Fish and Shellfish Immunology 120 (2022) 155–165

Contents lists available at ScienceDirect

Fish and Shellfish Immunology

journal homepage: www.elsevier.com/locate/fsi

A synbiotic containing prebiotic prepared from a by-product of king oyster

mushroom, Pleurotus eryngii and probiotic, Lactobacillus plantarum
incorporated in diet to improve the growth performance and health status
of white shrimp, Litopenaeus vannamei
Estuningdyah Prabawati a, b, Shao-Yang Hu a, c, 1, Shieh-Tsung Chiu d, Rolissa Balantyne e,
Yenny Risjani b, Chun-Hung Liu c, d, *
a
Department of Biological Science and Technology, National Pingtung University of Science and Technology, Pingtung, Taiwan
b
Faculty of Fisheries and Marine Science, University of Brawijaya, Malang, 65145, Indonesia
c
Research Center for Animal Biologics, National Pingtung University of Science and Technology, Pingtung, Taiwan
d
Department of Aquaculture, National Pingtung University of Science and Technology, Pingtung, Taiwan
e
Department of Tropical Agriculture and International Cooperation, National Pingtung University of Science and Technology, Pingtung, Taiwan

A R T I C L E I N F O A B S T R A C T

Keywords: This study aimed to evaluate the effects of a synbiotic composite an extract from a by-product of king oyster
White shrimp mushroom, Pleurotus eryngii (KOME), and probiotic Lactobacillus plantarum 7–40 on the growth performance and
King oyster mushroom health status of white shrimp, Litopenaeus vannamei. The KOME was able to stimulate the growth of probiotic, but
By-product
not the growth of Vibrio pathogens, including V. alginolyticus, V. parahaemolyticus, and V. harveyi. Four diets were
Growth performance
Heath status
formulated, including a control diet supplemented without prebiotic and probiotic, a basal diet supplemented
Circular economy with KOME (5 g kg− 1) (ME), a basal diet supplemented with probiotic (1 × 108 CFU kg− 1) (LP), and a basal diet
supplemented with KOME (5 g kg− 1) and probiotic (1 × 108 CFU kg− 1) (SYN). Shrimp fed the ME, LP, and SYN
diets had significantly higher survival than that of shrimp fed with the control diet for 8 weeks. Shrimp in the
SYN group also had a significantly higher weight gain and total final weight in comparison with the control and
other treatments. In the intestinal tract, lactic acid bacteria count was significantly higher in the SYN group,
whereas the Vibrio-like bacteria count was significantly higher in the ME group than in the control group. For the
health status assessment, the disease resistance of shrimp against V. alginolyticus was improved in all treatments
compared to the shrimp in control. Shrimps in the SYN group had significantly lower cumulative mortality due to
the significant increase in immune responses, including phenoloxidase, respiratory burst, and lysozyme activity,
and the gene expression of pexn and pen4 in the haemocytes, and lgbp, sp, propoii, pexn, pen3a, pen4, and gpx in
the haepatopancreas of shrimp as compared to the control. Therefore, it is suggested that a combination of KOME
and probiotics can be used as a synbiotic to improve the growth performance and reduce the risk of infectious
diseases caused by Vibrio and at the same time significantly contribute to the circular economy.

1. Introduction
The pacific white shrimp (Litopenaeus vannamei) is one of the sig­
nificant productive crustaceans in the aquaculture industry. According
to FAO [1], white shrimp is approximately 52.9% of crustaceans pro­
duced in aquaculture worldwide. The aquaculture industry is over­
whelmed by diseases caused by bacteria, viruses, fungi, and parasites.
Thus, there are increasing concerns and challenges associated with
disease control [2]. The emergence of vibriosis continues to threaten
shrimp production worldwide, causing mass mortality [3] that result in
severe economic losses [4]. Farmers have used antibiotics to prevent
disease outbreaks for decades. However, the inappropriate use of anti­
biotics to prevent disease outbreaks exerted undesirable side effects that
generate antibiotic-resistant strains of bacteria and leads to the

* Corresponding author. Department of Aquaculture, National Pingtung University of Science and Technology , Pingtung, 91201, Taiwan.
E-mail address: chliu@mail.npust.edu.tw (C.-H. Liu).
1
Professor Shao-Yang Hu (equal contribution as the 1st author).

https://doi.org/10.1016/j.fsi.2021.11.031
Received 31 October 2021; Received in revised form 19 November 2021; Accepted 20 November 2021
Available online 22 November 2021
1050-4648/© 2021 Published by Elsevier Ltd.
E. Prabawati et al.
accumulation of antibiotic residues in aquaculture products [5].
Several alternatives such as probiotics, prebiotics, or synbiotics have
been used as sustainable practices to control disease in shrimp aqua­
culture. Prebiotics is a non-digestible food component that acts as a
substrate that remains intact as it passes through the gastrointestinal
tract and is selectively utilized by host intestinal microbiota, thus
enhancing the growth and metabolism of beneficial bacteria, improving
the digestion of nutrients, and stimulating the immune response of the
host [6–8]. Risjani et al. [9] indicated an increase in white shrimp health
status after being administered with polysaccharides. Probiotics refer to
a live microorganism that could confer a beneficial effect when
administered into a host in adequate doses [10]. Recently, studies about
the synbiotic application as a nutritional feed supplement in aquaculture
have received much attention. Synbiotic is the combination of in­
gredients that exerts more benefits than those obtained from an indi­
vidual ingredient [11]. Synbiotics have proven their ability to promote
growth performance, improve immune response against pathogen and
enhance intestinal health of aquatic organisms [12–14].
Mushroom has been consumed for decades either as healthy nutri­
tional food or as a medicine because of significant antioxidant, anti-
inflammatory, anti-tumor, and immune-stimulating activities that ben­
efits the host or can be used as a synthetic antimelanosic agents to inhibit
postmortem melanosis in shrimp [15–17]. The king oyster mushroom,
Pleurotus eryngii has an extensive enzyme system capable of utilizing
complex organic compounds, usually found in agricultural wastes or
industrial by-products. In nature, they live on plants deficient in nutri­
ents and vitamins [18,19]. Lately, the consumption demand for mush­
rooms has increased due to their beneficial effects. In line with the
increase in mushroom production, many by-products are generated from
mushrooms’ stipe, caps, and rejected mushrooms that fail to meet re­
tailers’ specifications. These by-products are deemed highly nutritious
[20,21]. According to a report by Synytsya et al. [22] and Kim et al.
[23], Pleurotus species are rich in non-digestible oligosaccharides such as
β-glucan, xylose, fructose, mannose, glucose, sucrose, and trehalose. Due
to the abundance of bioactive components, these mushrooms can be
used as potential prebiotic agents that could promote the growth of
beneficial probiotic bacteria and modulate the immune system of hosts
[24–27].
Lactobacillus plantarum is a gram-positive, rod-shaped bacterium and
a proven probiotic agent in the aquaculture industry. Several studies
reported that the supplementation of Lac. plantarum in the diet increased
the activity of the digestive enzymes, improved the host growth per­
formance, and inhibited pathogenic bacteria adhesion and growth,
thereby improving the host immunity, disease resistance, and survival
[28,29]. Numerous reports regarding the use of Lac. plantarum as pro­
biotic agents have been established in aquatic animals such as (Acan­
thopagrus schlegelii) [30], crayfish (Cherax cainii) [31], olive flounder
(Paralichthys olivaceus) [32], and white shrimp (L. vannamei) [14].
Huynh et al. [14] previously reported that the dietary administration
of synbiotic with pure galactooligosaccharides as a prebiotic signifi­
cantly proliferated the growth of Lac. plantarum 7–40. Moreover, shrimp
fed the synbiotic diet showed substantial improvement in the growth
performance, disease resistance, and immune system than individual
application. However, obtaining pure polysaccharides is more expensive
as compared to the prebiotic prepared from agriculture by-products.
Therefore, using agriculture by-products as a cost-effective and poten­
tial material to produce a synbiotic composed of prebiotic mushroom
stalk needs further exploration.
Although there are many studies regarding synbiotic effects, there
are no reports on combining extract derived from mushroom by-
products with a probiotic in aquaculture. Therefore, this study evalu­
ates the ability of by-product extract from king oyster mushroom to
enhance the Lac. plantarum 7–40 efficiency and accelerate white
shrimp’s growth performance and health status.
156
Fish and Shellfish Immunology 120 (2022) 155–165
2. Materials and methods
2.1. King oyster mushroom extract (KOME) preparation
After harvesting king oyster mushroom, the residual parts (including
the bottom of the stem and volva) were extracted and prepared using a
hot-water method Yap and Ng [33] with slight modification. The re­
sidual parts of mushroom were collected from a private mushroom farm
in Chiayi country, Taiwan. After sawdust removal, 500 g of mushroom
residue was cut into pieces and blended with 1000 ml distilled water.
Then, the mixture was poured into 2000 ml glass beaker and tightly
covered with aluminum foil, and boiled for 15 min. After cooling down
to room temperature, the mixture was centrifuged at 14,400×g for 20
min at 4 ◦ C to remove any insoluble particles, and the supernatant was
reserved. The resulting supernatant was then boiled for 15 min and left
to cool down to room temperature. The water extract was stored at 4 ◦ C
until use.
2.2. Probiotic preparation
The probiotic strain used in this study was Lac. plantarum 7–40 [14],
which was cultured in De Man, Rogosa and Sharpe (MRS) agar (DifcoTM
Laboratories, Sparks MD, USA) for 24 h at 37 ◦ C. A single colony was
transferred in MRS broth medium and incubated for 24 h at 37 ◦ C. Then,
probiotic was centrifuged at 2,840×g for 20 min at 4 ◦ C. The pellet was
then dissolved in 100 ml of 10% skim milk and stored at − 20 ◦ C until
use. The viability of the probiotic was determined by using the
pour-plate method before preparing experimental diets.
2.3. Experimental design
The study was conducted in two stages; first, to evaluate KOME as a
growth medium for the probiotic, Lac. plantarum 7–40 and pathogenic
bacteria, including V. alginolyticus, V. parahaemolyticus, and V. harveyi;
and second to prepare a synbiotic diet containing prebiotic, KOME and
Lac. plantarum 7–40 to evaluate its efficiency in the improvement of
growth and health status of white shrimp. The four experimental diets
were used, including a control diet without probiotic and KOME, and the
ME diets supplemented with KOME at a concentration of 5 g kg− 1, LP
diet supplemented with Lac. plantarum 7–40 at a level of 1 × 108 CFU
kg− 1, and SYN diet combined with KOME at a concentration of 5 g kg− 1
and Lac. plantarum 7–40 at a level of 1 × 108 CFU kg− 1, respectively.
Before the growth trial, the level of probiotic in this experimental diets
was evaluated according to Huynh et al. [13]. The growth trail was
carried out for 8 weeks. At the end of the growth trial, the immune status
and disease resistance of shrimp were evaluated.
2.4. Bacteria growth stimulated by KOME
Bacterial growth of Lac. plantarum 7-40, V. harveyi,
V. parahaemolyticus, and V. alginolyticus in KOME were evaluated. Pro­
biotic and pathogens were inoculated in MRS agar for 24 h at 37 ◦ C and
in tryptic soy agar with 1.5% NaCl (BactoTM Laboratories, Sparks, MD,
USA) for 24 h at 27 ◦ C. A single colony from probiotic and Vibrio plates
was then transferred into 20 ml of MRS broth and tryptic soy broth (TSB)
with 1.5% NaCl, respectively, at the conditions described above. After
24 h of culture, each bacteria was adjusted to ~1 × 109 CFU ml-1 as stock
solutions. Two hundred microliter of each stock solution was then
individually transferred to 20 ml of KOME and incubated at the above
conditions. The experiment was conducted in triplicates. Bacterial
growth was then measured at the beginning, then at 6, 12, and 24 h after
being cultured in KOME by pour plate method in MRS agar at 37 ◦ C for
Lac. plantarum 7–40) or spread plate method on tryptone soy agar (TSA)
with 1.5% NaCl at 27 ◦ C for Vibrios. All bacterial colonies that appeared
in the plates were counted after 24–48 h of incubation.
E. Prabawati et al. Fish and Shellfish Immunology 120 (2022) 155–165

2.5. Growth trial changed once every 2 weeks after shrimp weight measurement.
Ammonia-N and nitrite-N were determined based on the methods of
2.5.1. Experimental diet preparation Bower and Bidwell [36] and Bendschneider and Robinson [37],
Four experimental diets as mentioned above were formulated and respectively. At the end of growth trial, all shrimp were harvested and
shown in Table 1. The dry ingredients were weighed and ground in a weighed, and the parameters of growth performance were calculated as
feed grinder mill and sieved to avoid lumps. The well-sieved ingredients follows:
were placed into a stand mixer and stirred thoroughly. Then, fish oil and
Weight gain (g) = (final weight – initial weight) × 100;
water were added gradually into the mixture to form a stiff dough. Feed
pellets were made at a diameter of 1.3 mm using a pelletizer and then Survival (%) = (final shrimp number/initial shrimp number) × 100%;
dried at room temperature to a moisture level of <10%. The feed was
placed into zip-locked bags and stored at 4 ◦ C until use. Before growth Specific growth rate (% day− 1) = (ln final weight - ln initial weight) × 100 /
trial, the experimental diets were analyzed respectively for the probiotic days; and
viability and proximate compositions. The pour-plate method was used
Feed efficiency = (total weight gain / total feed intake).
to determine the viability of bacteria in the experimental diets. Crude
protein of the feed was analyzed by the Kjeldahl method using Kjeltec
System from Tecator (Höganäs, Sweden). Crude lipids were determined
using the method of Holman et al. [34]. A moisture analyzer (MX-50,
2.6. Gut lactic acid bacteria count and Vibrio-like count
A&D, Tokyo, Japan) was used for moisture analysis. The ash content
were measured according to the method described by Liu [35].
At the end of growth trial, six shrimp at intermoult stage were
starved for 24 h, to assess the lactic acid bacteria (LABs) count and
2.5.2. Shrimp rearing
Vibrio-like (VCBs) count. Whole intestine of shrimp was dissected,
Shrimp were selected from the culture pond at a farm at the
weighed and homogenized in sterile saline (0.85% NaCl) in a 1.5 ml
Department of Aquaculture, National Pingtung University of Science
tube. Following this step, a total of 100 μl solution was pipetted and
and Technology, Pingtung, Taiwan, and acclimatized in a cement tank
spread on plates to determine bacterial count. Each sample was analyzed
(6 × 2 × 1 m) with 25‰ brackish water. During the 7-days acclimati­
in triplicate. The MRS agar supplemented with 0.2% CaCO3 was used to
zation, shrimp were fed with the control diet to apparent satiation.
determine the presumptive LABs and incubated at 37 ◦ C for 48 h. The
After acclimatization, 360 shrimp (initial weight: 0.37 ± 0.02 g)
VCBs were determined using thiosulphate citrate bile-salt sucrose
were randomly assigned to rectangular cages (120 × 40 × 80 cm) placed
(TCBS) agar and incubated at 27 ◦ C for 24 h. The LABs colonies were
in a cement tank (6 × 2 × 1 m). Each treatment was carried out in
identified by clearing zone appearance. The VCBs colonies that appeared
triplicate with 30 shrimp in each. During the growth trial, water salinity
on the TCBS were counted.
was maintained at 25‰ and aeration was supplied continuously using
air stones to keep dissolved oxygen (DO) at ≥5 mg L− 1. Shrimps were fed
with experimental diets at a ratio 6% of their body weight and three 2.7. Health status assessment
times daily at 8:30, 12:00, and 15:00, respectively. Uneaten feed was
siphoned 1h after feeding, then dried, and weighed to calculate the total After final weight measurement, shrimp were starved for 24 h, and
feed intake. Shrimps were weighed biweekly, and the daily feed rations then sampled for the assessments of health status, including challenge
were adjusted. In order to maintain the water quality, 1/3 water was test with the pathogen, V. alginolyticus, analysis of immune status (im­
mune parameters and immune related gene expressions). Only shrimp at
intermoult stage were used in this trial.
Table 1
Ingredients and proximate compositions of experimental diets. 2.7.1. Challenge test
Ingredients Experimental diets (g kg− 1) Challenge test with pathogen, V. alginolyticus [38] was done to assess
Control LP ME SYN shrimps’ resistance to disease after being fed with different experimental
diets for 8 weeks. V. alginolyticus was inoculated in TSA supplemented
Fish meal 405 405 405 405
Soybean meal 300 300 300 300
with 1.5% NaCl for 24 h at 27 ◦ C. The cultured bacteria was then
Squid meal 50 50 50 50 transferred to 50 ml of TSB supplemented with 1.5% NaCl medium and
α-starch 150 150 150 150 placed in the shaker at 100 rpm for 24 h at 27 ◦ C as the stock culture.
Vit. Mixa 20 20 20 20 Bacteria was centrifuged for 5 min at 6,400×g at 4 ◦ C. The supernatant
Min. Mixa 40 40 40 40
was discarded, and the pellets were washed with saline solution (0.85%
Fish oil 29 29 29 29
Probiotic (10⁸ CFU g− 1) 0 1 0 1 NaCl) then centrifuge again. The pellets were re-suspended in saline
Skim milk 1 0 1 0 solution, and the was adjusted spectrophotometrically to 3 × 107 CFU
Cellulose 5 5 0 0 ml− 1 by measuring O.D. at 490 nm (O.D. = 1 is ~109 CFU ml− 1).
KOMEb 0 0 5 5 The challenge test was conducted in triplicates and 10 shrimp per
Proximate composition
Crude protein (%, dry 40.87 ± 40.63 ± 40.5 ± 40.62 ±
replicate. Shrimp from the control group injected with saline (0.85%
weight) 0.54 0.12 0,07 0.14 NaCl) served as unchallenge control. The bacteria suspension was
Crude lipid (%, dry 8.48 ± 8.60 ± 8.78 ± 8.49 ± injected into the ventral sinus at a dosage of 1.5 × 105 CFU g− 1 shrimp.
weight) 0.87 0.48 0.43 0.33 Shrimp was then kept in a 30L glass aquarium containing 20L of 25‰
Ash (%, dry weight) 13.44 ± 13.47 ± 13.32 ± 13.7 ±
brackish water and equipped with aeration. During the trials, 1/3 water
0.02 0.03 0.11 0.02
Moisture (%, dry 7.49 ± 7.8 ± 0.08 7.31 ± 7.36 ± was renewed once daily, and the mortality was recorded every day.
weight) 0.05 0.01 0.08
2.7.2. Immune responses
LP: basal diet supplemented with L. plantarum 7–40; ME: basal diet supple­
mented with king oyster mushroom extract (KOME); SYN: basal diet supple­ The immune responses of the shrimp included total haemocyte count
mented with a mixture of L. plantarum 7–40 and KOME. (THC), phenoloxidase activity (PO), respiratory bursts (RBs), superoxide
a
Vitamin and mineral premix as given in Cheng et al. [39]. dismutase (SOD) activity, lysozyme (LYZ) activity, and phagocytosis
b
The concentration of KOME was 0.5% in dry weight. Therefore, 100 ml of activity (PA). A total of 12 shrimp of each group were assayed. Six of the
KOME was added for 1 kg ME and SYN diet preparation. selected shrimps was use to measure THC, PO, RBs, SOD, and LYZ of

157
E. Prabawati et al.
haemocytes, and the other six was use to measure PA.
2.7.2.1. Haemolymph. Haemolymph was withdrawn from the ventral
sinus of shrimp and then mixed evenly with anticoagulant solution (30
mM trisodium citrate, 0.34 M NaCl, and 10 mM EDTA, at pH 7.55, with
osmolality adjusted to glucose up to 780 mOsm kg− 1) at a ratio of 1:9 in
pre-cold tubes.
2.7.2.2. THC. Diluted haemolymph was loaded into haemocytometer
and the haemocyte in both top and bottom cell count chambers was
counted under an inverted phase-contrast microscope (Leica, DMIL,
Leica Microsystem, Wetzlar, Germany).
2.7.2.3. PO activity. PO activity was measured spectrophotometrically
using the method of Cheng et al. [39]. Diluted haemolymph was
centrifuged for 20 min at 490×g at 4 ◦ C, and the supernatant was dis­
carded. A total of 450 μl of cacodylate-citrate buffer (10 mM sodium
cacodylate, 450 mM sodium chloride, and 100 mM trisodium citrate; pH
7.0) was added into the tube and centrifuge again for 20 min at 490×g at
4 ◦ C and the supernatant was removed. Then, 200 μl of cacodylate buffer
(10 mM sodium cacodylate, 450 mM sodium chloride, 10 mM calcium
chloride, and 260 mM magnesium chloride; pH 7.0) was added, and the
cell suspension was separated into two tubes with 100 μl in each.
Trypsin solution (50 μl; 1 mg ml− 1) was used as elicitor to active PO, and
50 μl of cacodylate buffer was used to replace trypsin solution as a blank.
The mixtures were then incubated for 10 min at room temperature, after
which 50 μl of L-DOPA was then added and allowed to react for 5 min.
After that, a total of 800 μl of cacodylate buffer was added to each tube.
The PO activity was analyzed spectrophotometrically (Jasco V-630,
Hachioji, Tokyo, Japan) at an optical density of 490 nm.
2.7.2.4. RBs assay. RBs of haemocyte was evaluated based on reduction
of nitro blue tetrazolium (NBT) to formazan caused by superoxide anion
(O2− ) [40]. Diluted haemolymph (100 μl) was loaded into 96-well plate
previously coated with poly-L-lysine solution to improve cell adhesion.
The plate were then centrifuged for 20 min at 300×g at 4 ◦ C, and the
supernatant was discarded. A zymogen solution (100 μl) was added and
allowed to react for 30 min at room temperature. In addition, a 100 μl
modified complete Hank’s balanced salt solution (MCHBSS) was added
to serve as a blank and incubated for 30 min at room temperature. After
reaction, the suspension was discarded, and haemocytes were washed
three times with 100 μl MCHBSS. Thereafter, the 0.3% NBT solution
(100 μl) was immediately added and allowed to react for 30 min at room
temperature to form the formazan. The NBT solution was discarded and
the haemocytes were fixed and washed three time using 200 μl absolute
methanol, and 70% methanol, respectively, then dried. To dissolve the
insoluble formazan crystals formed by the reduction of NBT, 120 μl of 2
M KOH and 140 μl of dimethyl sulfoxide (DMSO) were used. The OD at
630 nm was measured in triplicate using a microplate spectrophotom­
eter (Spectramax® 190, Sunnyvale, CA, USA). On completion, RBs
measurement was calculated as RBA = stimulated O.D. (SA) - blank O.D.
(BA). SA is the RBs that generates due to the zymosan stimulation, and
BA is the RBs that generates without the zymosan stimulation.
2.7.2.5. SOD and LYZ assay. To assess the SOD and LYZ activities,
diluted haemolymph was centrifuged for 20 min at 490 Xg at 4 ◦ C, and
the supernatant was discarded. The pellet was then washed with PBS
solution (500 μl) and centrifuged again. After supernatant was dis­
carded, the resulting pellet was resuspended in 50 μl of PBS, and ho­
mogenized by using an ultrasonic reactor on ice and then centrifuged for
15 min at 17,600 Xg at 4 ◦ C. The supernatant used for the assessments of
SOD and LYZ activities was haemocyte lyzed solution (HLS).
SOD activity was evaluated using the method described by Beau­
champ and Fridovich [41] with minor modification. Using HLS, 10 μl
was mixed thoroughly mixed with 250 μl of PBS, 75 μl of methionine, 75
158
Fish and Shellfish Immunology 120 (2022) 155–165
μl of Na2 EDTA, 75 μl of NBT, and a 150 μl of Vit. B12, and then incu­
bated at room temperature for 10 min. Thereafter, 200 μl mixture was
transferred to a 96-well plate, and was measured using a microplate
spectrophotometer (Spectramax® 190, Sunnyvale, CA, USA) at an O.D.
560 nm. The SOD activity was expressed as U (g protein)− 1.
HLS (10 μl) was mixed with Micrococcus lysodeikticus (Sigma, St.
Louis, MO, USA) suspension (200 μl; 0.2 mg ml− 1 in 0.05 M sodium
phosphate buffer, pH 6.2). The mixture was determined at O.D. 530 nm
at 30 s and 4 min 30 s at 25 ◦ C. The unit of LYZ was defined as the
amount of enzyme-producing a decrease in absorbance of 0.01 min− 1,
and the specific activity was expressed as U (mg protein)− 1.
Total protein was quantified by the Bradford method, using a Bio-
Rad Protein assay kit (no. 500-0006, Bio-Rad Laboratories, Hercules,
CA, USA) with bovine serum albumin to make a standard curve.
2.7.2.6. PA analysis. Diluted haemolymph (100 μl of haemolymph
mixed with 900 μl of an anticoagulant) was loaded into a 24-well plate
and then centrifuged for 10 min at 490 × g at 4 ◦ C and incubated for 1 h
at room temperature. Thereafter, the supernatant was discarded, and a
fluorescent latex beads (L4655, Sigma) solution (300 μl; 105 beads in
PBS) was added and incubated for 40 min at room temperature. Wells
were washed with L-15, and 300 μl of paraformaldehyde (2%) was
added to fix haemocyte for 5 min. Following fixation, paraformaldehyde
solution was discarded, haemocyte was washed using L-15, and 300 μl of
0.1% propidium iodide was applied to stain the cells for 10 min at room
temperature. Wells were washed again with PBS and air-dried. Samples
were observed under a fluorescence microscope (Leica DMIL, Leica
Microsystems, Wetzlar, Germany). Phagocytic activity was expressed as:
PA (%) = (phagocytic haemocytes / total haemocytes) × 100
2.7.3. Expressions of immune related genes
Total ribonucleic acid (RNA) isolation of haemocyte and haepato­
pancrease were conducted by using the Rezol reagent (AMRESCO,
Solon, OH, USA) following the manufacturer’s instructions. RNA was
adjusted to the same concentration with diethylpyrocarbonate (DEPC)
water and accurately quantified with a spectrophotometer. For first-
strand complementary (c) DNA synthesis, 1 μg of total RNA from each
tissue was used with SuperScript II RNase H- reverse transcriptase
(Promega, Madison, WI, USA) to transcribe poly (A)+ RNA with oligo
d (T)18 as the primer following the conditions recommended by
manufacturers.
The assessment of immune-related gene expressions was carried out
using a real-time polymerase chain reaction (PCR) (ABI StepOne Real-
Time PCR System, Applied Biosystem, Carlsbad, CA, USA) with SYBR
green, and the primer pairs listed in Table 2. The amplification was
performed in a 96-well plate, and the reaction conditions were set up
according to the methods described by Chiu et al. [40]. For the
normalization of target gene expressions, an internal control gene,
β-actin, was used. Relative expression levels of target gene to the
reference gene were calculated using the 2− ΔΔCt method [42]. Results
are expressed as the mRNA expression relative to the control.
2.8. Statistical analysis
Statistical analysis was performed using SAS computer software vers.
9.4 (SAS Institute, Cary, NC, USA). The data were analyzed using a one-
way analysis of variance (ANOVA) to identify differences among groups.
A post hoc, Tukey’s multi-comparisons test was applied to examine
significant differences between treatments. p < 0.05 was considered
statistically significant.
E. Prabawati et al. Fish and Shellfish Immunology 120 (2022) 155–165

Table 2 Table 3
Primer used in this study. Growth performance of shrimp fed with the experimental diets for 8 weeks.
Genes Primers References
Values are presented as mean ± SE (n = 3). The values in the same row with
different letters are significantly different among groups (p < 0.05). SGR: spe­
lgbp F: 5 -CATGTCCAACTTCGCTTTCAGA-3
′ ′
[39] cific growth rate; FE: feed efficiency.
R: 5′ -ATCACCGCGTGGCATCTT-3′
sp F: 5′ -CGTCGTTAGGTTAAGTGCGTTCT-3′ [43] Parameters Treatments
R: 5′ -TTTCAGCGCATTAAGACGTGTT-3′ Control ME LP SYN
propoi F: 5′ -GCCTTGGCAACGCTTTCA-3′ [39]
R: 5′ -CGCGCATCAGTTCAGTTTGT-3′ Final weight (g) 4.92 ± 0.22a 4.92 ± 0.72a 4.81 ± 0.04a 5.75 ± 0.20a
propoii F: 5′ -GAGAGGCTGAACCGAGACTGA-3′ [39] Weight gain 1060.08 ± 1177.93 ± 1195.30 ± 1451.21 ±
R: 5′ -AAGAAAACGGCCCCCAATT-3′ (%) 60.5b 207.0ab 10.0ab 155.27a
pexn F: 5′ -TGGACCTCGCGGGAGAT-3′ [39] Total final 129.12 ± 142.23 ± 144.17 ± 172.65 ±
R: 5′ -GACCGATAGCCACCATGCTT-3′ weight (g) 6.73b 23.04ab 1.111ab 6.152a
alf1 F: 5′ -GTCAGCGGCCCTCCTTCT-3′ [44] SGR (% (d)− 1) 4.72 ± 4.86 ± 4.93 ± 5.27 ± 0.06a
R: 5′ -ACACCACATCCTGCATTGA-3′ 0.065a 0.274a 0.015a
alf2 F: 5′ -GCAACTGTACTTCAGGGGTCGCATG-3′ [45] Survival (%) 87.8 ± 1.35b 96.67 ± 100 ± 0.00a 100 ± 0.00a
R: 5′ -TGTGGGTGGGAGCGAAAGGGTTAGT-3′ 2.37a
crus F: 5′ - TGCTGGCCTCGATAAGTGTTG-3′ [46] FE 0.6 ± 0.014a 0.6 ± 0.052a 0.7 ± 0.009a 0.7 ± 0.07a
R: 5′ -GGAGGCTTGCACACGTGTT-3′
lyz F: 5′ -AACGTCTGCAAAATCCCATGT-3′ [47]
R: 5′ -CAGGGCCTCCGTGATATCA-3′ 3.3. LABs and VCBs content in shrimp intestine
pen3a F: 5′ - CACCCTTCGTGAGACCTTTG -3′ [48]
R: 5′ -AATATCCCTTTCCCACGTGAC-3′
LABs and VCBs contents in the shrimp intestine after feeding
pen4 F: 5′ -GCCCGTTACCCAAACCATC-3′ [49]
R: 5′ -CCGTATCTGAAGCAGCAAAGTC-3′ experimental diets are shown in Fig. 2. The SYN diet significantly
mnsod F: 5′ -TCATGCTTTGCCACCTCTC-3′ [50] increased the LABs count in the gut of shrimp as compared to the control
R: 5′ -CCGCTTCAACCAACTTCTTC-3′ (Fig. 2A). However, no significant difference in LABs content were
cat F: 5′ -TACTGCAAGTTCCATTACAAGACG-3′ [51] recorded among the control, ME and LP groups, or among ME, LP and
R: 5′ -GTAATTCTTTGGATTGCGGTCA-3′
gpx F: 5′ -TCGGCAAAGTCGACGTCAA-3′ [39]
SYN groups. The VCBs content was significantly altered in shrimp fed
R: 5′ -GCAGTCGCTCCTTCAGGTACTTA-3′ ME diet compared to other dietary treatments. There were no significant
β-actin F: 5′ -GAGCAACACGGAGTTCGTTGT-3′ [52] differences for VCBs count in the SYN treatment when compared to that
R: 5′ -CATCACCAACTGGGACGACATGGA-3′ of shrimp fed with the control and LP diets (Fig. 2B).

3. Result 3.4. Health status of shrimp

3.1. Bacteria growth stimulated by KOME 3.4.1. Challenge test

The effect of KOME on probiotic and pathogen growth is shown in
Fig. 1. The results on the probiotic demonstrated that the growth of Lac.
plantarum 7–40 was significantly faster and higher after 24 h compared
to the other four bacteria cultured in KOME. Although the growth of
V. alginolyticus was significantly higher than V. parahaemolyticus and
V. harveyi, the growth of pathogens was not good as probiotic in KOME.
3.2. Growth performance analysis
The growth performance of shrimp fed with the experimental diets is
shown in Table 3. The survival of shrimp fed with ME, LP and SYN diets
was significantly higher than that of shrimp fed with the control diet. In
addition, shrimp in the SYN group had a significantly higher weight gain
and total final weight than that of the control. However, there were no
significant differences in final weight, SGR and FE among groups.
The cumulative mortality of shrimp challenged with V. alginolyticus
is shown in Fig. 3. No dead shrimp in the unchallenge test was recorded
during the trial. Dead shrimp was observed after 24 h of injection in the
control, ME and LP groups, but not in SYN group. At the end of challenge
test (96 h), the lowest mortality of shrimp was recorded for the SYN
group, but was not significantly different from the LP group. Overall,
shrimp fed with SYN diets had a significantly lower mortality than those
fed with ME and control diets. Furthermore, the mortality of shrimp fed
with LP and ME diet was significantly lower than shrimp fed with con­
trol diet.
3.4.2. Immune parameters
Immune responses of shrimp fed the experimental diets are shown in
Fig. 4. No significant differences in THC and PA were observed among
groups (Fig. 4A and F). The PO activity was significantly higher in
shrimps fed SYN diet as compared to that of the control diet. However,
the PO activity of SYN-fed shrimps were not significantly different to ME
and LP diets (Fig. 4B). The RBs in haemocytes significantly increased
after shrimps were fed ME, LP and SYN diets when compared to the
control. Whereas the highest RBs was recorded in shrimps fed with the
LP diet (Fig. 4C). The SOD activity was significantly lower in shrimps fed
with LP diet than shrimps fed SYN diet, but not significantly different
from the control (Fig. 4D). LYZ activity significantly increased when
shrimps were fed with the SYN diet as compared to the control (Fig. 4E).
However, LYZ activity was not significantly different among the control,
ME and LP groups.

3.4.3. Immune gene expression

Fig. 1. Bacteria concentrations after cultured in KOME. Data with different
letters are significantly different among groups at the end of trial (p < 0.05).
ProPO system-related gene expressions of shrimp fed with the
experimental diet are shown in Fig. 5. No significant differences in the
gene expressions of lgbp, sp, propoi and propoii in haemocyte of shrimp
were recorded among the control and treatments. The pexn expression
was significantly higher in haemocyte of shrimps fed diets supplemented

159
E. Prabawati et al.
Fig. 2. Presumptive lactic acid bacteria (LABs) (A) and Vibrio-like bacteria counts (VCBs) (B) in the intestine of shrimp fed with the experimental diets for 8 weeks.
Each bar represent mean value and the standard error. Data with different letters are significantly different among groups (p < 0.05).
Fig. 3. Cumulative mortality of shrimp fed with the experiment diets for 8
weeks and then challenged with V. alginolyticus. Data with different letters at
the end of trial are significantly different among groups (p < 0.05).
with ME, LP and SYN as compared to that of shrimp fed with the control
diets (Fig. 5A). In the haepatopancreas, all detected genes, including
lgbp, sp, propoii and pexn significantly increased in SYN group as
compared to the control (Fig. 5B).
The gene expression of antimicrobial molecule-involved genes,
including alf1, alf2, crus, lyz, pen3a in haemocyte, and alf1, alf2, crus and
lyz in haepatopancreas were not significantly different among the con­
trol and treatments (Fig. 6). An up-regulation of pen4 was observed in
the haemocyte of LP- and SYN-fed shrimp (Fig. 6A), and in the haepa­
topancreas of ME- and LP-fed shrimp (Fig. 6B). SYN was also able to
increase the gene expression of pen3a in haepatopancreas as compared
to the control (Fig. 6B).
For the antioxidant-related gene expression, only the gpx transcrip­
tion increased in the haepatopancreas of shrimps fed ME, LP and SYN as
compared to the control (Fig. 7B). The gene expressions of mnsod and cat
in both the haemocyte and haepatopancreas, and gpx in haemocyte were
not significantly different among the control and treatments (Fig. 7).
4. Discussion
The application of synbiotic diets is a promising alternative feeding
strategy for improving the growth performance and health status of
aquaculture species. Several studies reported increased growth perfor­
mance and health status in aquatic animals [12,13], including white
shrimp [14] after synbiotic administration. However, very little is
currently known about using agricultural by-products to produce a
prebiotic combined with a probiotic to formulate synbiotic in
160
Fish and Shellfish Immunology 120 (2022) 155–165
aquaculture or other animals. The biodegradable organic metabolite
product from microalgae Porphyridium such as exopolysaccharide has
been revealed in health increasing status in white shrimp against
vibriosis [9]. It can rapidly stimulate the non-specific immune activity of
the white shrimp. Fruit processing by-products are considered more
effective and less expensive natural sources of prebiotic that exhibit
significant antioxidant and synbiotic properties [53]. Fibers from apples
and bananas increased the viability of the probiotics Lac. acidophilus L10
and Bifidobacterium animalis subsp. lactis BL04, HN019, and B94 and
increased the short-chain and polyunsaturated fatty acid in yogurts [54].
Like fruit processing by-products, mushrooms have been used as a di­
etary supplement because they contain enormous bioactive compounds
such as polysaccharides that stimulate probiotic growth. Nowak et al.
[25] reported that mushroom polysaccharides could promote the
growth of Lactobacillus strain. Sawangwan et al. [55] reported that Lac.
acidophilus and Lac. plantarum growth can be stimulated by the extracts
from Lentinus edodoes and P. pulmonarius. In this study, the findings of
prebiotic properties showed that KOME significantly stimulated the
growth of probiotic, Lac. plantarum 7–40 rather than the growth of
pathogenic bacteria, including V. alginolyticus, V. parahaemolyticus, and
V. harveyi.
Several studies reported that shrimp fed with a synbiotic diet had
higher growth performance [14,56,57]. The dietary inclusion of 0.2%
encapsulated synbiotic (Bacillus sp. NP5 plus oligosaccharide) improved
the growth and feed conversion ratio in white shrimp [56]. Huynh et al.
[14] reported that white shrimp fed with the synbiotic diet (Lac. plan­
tarus 7–40 plus galactooligosaccharide (GOS)) had significantly higher
weight gain due to higher digestive enzymes, including protease,
leu-aminopeptidase, and b-galactosidase activity. The growth perfor­
mance of white shrimp fed with a synbiotic diet agrees with the findings
of Nurhayati et al. [57]. This study also found that shrimp fed with SYN
diet containing extract derived from the by-product of king oyster
mushroom and combined with Lac. plantarum 7–40 significantly
increased growth performance, including weight gain and total final
weight, but the growth performance of shrimp in ME and LP groups was
not improved significantly compared to that of shrimp in control. These
findings are the first ever to report on the use of KOME as a prebiotic to
accelerate the probiotic efficiency of Lac. plantarum 7–40 to increase the
growth performance of white shrimp. In addition to the growth per­
formance, shrimp fed with the SYN, ME and LP diets had significantly
higher survival which is in accordance with the results found by Cai
et al. [10] and Widanarni et al. [6]. A higher survival of shrimp after a
functional food treatment might be due to indirect provision of energy,
metabolic substrates, and essential micronutrients [58] resulting in the
improvement in health status and environmental tolerance of host [47].
The alteration of intestinal microbial communities upon synbiotic
E. Prabawati et al.
Fig. 4. Immune responses of shrimp fed with the experimental diets for 8 weeks. Total haemocyte count (A); phenoloxidase activity (B); respiratory burst (C);
superoxide dismutase activity (D); lysozyme activity (E); phagocytic activity (F). Each bar represents mean value and the standard error. Data with different letters
are significantly different among groups (p < 0.05).
administration has been established in previous studies [59,60]. These
studies showed that a diverse set of bacteria in the intestine are closely
related to the growth and health of the host. Hasyimi et al. [61] found
that white shrimp fed with a synbiotic containing Bacillus sp. NP5 RfR
and honey prebiotic had significantly higher growth performance and
significantly higher operational taxonomic units (OTUs) compared to
that of control. Dietary synbiotic, containing Lac. plantarum 7–40 and
GOS led to significantly lower VCBs and significantly higher LABs in the
intestine of white shrimp [14]. In addition, white shrimp fed with the
synbiotic (Lac. plantarum 7–40 plus GOS) had decreased V. harveyi and
Photobacterium damselae and increased Lac. plantarum in the intestine
which was determined by using next-generation sequencing (NGS)
technology [59]. Interestingly, KOME could not sustain the growth of
shrimp pathogens, including V. alginolyticus, V. parahaemolyticus, and
V. harveyi, but the VCBs were significantly higher in the shrimp fed with
the ME diet in this study. It seems possible that KOME can likely support
the growth of Vibrio spp. except for the pathogens selected for the trial or
growth of other bacteria on TCBS. Therefore, a precise method for in­
testinal microbiota analysis, such as NGS, is needed in a future study. In
addition, it is clear that LAB was significantly higher in the intestine of
shrimp, but the VCBs were not significantly increased in the SYN and ME
161
Fish and Shellfish Immunology 120 (2022) 155–165
groups compared to the control. The study further suggests that pro­
biotic and KOME can be combined and supplemented in shrimps’ diet to
prevent the increase of potential pathogen, Vibrio genus bacteria, and
also stimulate the growth of beneficial bacteria colonies in the shrimp
gut.
It is well known that dietary synbiotic has better efficiency in
increasing disease resistance of shrimp against pathogens than dietary
probiotic or prebiotic [60,62]. Huynh et al. [63] indicated that disease
resistance against V. alginolyticus was better in shrimp fed with the diets
containing synbiotic compared to that of shrimp fed with the control diet
and the diets supplemented with probiotic or prebiotic. In addition, the
survival of shrimp was significantly higher in the synbiotic group, fol­
lowed by the probiotic group, prebiotic group, and control group. Dis­
ease resistance of synbiotic-fed shrimp was also observed in the white
shrimp fed 108 CFU g− 1 Bacillus subtilis and 0.2% iso­
maltooligosaccharide (IMO), and 108 CFU g− 1 B. licheniformis in com­
bination with 108 CFU g− 1 B. subtilis and 0.2% IMO [64] which is in
agreement with Hamsah et al. [65] and Oktaviana et al. [66]. In this
study, SYN significantly improved the white shrimp resistance against
V. alginolyticus after 8 weeks via the alteration of intestinal microbiota
that simultaneously enhanced the immune response.
E. Prabawati et al.
Fig. 5. Gene expressions of proPO system-related molecule in haemocytes (A),
and haepatopancreas (B) of shrimp fed with the experimental diets for 8 weeks.
Each bar represents mean value and the standard error. Data with different
letters are significantly different among groups (p < 0.05).
The synergistic effects of dietary synbiotics can enhance shrimp
immunity and provide better protection against pathogens [62]. Zhang
et al. [64] documented that immune modulation occurred in white
shrimp fed with synbiotic-containing diet (Bacillus probiotics and IMO)
in which the THC, PO activity, SOD activity, LYZ activity, and nitric
oxide synthase activity significantly increased. Artemia was used to
bio-encapsulate synbiotic (Pseudoalteromonas piscidida and man­
nanoligosaccharide (MOS)) for white shrimp larvae, and the results
showed that the expression of immune-related genes, including sp, pexn,
and lgbp, and immune response, including THC, PO activity, RBs were
significantly higher than that of control [65]. Similarly, Zubaidah et al.
[56] and Oktaviana et al. [66] found positive effects on shrimp immu­
nity when synbiotic were applied to the diet. In our previous study, we
found that the synergistic effects of synbiotic comprising GOS and Lac.
plantarum 7–40 enhanced the immunity and disease resistance by
inducing syntheses of a nucleotide, a branched amino acid (valine), and
a methyl group donor (betaine) in the haepatopancreas [63]. In the
present study, shrimp fed with the diet supplemented with probiotic and
prebiotic derived from the by-product of king oyster mushroom revealed
a significantly higher PO, RBs and LYZ. In addition, immune-related
gene expression of pexn and pen4 in the haemocytes, and lgbp, sp, pro­
poii, pexn, pen3a, pen4, and gpx in the haepatopancreas of shrimp was
also significantly increased after feeding SYN diet.
Prophenoloxidase (proPO) system, antimicrobial peptide (AMP), and
reactive oxygen species (ROS), and antioxidant enzymes play an
essential role in shrimp’s innate immunity [67]. ProPO system is initi­
ated by the recognition and binding of foreign molecules like lipopoly­
saccharide and β-1, 3-glucan, referred to as pathogen-associated
molecular patterns (PAMPs) of the host recognition molecules
162
Fish and Shellfish Immunology 120 (2022) 155–165
Fig. 6. Gene expressions of antimicrobial molecules in hemocytes (A), and
haepatopancreas (B) of shrimp fed with the experimental diets for 8 weeks.
Each bar represent mean value and the standard error. Data with different
letters are significantly different among groups (p < 0.05).
pattern-recognition proteins (PRPs) [68], leading to activation of a
serine proteinase cascade that results in the activation of
proPO-activating enzymes (PPAEs). The active PPAEs convert the proPO
to PO, which catalyzes the formation of quinone-reactive intermediates
for melanin synthesis [69,70]. In addition, a multifunctional molecule,
peroxinectin with peroxidase activity involved in degranulation hae­
mocyte, immobilization of invasive microorganism, phagocytosis,
encapsulation, nodule formation, opsonisation, and activation of trans­
duction pathway regulating the expression of AMP genes, is released and
activated after proPO system activation [71,72]. Therefore, the
increased PO activity and the gene expressions of lgbp, sp, propoii, and
pexn in the haemocyte are considered due to better protection after
pathogen infection and lower mortality for shrimps fed SYN after
V. alginolyticus infection in this study.
ROS plays an important role in shrimp’s defense against pathogenic
bacteria and viruses [73]. ROS is produced to destroy the pathogens
engulfed on the membranes of the endosome of the phagocytic cells via
the activation of nicotinamide adenine dinucleotide phosphate
(NADPH) during phagocytosis. Physiological concentrations of ROS as
second messengers are required, but high local concentrations of ROS
produced by immune cells to kill pathogens can injure the cells of the
host [74]. For instance, higher concentrations of ROS can damage
cellular components such as proteins, lipids, and nucleic acids [75]. This
study generated higher RBs in the haemocyte of shrimp fed with ME, LP
and SYN diets after a zymogen stimulation, indicating that up-regulation
in ROS kill pathogens by dietary supplementation of ME, LP and SYN. In
addtion, the higher ROS generated in shrimp fed with ME, LP, and SYN
diets could be eliminated by antioxidant enzymes following higher gene
expressions of gpx and pexn that supports pathogen defence.
Shrimp AMPs have an essential role in the immune response and
survivability against bacterial infections [76]. In this study, shrimp fed
with synbiotic comprised of KOME and Lac. plantarum 7–40 exhibited
E. Prabawati et al.
Fig. 7. Gene expressions of antioxidant enzymes in shrimp in haemocytes (A),
and haepatopancreas (B) of shrimp fed with the experimental diets for 8 weeks.
Each bar represents mean value and the standard error. Data with different
letters are significantly different among groups (p < 0.05).
significantly higher gene expressions of pen4 in haemocytes and pen3a in
haepatopancreas than the control. The increase of AMPs expression
might be related to its response to infections and its mechanism in killing
pathogens by disrupting the pathogen’s outer cell membrane [77],
resulting in higher survival of shrimp after a V. alginolyticus challenge in
this study.
5. Conclusion
In conclusion, based on the result of growth performance and health
status, KOME was able to form a health-promoting and growth-
stimulating synergistic effect together with Lac. plantarum 7–40. The
combination of KOME at a concentration of 5 g kg− 1 and Lac. plantarum
7–40 at a level of 1 × 108 CFU kg− 1 positively complemented the growth
performance, immune response, and disease resistance of white shrimp
rather than diets supplemented with ME or LP-only and control. The
current findings provide concrete evidence on the benefits of using
agricultural by-products such as mushrooms to produce a cost-effective
prebiotic and synbiotic that collectively contributes to the growth and
health of shrimp and promotes sustainable aquaculture practice that
supports the circular economy.
CRediT authorship contribution statement
Estuningdyah Prabawati: Investigation, Data curation. Shao-Yang
Hu: Conceptualization. Shieh-Tsung Chiu: Resources. Rolissa Balan­
tyne: Investigation. Yenny Risjani: Editing. Chun-Hung Liu: Concep­
tualization, Writing – review & editing, Conceptualization.
Acknowledgements
This study was supported by a grant (MOST 110-2313-B-020-006-
163
Fish and Shellfish Immunology 120 (2022) 155–165
MY3 and MOST 109-2637-B-020-004-) from the Ministry of Science and
Technology, ROC.
References
[1] FAO, The State of World Fisheries and Aquaculture; Food and Agriculture
Organization of the United Nations, 2020. Rome, Italy.
[2] M.G. Bondad-Reantaso, R.P. Subasinghe, J.R. Arthur, K. Ogawa, S. Chinabut,
R. Adlard, Z. Tan, M. Shariff, Disease and health management in asian aquaculture,
Vet. Parasitol. 132 (2005) 249–272, https://doi.org/10.1016/j.
vetpar.2005.07.005.
[3] M.A. Amatul-Samahah, W.H.H.W. Omar, N.F.M. Ikhsan, M.N.A. Azmai, M. Zamri-
Saad, M.Y. Ina-Salwany, Vaccination trials against vibriosis in shrimp: a review,
Aquacult. Rep. (2020), https://doi.org/10.1016/j.aqrep.2020.100471.
[4] N. Van Hai, The use of medicinal plants as immunostimulants in aquaculture: a
review, Aquaculture 446 (2015) 88–96, https://doi.org/10.1016/j.
aquaculture.2015.03.014.
[5] A.D. Anderson, J.M. Nelson, S. Rossiter, F.J. Angulo, Public health consequences of
use of antimicrobial agents in food animals in the United States, Microb. Drug
Resist. 9 (2003) 373–379, https://doi.org/10.1089/107662903322762815.
[6] F.N. Widanarni, Rahman Putri, Growth performance of white shrimp Litopenaeus
vannamei fed with various dosages of prebiotic honey, IOP Conf. Ser. Earth
Environ. Sci. 278 (2019) 12079, https://doi.org/10.1088/1755-1315/278/1/
012079.
[7] M. Chen, X.Q. Chen, L.X. Tian, Y.J. Liu, J. Niu, Enhanced intestinal health, immune
responses and ammonia resistance in pacific white shrimp (Litopenaeus vannamei)
fed dietary hydrolyzed yeast (Rhodotorula mucilaginosa) and Bacillus licheniformis,
Aquacult. Rep. 17 (2020) 100385, https://doi.org/10.1016/j.aqrep.2020.100385.
[8] C. Vera, A. Illanes, C. Guerrero, Enzymatic production of prebiotic
oligosaccharides, Curr. Opin. Food Sci. 37 (2021) 160–170, https://doi.org/
10.1016/j.cofs.2020.10.013.
[9] Y. Risjani, N. Mutmainnah, P. Manurung, S.N. Wulan, Yunianta, Exopolysaccharide
from Porphyridium cruentum (purpureum) is not toxic and stimulates immune
response against vibriosis: the assessment using zebrafish and white shrimp
Litopenaeus vannamei, Mar. Drugs 19 (2021) 1–17, https://doi.org/10.3390/
md19030133.
[10] Y. Cai, W. Yuan, S. Wang, W. Guo, A. Li, Y. Wu, X. Chen, Z. Ren, Y. Zhou, In vitro
screening of putative probiotics and their dual beneficial effects: to white shrimp
(Litopenaeus vannamei) postlarvae and to the rearing water, Aquaculture 498
(2019) 61–71, https://doi.org/10.1016/j.aquaculture.2018.08.024.
[11] M.A.O. Dawood, N.M. Eweedah, M.E. El-Sharawy, S.S. Awad, H. Van Doan, B.
A. Paray, Dietary white button mushroom improved the growth, immunity,
antioxidative status and resistance against heat stress in nile tilapia (Oreochromis
niloticus), Aquaculture 523 (2020) 735229, https://doi.org/10.1016/J.
AQUACULTURE.2020.735229.
[12] R.B. Cavalcante, G.S. Telli, L. Tachibana, D.C. Dias, E. Oshiro, M.M. Natori, W.F. da
Silva, M.J. Ranzani-Paiva, Probiotics, prebiotics and synbiotics for nile tilapia:
growth performance and protection against Aeromonas hydrophila infection,
Aquacult. Rep. 17 (2020) 100343, https://doi.org/10.1016/j.aqrep.2020.100343.
[13] M. Sewaka, C. Trullas, A. Chotiko, C. Rodkhum, N. Chansue, S. Boonanuntanasarn,
N. Pirarat, Efficacy of synbiotic jerusalem artichoke and Lactobacillus rhamnosus
GG-supplemented diets on growth performance, serum biochemical parameters,
intestinal morphology, immune parameters and protection against Aeromonas
veronii in juvenile red tilapia (Oreochromis spp.), Fish Shellfish Immunol. 86 (2019)
260–268, https://doi.org/10.1016/j.fsi.2018.11.026.
[14] T.G. Huynh, C.C. Chi, T.P. Nguyen, T.T.T.H. Tran, A.C. Cheng, C.H. Liu, Effects of
synbiotic containing Lactobacillus plantarum 7–40 and galactooligosaccharide on
the growth performance of white shrimp, Litopenaeus vannamei, Aquacult. Res. 49
(2018) 2416–2428, https://doi.org/10.1111/ARE.13701.
[15] M.G. Llanto, A.B. Encarnacion, Application of edible oyster mushroom, Pleurotus
ostreatus extract to control postharvest melanosis in shrimp, Penaeus vannamei,
Philipp. J. Sci. 147: 231–238. https://doi.org/10.1016/j.carbpol.2013.05.028.
[16] X. Liu, L. Wang, C. Zhang, H. Wang, X. Zhang, Y. Li, Structure characterization and
antitumor activity of a polysaccharide from the alkaline extract of king oyster
mushroom, Carbohydr. Polym. 118 (2015) 101–106, https://doi.org/10.1016/j.
carbpol.2014.10.058.
[17] H.I. Wei, S. Yue, S. Zhang, L. Lu, Lipid-lowering effect of the Pleurotus eryngii (king
oyster mushroom) polysaccharide from solid-state fermentation on both
macrophage-derived foam cells and zebrafish models, Polymers 10 (2018) 1–11,
https://doi.org/10.3390/polym10050492.
[18] E. Baysal, H. Peker, M.K. Yalinkiliç, A. Temiz, Cultivation of oyster mushroom on
waste paper with some added supplementary materials, Bioresour. Technol. 89
(2003) 95–97, https://doi.org/10.1016/S0960-8524(03)00028-2.
[19] C.F. Ellefsen, C.W. Wold, A.L. Wilkins, F. Rise, A.B.C. Samuelsen, Water-soluble
polysaccharides from Pleurotus eryngii fruiting bodies, their activity and affinity for
toll-like receptor 2 and dectin-1, Carbohydr. Polym. 264 (2021) 117991, https://
doi.org/10.1016/j.carbpol.2021.117991.
[20] I. Aguiló-Aguayo, J. Walton, I. Viñas, B.K. Tiwari, Ultrasound assisted extraction of
polysaccharides from mushroom by-products, Lebensm. Wiss. Technol. 77 (2017)
92–99, https://doi.org/10.1016/j.lwt.2016.11.043.
[21] F.S. Reis, A. Martins, L. Barros, I.C.F.R. Ferreira, Antioxidant properties and
phenolic profile of the most widely appreciated cultivated mushrooms: a
comparative study between in vivo and in vitro samples, Food Chem. Toxicol. 50
(2012) 1201–1207, https://doi.org/10.1016/j.fct.2012.02.013.
E. Prabawati et al.
[22] A. Synytsya, K. Míčková, A. Synytsya, I. Jablonský, J. Spěváček, V. Erban,
E. Kováříková, J. Čopíková, Glucans from fruit bodies of cultivated mushrooms
Pleurotus ostreatus and Pleurotus eryngii: structure and potential prebiotic activity,
Carbohydr. Polym. 76 (2009) 548–556, https://doi.org/10.1016/j.
carbpol.2008.11.021.
[23] M.Y. Kim, I.M. Chung, S.J. Lee, J.K. Ahn, E.H. Kim, M.J. Kim, S.L. Kim, Comparison
of free amino acid, carbohydrates concentrations in Korean edible and medicinal
mushrooms, Food Chem. 113 (2009) 386–393, https://doi.org/10.1016/j.
foodchem.2008.07.045.
[24] W.T. Chou, I.C. Sheih, T.J. Fang, The applications of polysaccharides from various
mushroom wastes as prebiotics in different systems, J. Food Sci. 78 (2013)
M1041–M1048, https://doi.org/10.1111/1750-3841.12160.
[25] R. Nowak, N. Nowacka-Jechalke, M. Juda, A. Malm, The preliminary study of
prebiotic potential of polish wild mushroom polysaccharides: the stimulation effect
on Lactobacillus strains growth,, Eur. J. Nutr. 57 (2018) 1511–1521, https://doi.
org/10.1007/s00394-017-1436-9.
[26] A.C. Ruthes, T.M. Cantu-Jungles, L.M.C. Cordeiro, M. Iacomini, Prebiotic potential
of mushroom D-glucans: implications of physicochemical properties and structural
features, Carbohydr. Polym. 262 (2021) 117940, https://doi.org/10.1016/j.
carbpol.2021.117940.
[27] C.Y. Wang, A review on the potential reuse of functional polysaccharides extracted
from the by-products of mushroom processing, Food Bioprocess Technol. 13 (2020)
217–228, https://doi.org/10.1007/s11947-020-02403-2.
[28] H. Van Doan, C. Lumsangkul, S.H. Hoseinifar, S. Tongsiri, C. Chitmanat, M.
S. Musthafa, E. El-Haroun, E. Ringo, Modulation of growth, innate immunity, and
disease resistance of nile tilapia (Oreochromis niloticus) culture under biofloc system
by supplementing pineapple peel powder and Lactobacillus plantarum, Fish Shellfish
Immunol. (2021), https://doi.org/10.1016/j.fsi.2021.06.008.
[29] T.T.T. Hien, T.T.T. Hoa, P.T. Liem, S. Onoda, P.M. Duc, Effects of dietary
supplementation of heat-killed Lactobacillus plantarum L-137 on growth
performance and immune response of bighead catfish (Clarias macrocephalus),
Aquacult. Rep. 20 (2021) 100741, https://doi.org/10.1016/j.aqrep.2021.100741.
[30] G. Sagada, N. Gray, L. Wang, B. Xu, L. Zheng, Z. Zhong, S. Ullah, A.F. Tegomo,
Q. Shao, Effect of dietary inactivated Lactobacillus plantarum on growth
performance, antioxidative capacity, and intestinal integrity of black sea bream
(Acanthopagrus schlegelii) fingerlings, Aquaculture 535 (2021) 736370, https://doi.
org/10.1016/j.aquaculture.2021.736370.
[31] M.J. Foysal, R. Fotedar, M.A.B. Siddik, M.R. Chaklader, A. Tay, Lactobacillus
plantarum in black soldier fly (Hermetica illucens) meal modulates gut health and
immunity of freshwater crayfish (Cherax cainii), Fish Shellfish Immunol. 108
(2021) 42–52, https://doi.org/10.1016/j.fsi.2020.11.020.
[32] Y. Li, Y. Yang, L. Song, J. Wang, Y. Hu, Q. Yang, P. Cheng, J. Li, Effects of dietary
supplementation of Lactobacillus plantarum and Bacillus subtilis on growth
performance, survival, immune response, antioxidant capacity and digestive
enzyme activity in olive flounder (Paralichthys olivaceus), Aquacult. Fish. 6 (2020)
283–288, https://doi.org/10.1016/j.aaf.2020.10.006.
[33] A.T. Yap, M.L. Ng, An improved method for the isolation of lentinan from the
edible and medicinal shiitake mushroom, Lentinus edodes (Berk.) Sing.
(Agaricomycetideae), Int. J. Med. Mushrooms 3 (2001) 11, https://doi.org/
10.1615/INTJMEDMUSHR.V3.I1.20.
[34] B.W.B. Holman, K.L. Bailes, R.G. Meyer, D.L. Hopkins, Effect of modified soxhlet
(soxtec) and folch extraction method selection on the total lipid determination of
aged beef, J. Food Sci. Technol. 56 (2019) 3957–3961, https://doi.org/10.1007/
S13197-019-03878-4.
[35] K. Liu, Effects of sample size, dry ashing temperature and duration on
determination of ash content in algae and other biomass, Algal Res. 40 (2019)
101486, https://doi.org/10.1016/J.ALGAL.2019.101486.
[36] C.E. Bower, J.P. Bidwell, Ionization of ammonia in seawater: effects of
temperature, pH, and salinity, J. Fish. Board Canada 35 (1978) 1012–1016,
https://doi.org/10.1139/F78-165.
[37] K. Bendschneider, R.J. Robinson, A new spectrometric method for the
determination of nitrite in the sea water, J. Mar. Res. 11 (1952) 87–96.
[38] C.H. Liu, W. Cheng, J.P. Hsu, J.C. Chen, Vibrio alginolyticus infection in the white
shrimp Litopenaeus vannamei confirmed by polymerase chain reaction and 16s
RDNA sequencing, Dis. Aquat. Org. 61 (2004) 169–174, https://doi.org/10.3354/
DAO061169.
[39] A.C. Cheng, Y.L. Shiu, S.T. Chiu, R. Ballantyne, C.H. Liu, Effects of chitin from
Daphnia similis and its derivative, chitosan on the immune response and disease
resistance of white shrimp, Litopenaeus vannamei, Fish Shellfish Immunol. 119
(2021) 329–338, https://doi.org/10.1016/j.fsi.2021.10.017.
[40] S.T. Chiu, T.W. Chu, T. Simangunsong, R. Ballantyne, C.S. Chiu, C.H. Liu,
Probiotic, Lactobacillus pentosus BD6 boost the growth and health status of white
shrimp, Litopenaeus vannamei via oral administration, Fish Shellfish Immunol. 117
(2021) 124–135, https://doi.org/10.1016/J.FSI.2021.07.024.
[41] C. Beauchamp, I. Fridovich, Superoxide dismutase: improved assays and an assay
applicable to acrylamide gels, Anal. Biochem. 44 (1971) 276–287, https://doi.org/
10.1016/0003-2697(71)90370-8.
[42] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative pcr and the 2-ΔΔCT method, Methods 25 (2001) 402–408, https://
doi.org/10.1006/meth.2001.1262.
[43] F. Jiménez-Vega, F. Vargas-Albores, K. Söderhäll, Characterisation of a serine
proteinase from Penaeus vannamei haemocytes, Fish Shellfish Immunol. 18 (2005)
101–108, https://doi.org/10.1016/j.fsi.2004.02.001.
[44] R.D. Rosa, A. Vergnes, J. Lorgeril, P. Goncalves, L.M. Perazzolo, L. Sauné,
B. Romestand, J. Fievet, Y. Gueguen, E. Bachère, D. Destoumieux-Garzón,
Functional divergence in shrimp anti-lipopolysaccharide factors (ALFs): from
164
Fish and Shellfish Immunology 120 (2022) 155–165
recognition of cell wall components to antimicrobial activity, PLoS One 8 (2013),
https://doi.org/10.1371/JOURNAL.PONE.0067937.
[45] J. Liu, Y. Yu, F. Li, X. Zhang, J. Xiang, A new ALF from Litopenaeus vannamei and its
SNPs related to WSSV resistance, Chin. J. Oceanol. Limnol. 32 (2014) 1232–1247,
https://doi.org/10.1007/s00343-015-4010-4.
[46] H.W. Kuo, D.W. Lin, W. Cheng, Transient enhancement of immune resistance
functions in Litopenaeus vannamei through a low-dose octopamine injection, Fish
Shellfish Immunol. 84 (2019) 532–540, https://doi.org/10.1016/j.
fsi.2018.10.060.
[47] K.F. Liu, C.H. Chiu, Y.L. Shiu, W. Cheng, C.H. Liu, Effects of the probiotic, Bacillus
subtilis E20, on the survival, development, stress tolerance, and immune status of
white shrimp, Litopenaeus vannamei larvae, Fish Shellfish Immunol. 28 (2010)
837–844, https://doi.org/10.1016/j.fsi.2010.01.012.
[48] H.K. Miandare, A.T. Mirghaed, M. Hosseini, N. Mazloumi, A. Zargar, S. Nazari,
Dietary Immunogen® modulated digestive enzyme activity and immune gene
expression in Litopenaeus vannamei post larvae, Fish Shellfish Immunol. 70 (2017)
621–627, https://doi.org/10.1016/j.fsi.2017.09.048.
[49] N.A. O’Leary, P.S. Gross, Genomic structure and transcriptional regulation of the
penaeidin gene family from Litopenaeus vannamei, Gene 371 (2006) 75–83, https://
doi.org/10.1016/J.GENE.2005.11.028.
[50] P.F. Ji, C.L. Yao, Z.Y. Wang, Immune response and gene expression in shrimp
(Litopenaeus vannamei) hemocytes and hepatopancreas against some pathogen-
associated molecular patterns, Fish Shellfish Immunol. 27 (2009) 563–570,
https://doi.org/10.1016/j.fsi.2009.08.001.
[51] E. Cardona, D. Saulnier, B. Lorgeoux, L. Chim, Y. Gueguen, Rearing effect of biofloc
on antioxidant and antimicrobial transcriptional response in Litopenaeus stylirostris
shrimp facing an experimental sub-lethal hydrogen peroxide stress, Fish Shellfish
Immunol. 45 (2015) 933–939, https://doi.org/10.1016/j.fsi.2015.05.041.
[52] P.S. Sun, M. Soderlund, N.C. Venzon, D. Ye, Y. Lu, Isolation and characterization of
two actins of the Pacific white shrimp, Litopenaeus vannamei, Mar. Biol. 151 (2007)
2145–2151, https://doi.org/10.1007/s00227-007-0646-8.
[53] B. Akter, M.S. Rabeta, Synbiotic and antioxidant activity of fruit by-products and
their effect on human health, Food Res. 5 (2021) 24–35, https://doi.org/
10.26656/fr.2017.5(1).401.
[54] A.P.E. Santo, N.S. Cartolano, T.F. Silva, F.A.S.M. Soares, L.A. Gioielli, P. Perego,
A. Converti, M.N. Oliveria, Fibers from fruit by-products enhance probiotic
viability and fatty acid profile and increase CLA content in yoghurts, Int. J. Food
Microbiol. 154 (2012) 135–141, https://doi.org/10.1016/j.
ijfoodmicro.2011.12.025.
[55] T. Sawangwan, W. Wansanit, L. Pattani, C. Noysang, Study of prebiotic properties
from edible mushroom extraction, Agric. Nat. Resour. 52 (2018) 519–524, https://
doi.org/10.1016/j.anres.2018.11.020.
[56] A. Zubaidah, M. Yuhana, Widanarni, Encapsulated synbiotic dietary
supplementation at different dosages to prevent vibriosis in white shrimp,
Litopenaeus vannamei, HAYATI J. Biosci. 22 (2015) 163–168, https://doi.org/
10.1016/j.hjb.2015.10.007.
[57] D. Nurhayati, Widanarni, M. Yuhana, Dietary synbiotic influence on the growth
performances and immune responses to co-infection with infectious Myonecrosis
Virus and Vibrio harveyi in Litopenaeus vannamei, J. Fish. Aquat. Sci. 10 (2015)
13–23, https://doi.org/10.3923/jfas.2015.13.23.
[58] G.R. Gibson, M.B. Roberfroid, Dietary modulation of the human colonic
microbiota: introducing the concept of prebiotics, J. Nutr. 125 (1995) 1401–1412,
https://doi.org/10.1093/jn/125.6.1401.
[59] T.G. Huynh, S.Y. Hu, C.S. Chiu, Q.P. Truong, C.H. Liu, Bacterial population in
intestines of white shrimp, Litopenaeus vannamei fed a synbiotic containing
Lactobacillus plantarum and galactooligosaccharide, Aquacult. Res. 50 (2019)
807–817, https://doi.org/10.1111/are.13951.
[60] T.G. Huynh, Y.L. Shiu, T.P. Nguyen, Q.P. Troung, J.C. Chen, C.H. Liu, Current
applications, selection, and possible mechanisms of actions of synbiotics in
improving the growth and health status in aquaculture: a review, Fish Shellfish
Immunol. 64 (2017) 367–382, https://doi.org/10.1016/j.fsi.2017.03.035.
[61] W. Hasyimi, W. Widanarni, M. Yuhana, Growth performance and intestinal
microbiota diversity in pacific white shrimp Litopenaeus vannamei fed with a
probiotic bacterium, honey prebiotic, and synbiotic, Curr. Microbiol. 77 (2020)
2982–2990, https://doi.org/10.1007/s00284-020-02117-w.
[62] U.D. Butt, N. Lin, N. Akhter, T. Siddiqui, S. Li, B. Wu, Overview of the latest
developments in the role of probiotics, prebiotics and synbiotics in shrimp
aquaculture, Fish Shellfish Immunol. 114 (2021) 263–281, https://doi.org/
10.1016/j.fsi.2021.05.003.
[63] T.G. Huynh, A.C. Cheng, C.C. Chi, K.H. Chiu, C.H. Liu, A synbiotic improves the
immunity of white shrimp, Litopenaeus vannamei: metabolomic analysis reveal
compelling evidence,, Fish Shellfish Immunol. 79 (2018) 284–293, https://doi.
org/10.1016/j.fsi.2018.05.031.
[64] Q. Zhang, B. Tan, K. Mai, W. Zhang, H. Ma, Q. Ai, X. Wang, Z. Liufu, Dietary
administration of Bacillus (B. licheniformis and B. subtilis) and
isomaltooligosaccharide influences the intestinal microflora, immunological
parameters and resistance against Vibrio alginolyticus in shrimp, Penaeus japonicus
(Decapoda: Penaeidae), Aquacult. Res. 42 (2011) 943–952, https://doi.org/
10.1111/j.1365-2109.2010.02677.x.
[65] H. Hamsah, W. Widanarni, A. Alimuddin, M. Yuhana, M.Z. Junior, D. Hidayatullah,
Immune response and resistance of pacific white shrimp larvae administered
probiotic, prebiotic, and synbiotic through the bio-encapsulation of Artemia sp,
Aquacult. Int. 27 (2019) 567–580, https://doi.org/10.1007/s10499-019-00346-w.
[66] A.D.N.I. Oktaviana, Widanarni, M. Yuhana, The use of synbiotics to prevent IMNV
and Vibrio harveyi co-infection in Litopenaeus vannamei, HAYATI J. Biosci. 21
(2014) 127–134, https://doi.org/10.4308/hjb.21.3.127.
E. Prabawati et al.
[67] K. Söderhäll, Invertebrate Immunity, Landes Bioscience and Springer Science+
Business Media, Boston, MA, 2010, https://doi.org/10.1007/978-1-4419-8059-5.
[68] P. Amparyup, J. Sutthangkul, W. Charoensapsri, A. Tassanakajon, Pattern
recognition protein binds to lipopolysaccharide and β-1, 3-glucan and activates
shrimp prophenoloxidase system, J. Biol. Chem. 287 (2012) 10060–10069,
https://doi.org/10.1074/jbc.m111.294744.
[69] P. Zhao, J. Li, Y. Wang, H. Jiang, Broad-spectrum antimicrobial activity of the
reactive compounds generated in vitro by Manduca sexta phenoloxidase, Insect
Biochem. Mol. Biol. 37 (2007) 952–959, https://doi.org/10.1016/j.
ibmb.2007.05.001.
[70] L. Cerenius, R. Babu, K. Söderhäll, P. Jiravanichpaisal, In vitro effects on bacterial
growth of phenoloxidase reaction products, J. Invertebr. Pathol. 103 (2010) 21–23,
https://doi.org/10.1016/j.jip.2009.09.006.
[71] M.W. Johansson, K. Söderhäll, Isolation and purification of a cell adhesion factor
from crayfish blood cells, J. Cell Biol. 106 (1988) 1795–1803, https://doi.org/
10.1083/jcb.106.5.1795.
165
Fish and Shellfish Immunology 120 (2022) 155–165
[72] B. Dong, F. Liu, H. Gao, B. Wang, J. Xiang, cDNA cloning and gene expression
pattern following bacterial challenge of peroxinectin in Chinese shrimp
Fenneropenaeus chinensis, Mol. Biol. Rep. 36 (2009) 2333–2339, https://doi.org/
10.1007/s11033-009-9453-2.
[73] P.F. Ji, C.L. Yao, Z.Y. Wang, Reactive oxygen system plays an important role in
shrimp Litopenaeus vannamei defense against Vibrio parahaemolyticus and WSSV
infection, Dis. Aquat. Org. 96 (2011) 9–20, https://doi.org/10.1007/10.3354/
dao02373.
[74] T.L. Leto, M. Geiszt, Role of Nox family NADPH oxidases in host defense, Antioxid.
Redox Signal 8 (2006) 1549–1561, https://doi.org/10.1089/ars.2006.8.1549.
[75] A.A. Alfadda, R.M. Sallam, Reactive oxygen species in health and disease,
J. Biomed. Biotechnol. 2012 (2012) 936486, https://doi.org/10.1155/2012/
936486.
[76] R.D. Rosa, M.A. Barracco, Antimicrobial peptides in crustaceans, Invertebr. Surviv.
J. 7 (2010) 262–284.
[77] M.R. Yeaman, N.T. Yount, Mechanisms of antimicrobial peptide action and
resistance, Pharmacol. Rev. 55 (2003) 27–55, https://doi.org/10.1124/pr.55.1.2.