes are compiled from Bowman et al.
(2005).
Characteristic KCP-516 P. alcaligenes Characteristic KCP-516 P. alcaligenes

Gelatinase (IUBMB 1992) − − Lactose − n
Oxidase (IUBMB 1992) + + Starch − −
Gluconate − − Galactose − −
Arabinose − − Malonate − −
ONPGa − n Xylose − −
Glucose − − KCN − n
Salicin − n Tartrate − −
Amygdalin − n Melibiose − n
Phenylalanine − − Esculin − n
Citrate − d Trehalose − −
Hydrogen sulfide − n Sorbitol − −
Cellobiose − n Turanose − n
Mannose − − Fructose − −
Rhamnose − n DNase (3.1.21.2; + n
IUBMB 1992)
Lysine decarboxylase (4.1.1.18; IUBMB 1992) − − Maltose + −
Nitrate reductase (1.7.1.1; IUBMB 1992) + n Dulcitol − n
Raffinose − n Xylitol − n
Melezitose − n Ornithine − −
Mannitol − − Sorbose − n
Erythritol − n Inositol − −
0% NaCl + n 20°C + n
0.5% NaCl + n 35°C + +
1.5% NaCl + n pH 5.0 ± n
2.5% NaCl + n pH 7.0 + n
3.5% NaCl + n pH 9.0 + n
a
ONPG = o-nitrophenyl-β-d-galactopyranoside.
Analyses of 16S Ribosomal RNA, gyrA*, and gyrB* Gene Growth Characteristics of the Isolate
Sequences The isolate KCP-516 grew at a temperature between
The 16S rRNA, gyrA*, and gyrB* genes of isolate 20°C and 35°C, a salinity between 0.0% and 3.5% NaCl,
KCP-516 were amplified by PCR for sequencing. These and a pH between 5 and 9. Optimal growth was observed
sequences were submitted to GenBank under accession at 25°C, 2.5% NaCl, and pH 8 (Figure 3).
numbers MH979631, MH985593, and MH985594,
respectively. The BLAST alignments revealed that iso- Experimental Challenge
late KCP-516 was most closely related to P. alcaligenes The isolate KCP-516 was confirmed as pathogenic to
type strain ATCC 14909, with 16S rRNA (NR114472), koi by challenge experiments. The results showed that P.
gyrA* (WP061904836), and gyrB* (WP076423501) alcaligenes strain KCP-516 had a cumulative mortality
sequence identities of 99.04, 99.00, and 98.16%, respec- rate of 100% at a dose of 1.2 × 107 CFU/fish, with an
tively. The phylogenetic trees based on the 16S rRNA LD50 value of 7.0 × 104 CFU/g fish weight in koi juve-
and gyrB* sequences confirmed that the isolate KCP- niles. In the experimental challenge, the main clinical signs
516 was most closely related to P. alcaligenes reference were similar to signs observed in natural infections, includ-
strains (Figure 2), Therefore, phylogenetic analyses ing hemorrhages in the tail fin and ulcers in the skin (Fig-
derived from 16S rRNA, gyrA*, and gyrB* sequences ure 4). Survival rates of the experimentally infected koi are
all strongly indicated that the identity of isolate KCP- shown in Figure 5. To validate Koch’s postulates, the
516 was P. alcaligenes. same P. alcaligenes strains were reisolated and identified
(A)
60 P. alcaligenes strain ATCC 14909 (NR 114472)
99 KCP-516 (MH979631)
51 P. alcaligenes (D84006)
P. otitidis (AY953147)
99 P. aeruginosa (HE978271)
P. guangdongensis (JX274436)
99 P. linyingensis (HM246142)
100 P. sagittaria (JQ277453)
91 P. chloritidismutans (AY017341)
78
66 P. kunmingensis (JQ246444)
100 P. xanthomarina (AB176954)
57
P. zhaodongensis (JQ762275)
P. stutzeri ATCC 17588 LMG 11199 (AF094748)
P.pseudoalcaligenes LMG 1225T (Z76666)
49 63 45 P. toyotomiensis (AB453701)
P. chengduensis (EU307111)
P. oleovorans subsp. lubricantis (DQ842018)
84 96
P. alcalophila (AB030583)
P. mendocina (D84016)
80 P. panipatensis (EF424401)
P.citronellolis (Z76659)
88
89 P. nitritireducens (HM246143)
P. multiresinivorans ATCC 700690T (X96787)
100 93
P. nitroreducens (AM088473)
Pseudomonas sp. (AF468448)
V.vulnificus ATCC 27562 T (X76333)
0.002
(B) P. alcaligenes (WP 076423501)

KCP-516 (MH985594)
Pseudomonas sp (WP 043311962)

85 63 Pseudomonas sp (WP 095940918)
P. alcaligenes (WP 061902834)
58
100
P. mendocina (WP 106737944)
90 P. mendocina (WP 013713161)
93 P. mendocina (WP 047592346)
96 P. oleovorans (WP 037054798)
51
P. composti (WP 061238814)
69

46
P. alcaliphila (WP 074677199)
Pseudomonas (WP 037000993)
80 Pseudomonas (WP 017676278)

P. alcaliphila (WP 075744651)
P. sihuiensis (WP 092379037)
P. toyotomiensis (WP 059391029)
70
Pseudomonas (WP 074915568)

65
52 P. oleovorans (WP 074856731)
P. pseudoalcaligenes (WP 003458436)

69
Pseudomonas sp (KUJ92295)
84
P. indoloxydans (WP 108235095)
52
0.002 Pseudomonas sp (OZB31932)
FIGURE 2. Phylogenetic tree analysis of Pseudomonas spp. based on (A) 16S ribosomal RNA sequences and (B) gyrase subunit B amino acid
sequences translated from the nucleotide sequences. Unrooted trees were generated using the neighbor-joining method in MEGA7 software. The
numbers next to the branches indicate percentage values for 1,000 bootstrap replicates. Bootstrap values above 45% are shown at the nodes (V.
vulnificus = Vibrio vulnificus).
248 BAI ET AL.
FIGURE 3. Growth characteristics (optical density [OD]) of bacterial isolate KCP-516: (A) effect of temperature on growth, (B) effect of salinity on
growth, (C) effect of pH on growth, and (D) growth curve for the isolate under optimal conditions of 25°C, 2.5% NaCl, and pH 8.
from the moribund koi by phenotypic and molecular Carrero et al. 2016). Few outbreaks of P. alcaligenes
methods. No clinical signs were observed in the control infection have been reported in aquacultured animals in
fish during the experimental period. China, showing typical signs of external hemorrhages in
the skin and intestinal hemorrhages (Ma and Shu 2000;
Xu et al. 2015). In this study, histopathological observa-
DISCUSSION tion demonstrated the moderate filling of the interlamel-
Pseudomonas alcaligenes is widely distributed in water lar sulci by proliferating epithelial cells and possibly
and soil (Bowman 2005; Su et al. 2006). It is commonly inflammatory cells in gills, the presence of pigment-
used as a beneficial bacillus for biodegradation and biore- containing macrophages in the spleen, and mild submu-
mediation purposes (Oliveira et al. 2009; Bharathiraja cosal inflammation in the intestines (data not shown). To
et al. 2013; Wang et al. 2015). Pseudomonas alcaligenes our knowledge, this study represents the first report of a
is frequently found in natural habitats and is occasionally P. alcaligenes infection in koi associated with significant
observed as an opportunistic pathogen (Ma and Shu mortality; diseased koi presented clinical signs similar to
2000; Gopal and Gupta 2002; Utter and Wotman 2009; those observed in other fish. These findings will help us
Flores-Carrero et al. 2016). Several studies have reported to understand the nature of P. alcaligenes as an oppor-
opportunistic P. alcaligenes infections in humans and ter- tunistic pathogenic bacterium in ornamental fish.
restrial and aquatic animals (Ma and Shu 2000; Gopal Pseudomonas alcaligenes is regularly reported as an
and Gupta 2002; Utter and Wotman 2009; Flores- opportunistic pathogen in fish populations under stressful
(A) susceptibility of Chinese Sturgeon to P. alcaligenes infec-

tion (Xu et al. 2015). Although no indicator of stress was
investigated for the cultured koi, the high water tempera-
ture over 26°C might be a major stressor contributing to
the opportunistic P. alcaligenes outbreak. In this study,
the optimal growth temperature was observed at about
26°C for P. alcaligenes; further studies focusing on this
opportunistic pathogen are required.
(B) In ornamental fish species, antimicrobial resistance and
susceptibility will provide information for clinical treat-
ment and prevention (Lü et al. 2016; Song et al. 2017). It
is worth mentioning that multi-drug-resistant P. alcalige-
nes was recently isolated from the water in an aquaculture
facility (Lee et al. 2016). Interestingly, studies have
reported that multi-drug resistance of P. aeruginosa was
associated with reduced pathogenicity (Hirsch and Tam
2010). Our study showed that isolate KCP-516 was sus-
ceptible to amikacin, ciprofloxacin, and sulfamethazole
FIGURE 4. Clinical signs in koi after experimental infection with but was resistant to cephalosporins (data not shown);
bacterial isolate KCP-516: (A) eye hemorrhages (black arrow) and (B) these results are in accordance with previous reports of
ulcerative skin (white arrow) and tail fin petechial hemorrhages (red circle).
antimicrobial susceptibility for P. alcaligenes (Ma and Shu
[Color figure can viewed at afsjournals.org.]
2000; Suzuki et al. 2014; Flores-Carrero et al. 2016).
In summary, this study is the first report of P. alcali-
conditions, such as overcrowding, low oxygen concentra- genes infection in koi, and the pathogenicity of isolate
tion, and high water temperature (Ma and Shu 2000; KCP-516 was demonstrated in the experimental chal-
Gopal and Gupta 2002; Xu et al. 2015). As an oppor- lenges. Blood agar is commonly used for nonselective
tunistic pathogen, very little was known about the associa- isolation of fish pathogens; however, we used LB agar
tion of P. alcaligenes with fish susceptibility to infectious for bacterial isolation, which might have influenced the
diseases (Suzuki et al. 2013; Huang et al. 2019). A recent types of bacteria that were isolated. The morphological,
study indicated that water temperature is the most impor- biochemical, and molecular characteristics and growth
tant environmental factor affecting the P. plecoglossicida- properties will provide a new understanding of the
induced white spots disease (Huang et al. 2019). Notably, diagnostics, pathogenesis, and treatment of P. alcaligenes
high water temperature was associated with the infection in fish.
control group 1.2×10⁴ 1.2×10⁵ 1.2×10⁶ 1.2×10⁷ 1.2×10⁸
100%
90%
80%
70%
Survival rates
60%
50%
40%
30%
20%
10%
0%
0 1 2 3 4 5 6 7
Day post injection (dpi)
FIGURE 5. Survival rates (%) of koi during the 7-d period after inoculation with bacterial strain KCP-516. [Color figure can viewed at afsjournals.org.]
250 BAI ET AL.
ACKNOWLEDGMENTS (MAR) bacteria in water of fish facility. International Food Research

This study was supported by the Natural Science Journal 23:1255–1261.
Liu, X. X., X. C. Hu, A. J. Lu, J. F. Sun, C. X. Chen, Y. A. Huo, and
Foundation of Tianjin City (18JCYBJC29900; Y. J. Song. 2018. Histopathology and detection of cyprinid her-
21YDTPJC00510), Key Scientific Research Project Uni- pesvirus infection in two koi farms in Tianjin City (China). Israeli
versities and Colleges in Tianjin (2019ZD14), the Open Journal of Aquaculture-Bamidgeh 70:1–9.
Project of Tianjin Key Lab of Aquatic Ecology and Lü, A. J., X. C. Hu, L. Li, J. F. Sun, Y. J. Song, C. Pei, C. Zhang, and X.
Aquaculture (TJAE201803), the Innovation Team of H. Kong. 2016. Isolation, identification and antimicrobial susceptibility
of pathogenic Aeromonas media isolated from diseased koi carp (Cypri-
Tianjin Fisheries Research System (ITTFRS2017009), and nus carpio koi). Iranian Journal of Fisheries Sciences 15:760–774.
the Tianjin Agricultural University Key Laboratory of Lü, A. J., R. X. Wang, X. C. Hu, J. F. Sun, L. Li, C. Pei, C. Zhang,
Aqua-Ecology platform project (J01009030638). Jie Bai, and G. X. Nie. 2017. First report of Rahnella aquatilis infection in
Yian Huo, and Xiucai Hu contributed equally to this Crucian Carp Carassius auratus in China. Diseases of Aquatic Organ-
work. There is no conflict of interest declared in this isms 123:205–212.
Luo, Z., X. Bai, Y. Xu, Z. Zhang, S. Hao, N. Li, and S. Feng. 2015.
article. Recovery of Pseudomonas aeruginosa from diseased Grass Carp
(Ctenopharyngodon idella) in China. Israeli Journal of Aquaculture-
Bamidgeh 67:1–7.
ORCID Ma, Y. Z., and M. A. Shu. 2000. Isolation and identification of Pseu-
Aijun Lü https://orcid.org/0000-0002-0863-2307 domonas alcaligenes in Monopterus albus. Freshwater Fish 30:33–34.
(In Chinese.)
O’Mahony, M. M., A. D. W. Dobson, J. D. Barnes, and I. Singleton.
REFERENCES 2006. The use of ozone in the remediation of polycyclic aromatic
Bharathiraja, B., J. Jayamuthunagai, M. Jayakumar, M. A. Kiruba- hydrocarbon contaminated soil. Chemosphere 63:307–314.
karan, P. Vivek, M. Chandran, and R. P. Kumar. 2013. Biodegrada- Oliveira, F. J. S., L. Vazquez, N. P. de Campos, and F. P. de Franca.
tion of poly(vinyl alcohol) using Pseudomonas alcaligenes. Asian 2009. Production of rhamnolipids by a Pseudomonas alcaligenes
Journal of Chemistry 25:8663–8667. strain. Process Biochemistry 44:383–389.
Bowman, J. P. 2005. Genus: Pseudomonas. Pages 323–379 in D. J. Bren- Qian, Z., P. Hui, L. Han, Y. Ling-zhi, Z. Bo-shun, Z. Jie, G. Wan-li, W.
ner, N. R. Krieg, and J. R. Staley, editors. Bergey’s manual of sys- Nan, J. Shi-jin, and X. Zhi-jing. 2020. Serotypes and virulence genes
tematic bacteriology, volume 2: the Proteobacteria, part B: the of Pseudomonas aeruginosa isolated from mink and its pathogenicity
Gammaproteobacteria. Springer, New York. in mink. Microbial Pathogenesis 139:103904.
Camus, A. C., P. L. Shewmaker, M. J. Mauel, and D. J. Wise. 2008. Reed, L. J., and H. Muench. 1938. A simple method of estimating
Streptococcus ictaluri arthritis, osteolysis, myositis, and spinal menin- fifty per cent endpoints. American Journal of Epidemiology
gitis in Channel Catfish broodstock. Journal of Aquatic Animal 27:493–497.
Health 20:54–62. Shen, X. J., X. C. Hu, Y. Lan, X. Li, A. H. Zhu, P. Zhang, and A. J.
Crossland, N., J. Hawke, F. Del Piero, Y. Sokolova, T. Waltzek, and P. Lü. 2014. Drug susceptibility, isolation and identification of patho-
Viadanna. 2018. Investigation of a cyprinid herpesvirus 1 disease epi- genic bacterium Pseudomonas fluorescens from koi carp (Cyprinus car-
sode in a group of pond-reared koi. Journal of Aquatic Animal pio). Fisheries Science 33:443–446.
Health 30:185–190. Song, Y. J., X. C. Hu, A. J. Lü, J. F. Sun, Y. Yiksung, C. Pei, C.
Flores-Carrero, A., A. Paniz-Mondolfi, and M. Araque. 2016. Nosoco- Zhang, and L. Li. 2017. Isolation and characterization of Aeromonas
mial bloodstream infection caused by Pseudomonas alcaligenes in a veronii from ornamental fish species in China. Israeli Journal of
preterm neonate from Merida, Venezuela. Journal of Clinical Neona- Aquaculture-Bamidgeh 69:1–11.
tology 5:131–133. Su, J.-J., K.-S. Yeh, and P.-W. Tseng. 2006. A strain of Pseudomonas sp.
Gopal, M., and A. Gupta. 2002. An opportunistic bacterial pathogen, isolated from piggery wastewater treatment systems with hetero-
Pseudomonas alcaligenes, may limit the perpetuation of Oryctes virus, trophic nitrification capability in Taiwan. Current Microbiology
a biocontrol agent of Oryctes rhinoceros L. Biocontrol Science and 53:77–81.
Technology 12:507–512. Suzuki, M., S. Suzuki, M. Matsui, Y. Hiraki, F. Kawano, and K. Shi-
Han, Z., J. Sun, A. Lv, Y. Sung, H. Shi, X. Hu, and K. Xing. 2017. Iso- bayama. 2013. Genome sequence of a strain of the human pathogenic
lation, identification and characterization of Shewanella algae from bacterium Pseudomonas alcaligenes that caused bloodstream infection.
Reared Tongue Sole, Cynoglossus semilaevis Günther. Aquaculture Genome Announcements 1(5):e00919–e1013.
468:356–362. Suzuki, M., S. Suzuki, M. Matsui, Y. Hiraki, F. Kawano, and K. Shi-
Hirsch, E. B., and V. H. Tam. 2010. Impact of multidrug-resistant Pseu- bayama. 2014. A subclass B3 metallo-beta-lactamase found in Pseu-
domonas aeruginosa infection on patient outcomes. Expert Review of domonas alcaligenes. Journal of Antimicrobial Chemotherapy
Pharmacoeconomics and Outcomes Research 10:441–451. 69:1430–1432.
Huang, L. X., Y. F. Zuo, Q. L. Jiang, Y. Q. Su, Y. X. Qin, X. J. Xu, L. Utter, M. E., and K. L. Wotman. 2009. Nonulcerative bullous keratitis
M. Zhao, and Q. P. Yan. 2019. A metabolomic investigation into the associated with Pseudomonas alcaligenes infection in a thoroughbred
temperature-dependent virulence of Pseudomonas plecoglossicida from mare. Equine Veterinary Education 21:590–595.
Large Yellow Croaker (Pseudosciaena crocea). Journal of Fish Dis- Valenstein, P., G. H. Bardy, C. C. Cox, and P. Zwadyk. 1983. Pseu-
eases 42:431–446. domonas alcaligenes endocarditis. American Journal of Clinical
IUBMB (International Union of Biochemistry and Molecular Biology). Pathology 79:245–247.
1992. Enzyme nomenclature 1992. Academic Press, San Diego, Cali- Wang, Y., Z. B. Yang, L. L. Zhu, Z. Q. Shi, L. J. Ma, Z. W. Tang, and
fornia. R. J. Jiang. 2015. Isolation and identification of dexamethasone
Lee, K. S., L. Samuel, C. Y. Kong, and S. C. Toh. 2016. Water quality sodium phosphate degrading Pseudomonas alcaligenes. Journal of
and microbiological risk associated with multiple antibiotic resistance Basic Microbiology 55:262–268.
Weisburg, W. G., S. M. Barns, D. A. Pelletier, and D. J. Lane. 1991. Pseudomonas alcaligenes; AE biodegradation by Pseudomonas alcali-
16S ribosomal DNA amplification for phylogenetic study. Journal of genes. Tenside Surfactants Detergents 55:43–48.
Bacteriology 173:697–703. Xu, J., X. Zeng, N. Jiang, Y. Zhou, and L. Zeng. 2015. Pseudomonas al-
Witkowska, D., D. Ginter-Kramarczyk, A. Holderna-Odachowska, I. caligenes infection and mortality in cultured Chinese Sturgeon, Aci-
Budnik, E. Kaczorek, Z. Lukaszewski, and J. Zembrzuska. 2018. penser sinensis. Aquaculture 446:37–41.
Biodegradation of oxyethylated fatty alcohols by bacterium

J Aqua Anim HLTH - 2021 - Bai - Characterization of Pathogenic Pseudomonas Alcaligenes Isolated From Koi Carp in China

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

J Aqua Anim HLTH - 2021 - Bai - Characterization of Pathogenic Pseudomonas Alcaligenes Isolated From Koi Carp in China

Uploaded by

Copyright:

Available Formats

Journal of Aquatic Animal Health 33:243–251, 2021

© 2021 American Fisheries Society

Characterization of Pathogenic Pseudomonas alcaligenes Isolated from

*Corresponding author: lajand@126.com

Characteristic KCP-516 P. alcaligenes Characteristic KCP-516 P. alcaligenes

(B) P. alcaligenes (WP 076423501)

Pseudomonas sp (WP 043311962)

Pseudomonas sp (WP 099525048)

Pseudomonas (WP 037000993)

80 Pseudomonas (WP 017676278)

Pseudomonas (WP 074915568)

P. pseudoalcaligenes (WP 003458436)

(A) susceptibility of Chinese Sturgeon to P. alcaligenes infec-

control group 1.2×10⁴ 1.2×10⁵ 1.2×10⁶ 1.2×10⁷ 1.2×10⁸

ACKNOWLEDGMENTS (MAR) bacteria in water of ﬁsh facility. International Food Research

You might also like