Article

Human and Experimental Toxicology

2020, Vol. 39(3) 290–300
Systemic administration with ª The Author(s) 2019
Article reuse guidelines:
sagepub.com/journals-permissions
tetrahydrocannabinol causes retinal DOI: 10.1177/0960327119886037
journals.sagepub.com/home/het
damage in BALB/c mice

Z Zhang, R Li, H Lu and X Zhang

Abstract
Recent years have seen substantial shifts in cultural attitudes towards cannabis for medical and recreational use.
However, legalizing recreational marijuana may have adverse effects on individual and public health. As the
most widely used illicit agent, cannabis is commonly reported to disrupt learning and memory. Unfortunately,
the molecular mechanisms underlying behavioral impairment by cannabis abuse remain poorly understood.
Tetrahydrocannabinol (THC), a major component in cannabis, causes short-term effects on the visual system,
but little is known about persisting visual disturbances. This study was to investigate the effects of systemic
administration with THC on retina and explore its underlying mechanisms. BALB/c mice were treated with 1
or 2 mg/kg THC intraperitoneally daily for 2 months, mice treated with vehicle as negative control. The retinal
function was tested by electroretinography after THC treatment. Morphology and pathology changes of retina
were detected by hematoxylin and eosin staining. Terminal deoxynucleotidyl transferase dUTP nick end
labeling assay was used to detect the apoptosis in photoreceptor cells. Enzyme-linked immunosorbent assay
was used to show the inflammatory responses and oxidative stress. mRNA and protein changes were mea-
sured by real-time polymerase chain reaction and Western blot to explore the underlying mechanisms. Results
indicated that 2-month treatment with THC caused retinal damage, evidenced by its functional loss and
increased apoptosis in photoreceptor cells through inducing inflammatory responses and oxidative stress.
Our study demonstrated that systemic administration with THC caused toxic effects on retinas of BALB/c
mice, suggesting the potential mechanisms for the retina damage caused by cannabis abuse.

Keywords
Tetrahydrocannabinol, BALB/c mice, retinal damage, inflammatory responses, oxidative stress

Introduction treatment of glaucoma after short-term application.4

As the world’s most widely cultivated, trafficked, and
abused illicit substance, cannabis is used by approxi-
mately 2.5% of the world’s population (147 million
people).1,2 In recent years, cannabis use peaks during
adolescence, with greater decline in cognitive func-
tions, including learning and memory performance.3
The initial state of acute intoxication formulates the
symptoms such as euphoria and perception altera-
tions. The active ingredient is believed to be tetrahy-
drocannabinol (THC), which is also responsible for
intoxication. Studies showed that inhaled doses of 2–3
mg of THC and ingested doses of 5–20 mg THC can
cause impairment of memory, attention, executive
functioning, and short-term memory, although with
potential use as a novel topical therapy for the
Chronic use may lead to long-term effects on cogni-
tive performance.5,6 Impairment of sensory percep-
tion is among the more common effects with
hallucinogen persisting perception disorder after mar-
ijuana consumption. Although much progress has
been made in understanding the neurotoxicity of can-
nabis abuse,7–9 its toxic effects on the visual system
Ophthalmology Hospital, The First Affiliated Hospital of Harbin
Medical University, Harbin, People’s Republic of China
Corresponding author:
X Zhang, Ophthalmology Hospital, The First Affiliated Hospital of
Harbin Medical University, Harbin 150001, People’s Republic of
China.
Email: zhangxiaomeiphd@163.com
Zhang et al.
after long-term treatment have not been elucidated,
specifically on retina. Therefore, it is necessary to
investigate its effects and the underlying mechanisms.
Cannabinoids act on two cannabinoid binding (CB)
receptors, CB1 and CB2. CB1 is primarily centrally
located and mainly involved in central effects, includ-
ing consequences on learning, memory cognition,
emotion, sensory perception, and so on. CB2 is pri-
marily peripherally located and found to affect
inflammation and immune system regulation. The
wide distribution of CB1 in both the anterior eye and
the retina suggests that cannabinoids influence several
different physiological functions in the eye.10 Stimu-
lation of CB1 may result in the stimulation of various
neurotransmitters, including L-glutamate, dopamine,
and 5-hydroxytryptamine, which contribute to the
central and peripheral effects observed in cannabinoid
toxicity.11 Neuroinflammation has been considered as
an important cause relating with neurological disor-
ders.12 THC has been characterized as a full agonist at
CB1 receptors on gamma-aminobutyric acid neuron
axon terminals in the hippocampus,13 which may con-
tribute to THC-induced neurotoxicity, because acti-
vated neurons produce pro-inflammatory cytokines
and reactive oxygen species (ROS) to amplify the
neuron damage.14
The use of hallucinogenic drugs causes prolonged
adverse reactions. Among these reactions are halluci-
nogen persisting perception disorder and persistent
psychosis which are usually seen after repeated drug
administrations. This study was to investigate whether
systemic administration with THC would cause toxic
effects on retinas of BALB/c mice, providing the
potential mechanisms for the retinal damage caused
by cannabis abuse.
Materials and methods
Mouse treatment
Six-week-old BALB/c mice were purchased from
Vital River Ltd (Beijing, China) and housed in
humidity and temperature-controlled (23 + 2 C)
facility on a 12-h light/12-h dark cycle. Mice had
ad libitum access to food and water in their home
cage. All animal studies were performed according
to Chinese animal care guidelines under an approved
Institutional Animal Care and Use Committee pro-
tocol from Harbin Medical University. THC was
purchased from National Institutes for Food and Drug
Control (Beijing, China). The mixture solution of
ethanol, alkamuls-620 (Rhone-Poulenc, Princeton,
291
New Jersey, USA), and saline (prepared according
to the ratio: 1/1/18, v/v/v) was used to dissolve
THC. BALB/c mice were treated with THC at 1
or 2 mg/kg (n ¼ 10) by intraperitoneal injection
daily with mice treated with vehicle (n ¼ 10) as
negative control.
Electroretinography
After overnight dark adaptation, mice were anesthe-
tized to perform the electroretinography (ERG) test
with UTAS-E3000 Electrophysiology System (LKC
Technologies, Gaithersburg, Maryland, USA).15,16
Mouse pupils were dilated, and the corneal surface
was anesthetized with 0.5% proparacaine hydrochlo-
ric acid (Alcon, Beijing, China). Reference and
ground electrodes were attached to the mouth and
placed in the neck-back region subcutaneously. In
the light-adapted session, the flash luminance ranged
from 0.8 log cd s/m2 to 1.9 log cd s/m2. In the dark-
adapted session, the flash luminance ranged from
2.4 log cd s/m2 to 2.1 log cd s/m2 (b wave) and 0
log cd s/m2 to 2.1 log cd s/m2 (a wave). The ERG a-
wave is the initial corneal-negative deflection and its
amplitude was measured from baseline to the trough
of the a-wave. The ERG b-wave is the corneal-
positive deflection and its amplitude is measured
from the trough of the a-wave to the peak of the b-
wave (Figure 1).17
Terminal deoxynucleotidyl transferase dUTP nick
end labeling assay
After euthanization with carbon dioxide, mouse eyes
were fixed with 4% paraformaldehyde for 4 h and
then dehydrated in graded sucrose solution. After
being embedded in optimal cutting temperature
(OCT) compound, 10-mm-thick frozen sections were
cut sagittally passing through the optic disc with
freezing microtome (Sakura, the Netherlands). Frozen
sections were permeabilized with 0.1% Triton X-100/
0.1% sodium citrate solution for 2 min on ice and then
incubated with the terminal deoxynucleotidyl trans-
ferase dUTP nick end labeling reaction mixture
(Sigma-Aldrich, St Louis, Missouri, USA) for 60 min
at 37 C. After rinsing, sections were sealed with
VECTASHIELD mounting medium containing 40 ,6-
diamidino-2-phenylindole and visualized under the
fluorescence microscope.
292 Human and Experimental Toxicology 39(3)

Figure 1. THC treatment caused retina dysfunction and damage in BALB/c mice. BALB/c mice were treated with THC at
1 or 2 mg/kg (n ¼ 10) by intraperitoneal injection daily, mice treated with vehicle (n ¼ 10) as negative control. ERG
response was obtained from BALB/c mice treated with THC (n ¼ 10) or vehicle (n ¼ 10) after 1 and 2 months, shown by
dark-adapted ERG a wave (a), dark-adapted ERG b wave (b), and light-adapted ERG b wave (c). Representative images
(20) of HE staining from BALB/c mice treated with THC or vehicle after 2 months were presented. THC treatment
significantly decreased the ONL thickness (d). Data were expressed as mean + SD. *p < 0.05, **p < 0.01 versus vehicle
group. THC: tetrahydrocannabinol; ERG: electroretinography; HE: hematoxylin and eosin; ONL: outer nuclear layer.
Zhang et al.
Hematoxylin and eosin staining
Ten-mm-thick frozen sections were stained with
hematoxylin and eosin18 and visualized under an
Olympus BX60 microscope (Olympus, Shinjuku,
Japan). The thickness of the outer nuclear layer
(ONL) was measured at 200 mm from the edge of the
optic disc using ImageJ 1.48v software (National
Institutes of Health, Bethesda, Maryland, USA).
SOD and catalase activities, MDA and GSH
content measurement
Retinas were harvested after the ERG recording. The
retinas were grinded with ReadyPrep Mini Grinders
(1632146, Bio-Rad, Hercules, California, USA) in
lysis buffer (ReadyPrep Protein Extraction Kit,
1632086, Bio-Rad). Cell lysate was used to determine
the superoxide dismutase (SOD) and catalase activi-
ties and malondialdehyde (MDA) as well as glu-
tathione (GSH) levels by enzyme-linked
immunosorbent assay (ELISA) kits (Jiancheng Biolo-
gical Engineering, Nanjing, China) according to the
manufacturers’ instructions.
Cytochrome c assay
The concentration of cytochrome c in retinas was
determined by the mouse cytochrome c immunoassay
kit (R&D Systems, Minneapolis, Minnesota, USA).
The optical density was measured on an ELISA plate
reader with a wavelength of 490 nm.
Caspase activity measurement
The caspase 3 (Ac-DEVD-Amc, 390/475 nm) and
caspase 9 (Ac-LEDH-Afc, 400/505 nm) activities in
retinas were determined using the fluorescent assay
kit (R&D systems) by a microplate reader, respec-
tively, according to the manufacturer’s instruction.
Cytokine assays
Cytokine levels of interleukin (IL)-1b, IL-6, and
tumor necrosis factor a (TNF-a) were measured by
ELISA kits (Jiancheng Biological Engineering, Nanj-
ing, China) according to the manufacturer’s
instruction.
Nitric oxide measurement
Nitric oxide (NO) in cell lysate of retinas was mea-
sured by Griess assay (Sigma-Aldrich).19
293
Real-time polymerase chain reaction
RNA was extracted from retinas after the ERG test
with TRIzol using manufacturer’s protocol. RNA
concentration was quantified by a spectrophotometer,
and mRNA was reverse transcribed into cDNA with
SuperScript master mix (Bio-Rad). Quantitative poly-
merase chain reaction was conducted using SYBR
Green Supermix (Bio-Rad) with comparative Ct value
method to quantify the expression in different sam-
ples. The mRNA levels were normalized to that of a
housekeeping gene b-actin. The gene-specific primer
sequences are the following. For SOD, forward:
ccgaggagaagtaccacgag, reverse: gaaccttggactccca-
caga, and GenBank reference: Z18857.1; for Cata-
lase, forward: ttgacagagagcggattcct, reverse:
agctgagcctgactctccag, and GenBank reference:
AK075853.1; for glucose-regulated protein 78 kDa
(GRP78), forward: cgtatgtggccttcactcct, reverse:
tttcttctggggcaaatgtc, and GenBank reference:
D78645.1; for activating transcription factor 6
(ATF6), forward: acatgctcatgtggtttcca, reverse:
agggctgaaccacaaatcac, and NCBI reference:
NM_001081304.1; for inositol-requiring enzyme 1a
(IRE1a), forward: gaatctggttttgcctgcat, reverse:
tccacagcattgctaacgag, and GenBank reference:
AB031332.1; for nitric oxide synthase (NOS), forward:
ctcactgggacagcacagaa, reverse: gcttgtctctgggtcctctg,
and GenBank reference: U43428.1; for IL-1b, forward:
tgaaatgccaccttttgaca, reverse: tgtcctcatcctggaaggtc, and
NCBI reference: NM_008361.4; for IL-6, forward:
gagcccaccaagaacgatag, reverse: tccacgatttcccagagaac,
and NCBI reference: NM_031168.2; for TNF-a,
forward: gattatggctcagggtccaa, reverse: ctccctttgca-
gaactcagg, and NCBI reference: NM_013693.3; and for
b-actin, forward: tgttaccaactgggacgaca, reverse: gggg
tgttgaaggtctcaaa, and NCBI reference: NM_007393.5.
Western blot
Protein was extracted from retinas after the ERG test
with radioimmunoprecipitation assay (RIPA) buffer
(Sigma-Aldrich), supplemented with protease inhibi-
tors (Roche, Basel, Switzerland) and phosphatase
inhibitors (Thermo Scientific, Waltham, Massachu-
setts, USA). Protein was quantified with the bicinch-
oninic acid assay kit (Thermo Scientific, Waltham,
MA, USA). Equal amounts of protein (40-mg per lane)
were mixed with 4 loading buffer and subjected to
sodium dodecyl sulfate polyacrylamide gel electro-
phoresis with 4–12% gel. Protein was transferred to
polyvinylidene fluoride membranes, blocked for 1 h
294
at room temperature in 1% bovine serum albumin,
and then incubated with primary antibodies (anti-
cleaved caspase 3, rabbit pAb, ab49822, 1:1000;
anti-cleaved caspase 9, rabbit mAb, #9509, 1:1500;
anti-Bcl-2, rabbit pAb, ab196495, 1:1000; anti-Bax,
rabbit mAb, #14796, 1:2000; anti-nicotinamide ade-
nine dinucleotide phosphate (NADPH) oxidase 4, rab-
bit mAb, ab195524, 1:1000; anti-GRP78, rabbit pAb,
ab21685, 1:1000; anti-ATF6, rabbit pAb, ab37149,
1:1000; anti-p-IRE1a, rabbit pAb, ab48187, 1:1000;
anti-p-P38, rabbit pAb, ab47363, 1:1000; anti-NF-kB
(nuclear factor kappa-light-chain-enhancer of acti-
vated B cells) rabbit mAb, #8242, 1:1000; and anti-
b-actin, rabbit pAb, ab16039,1:3000) overnight at
4 C. Bound antibodies were washed and incubated
with the secondary antibody (goat anti-rabbit IgG
H&L HRP, ab6721, 1:3000) for 1 h. Membranes were
washed and exposed to PierceTM ECL substrates
(Thermo Scientific), followed by the X-ray film
development.
Statistical analysis
Data were expressed as mean + SD and analyzed
with SPSS 19.0 software (SPSS Inc., Chicago, Illi-
nois, USA). Two-way repeated analysis of variance
(ANOVA) was used to analyze the ERG data. All
other comparisons were made by one-way ANOVA
followed by Least Significant Difference (LSD) post
hoc analysis. A value of p < 0.05 was considered as
significant difference.
Results
Systematic treatment with THC caused retinal
dysfunction and damage in BALB/c mice
ERG can be used to test the function of outer retina or
monitor disease progression, because it reflects the
mass response of photoreceptor cells. Our results
showed that the amplitude of ERG significantly
decreased after 2-month treatment with THC, indicat-
ing THC treatment caused retinal dysfunction, which
was also evidenced by the decreased thickness of
ONL (Figure 1).
THC treatment caused photoreceptor cell
apoptosis
THC treatment significantly increased apoptotic cells
in the ONL, together with increase of caspase activi-
ties and cytochrome c release (p < 0.01). Proapoptotic
Human and Experimental Toxicology 39(3)
protein Bax and caspase expression increased but
antiapoptotic protein Bcl-2 decreased after THC treat-
ment (Figure 2).
THC treatment increased oxidative stress in
retinas
Compared to vehicle control, oxidative stress signif-
icantly increased after 2-month treatment with THC,
evidenced by increased MDA level, decreased GSH
level, SOD, and catalase activity, together with the
decrease of mRNA expression of SOD and catalase,
and the increase of NADPH oxidase 4 protein expres-
sion, suggesting THC caused retina damage through
increasing oxidative stress (Figure 3).
THC treatment increased endoplasmic reticulum
stress in retinas
As a central regulator for endoplasmic reticulum (ER)
stress due to its role as a major ER chaperone and its
ability to control the activation of transmembrane ER
stress sensors IRE1 and ATF6, a large number of
studies established that induction of GRP78 is a mar-
ker for ER stress.20 IRE1a and ATF6 are signaling
proteins in ER stress. IRE1a stimulates activation of
the apoptotic-signaling kinase-1, which activates
downstream of stress kinases to promote apoptosis.
As a transcriptional factor, ATF6 translocates to the
Golgi compartment where it is cleaved upon ER
stress.21 ER stress markers were detected after THC
treatment. Results showed that THC increased the
mRNA and protein expression of GRP78, ATF6, and
IRE1a (Figure 4).
THC treatment induced inflammatory responses
in retinas
Production of NO and IL-1b, IL-6, and TNF-a in
retinas of BALB/c mice significantly increased after
2-month treatment with THC. mRNA expression of
NOS, IL-1b, IL-6, and TNF-a and protein expression
of p-P38 and NF-kB in the BALB/c mouse retinas
also increased after THC treatment (p < 0.01)
(Figure 5).
Discussion
Marijuana for recreational use has many negative
health effects. The drug is addictive, with mounting
evidence for the existence of a withdrawal syndrome.
Furthermore, it has been shown to have adverse
Zhang et al. 295

Figure 2. THC treatment caused photoreceptor cell apoptosis. BALB/c mice were treated with THC at 1 or 2 mg/kg (n ¼
10) by intraperitoneal injection daily, mice treated with vehicle (n ¼ 10) as negative control. Mice were euthanized after 2
months and retinas were harvested for the following assays. The red spots indicated the TUNEL-positive cells (20) (a).
THC treatment significantly increased DNA fragmentation (a), cytochrome c release (b), and caspase activities (c). THC
treatment decreased antiapoptotic protein but increased proapoptotic protein expression (d). Data were expressed as
mean + SD. *p < 0.05, **p < 0.01 versus vehicle group. THC: tetrahydrocannabinol; TUNEL: Terminal deoxynucleotidyl
transferase dUTP Nick End Labeling; ONL: outer nuclear layer; INL: inner nuclear layer; GLC: ganglion cells.

effects on mental health, intelligence (including irre- medications prescribed by physicians.22 Impairments
versible declines in cognition), and the respiratory of learning and memory by cannabis abuse have been
system. Medical marijuana should also be subject to reported and much progress has been made in under-
the same rigorous approval process as other standing its neurological consequence.23,24 However,
296 Human and Experimental Toxicology 39(3)

Figure 3. THC treatment increased oxidative stress in retinas of BALB/c mice. BALB/c mice were treated with THC at 1
or 2 mg/kg (n ¼ 10) by intraperitoneal injection daily, mice treated with vehicle (n ¼ 10) as negative control. Mice were
euthanized after 2 months. Retinas were harvested to measure the oxidative stress: MDA content, GSH level, and SOD
activity (a); catalase activity (b); mRNA expression of SOD and Catalase (c) and oxidative stress-related protein expression
(d). Data were expressed as mean + SD. *p < 0.05, **p < 0.01 versus vehicle group. THC: tetrahydrocannabinol; MDA:
malondialdehyde; GSH: glutathione; SOD: superoxide dismutase.

few studies have investigated the effects of cannabis
abuse on retinas.25 There is limited knowledge about
the chronic toxicity induced by cannabis abuse and no
effective treatment is available for this injury. After
administration with THC at the same dosage (5 mg/
kg), absorption after intraperitoneal (ip) route was
rapid and plasma disappearance was slow, which pro-
duced approximately four to six times higher plasma
concentration than that after per os or subcutaneous
routes. Moreover, the brain disappearance of THC
was slower after repeated administration than that
after single treatment.26 Evaluation of abuse liability
of substances via ip administration is comparable to
vapor inhalation.27 This study was to investigate the
effects of systemic administration with THC, the
major component in cannabis, on mouse retinas and
its underlying mechanisms. For the first time, we
explored the effects of dosing and administration
duration (up to 2 months) that reflect cannabis abuse
situations, complementing studies into the mechan-
isms underlying retina damage caused by cannabis
abuse.
Apoptosis was considered as the main pathway of
cell death in retinal degeneration.28,29 Cytochrome c
release from the mitochondria to nucleus would acti-
vate caspase 9 to facilitate the formation of apopto-
some complex.30 As an apoptotic executor, caspase 3
activates DNA fragmentation factors, which in turn
activate endonucleases to cleave nuclear DNA, ulti-
mately resulting in cell death.31 Our data showed that
Zhang et al. 297

Figure 4. THC treatment increased ER stress in retinas of BALB/c mice. BALB/c mice were treated with THC at 1 or 2
mg/kg (n ¼ 10) by intraperitoneal injection daily, mice treated with vehicle (n ¼ 10) as negative control. Mice were
euthanized after 2 months and retinas were harvested for the following assays. ER stress was evaluated by examining ER
stress-related proteins (GRP78, ATF6, and p-IRE1a) and their mRNA expression through Western blot (a) and real-time
PCR (b). Data were expressed as mean + SD. *p < 0.05, **p < 0.01 versus vehicle group. THC: tetrahydrocannabinol; ER:
endoplasmic reticulum; GRP78: glucose-regulated protein 78 kDa; ATF6: activating transcription factor 6; IRE1a: inositol-
requiring enzyme 1a; PCR: polymerase chain reaction.

apoptotic cells significantly increased after THC
treatment and this is the first report that apoptosis was
induced in retinas after 2-month of daily THC systema-
tic administration. Furthermore, THC treatment
increased cytochrome c release and caspase 3/caspase
9 activities. Antiapoptotic protein expression decreased
but proapoptotic protein expression increased.
Oxidative stress plays a pivotal role in the mode
of action of “ecstasy” through affecting various
biological macromolecules and cellular func-
tion.32,33 A high content of polyunsaturated fatty
acids are found in retinas, which is particularly
susceptible to ROS.34
MDA is well-known as a widely used marker for
oxidative damage and resultant thiobarbituric acid
reactive substances, which are proportional to lipid
peroxidation and oxidative stress.35 Importantly,
intracellular antioxidants limiting oxidative damage
caused by ROS, SOD, and GSH constitute a first-
line defense system in cells. The depletion of GSH
and the decreased activities of SOD compromise cel-
lular defense pathway. In this study, THC treatment
resulted in the depletion of GSH and decrease of SOD
activity, together with markedly increase of MDA and
protein expression of NADPH oxidase 4, a major
enzyme responsible for the production of superoxide
by transferring electrons across the membrane from
NAD(P)H to molecular oxygen,36 in retinas of mice,
suggesting THC systematic treatment caused oxida-
tive stress.
Protein misfolding in the ER causes the pathogen-
esis of many diseases, and activation of the unfolded
protein response leads to oxidative stress and resul-
tantly apoptosis.37 ER stress has been established as a
pathogenic factor contributing to photoreceptor cell
death.38 Chronic ER stress promotes inflammatory
responses through activating NF-kB and mitogen-
activated protein kinase (MAPK) pathway to induce
autophagy and apoptosis.39–41 In this study, THC
treatment upregulated the expression of GRP78,
ATF6, and IRE1a, indicating THC at least partially
caused retinal damage through inducing ER stress.
Inflammatory response has been considered as a
possible factor in the pathogenesis of retinal degen-
eration. During chronic inflammation, intracellular
responsive cascades such as NF-kB and MAPKs
become activated, increasing expression of pro-
inflammatory products, including IL-1b, IL-6,
TNF-a, and COX-2, as well as genes responsible
for regulating cell survival and growth.42,43 Over-
production of pro-inflammatory factors stimulates
the production of oxidants with subsequent peroxi-
dative damage to biological macromolecules, caus-
ing intracellular toxic events. 44 Studies have
demonstrated that the levels of pro-inflammatory
cytokines and chemokines were substantially
298 Human and Experimental Toxicology 39(3)

Figure 5. THC treatment induced inflammatory responses in retinas of BALB/c mice. BALB/c mice were treated with
THC at 1 or 2 mg/kg (n ¼ 10) by intraperitoneal injection daily, mice treated with vehicle (n ¼ 10) as negative control.
Mice were euthanized after 2 months and retinas were harvested for the following assays. THC treatment promoted
inflammatory responses, evidenced by the increase of pro-inflammatory factors: NO (a), IL-1b (b), IL-6 (c), and TNF-a (d).
THC treatment increased mRNA expression of pro-inflammatory factors (e) and the protein expression of p-P38 and NF-
kB (f). Data were expressed as mean + SD. *p < 0.05, **p < 0.01 versus vehicle group. THC: tetrahydrocannabinol; NO:
nitric oxide.

increased in the retinas of retina-degenerated mice
and these events preceded the photoreceptor cell
loss.45,46 NF-kB has been considered as a prototy-
pical pro-inflammatory signaling pathway.47 Addi-
tionally, the p38 MAPK pathway is associated with
several inflammatory diseases such as Alzheimer’s
disease, rheumatoid arthritis, and inflammatory
bowel disease.48 Our results indicated that THC
treatment increased the gene expression of NOS,
IL-1b, IL-6, and TNF-a and, consequently,
increased their levels in the retinas, through activat-
ing MAPK and NF-kB pathways.
Zhang et al.
In conclusion, our data demonstrated that systemic
administration with THC caused retina damage in
BALB/c mice through promoting inflammatory
response and increasing oxidative stress, providing
scientific rationale for the retina damage caused by
the cannabis abuse and potential for harm to many
more users.
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest
with respect to the research, authorship, and/or publication
of this article.
Funding
The author(s) disclosed receipt of the following financial
support for the research, authorship, and/or publication of
this article: This work was supported by the Health and
Family Planning Commission of Heilongjiang province
(Grant No. 2016-014).
ORCID iD
X Zhang https://orcid.org/0000-0002-7466-0410
References
1. Curran HV, Freeman TP, Mokrysz C, et al. Keep off
the grass? Cannabis, cognition and addiction. Nat Rev
Neurosci 2016; 17: 293–306.
2. Steel RWJ, Miller JH, Sim DA, et al.
Delta-9-tetrahydrocannabinol disrupts hippocampal
neuroplasticity and neurogenesis in trained, but not
untrained adolescent Sprague-Dawley rats. Brain Res
2014; 1548: 12–19.
3. Panlilio LV and Justinova Z. Preclinical studies of
cannabinoid reward, treatments for cannabis use dis-
order, and addiction-related effects of cannabinoid
exposure. Neuropsychopharmacology 2018; 43:
116–141.
4. Crandall J, Matragoon S, Khalifa YM, et al. Neuropro-
tective and intraocular pressure-lowering effects of
(-)Delta9-tetrahydrocannabinol in a rat model of
glaucoma. Ophthalmic Res 2007; 39: 69–75.
5. Isbell H, Gorodetzsky CW, Jasinski D, et al. Effects
of (–)delta-9-trans-tetrahydrocannabinol in man.
Psychopharmacologia 1967; 11: 184–188.
6. Tart CT. Marijuana intoxication common experiences.
Nature 1970; 226: 701–704.
7. Dougherty DM, Mathias CW, Dawes MA, et al. Impul-
sivity, attention, memory, and decision-making among
adolescent marijuana users. Psychopharmacology
(Berl) 2013; 226: 307–319.
299
8. Schweinsburg AD, Brown SA and Tapert SF. The
influence of marijuana use on neurocognitive function-
ing in adolescents. Curr Drug Abuse Rev 2008; 1:
99–111.
9. Gonzalez R, Schuster RM, Mermelstein RJ, et al. Per-
formance of young adult cannabis users on neurocog-
nitive measures of impulsive behavior and their
relationship to symptoms of cannabis use disorders.
J Clin Exp Neuropsychol 2012; 34: 962–976.
10. Straiker AJ, Maguire G, Mackie K, et al. Localization
of cannabinoid CB1 receptors in the human anterior
eye and retina. Invest Ophthalmol Vis Sci 1999; 40:
2442–2448.
11. Howlett AC and Abood ME. CB1and CB2Receptor
pharmacology. Adv Pharmacol 2017; 80: 169–206.
12. Czlonkowska A and Kurkowska-Jastrzebska I. Inflam-
mation and gliosis in neurological diseases-clinical
implications. J Neuroimmunol 2011; 231: 78–85.
13. Laaris N, Good CH and Lupica CR. Delta9-
tetrahydrocannabinol is a full agonist at CB1 receptors
on GABA neuron axon terminals in the hippocampus.
Neuropharmacology 2010; 59: 121–127.
14. Clark KH, Wiley CA and Bradberry CW. Psychosti-
mulant abuse and neuroinflammation: emerging evi-
dence of their interconnection. Neurotox Res 2013;
23: 174–188.
15. Kang K, Tarchick MJ, Yu X, et al. Carnosic acid slows
photoreceptor degeneration in the Pde6brd10 mouse
model of retinitis pigmentosa. Sci Rep 2016; 6:
22632–22642.
16. Kang K and Yu MZ. Protective effect of sulforaphane
against retinal degeneration in the Pde6rd10 mouse
model of retinitis pigmentosa. Curr Eye Res 2017;
42: 1684–1688.
17. Yu MZ, Kang K, Bu P, et al. Deficiency of CC che-
mokine ligand 2 and decay-accelerating factor causes
retinal degeneration in mice. Exp Eye Res 2015; 138:
126–133.
18. Fischer AH, Jacobson KA, Rose J, et al. Hematoxylin
and eosin staining of tissue and cell sections. CSH
Protoc 2008; 2008: pdb.prot4986.
19. Schmölz L, Wallert M and Lorkowski S. Optimized
incubation regime for nitric oxide measurements in
murine macrophages using the Griess assay. J Immunol
Methods 2017; 449: 68–70.
20. Lee AS. The ER chaperone and signaling regulator
GRP78/BiP as a monitor of endoplasmic reticulum
stress. Methods 2005; 35: 373–381.
21. Sano R and Reed JC. ER stress-induced cell death
mechanisms. Biochim Biophys Acta 2013; 1833:
3460–3470.
300
22. Wilkinson ST. Medical and recreational marijuana:
commentary and review of the literature. Mo Med
2013; 110: 524–528.
23. Nestor L, Roberts G, Garavan H, et al. Deficits in
learning and memory: parahippocampal hyperactivity
and frontocortical hypoactivity in cannabis users.
Neuroimage 2008; 40: 1328–1339.
24. Solowij N, Jones KA, Rozman ME, et al. Verbal learn-
ing and memory in adolescent cannabis users, alcohol
users and non-users. Psychopharmacology (Berl)
2011; 216: 131–144.
25. Yazulla S. Endocannabinoids in the retina: from
marijuana to neuroprotection. Prog Retin Eye Res
2008; 27: 501–526.
26. Mantilla-Plata B and Harbison RD. Distribution studies
of [14C]delta-9-tetrahydrocannabinol in mice: effect of
vehicle, route of administration, and duration of treat-
ment. Toxicol Appl Pharmacol 1975; 34: 292–300.
27. Wiley JL, Lefever TW, Glass M, et al. Do you feel it
now? Route of administration and D9-tetrahydrocanna-
binol-like discriminative stimulus effects of synthetic
cannabinoids in mice. Neurotoxicology 2019; 73:
161–167.
28. Marigo V. Programmed cell death in retinal degenera-
tion: targeting apoptosis in photoreceptors as potential
therapy for retinal degeneration. Cell Cycle 2007; 6:
652–655.
29. Portera-Cailliau C, Sung CH, Nathans J, et al.
Apoptotic photoreceptor cell death in mouse models
of retinitis pigmentosa. Proc Natl Acad Sci USA 1994;
91: 974–978.
30. Wang Z, Lu W, Li Y, et al. Alpinetin promotes Bax
translocation, induces apoptosis through the mitochon-
drial pathway and arrests human gastric cancer cells at
the G2/M phase. Mol Med Rep 2013; 7: 915–920.
31. Xin BR, Liu JF, Kang J, et al. (2R, 3S)-pinobanksin-3-
cinnamate, a new flavonone from seeds of Alpinia
galanga willd., presents in vitro neuroprotective
effects. Mol Cell Toxicol 2014; 10: 165–172.
32. Wang X and Michaelis EK. Selective neuronal vulner-
ability to oxidative stress in the brain. Front Aging
Neurosci 2010; 2: 12–25.
33. Adibhatla RM and Hatcher JF. Lipid oxidation and
peroxidation in CNS health and disease: from molecu-
lar mechanisms to therapeutic opportunities. Antioxid
Redox Signal 2010; 12: 125–169.
34. Kagan VE, Shvedova AA, Novikov KN, et al.
Free-radical oxidation of photoreceptor membrane
lipids. Doklady Akademii Nauk SSSR 1973; 210:
1208–1210.
Human and Experimental Toxicology 39(3)
35. Xiao X, Liu J, Hu J, et al. Protective effects of proto-
pine on hydrogen peroxide-induced oxidative injury of
PC12 cells via Ca 2þ antagonism and antioxidant
mechanisms. Eur J Pharmacol 2008; 591: 21–27.
36. Bedard K and Krause KH. The NOX family of
ROS-generating NADPH oxidases: physiology and
pathophysiology. Physiol Rev 2007; 87: 245–313.
37. Malhotra JD, Miao H, Zhang K, et al. Antioxidants
reduce endoplasmic reticulum stress and improve
protein secretion. Proc Natl Acad Sci USA 2008;
105: 18525–18530.
38. Salminen A, Kauppinen A, Hyttinen JM, et al. Endo-
plasmic reticulum stress in age-related macular degen-
eration: trigger for neovascularization. Mol Med 2010;
16: 535–542.
39. Hotamisligil GS. Endoplasmic reticulum stress and the
inflammatory basis of metabolic disease. Cell 2010;
140: 900–917.
40. Kim DS, Kim JH, Lee GH, et al. p38 mitogen-activated
protein kinase is involved in endoplasmic reticulum
stress-induced cell death and autophagy in human gin-
gival fibroblasts. Biol Pharm Bull 2010; 33: 545–549.
41. Mishra R and Karande AA. Endoplasmic reticulum
stress-mediated activation of p38 MAPK, Caspase-2
and Caspase-8 leads to abrin-induced apoptosis. PLoS
One 2014; 9: e92586.
42. Karin M and Lin A. NF-kappaB at the crossroads of
life and death. Nat Immunol 2002: 3: 221–227.
43. Marcu KB, Otero M, Olivotto E, et al. NF-kappaB
signaling: multiple angles to target OA. Curr Drug
Targets 2010; 11: 599–613.
44. Leuner K, Pantel J, Schindowski K, et al. Enhanced
apoptosis, oxidative stress and mitochondrial dysfunc-
tion in lymphocytes as potential biomarkers for Alz-
heimer’s disease. J Neural Transm Suppl 2007;
207–215.
45. Yoshida N, Ikeda Y, Notomi S, et al. Clinical evidence
of sustained chronic inflammatory reaction in retinitis
pigmentosa. Ophthalmology 2013; 120: 100–105.
46. Yoshida N, Ikeda Y, Notomi S, et al. Laboratory evi-
dence of sustained chronic inflammatory reaction in
retinitis pigmentosa. Ophthalmology 2013; 120: e5–e12.
47. Lawrence T. The nuclear factor NF-kB pathway in
inflammation. Cold Spring Harb Perspect Biol 2009;
1: a001651.
48. Acharyya S, Villalta SA, Bakkar N, et al. Interplay of
IKK/NF-kappaB signaling in macrophages and myofi-
bers promotes muscle degeneration in duchenne mus-
cular dystrophy. J Clin Invest 2007; 117: 889–901.