Am J Physiol Endocrinol Metab 306: E443–E456, 2014.

First published December 24, 2013; doi:10.1152/ajpendo.00478.2013.

Characterization of the adverse effects of nicotine on placental development:

in vivo and in vitro studies
A. C. Holloway,5 A. Salomon,2,3,4 M. J. Soares,7 V. Garnier,2,3,4 S. Raha,6 F. Sergent,2,3,4 C. J. Nicholson,5
J. J. Feige,2,3,4 M. Benharouga,1,2,3 and N. Alfaidy2,3,4
1
Centre National de la Recherche Scientifique, Grenoble, France; 2Commissariat à l’Energie Atomique, Grenoble, France;
3
Université Joseph Fourrier, Grenoble, France; 4Institut National de la Santé et de la Recherche Médicale, Grenoble,
France; 5Department of Obstetrics and Gynecology, McMaster University, Hamilton, Ontario, Canada; 6Department of
Pediatrics, McMaster University, Hamilton, Ontario, Canada; and 7Institute for Reproductive Health and Regenerative
Medicine, University of Kansas Medical Center, Kansas City, Kansas
Submitted 3 September 2013; accepted in final form 17 December 2013

Holloway AC, Salomon A, Soares MJ, Garnier V, Raha S, Sergent F,
Nicholson CJ, Feige JJ, Benharouga M, Alfaidy N. Characterization of the
adverse effects of nicotine on placental development: in vivo and in vitro
studies. Am J Physiol Endocrinol Metab 306: E443–E456, 2014. First
published December 24, 2013; doi:10.1152/ajpendo.00478.2013.—In utero
exposure to nicotine is associated with increased risk of numerous
adverse fetal and neonatal outcomes, which suggests that it acts
directly to affect placental development and the establishment of the
fetomaternal circulation (FC). This study used both in vivo [Wistar
rats treated with 1 mg/kg nicotine from 2 wk prior to mating until
gestational day (GD) 15] and in vitro (RCHO-1 cell line; treated
with 10⫺9 to 10⫺3M nicotine) models to examine the effects of
nicotine on these pathways. At GD 15, control and treated placen-
tas were examined for the impact of nicotine on 1) trophoblast
invasion, proliferation, and degree of hypoxia, 2) labyrinth vascu-
larization, 3) expression of key genes of placental development,
and 4) expression of placental angiogenic factors. The RCHO-1
cell line was used to determine the direct effects of nicotine on
trophoblast differentiation. Our in vivo experiments show that
nicotine inhibits trophoblast interstitial invasion, increases placen-
tal hypoxia, downregulates labyrinth vascularization as well as key
transcription factors Hand1 and GCM1, and decreases local and
circulating EG-VEGF, a key placental angiogenic factor. The in
vitro experiments confirmed the inhibitory effects of nicotine on
the trophoblast migration, invasion, and differentiation processes
and demonstrated that those effects are most likely due to a
dysregulation in the expression of nicotine receptors and a de-
crease in MMP9 activity. Taken together, these data suggest that
adverse effects of maternal smoking on pregnancy outcome are due
in part to direct and endocrine effects of nicotine on the main
processes of placental development and establishment of FC.
trophoblast invasion and differentiation; rat placentation; endocrine
gland-derived vascular endothelial growth factor; matrix metallopro-
teinase 9; nicotinic acetylcholine receptors
CIGARETTE SMOKE EXPOSURE is associated with many adverse
pregnancy outcomes, including preterm labor, preterm prema-
ture rupture of membranes, placental abruption, and fetal
growth restriction/low birth weight (4, 12). There is a direct
relationship between the number of cigarettes smoked during
pregnancy and the relative risk of low birth weight (12). In
developed countries, it has been suggested that maternal ciga-
rette smoking during pregnancy is a principal environmental
Address for reprint requests and other correspondence: N. Alfaidy, Unité
INSERM U1036, Laboratoire BCI-iRTSV, CEA Grenoble, 17, rue des Martyrs,
38054 Grenoble cedex 9, France (e-mail: nadia.alfaidy-benharouga@cea.fr).
http://www.ajpendo.org 0193-1849/14 Copyright © 2014 the American Physiological Society
cause of fetal growth restriction (60). Moreover, although
cigarette smoking during pregnancy has been identified as a
significant modifiable risk factor for low birth weight, many
women continue to smoke during their pregnancies (3).
Cigarette smoke is estimated to contain as many as 4,000
chemicals (49, 53), including the addictive component nico-
tine. Data from animal studies suggest that nicotine exposure
may be a critical component in the development of adverse
reproductive effects in women who smoke (6, 42). In previous
reports, we have shown that exposure of gravid rats to nicotine
impaired fetal growth, resulting in reduced birth weight (27),
an effect that is similar to the growth restriction seen in women
who smoke (55). It is well established that normal fetal growth
depends on the proper growth and development of the placenta;
importantly, nicotine and its metabolites have been shown to
accumulate in the placenta (35), where they may have direct
effects on placental development and function. However, few
reports have addressed the direct effect of nicotine insults on
placental development and cell differentiation.
Normal placental development and vascularization depend
on a tightly orchestrated coordination between the maternal
decidua and trophoblast cells. They depend on adequate trans-
formation of the uteroplacental vasculature by trophoblast cells
following their proliferation, migration, and invasion into the
maternal decidua (16, 52). During pregnancy, the depth of
invasion by placental trophoblast cells into the uterine wall is
critical and finely controlled. Poor invasion of maternal vessels
has been correlated with placental pathologies such as fetal
growth restriction, whereas an excessive trophoblast invasion
is associated with choriocarcinoma (59).
Trophoblast cells are the earliest cell lineage to differentiate
during mammalian development, arising from trophectoderm
of the blastocyst (48). These stem cells can continue to prolif-
erate or go on to differentiate along a multilineage pathway
(25), which in rodents leads to five phenotypically distinct cell
types: trophoblast giant cells, spongiotrophoblast cells, inva-
sive extraplacental trophoblast cells, glycogen cells, and syn-
cytial trophoblast cells. Recent work from Ain et al. (1) and
Vercruysse et al. (57) showed that rat placentation proceeds
along two types of invasion, the endovascular pathway that
occurs between gestational days (GD) 8 and 10 and involves
mainly giant trophoblast cells and the interstitial pathway that
involves glycogen cells and occurs around GD 15. Considering
the greater depth of both endovascular and interstitial tropho-
blast invasion in the rat compared with the mouse, the former
species seemed more appropriate as an animal model to study
E443
E444 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME
trophoblast invasion (57). In cultured human placental ex-
plants, Zdravkovic et al. (63) have shown that nicotine inhibits
trophoblast migration, a key process in the establishment of the
fetomaternal circulation (FC). However, neither a mechanism
of nicotine inhibition of trophoblast invasion nor an in vivo
study confirming these findings has been performed to date.
The aim of this study was to investigate the effects of
nicotine on the key processes of trophoblast invasion and
differentiation. Using both in vitro and in vivo models, we
examined the impact of nicotine on 1) trophoblast prolifera-
tion, migration, and invasion, 2) placental vascularization and
degree of hypoxia, 3) expression of key genes of placental
development, and 4) expression of circulating and placental
angiogenic factors. The cellular model, the RCHO-1 cell line,
was used to determine the mechanism(s) by which nicotine
affects these processes.
MATERIALS AND METHODS
Two models to study the effects of nicotine on trophoblast invasion
and cell differentiation were used. For in vivo studies, rats were
exposed to nicotine before mating and during placental development.
For in vitro studies, we used the rat trophoblast cell line RCHO-1. The
RCHO-1 cell line provides an effective in vitro model system for
dissecting the trophoblast cell differentiation pathway (23, 51), as
these cells exhibit many characteristics of trophoblast stem cells (15,
23, 44). More importantly, the RCHO-1 trophoblast stem cells can be
manipulated to proliferate or differentiate by altering their culture
conditions (44).
Maintenance and Treatment of Animals
All animal experiments were approved by the Animal Research
Ethics Board at McMaster University in accordance with the guide-
lines of the Canadian Council for Animal Care. Nulliparous 200- to
250-g female Wistar rats (Harlan, Indianapolis, IN) were maintained
under controlled lighting (12:12-h light-dark cycle) and temperature
(22°C) with ad libitum access to food and water. Dams were randomly
assigned to receive saline (n ⫽ 6) or nicotine bitartrate (1
mg·kg⫺1·day⫺1; Sigma-Aldrich, St. Louis, MO) (n ⫽ 5) via daily
subcutaneous injection starting 2 wk prior to mating. We have
demonstrated previously that this dose of nicotine results in cotinine
concentrations in maternal and neonatal serum that are similar to those
found in female smokers and their infants (20, 32, 39). Copulation
(GD 0) was confirmed by the presence of sperm in a vaginal flush. At
necropsy (GD15) each fetus and its corresponding placenta were
separated and weighted, and serum (maternal) was collected. Placen-
tal tissue samples were snap-frozen in liquid nitrogen and stored at
⫺80°C until analysis or immersed in Accustain formalin-free fixative
(Sigma-Aldrich).
Serum VEGF and Endocrine Gland-Derived VEGF
VEGF and endocrine gland-derived VEGF (EG-VEGF) concentra-
tions in the serum of saline- and nicotine-treated dams were deter-
mined using commercially available ELISA kits; we used murine
VEGF and human EG-VEGF kits, respectively (PeproTech). For each
assay, two separate standard curves were constructed to allow accu-
rate readings of samples at upper and lower ranges of the assay. All
samples were in the linear range of the standard curves. The detection
limit of the assay was 16 pg/ml for EG-VEGF and 63 pg/ml for
VEGF.
Placental Histology and Immunohistochemistry
Placental histomorphometry. Following overnight immersion in
10% (vol/vol) neutral buffered formalin (EM Science, Gibbstown, NJ)
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org
at 4°C, two placentas from each dam were washed in water, fixed in
PFA or Accustain formalin-free fixative, and embedded in paraffin
and sectioned (5 ␮m). Sections were stained with hematoxylin and
eosin (H & E) for general histological analysis or periodic acid-Schiff
(PAS; Sigma Aldrich) for the identification of glycogen cells. The
relative cross-sectional areas of GD 15 placentas were determined
from H & E-stained sections. Pictures were made with a digital
camera (Spot-RT; Diagnostic Instruments, Sterling Heights, MI) and
used to calculate the layer surface of the three placental zones
(decidua, junctional zone, and labyrinth) with Image J software
(National Institutes of Health, Bethesda, MD; http://rsb.info.nih.gov/ij/).
The sections to be analyzed were determined based on the site of the
umbilical attachment. At least three sections per placenta were ana-
lyzed, but to control for maternal effects only one placenta per dam
was used for each outcome measure. To quantify capillary length,
images were processed for morphometric analysis with Image J
software. A macro command was edited to give the total vessel length
after binarization, skeletonization, and pixel count of the CD31
staining (46).
Immunohistochemistry and immunocytochemistry. Immunohisto-
chemistry was performed as described previously (2, 7). For antigen
detection, 5-␮m sections were incubated with the following antibod-
ies: anti-cytokeratin (Abcam), anti-VEGF (Abcam), anti-EG-VEGF
(Covalab), anti-CD31 (DAKO), anti-carboxic anhydrase IX (CA-IX;
Novus Biological), anti-proliferating cell nuclear antigen (PCNA;
DAKO), and anti-cytokeratin. Immunopositive staining was detected
using a Vectastain ABC kit, using 3,3-diaminobenzidine as the chro-
magen (Vector Laboratories). Slides were counterstained using H & E
(Sigma-Aldrich). At least three sections per placenta collected from
each animal were analyzed. Immunocytochemistry was performed for
RCHO-1 cells using desmoplakin antibody (Abcam). Desmoplakin
staining was performed as described previously (9). Desmoplakin was
used to visualize the cell’s edges. RCHO-1 cells were washed, fixed,
and permeabilized in methanol at ⫺20°C for 25 min. Immunopositive
staining was detected using a Vectastain ABC kit, using 3,3-diamino-
benzidine-tetrahydrochloride as the chromagen.
Western blotting. Frozen placental samples (n ⫽ 6 saline and n ⫽
5 nicotine) collected from different animals were homogenized on ice
for 1 min in RIPA lysis buffer [50 mm Tris·HCl (pH 7.5), 150 mM
NaCl, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1%
Triton X-100, 1 mM phenylmethylsulfonylfluoride, 5 ␮g/ml leupep-
tin, and 5 ␮g/ml aprotinin], as previously described (30). The homog-
enates were centrifuged (15,000 g at 4°C) for 15 min, and the
supernatants were collected. Protein concentrations were determined
using the Bradford assay. Twenty to forty micrograms of protein
extracts was electrophoretically separated on SDS-PAGE (12%) for
immunoblot analysis using the following antibodies: anti-CD31, anti-
PCNA, anti-CA-IX, anti-4HNE (R & D Systems, Minneapolis, MN),
anti-VEGF, anti-FLT-1 (fms-like tyrosine kinase-1; Santa Cruz Bio-
technology), and anti-EG-VEGF. As described previously (9), a
specific Western blot protocol was set up to detect EG-VEGF protein
(10 –12 kDa). Briefly, we used 100 ␮g of placental protein that was
separated on 0.1% SDS-17% polyacrylamide gels in Tris-tricine-SDS
buffer (Sigma-Aldrich) and electrically transferred onto 0.2-␮m poly-
vinylidine difluoride membranes (Millipore, Bedford, MA). The trans-
fer of the proteins was reduced to 30 min at 90 V. The blots were
washed with PBS-Tween 0.1% and incubated overnight in blocking
solution (2.5% skimmed milk in PBST). Subsequently, membranes
were immunoblotted with a rabbit antibody against EG-VEGF (0.48
␮g/ml; Covalab Lyon) for 2 h. Blots were then rinsed with PBST and
incubated with biotinylated goat anti-rabbit IgG (450 ng/ml, 1:2,000,
dilution in blocking solution; DakoCytomation) for 30 min. After 3
PBST washes, the membrane was incubated with a peroxidase-
conjugated extravidin (1:2,000 dilution in blocking solution; Sigma
Aldrich) for 30 min. Blots were washed six times with PBST, and the
antibody-antigen complex was detected using the ECL Plus detection
system (Amersham Pharmacia Biotech). ␤-Actin was used to stan-
 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME E445
Table 1. Primers used for real-time RT-PCR
Genes Forward 5= to 3= Reverse 5= to 3=

Hand1 CACCAGCTACATCGCCTACTTGAT AGCCAGTGCGTCCTTTAATCCTCT

Hand2 AGCTACATCGCCTACCTCATGGAT TCTCCTCTTTCACGTCGGTCTTCT
Mash2 GGTGACTCCTGGTGGACCTA TCCGGAAGATGGAAGATGTC
CGm1 CGATGTGAAACTGCCTCAGA CTTCCTCTGTGGAGCAGTCC
Proliferin TGTGTGCAATGAGGAATGGT TAGTGTGTGAGCCTGGCTTG
CD31 GCATCGGCAAAGTGGTCAA GTTCCATTTTCGGACTGGC
nAChr4 CCAACTGGACTTCTGGGAAA GGCATAGGTGATGTCAGGATAG
nAChr7 GTACAAGGAGCTGGTCAAGAA CAGGAGACTCAGGGAGAAGTA
RPL13 AGGGTGGCTGGTATCCACAAGAAA AGTGACTCCGTGGATTTGTTTCGC
nAChr, nicotinic acetylcholine receptor.

dardize the loading. For quantification of 4HNE, we determined the
total intensity of all the bands in each of the sample lanes following
immunostaining with anti-4HNE. The total 4HNE intensity/lane was
normalized to the intensity of total protein per lane.
RNA Isolation and Reverse Transcriptase-Polymerase Chain
Reaction Analysis
sion levels. To assess linearity and efficiency of PCR amplification,
standard curves for all transcripts were generated by using serial
dilutions of cDNA. The RealQuant analysis software (Roche Diag-
nostics) was used to quantify relative levels of expression.
Mitochondrial Electron Transport Chain Activity

Total RNA was extracted from RCHO-1 cells, GD 15 placental
tissue samples of saline, and nicotine-treated animals (n ⫽ 5 saline
and n ⫽ 6 nicotine) using a rapid RNA isolation system (Qiagen
RNeasy, Courtaboeuf, France). Reverse transcription was performed
on 1 ␮g of total RNA with Superscript II-RnaseH reverse transcrip-
tase (Invitrogen, Cergy Pontoise, France) under conditions recom-
mended by the manufacturer.
Real-Time Polymerase Chain Reaction Analysis
Proliferin, Hand1, Hand2, Mash 2, Gcm1, nAch7, nAch4, and
RPL13 expression were quantified by real-time RT-PCR using a Light
Cycler apparatus (Roche Diagnostics, Meylan, France). The PCR was
performed using the primers shown in Table 1 and SYBR green PCR
core reagents (Light Cycler-FastStart Master SYBR Green I; Roche
Diagnostics). The results were normalized to RPL13 mRNA expres-
Frozen GD 15 placental tissue was homogenized in homogeniza-
tion buffer (5 mM HEPES, pH 7.4, 100 mM KCl, 70 mM sucrose, 220
mM mannitol, and 1 mM EGTA) with Complete Mini EDTA-free
protease inhibitors (Roche Applied Science, Laval, QC, Canada),
using Tenbroeck tissue grinders. Homogenates were spun for 10 min
at 600 g, and the supernatant was removed, flash-frozen in liquid
nitrogen, and stored at ⫺80°C until use. Citrate synthase activity (an
indicator of total mitochondrial mass) was measured using the thiol
reagent 5,5=-dithiobis(2-nitrobenzoic acid) (Sigma Chemical, St. Louis,
MO). Complex IV (cytochrome c oxidase) activity was assessed by
measuring the rate of cytochrome c (from equine heart; Sigma
Chemical) oxidation. Both activity assays were performed using
UV-spectrophotometry (Varian, Palo Alto, CA) as described previ-
ously (41). Data are expressed as the mean enzyme activity relative to
the wet weight of tissue.

A Saline Nicotine

Decidua Junctional
zone Decidua Junctional
zone
Labyrinth
Fig. 1. Nicotine affects the layer surface of pla-
Labyrinth cental zones. A: rat parasagittal sections of repre-
sentative placentas collected from saline- and
nicotine-treated dams on gestational day (GD) 15.
Note that the nicotine placentas appear more
compacted than the saline placentas. Dashed lines
indicate layer separations. B: analysis of the pla-
cental zones of saline and nicotine placentas. For
B ** each group, 6 placental sections/animal were an-
alyzed (saline: n ⫽ 6; nicotine: n ⫽ 5). The graph
12 ** ns shows proportions of the surface layer of 3 zones
placental zone Area

10 of the placenta (labyrinth, junctional zone, and

( arbitrary units)

decidua). Surfaces of the 3 layers were measured

8 on parasagittal sections for each placenta. Mean
values were used to calculate the mean (SE)
6 surface proportion of the layers. **P ⬍ 0.05. NS,
not significant.
4

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

E446 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME

RCHO Cell Culture
The RCHO-1 cells were cultured as indicated previously (23, 44).
The RCHO-1 cell line was established from a rat-transplantable
choriocarcinoma (23). The cells exhibit many characteristics of tro-
phoblast stem cells (15, 54).
There are two strong advantages to using these cells. First,
RCHO-1 is a rat cell line, and second, this cell line can be maintained
in a proliferative (i.e., stem cells) or differentiated state (i.e., giant
cells). RCHO-1 cells are in a proliferative state when cultured in
RPMI 1640 medium and supplemented with 20% fetal bovine serum
(heat inactivated), 100 mg/ml penicillin-streptomycin, 1 mM sodium
pyruvate, and 50 mM 2-mercaptoethanol in a 37°C incubator under
95% air-5% CO2. Three days after the cells were cultured under
proliferative conditions, a differentiated state could be obtained by
switching to RPMI 1640 medium containing 10% horse serum (29).
Trophoblast giant cell differentiation was verified by the morpholog-
ical detection of trophoblast giant cells and/or the expression of
placental lactogen-I (44).
Cell Proliferation
The effect of nicotine on cell proliferation was assessed on
proliferative RCHO-1 cells using [3H]thymidine incorporation.
Nicotine concentrations ranged from 10⫺9 to 10⫺3 M. This range
encompasses the EC50 of nicotine for all of its receptor subtypes
(0.85–113 ␮M) (13, 18, 26) and the maximum (Cmax 1.8 –112nM)
and average (AUC0-⬁) range of nicotine concentrations that have
been reported in pharmacokinetic studies of nicotine replacement
therapies (10, 17, 28, 36). Proliferative cells were cultured over-
night (7 ⫻ 104 cells/well, 37°C, 5% CO2). The cells were incu-
bated for 24 h in the absence or presence of nicotine, labeled with
0.5 ␮Ci/ml [3H]thymidine (Amersham, France), and subsequently
washed in HBSS and incubated in 2 ml of ice-cold 5% trichloro-
acetic acid for 20 min at RT. After washing, 0.4 ml of 0.1 M NaOH
and 0.1% SDS were added; the lysates were transferred into a vial
containing scintillation liquid, and the radioactivity was counted in
a ␤-counter (Beckman).
Matrigel Invasion Assay
The invasive properties of nicotine-treated RCHO-1 cells were
measured using Matrigel-coated HTS FluoroBlok transwell inserts
(Becton-Dickinson). Matrigel (100 ␮l diluted at 1:25 with RPMI
1640) was added to the transwell inserts and allowed to set for 2 h
at 37°C. RCHO-1 cell monolayers were prelabeled in situ for 1 h
with 10 ␮g/ml acetylated low-density lipoprotein (DiI-Ac-LDL)

Saline Nicotine D *
C 2.0

(arbitrary units)
A B

PCNA levels
1.5
Saline Nicotine
PCNA

1.0
PCNA
0.5
β-actin
Saline Nicotine

E F G H
* Saline Nicotine
per labyrinth area (m)

0.4
Total capillary length

CD31
0.3
β-actin
CD31

0.2
Ratio
E’ (Mean+SEM) 1.33 + 0.13 0.89 + 0.11
F’ 0.1

*
Saline Nicotine

L *
3.5
(arbitrary units)

I J K
CA-IX levels

2.5
Saline Nicotine
CA-IX

1.5
CAIX
0.5
β-actin
Saline Nicotine
Fig. 2. Nicotine treatment influences proliferating cell nuclear antigen (PCNA), CD31, and carboxic anydrase IX (CA-IX) protein expression in the placenta. A,
E and E’, and I: representative photographs of PCNA, CD31, and CA-IX stainings, respectively, in the labyrinth of saline placentas. B, F, F’, and J: same stainings
in the labyrinth of the nicotine placentas. E’ and F’: skeletization of photographs in E and F, respectively. The black color represents the vascular network.
G: average length of the capillary network per labyrinth area for each group. Seven placental photographs were analyzed for each group. C, H, and K: comparisons
of PCNA, CD31, and CA-IX protein levels, respectively, in saline and in nicotine placental extracts. D and I: quantifications of the levels of PCNA and CA-IX
protein levels after standardization by ␤-actin. Data represent means ⫾ SE. *P ⬍ 0.05 vs. control. Scale bar, 50 ␮m.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME
labeled with 1,1=-dioctadecyl-3,3,3=,3=-tetramethyl-indocarbocya-
nine perchlorate. When cells are labeled with DiI-Ac-LDL, the
lipoprotein is degraded by lysosomal enzymes and the DiI (fluo-
rescent probe) accumulates in the intracellular membranes. Label-
ing cells with DiI-Ac-LDL has no effect on cell viability (58).
Cells were then trypsinized and resuspended to the apical chamber
of Matrigel precoated FluroBlok transwell (5 ⫻ 104 cells) in the
absence or presence of nicotine (10⫺9 to 10⫺3 M). Uncoated
fluoroBlok transwell inserts were also used to determine the
number of cells that invaded toward the chemoattractant. The
chemoattractant (10% serum) is added to the basal chamber.
The FluoroBlok transwell is incubated for 24 h at 37°C and 5%
CO2. The fluorescence of invaded cells is read at wavelengths of
540/570 nm. Data are expressed as the following equation [%in-
vasion ⫽ (mean fluorescence of cells invaded through the Matrigel
coated membrane toward chemoattractant/mean fluorescence of
E447
cells invaded through uncoated membrane toward chemoattractant) ⫻
100].
Wound Healing Assay
To evaluate the effect of nicotine on RCHO-1 migration capacity,
wound healing assays were performed as reported previously (7, 31).
At confluence, differentiated RCHO-1 cells (i.e., giant cells) were
scraped with a sterile tip to create an artificial wound that was allowed
to heal for the next 18 h. The cells were treated at time 0 by nicotine
at 10⫺9 to 10⫺3 M. The treatment lasted for 18 h. Preselected fields
were photographed at regular intervals (0 –18 h). The width of
denuded area was measured using an electronic grid, and the distances
crossed by cells were determined using Scion Image software (version
4.0.2; Scion). Results of at least three separate experiments were
expressed as percent of control (the initial wound).

Negative B
A Saline Nicotine control

b c D VEGF
a
Gic
β-actin
Jz Jz
VEGF

Ratio
(Mean+SEM) 1.32 + 0.04 1.22 + 0.07
Gc Gc
Gc ns
L L L

C Saline Nicotine D
a b EG-VEGF
L
JZ

L
JZ

β-actin

*
EG-VEGF

(arbitrary units)
EG-VEGF levels

1.6

c d 1.2

0.8

0.4
L L

Saline Nicotine

ns ns
E F
Circulating EG-VEGF

250
Circulating VEGF

300
200
250
(pg/ml)
(pg/ml)

200 150

150 100
100
50
50

Saline Nicotine Saline Nicotine

Fig. 3. Nicotine effect on placental and on circulating VEGF and endocrine gland-derived VEGF (EG-VEGF) in saline- and nicotine-treated dams. A: VEGF
staining in placental sections of saline (image a) and nicotine placentas (image b). B: comparison of VEGF protein levels in saline and in nicotine placental
extracts. C: EG-VEGF staining in placental sections of saline (images a and c) and nicotine placentas (images b and d). D: comparisons of EG-VEGF protein
levels in saline (n ⫽ 6) and nicotine (n ⫽ 5) placental extracts. E and F: comparisons of VEGF and EG-VEGF serum levels in saline- and nicotine-treated dams,
respectively. VEGF and EG-VEGF levels were measured by ELISA. *P ⬍ 0.05. D, decidua; Jz, junctional zone; Gc, glycogen cell; Gic, giant trophoblast cell;
L, labyrinth.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

E448 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME

A B
ns ns

Circulating Sflt-1
3500

VEGF/sFLT1 ratio
0.12
3000
0.10

(pg/ml)
2500
0.08
2000
1500 0.06

1000 0.04
500
0.02

Saline Nicotine
Saline Nicotine
Fig. 4. A and B: nicotine effects on circulating
soluble fms-like tyrosine kinase-1 (sFLT-1)
and on VEGF/sFLT-1 ratio, respectively. C and
D: nicotine effects on placental FLT-1 protein
expression and VEGF/fms-like tyrosine ki-
C Saline Nicotine D
nase-1 (FLT-1) ratio, respectively. Blot shows
comparisons of FLT-1 protein levels in saline
(n ⫽ 6) and nicotine (n ⫽ 5) placental extracts. FLT-1
ns
sFLT-1 levels were measured by ELISA.

Ratio of placental protein

1.0

Total VEGF to FLT1

β-actin
0.8
2.5
0.6
(arbitrary units)

2.0
FLT-1 levels

0.4
1.5
0.2
1.0

0.5
Saline Nicotine
0.0
Saline Nicotine

Zymography
About 20 ␮l of harvested RCHO-1 culture medium was electro-
phoresed under nonreducing conditions in a 10% acrylamide gel
containing 1 mg/ml gelatin (Sigma Aldrich) according to the method
of Xu et al. (62). After electrophoresis, the gels were washed at room
temperature for 1 h in 2.5% Triton X-100 and 50 mm Tris·HCl, pH
7.5, and then incubated at 37°C overnight in buffer containing 150
mm NaCl, 5 mm CaCl2, and 50 mm Tris·HCl, pH 7.6. Thereafter, gels
were stained with 0.1% (wt/vol) Coomassie brilliant blue R-250 in
30% (vol/vol) isopropyl alcohol and 10% glacial acetic acid for 60
min and destained in 10% (vol/vol) methanol and 5% (vol/vol) glacial
acetic acid. Semiquantification of the bands corresponding to 72- and
92-kDa gelatinases was performed using a densitometer.

A B
0.16
Hand1 mRNA level

Hand 2 mRNA level

0.20
(arbitrary units)

(arbitrary units)

ns
0.16 0.12

0.12

0.08
* 0.08

0.04
0.04
Fig. 5. Nicotine treatment effect on the mRNA
expression of Hand1, Hand2, Mash2, and
GCm1 mRNA in the placenta. mRNA was Saline Nicotine Saline Nicotine
isolated from whole placentas (saline: n ⫽ 6;
nicotine: n ⫽ 5). Expression of the indicated
genes was analyzed by quantitative RT-PCR,
plotted in arbitrary units, and normalized to C D
RPL13. Data are presented as means ⫾ SE.
Mash 2 mRNA level

*P ⬍ 0.05.
Gcm1 mRNA level
(arbitrary units)

0.007 0.08
ns
(arbitrary units)

0.005 0.06
*
0.003 0.04

0.001 0.02

Saline Nicotine
Saline Nicotine

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME
Statistical Analysis
All statistical analyses were performed using SigmaStat (Jandel
Scientific Software, SanRafael, CA). Data were analyzed by Student’s
t-test and one-way analysis of variance (ANOVA), followed by
comparison with the controls (Bonferroni’s t-test, ␣ ⫽ 0.05). Data
were tested for normality as well as equal variance, and when
normality or variance tests failed, data were analyzed using Mann-
Whitney Rank Sum test or Kruskal-Wallis one-way ANOVA on
ranks.
RESULTS
Nicotine Treatment Effects on Fetal Weight, Placental
Weight, and Placental Efficiency
Fetal and placental weights were measured at GD 15, and
placental efficiency was determined (fetal weight/placental
weight). There was no effect of nicotine treatment on fetal
weight, placental weight, or placental efficiency (all P ⬎ 0.05;
data not shown).
Structural Changes in Rat Placentas Following Nicotine
Treatment
At GD 15, placentas from nicotine-exposed dams had sig-
nificantly decreased decidua and junctional zone area and
E449
seemed more compacted (Fig. 1, A and B). There was no effect
of nicotine exposure on the size of the labyrinth zone (Fig. 1B).
Nicotine treatment affects placental vascularization and
development. To get more insight into the effects of the
nicotine treatment on placental development, we examined the
expression levels of PCNA, a marker of cell proliferation, and
CD31, a marker of vascularization. We have also examined the
level of expression of a marker of hypoxia, CA-IX (37).
Nicotine exposure caused a significant reduction in PCNA
expression in the labyrinth zone (Fig. 2, A vs. B) and in whole
placenta (Fig. 2, C and D). Also, a quantification of the
PCNA-stained nuclei in the labyrinth zone showed a significant
reduction in the number of positive cells in the placenta of
nicotine-treated dams (data not shown). Exposure to nicotine
caused a disorganization of the vascular tree in the labyrinth
layer (the major site of nutrient and gas exchange), with less
branching in the nicotine group (Fig. 2, E and E’ vs. F and F’).
There was a significant decrease in the total capillary length in
the labyrinth of nicotine-treated animals compared with the
saline controls (Fig. 2G).
This disorganization occurred in association with a signifi-
cant reduction in CD31 expression levels in whole placental
homogenates from nicotine-exposed animals (Fig. 2H).

A
a D D B
Gc

Gc
Gic

C D
Fig. 6. Nicotine effect on interstitial invasion. A
and B: representative photographs of rat placental
sections stained with cytokeratin (brown). Saline
D placenta (A) and nicotine placenta (B) are shown.
Gic Note the presence of invasive Gc in saline and not
in the nicotine placenta. C and D: placental sec-
Gic tions with higher magnification of sections shown
Gc in A and B. E and F: placental sections stained,
Gc with periodic acid-Schiff (purple) confirming the
identity of Gc. Scale bar, 50 ␮m.
Jz

E F
Gc Gc Gic D

Gic

L L

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

E450 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME

The reduction in the labyrinth vascularization occurred in
association with an increase in hypoxia (i.e., increased expres-
sion of carbonic anydrase in the labyrinth and whole placenta;
Fig. 2, I–L).
Nicotine effect on placental angiogenic factors. It is well
established that changes in placental vascularization that result
in increased placental hypoxia are often associated with alter-
ation in the expression and production of angiogenic factors by
the placenta. We compared the local and circulating levels of
VEGF, a key placental angiogenic factor that was reported to
be affected by smoking in other systems (34, 47). There was no
effect of nicotine treatment on the expression of VEGF in the
placenta (Fig. 3, A and B) or on serum levels of VEGF (Fig.
3E). Because VEGF needs to be considered in relation to its
receptor VEGFR1 (FLT-1), we have compared both placental
VEGFR1 levels and the levels of its circulating form, the
soluble fms-like tyrosine kinase-1 (sFLT-1), an antiangiogenic
factor, in the saline and nicotine groups. There were no
changes in the levels of placental FLT-1 or the circulating
sFLT-1 (Fig. 4). Because changes in the placental (VEGF to
FLT-1) ratio or in the circulating (VEGF to sFLT-1) ratio
might explain differences in the angiogenic status of a given
organ, we compared these ratios in both groups. No differ-
ences could be observed between the saline and nicotine
group (Fig. 4).
We have also compared the levels of expression of the new
placental angiogenic factor EG-VEGF. EG-VEGF plays a
major role in placental growth and angiogenesis (7–9, 31) and
was recently reported to be increased in placental pathologies
such as preeclampsia and intrauterine growth restriction (8, 9,
31). The placental expression of EG-VEGF in the placenta was
significantly decreased in nicotine-exposed animals compared
with the saline group (Fig. 3C). This was confirmed in whole
placental homogenates by Western blotting analysis (Fig. 3D).
A comparison of the circulating levels of EG-VEGF showed a
trend toward a decrease in the nicotine group; however, this did
not reach statistical significance (P ⫽ 0.056; Fig. 3D).
Nicotine effect on mitochondrial electron transport chain
activity and oxidative damage. There was no effect of maternal
nicotine administration on the activities of placental complex
IV or citrate synthase (data not shown). Moreover, there was
no evidence of increased oxidative damage (i.e., 4HNE expres-
sion) in the placentas of nicotine-exposed dams compared with
controls (data not shown).

Nicotine (M)

A Ctl 10-9 10-6 10-3

a b c d

Gic

e f g h

Gic

B
incorporation

7000

6000 *
5000 * *
(cpm)

4000
3H-thymidine

3000

2000

1000

Ctl 10-9 10-6 10-3

Nicotine (M)
Fig. 7. Nicotine effect on the proliferation and differentiation of RCHO-1 cells. A: dose-response effect of nicotine (10⫺9, 10⫺6, and 10⫺3 M) on RCHO-1 stem
cell differentiation. Images a–d show photographs of RCHO-1 cells stained with desmoplakin. Images e–h show photographs of RCHO-1 cells taken under phase
contrast. B: [3H]thymidine incorporation into RCHO-1 stem cells in the absence (black bar) or presence of nicotine at indicated concentrations (dashed bars).
Data are presented as the mean ⫾ SE of 3 independent experiments. *P ⬍ 0.05.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME
Correlation between structural changes and placental gene
expression. To determine whether the architectural abnormal-
ities observed in placentas from nicotine-exposed animals are
linked to quantitative changes in gene expression, real-time
RT-PCR analyses were performed for several key trophoblast
genes with specific roles in the formation of placental struc-
tures. We determined the expression of Hand1, a protein that
promotes differentiation of trophoblast giant cells, and Mash2,
a marker for spongiotrophoblast and a protein required for the
maintenance of giant cell precursors (50). We also determined
the expression levels of Gcm1, an important protein of laby-
rinth branching. Nicotine exposure had no effect on the pla-
cental expression of Hand2 or Mash2. Both Hand1 and Gcm1
expression were significantly decreased in the placentas from
nicotine-treated dams (Fig. 5, A and D). Taken together, these
data suggest that nicotine treatment affects trophoblast differ-
entiation toward an invasive phenotype and negatively impacts
labyrinth development.
Nicotine Treatment Inhibits Interstitial Trophoblast Invasion
Because the decidua and the junctional zones constitute the
main sites that govern interstitial trophoblast invasion, we
further analyzed the invasive process in the placenta of saline-
and nicotine-treated rats. In Fig. 6, glycogen cell staining by
cytokeratin is compared in the saline (Fig. 6, A and C) and in
the nicotine placentas (Fig. 6, B and D). Photographs in Fig. 6,
E and F, report PAS staining in the saline and in the treated
placentas, respectively. Both cytokeratin and PAS staining
show glycogen cells that migrate from the thick trophoblastic
wall into the decidua (see arrows for glycogen columns in Fig.
6, A and C). In contrast, in the treated placentas this migration
was not observed, and glycogen cells remained blocked within
the junctional zones by a barrier of trophoblast giant cells.
A B
1,40E-04 8,00E+07
Proliferin mRNA level
Hand1 mRNA level
(arbitrary units)
ns
(arbitrary units)
1,00E-04 6,00E+07
* *
4,00E+07
6,00E-05 *
2,00E+07
2,00E-05
Ctl 10-9 10-6 10-3
Nicotine (M)
C D
1,40E-03 ns
ns
Hand 2 mRNA level
ns
(arbitrary units)
Mash 2 mRNA level
(arbitrary units)
1,00E-02
6,00E-04
2,00E-04
Ctl 10-9 10-6 10-3
Nicotine (M)
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org
E451
These data strongly suggest that nicotine treatment affects
interstitial invasion in rat placentas.
Because in vivo data strongly suggested that nicotine treat-
ment affected trophoblast invasion and hence, their differenti-
ation, we carried out an in vitro study to examine the direct
effects of nicotine on trophoblast stem cell differentiation. We
used RCHO-1 cells, a rat cell line. These cells have the
advantage of being able to differentiate from trophoblast stem
cells to giant trophoblast cells under specific culture condi-
tions.
Effect of nicotine on the differentiation of trophoblast stem
cells to giant trophoblast cells. Under high-serum conditions
(20%), RCHO-1 cells proliferate and maintain their undiffer-
entiated state. A switch to 10% horse serum allows these cells
to differentiate. Under these conditions, the number of prolif-
erating cells decreases significantly, and the stem cells are
replaced by differentiated cells, i.e., the giant trophoblast cells.
To determine whether nicotine directly affects this process
of differentiation, we tested its effect over a large range of
nicotine concentrations (10⫺9 to 10⫺3M). In the absence of
nicotine (i.e., control) almost all of the RCHO-1 cells differ-
entiated to giant cells; this differentiation process was inhibited
by nicotine treatment, resulting in significantly enhanced pro-
liferation in nicotine-exposed cells (Fig. 7).
Nicotine effects on the expression of genes involved in cell
differentiation. Nicotine treatment of RCHO-1 cells resulted in
a significant reduction in Hand1 and proliferin mRNA expres-
sion (Fig. 8, A and B). Hand1 has been shown to be pivotal to
the differentiation of trophoblast giant cells (15, 24), and its
overexpression in RCHO-1 trophoblast cells has been shown to
promote their differentiation to trophoblast giant cells (15).
Conversely, nicotine treatment increased the expression of
Mash2 significantly (Fig. 8D). There was no effect of nicotine
*
*
Fig. 8. Nicotine effect on the mRNA expression
Ctl 10-9 10-6 10-3 of proliferin, Mash2, Hand1, and Hand2 in con-
trol and nicotine-treated RCHO-1 cells. Cells
Nicotine (M)
were treated for 24 h with nicotine (10⫺9, 10⫺6,
and 10⫺3 M). Expression of the indicated genes
was analyzed by quantitative RT-PCR, plotted
in arbitrary units, and normalized to RPL13.
Data are presented as means ⫹ SE. *P ⬍ 0.05.
2,00E-04
*
*
ns
1,50E-04
1,00E-04
5,00E-05
-3
Ctl 10-9 10-6 10
Nicotine (M)
E452 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME

on the expression of Hand2 at any dose tested (Fig. 8C). These
data demonstrate at the cellular level that the nicotine directly
affects key genes of the cell differentiation toward an invasive
phenotype, i.e., giant trophoblast cells.
Nicotine effects on RCHO cell migration. Trophoblast mi-
gration is an important process that accompanies trophoblast
differentiation and invasion into the maternal decidua. We
examined the effect of nicotine (10⫺9 to 10⫺3 M) on the
migration of RCHO-1 giant cells (i.e., differentiated cells)
using the wound healing assay. Treatment with nicotine sig-
nificantly delayed the wound healing of RCHO-1 giant cells
(Fig. 9, A and B).
Nicotine effect on RCHO-1 invasion. To further investigate
the effect of nicotine on the process of invasion of RCHO-1
cells, we determined their percentage of invasion through
Matrigel in the absence or presence of nicotine using the BD
FluoroBlok cell culture inserts. At the highest concentration
tested, there was a significant decrease in the invasion of
RCHO-1 cells (Fig. 9C). The migration of trophoblast cells
through the maternal decidua is mediated via the activity of
matrix metalloproteinases (MMPs). MMP2 and MMP9 are
the main MMPs known to be expressed in the placenta (5).
MMP2 was weakly detected in RCHO-1 cells, in accord
with previous reports (43). MMP9 was expressed abundantly
in these cells and was significantly reduced by nicotine treatment
(Fig. 9D).
Effect of Nicotine on Nicotinic Acetylcholine Receptor
Expression
Studies on nicotinic acetylcholine receptors (nAChRs) in the
placenta have reported that this tissue expresses different forms
of the nAChR. The ␣4- and ␣7-subunits are highly expressed
in the placenta (38). Nicotine treatment both in vivo (rats) and
in vitro (RCHO-1 cells) did not significantly alter the expres-
sion of the nAChR ␣7-subunit (Fig. 10, A and C). However,
nicotine treatment in vitro increased the expression of the
nAChR ␣4-subunit in a dose-dependent manner (Fig. 10D).
There was also a trend toward an increase in the expression of
this subunit in the placenta of nicotine-treated dams (Fig. 10B).

Nicotine (M)

A Ctl 10-9 10-6 10-3 B

0.052

% of wound closure
T0 50
40
30 * *
20
10
T18h
0
Ctl 10-9 10-6 10-3
Nicotine (M)

D Nicotine (M)
C
Ctl 10-9 10-6 10-3
RCHO-1
labelled cells MMP-9 92Kd

MMP-2 72Kd

120
ns 50
100 0.051
( arbitrary units)
% of invasion

* 40
MMP-9 levles

80 * *
60 30 *
40 20

20 10

Ctl 10-9 10-6 10-3 -9 -6 -3

Ctl 10 10 10
Nicotine (M) Nicotine (M)
Fig. 9. Nicotine effect on RCHO-1 cell migration and invasion. A: photographs of wounded RCHO-1 cells at 0 (T0) and 18 h (T18h) post-wounding. The cells
were treated at T0 with nicotine (10⫺9, 10⫺6, and 10⫺3 M). B: graph that reports the percentages of wound closure after 18 h of treatment. C: effect of nicotine
on RCHO-1 giant cell invasion using Matrigel-coated HTS fluroBlok transwell inserts. Top: photograph of RCHO-1 cells prelabeled with acetylated low-density
lipoprotein. Bottom: %invading cells upon treatment with nicotine (10⫺9, 10⫺6, and 10⫺3 M). Data are presented as means ⫹ SE. D: effect of nicotine on matrix
metallopeptidase (MMP)9 and MMP2 activities in RCHO-1 cells. Top: representative zymography of cells treated or not with nicotine for 24 h at indicated
concentrations. Bottom: densitometric analysis of zymographies of 3 independent experiments. Each bar represents the amounts of MMP9 as arbitrary units. Data
are presented as means ⫹ SE.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME E453

A B
3e-5 3 e-3

α /RPL13 mRNA
α /RPL13 mRNA

ns

(arbitrary units)
ns
(arbitrary units)

2e-5 2 e-3

nACh4α
nACh7α

1e-5 1e-3

Fig. 10. Nicotine effect on the mRNA expression

of nicotinic acetylcholine receptors (nAChRs)
Saline Nicotine Saline Nicotine nACh7␣ and nACh4␣. A and B: mRNA expres-
sion of nACh7␣ and nACh4␣ in the placenta of
saline- and nicotine-treated dams, respectively.
C and D: expression of the same genes in
C D RCHO-1 cells treated with nicotine for 24 h
7e-6 ns 1,4e-5 (10⫺9, 10⫺6, and 10⫺3 M). Expression of the
*
α /RPL13 mRNA

ns indicated genes was analyzed by quantitative RT-

ns
α /RPL13 mRNA
(arbitrary units)

PCR, plotted in arbitrary units, and normalized to

RPL13. Data are presented as means ⫾ SE. *P ⬍
(arbitrary units)

5e-6 1 e-5
* 10-4 0.05. Ctl, control.

*
nACh7α

3e-6 6 e-6
nACh4α

1e-6
2 e-6

Ctl 10-9 10-6 10-3 Ctl 10-9 10-6 10-3

Nicotine (M) Nicotine (M)

DISCUSSION We have demonstrated that nicotine treatment both in vivo and

Here, both in vitro and in vivo studies demonstrate that
nicotine 1) acts directly within the placenta, 2) exerts harmful
effects on placental development, 3) is involved in the dys-
regulation of the establishment of fetomaternal circulation, and
4) impacts the mechanisms underlying trophoblast invasion.
These statements are based on several key findings from this
study. First, nicotine receptors are expressed in the placenta,
and their levels are affected by nicotine treatment. Second,
both in vitro and in vivo data showed that nicotine inhibits
trophoblast differentiation by affecting key placental transcrip-
tion factors involved in the differentiation of trophoblast stem
cells, an effect that leads to an increase in their proliferation at
the expense of their differentiation toward an invasive pheno-
type. Third, nicotine inhibited trophoblast cell migration and
invasion, an effect that may be due in part to the reduction in
MMP9 activity. Fourth, nicotine affected the labyrinth zone of
the placenta by decreasing its vascularization and cell prolif-
eration and by increasing its hypoxic environment, all aspects
that might be the result of a failure in trophoblast invasion and
establishment of appropriate fetomaternal circulation.
In rodents, trophoblast invasion proceeds along two path-
ways: endovascular trophoblast invasion involving mainly gi-
ant trophoblast cells and interstitial trophoblast invasion in-
volving glycogen cells (1, 57). In this study, we investigated
the effects of nicotine on both types of invasion by using the
RCHO-1 cell, a cell line that models trophoblast stem cells that
differentiate to giant trophoblast cells (i.e., endovascular tro-
phoblast invasion), and an animal model in which we studied
glycogen cell invasion (i.e., interstitial trophoblast invasion).
in vitro inhibits trophoblast invasion and differentiation. An
inhibitory effect of nicotine on cell migration has previously
been reported in other systems such as primary human fibro-
blasts from gingival tissues (21, 22). However, the effect of
nicotine on trophoblast cell invasion and differentiation has not
been reported.
In the two models used in this study, nicotine reduced the
expression of Hand1, and we know that overexpression of
Hand1 in RCHO-1 trophoblast cells promotes their differenti-
ation to invading trophoblast giant cells (15, 24). This suggests
that the substantial invasion of giant trophoblast that still
persists at GD 15 might also be affected by the nicotine
treatment in vivo.
Trophoblast invasion is accompanied by the remodeling of
extracellular matrix by MMPs. We demonstrated that nicotine
inhibits the activity of MMP9, the main MMP expressed by
trophoblast cells during early pregnancy (5, 62). This inhibi-
tory effect suggests that nicotine affects the main enzyme
involved in the remodeling of the decidua.
The effects of nicotine on placental development are likely
to be mediated via nACh receptors in the placenta. Indeed, we
and others have identified the presence of nAChRs in the
placenta (38). Moreover, we have identified that nicotine ex-
posure increased the levels of the nAChR ␣4-subunit both in
vitro and in vitro. Importantly, the nAChR ␣4-subunit is the
receptor that exhibits the highest affinity for nicotine, and it is
highly expressed in trophoblast cells (14, 40).
In other systems, it has been reported that under stressful
conditions trophoblast cells release antiangiogenic factors lo-

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org

E454 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME
cally in the placenta and in the maternal circulation, causing
a failure in placental development along with harmful ef-
fects on the maternal vascular system (11). In the present
study, nicotine caused an increase in carbonic anhydrase,
suggesting hypoxia, but since there was no increase in
4HNE, this hypoxia was not sufficient to result in oxidative
damage in the placenta. In contrast, we observed a signifi-
cant decrease in the levels of placental EG-VEGF expres-
sion and a trend toward a decrease in its circulating levels in
the nicotine-treated rats. This finding corroborates with the one
reported by our group showing a decrease in the EG-VEGF levels
in the ovary of rats whose mothers were exposed to nicotine
during gestation (45). However, the mechanism by which
nicotine decreases the production of this key placental factor is
still to be determined.
In a previous study (33), we have shown that, compared with
control animals, nicotine treatment throughout the gestational
period was associated with a higher proportion of females who
delivered at least one stillborn pup. In our study, we have
demonstrated that nicotine administration to pregnant rats
resulted in structural abnormalities in the placenta at GD 15.
Importantly, these structural changes precede any deficits in
fetal growth that we have previously demonstrated were not
observable until GD 21 in this model (27). These data
suggest that the observed nicotine effects on fetal growth
might well be a consequence of a failure in placental
development occurring at the time of invasion and differ-
entiation of trophoblast cells. In fact, we have observed a
significant decrease in the vascularization along with a
decrease in the levels of proliferating cells within the
labyrinth zone, the key exchanging zone. The nicotine
effects in this zone might well be explained by the reduced
expression of EG-VEGF, as this factor has been shown to be
an important regulator of placentation by regulating tropho-
blast proliferation and intraplacental vascularization (7–9).
Further studies will determine the mechanism by which
nicotine regulates EG-VEGF expression.
Although it is well established that smoking during preg-
nancy reduces the risk of preeclampsia (PE) (19), studies of
smokeless tobacco use during pregnancy argue against nicotine
as being protective against the development of PE (19, 61).
Indeed, cigarette smoking is thought to protect against the
development of PE by decreasing levels of the circulating
factor sFLT-1 and hence, increasing the VEGF/sFLT-1 ratio,
which favors an improved placental angiogenesis (56).
However, in our model, nicotine did not affect either VEGF
and FLT-1 or VEGF/FLT-1 in either the circulation or the
placenta. Hence, these data substantiate previous studies
suggesting that nicotine is not the agent that confers PE
protection in pregnant women and suggest that it is mo-
re likely that tobacco combustion products and not nicotine
are the ingredients in cigarette smoke that protect against PE
(56, 61).
In conclusion, we have demonstrated that nicotine has direct
and local harmful effects on several main processes of placen-
tal development, and we propose a mechanism by which this
might occur at both the animal and cellular levels. This study
also suggests molecular explanations for why maternal smok-
ing has a negative effect on pregnancy outcome.
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org
ACKNOWLEDGMENTS
We thank the staff of the McMaster University Central Animal Facility for
their help with the animal work.
GRANTS
We acknowledge the following sources of funding: Institut National de la
Santé et de la Recherche Médicale (U1036), University Joseph Fourier,
Commissariat à l’Energie Atomique (DSV/iRTSV/BCI), the region Rhônes
Alpes, and the Canadian Institutes of Health Research (MOP 86474 to A. C.
Holloway and FRN 94331 to S. Raha). C. J. Nicholson was a recipient of the
Ashley Studentship for Research in Tobacco Control.
DISCLOSURES
No conflict of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
A.C.H., M.J.S., S.R., J.J.F., and N.A. contributed to the conception and
design of the research; A.C.H., A.S., V.G., S.R., F.S., C.J.N., and M.B.
performed the experiments; A.C.H. and N.A. interpreted the results of the
experiments; A.C.H., M.J.S., S.R., J.J.F., M.B., and N.A. edited and revised
the manuscript; A.C.H., M.J.S., and N.A. approved the final version of the
manuscript; J.J.F. and N.A. drafted the manuscript; N.A. analyzed data; N.A.
prepared the figures.
REFERENCES
1. Ain R, Canham LN, Soares MJ. Gestation stage-dependent intrauterine
trophoblast cell invasion in the rat and mouse: novel endocrine phenotype
and regulation. Dev Biol 260: 176 –190, 2003.
2. Alfaidy N, Chauvet S, Donadio-Andrei S, Salomon A, Saoudi Y,
Richaud P, Aude-Garcia C, Hoffmann P, Andrieux A, Moulis JM,
Feige JJ, Benharouga M. Prion protein expression and functional im-
portance in developmental angiogenesis: role in oxidative stress and
copper homeostasis. Antioxid Redox Signal 18: 400 –411, 2013.
3. Andres RL, Day MC. Perinatal complications associated with maternal
tobacco use. Semin Neonatol 5: 231–241, 2000.
4. Ashford KB, Hahn E, Hall L, Rayens MK, Noland M, Ferguson JE.
The effects of prenatal secondhand smoke exposure on preterm birth and
neonatal outcomes. J Obstet Gynecol Neonatal Nurs 39: 525–535, 2010.
5. Bischof P, Meisser A, Campana A. Control of MMP-9 expression at the
maternal-fetal interface. J Reprod Immunol 55: 3–10, 2002.
6. Blackburn CW, Peterson CA, Hales HA, Carrell DT, Jones KP, Urry
RL, Peterson CM. Nicotine, but not cotinine, has a direct toxic effect on
ovarian function in the immature gonadotropin-stimulated rat. Reprod
Toxicol 8: 325–331, 1994.
7. Brouillet S, Hoffmann P, Benharouga M, Salomon A, Schaal JP, Feige
JJ, Alfaidy N. Molecular characterization of EG-VEGF-mediated angio-
genesis: differential effects on microvascular and macrovascular endothe-
lial cells. Mol Biol Cell 21: 2832–2843, 2010.
8. Brouillet S, Hoffmann P, Feige JJ, Alfaidy N. EG-VEGF: a key
endocrine factor in placental development. Trends Endocrinol Metab 23:
501–508, 2012.
9. Brouillet S, Murthi P, Hoffmann P, Salomon A, Sergent F, De
Mazancourt P, Dakouane-Giudicelli M, Dieudonné MN, Rozenberg P,
Vaiman D, Barbaux S, Benharouga M, Feige JJ, Alfaidy N. EG-VEGF
controls placental growth and survival in normal and pathological preg-
nancies: case of fetal growth restriction (FGR). Cell Mol Life Sci 70:
511–525, 2013.
10. Bullen C, McRobbie H, Thornley S, Glover M, Lin R, Laugesen M.
Effect of an electronic nicotine delivery device (e cigarette) on desire to
smoke and withdrawal, user preferences and nicotine delivery: randomised
cross-over trial. Tob Control 19: 98 –103.
11. Burton GJ, Charnock-Jones DS, Jauniaux E. Regulation of vascular
growth and function in the human placenta. Reproduction 138: 895–902,
2009.
12. Castles A, Adams EK, Melvin CL, Kelsch C, Boulton ML. Effects of
smoking during pregnancy. Five meta-analyses. Am J Prev Med 16:
208 –215, 1999.
13. Chavez-Noriega LE, Crona JH, Washburn MS, Urrutia A, Elliott KJ,
Johnson EC. Pharmacological characterization of recombinant human
neuronal nicotinic acetylcholine receptors h alpha 2 beta 2, h alpha 2 beta
4, h alpha 3 beta 2, h alpha 3 beta 4, h alpha 4 beta 2, h alpha 4 beta 4 and
 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME
h alpha 7 expressed in Xenopus oocytes. J Pharmacol Exp Ther 280:
346 –356, 1997.
14. Cordero-Erausquin M, Marubio LM, Klink R, Changeux JP. Nico-
tinic receptor function: new perspectives from knockout mice. Trends
Pharmacol Sci 21: 211–217, 2000.
15. Cross JC, Flannery ML, Blanar MA, Steingrimsson E, Jenkins NA,
Copeland NG, Rutter WJ, Werb Z. Hxt encodes a basic helix-loop-helix
transcription factor that regulates trophoblast cell development. Develop-
ment 121: 2513–2523, 1995.
16. Cross JC, Werb Z, Fisher SJ. Implantation and the placenta: key pieces
of the development puzzle. Science 266: 1508 –1518, 1994.
17. DeVeaugh-Geiss AM, Chen LH, Kotler ML, Ramsay LR, Durcan MJ.
Pharmacokinetic comparison of two nicotine transdermal systems, a 21-
mg/24-hour patch and a 25-mg/16-hour patch: a randomized, open-label,
single-dose, two-way crossover study in adult smokers. Clin Ther 32:
1140 –1148, 2010.
18. Eaton JB, Peng JH, Schroeder KM, George AA, Fryer JD, Krishnan
C, Buhlman L, Kuo YP, Steinlein O, Lukas RJ. Characterization of
human alpha 4 beta 2-nicotinic acetylcholine receptors stably and heter-
ologously expressed in native nicotinic receptor-null SH-EP1 human
epithelial cells. Mol Pharmacol 64: 1283–1294, 2003.
19. England L, Zhang J. Smoking and risk of preeclampsia: a systematic
review. Front Biosci 12: 2471–2483, 2007.
20. Eskenazi B, Bergmann JJ. Passive and active maternal smoking during
pregnancy, as measured by serum cotinine, and postnatal smoke exposure.
I. Effects on physical growth at age 5 years. Am J Epidemiol 142:
S10 –S18, 1995.
21. Fang Y, Svoboda KK. Nicotine inhibits human gingival fibroblast mi-
gration via modulation of Rac signalling pathways. J Clin Periodontol 32:
1200 –1207, 2005.
22. Fang Y, Svoboda KK. Nicotine inhibits myofibroblast differentiation in
human gingival fibroblasts. J Cell Biochem 95: 1108 –1119, 2005.
23. Faria TN, Soares MJ. Trophoblast cell differentiation: establishment,
characterization, and modulation of a rat trophoblast cell line expressing
members of the placental prolactin family. Endocrinology 129: 2895–
2906, 1991.
24. Firulli AB, McFadden DG, Lin Q, Srivastava D, Olson EN. Heart and
extra-embryonic mesodermal defects in mouse embryos lacking the bHLH
transcription factor Hand1. Nat Genet 18: 266 –270, 1998.
25. Gardner RL, Beddington RS. Multi-lineage ‘stem’ cells in the mamma-
lian embryo. J Cell Sci Suppl 10: 11–27, 1988.
26. Gerzanich V, Peng X, Wang F, Wells G, Anand R, Fletcher S,
Lindstrom J. Comparative pharmacology of epibatidine: a potent agonist
for neuronal nicotinic acetylcholine receptors. Mol Pharmacol 48: 774 –
782, 1995.
27. Gruslin A, Cesta CE, Bell M, Qing Q, Petre MA, Holloway AC. Effect
of nicotine exposure during pregnancy and lactation on maternal, fetal, and
postnatal rat IGF-II profile. Reprod Sci 16: 875–882, 2009.
28. Gupta SK, Hwang SS, Causey D, Rolf CN, Gorsline J. Comparison of
the nicotine pharmacokinetics of Nicoderm (nicotine transdermal system)
and half-hourly cigarette smoking. J Clin Pharmacol 35: 985–989, 1995.
29. Hamlin GP, Lu XJ, Roby KF, Soares MJ. Recapitulation of the pathway
for trophoblast giant cell differentiation in vitro: stage-specific expression
of members of the prolactin gene family. Endocrinology 134: 2390 –2396,
1994.
30. Hoffmann P, Feige JJ, Alfaidy N. Placental expression of EG-VEGF and
its receptors PKR1 (prokineticin receptor-1) and PKR2 throughout mouse
gestation. Placenta 28: 1049 –1058, 2007.
31. Hoffmann P, Saoudi Y, Benharouga M, Graham CH, Schaal JP,
Mazouni C, Feige JJ, Alfaidy N. Role of EG-VEGF in human placen-
tation: Physiological and pathological implications. J Cell Mol Med 13:
2224 –2235, 2009.
32. Holloway AC, Kellenberger LD, Petrik JJ. Fetal and neonatal exposure
to nicotine disrupts ovarian function and fertility in adult female rats.
Endocrine 30: 213–216, 2006.
33. Holloway AC, Petrik JJ, Bruin JE, Gerstein HC. Rosiglitazone pre-
vents diabetes by increasing beta-cell mass in an animal model of type 2
diabetes characterized by reduced beta-cell mass at birth. Diabetes Obes
Metab 10: 763–771, 2008.
34. Jeyabalan A, Powers RW, Clifton RG, Van Dorsten P, Hauth JC,
Klebanoff MA, Lindheimer MD, Sibai B, Landon M, Miodovnik M;
Eunice Kennedy Shriver National Institute of Child Health and
Human Development Maternal-Fetal Medicine Units Network. Effect
AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org
E455
of smoking on circulating angiogenic factors in high risk pregnancies.
PLoS One 5: e13270, 2010.
35. Joya X, Pujadas M, Falcon M, Civit E, Garcia-Algar O, Vall O,
Pichini S, Luna A, de la Torre R. Gas chromatography-mass spectrom-
etry assay for the simultaneous quantification of drugs of abuse in human
placenta at 12th week of gestation. Forensic Sci Int 196: 38 –42.
36. Kraiczi H, Hansson A, Perfekt R. Single-dose pharmacokinetics of
nicotine when given with a novel mouth spray for nicotine replacement
therapy. Nicotine Tob Res 13: 1176 –1182.
37. Liao SY, Lerman MI, Stanbridge EJ. Expression of transmembrane
carbonic anhydrases, CAIX and CAXII, in human development. BMC Dev
Biol 9: 22, 2009.
38. Lips KS, Bruggmann D, Pfeil U, Vollerthun R, Grando SA, Kummer
W. Nicotinic acetylcholine receptors in rat and human placenta. Placenta
26: 735–746, 2005.
39. Luck W, Nau H. Nicotine and cotinine concentrations in serum and urine
of infants exposed via passive smoking or milk from smoking mothers. J
Pediatr 107: 816 –820, 1985.
40. Olale F, Gerzanich V, Kuryatov A, Wang F, Lindstrom J. Chronic
nicotine exposure differentially affects the function of human alpha3,
alpha4, and alpha7 neuronal nicotinic receptor subtypes. J Pharmacol Exp
Ther 283: 675–683, 1997.
41. Parise G, Brose AN, Tarnopolsky MA. Resistance exercise training
decreases oxidative damage to DNA and increases cytochrome oxidase
activity in older adults. Exp Gerontol 40: 173–180, 2005.
42. Patil SR, Ravindra Patil SR, Londonkar R, Patil SB. Nicotine induced
ovarian and uterine changes in albino mice. Indian J Physiol Pharmacol
42: 503–508, 1998.
43. Peters TJ, Albieri A, Bevilacqua E, Chapman BM, Crane LH, Hamlin
GP, Seiki M, Soares MJ. Differentiation-dependent expression of gela-
tinase B/matrix metalloproteinase-9 in trophoblast cells. Cell Tissue Res
295: 287–296, 1999.
44. Peters TJ, Chapman BM, Wolfe MW, Soares MJ. Placental lactogen-I
gene activation in differentiating trophoblast cells: extrinsic and intrinsic
regulation involving mitogen-activated protein kinase signaling pathways.
J Endocrinol 165: 443–456, 2000.
45. Petrik JJ, Gerstein HC, Cesta CE, Kellenberger LD, Alfaidy N,
Holloway AC. Effects of rosiglitazone on ovarian function and fertility in
animals with reduced fertility following fetal and neonatal exposure to
nicotine. Endocrine 36: 281–290, 2009.
46. Rampon C, Bouillot S, Climescu-Haulica A, Prandini MH, Cand F,
Vandenbrouck Y, Huber P. Protocadherin 12 deficiency alters morpho-
genesis and transcriptional profile of the placenta. Physiol Genomics 34:
193–204, 2008.
47. Romani F, Lanzone A, Tropea A, Tiberi F, Catino S, Apa R. Nicotine
and cotinine affect the release of vasoactive factors by trophoblast cells
and human umbilical vein endothelial cells. Placenta 32: 153–160, 2011.
48. Rossant J, Cross JC. Placental development: lessons from mouse mu-
tants. Nat Rev Genet 2: 538 –548, 2001.
49. Rustemeier K, Stabbert R, Haussmann HJ, Roemer E, Carmines EL.
Evaluation of the potential effects of ingredients added to cigarettes. Part
2: chemical composition of mainstream smoke. Food Chem Toxicol 40:
93–104, 2002.
50. Scott IC, Anson-Cartwright L, Riley P, Reda D, Cross JC. The
HAND1 basic helix-loop-helix transcription factor regulates trophoblast
differentiation via multiple mechanisms. Mol Cell Biol 20: 530 –541,
2000.
51. Soares MJ, Chakraborty D, Karim Rumi MA, Konno T, Renaud SJ.
Rat placentation: an experimental model for investigating the hemochorial
maternal-fetal interface. Placenta 33: 233–243, 2012.
52. Strickland S, Richards WG. Invasion of the trophoblasts. Cell 71:
355–357, 1992.
53. Swauger JE, Steichen TJ, Murphy PA, Kinsler S. An analysis of the
mainstream smoke chemistry of samples of the U.S. cigarette market
acquired between 1995 and 2000. Regul Toxicol Pharmacol 35: 142–156,
2002.
54. Takahashi Y, Carpino N, Cross JC, Torres M, Parganas E, Ihle JN.
SOCS3: an essential regulator of LIF receptor signaling in trophoblast
giant cell differentiation. EMBO J 22: 372–384, 2003.
55. Varvarigou AA, Fouzas S, Beratis NG. Effect of prenatal tobacco smoke
exposure on fetal growth potential. J Perinat Med 38: 683–687, 2010.
56. Venditti CC, Casselman R, Murphy MS, Adamson SL, Sled JG, Smith
GN. Chronic carbon monoxide inhalation during pregnancy augments
E456 EVIDENCE FOR ADVERSE EFFECTS OF NICOTINE ON PREGNANCY OUTCOME

uterine artery blood flow and uteroplacental vascular growth in mice. Am
J Physiol Regul Integr Comp Physiol 305: R939 –R948, 2013.
57. Vercruysse L, Caluwaerts S, Luyten C, Pijnenborg R. Interstitial
trophoblast invasion in the decidua and mesometrial triangle during the
last third of pregnancy in the rat. Placenta 27: 22–33, 2006.
58. Voyta JC, Via DP, Butterfield CE, Zetter BR. Identification and
isolation of endothelial cells based on their increased uptake of acetylated-
low density lipoprotein. J Cell Biol 99: 2034 –2040, 1984.
59. Wells M. The pathology of gestational trophoblastic disease: recent
advances. Pathology 39: 88 –96, 2007.
60. Wigle DT, Arbuckle TE, Turner MC, Berube A, Yang Q, Liu S,
Krewski D. Epidemiologic evidence of relationships between reproduc-
tive and child health outcomes and environmental chemical contaminants.
J Toxicol Environ Health B Crit Rev 11: 373–517, 2008.
61. Wikström AK, Stephansson O, Cnattingius S. Tobacco use during
pregnancy and preeclampsia risk: effects of cigarette smoking and snuff.
Hypertension 55: 1254 –1259, 2010.
62. Xu P, Alfaidy N, Challis JR. Expression of matrix metalloproteinase
(MMP)-2 and MMP-9 in human placenta and fetal membranes in relation
to preterm and term labor. J Clin Endocrinol Metab 87: 1353–1361, 2002.
63. Zdravkovic T, Genbacev O, Prakobphol A, Cvetkovic M, Schanz A,
McMaster M, Fisher SJ. Nicotine downregulates the l-selectin system
that mediates cytotrophoblast emigration from cell columns and attach-
ment to the uterine wall. Reprod Toxicol 22: 69 –76, 2006.

AJP-Endocrinol Metab • doi:10.1152/ajpendo.00478.2013 • www.ajpendo.org