CODE-A 04/04/2024 Aakash (=) Medicall IIT-JEE| Foundations 7623456 Road, New Delhi-110005, Ph.011-4 5, 8, Pusa Roat kash Tower rate Office: Aal Corpors (Advanced INTENSIVE lastery for 120) Time :3 Hrs. 20 Min. CsT-2 MM : 720 e@) 121. @) 162. 3) 81. (4) 122. @2) 183. (1) 4.) 82. (2) 123.) 164. @) 1 @ 42. 3) 83. (4) 124. (4) 185. @2) 2 4) 43. @) 84. (2) 125. (4) 188. 2) 3 3) 4a. (4) 85. 3) 126. (4) 187. (1) 4 @ 45. (1) 86. (1) 427.2) 188. 3) 5 @) 46. (1) 87. (2) 128. (4) 183. 2) 8 @) 47. 3) 88. (1) 129. (1) 170. (4) 7 @ 48. (4) 88. (2) 130. 3) 171. (1) 8 @) 42. 3) 90. @) 131.2) 172. @) 9 (1) 50. (1) 91. 3) 132 (4) 173.2) 10. @) 51. (2) 92. (4) 433. (1) 174. @) 1. @) 52. (1) 93. 3) 4134. (4) 175. (4) 12 @) 53. (1) 94. (4) 435.(1) 176. (1) 13. @) 54. (2) 95. (3) 136. (4) 177. @) 14 (4) 55. (1) 96. (4) 137. @) 178. (1) 18. @) 56. (3) 97. 3) 138. @) 173. (1) 16 @) 57. (4) 98. (3) 139. @) 180. (3) 7 (1) 58. (3) 98. (3) 140. (1) 181. 2) 18 @) 52. (4) 4100. 2) 141. 2) 182. 3) 12 @) 60. (4) 101. @) 142.2) 183. 2) 20. (1) 81. (t) 402. (3) 143. 2) 184. @) 21. @) 62. 2) 103. (3) 144. (1) 185. @2) 22. (1) 63. @) 104. (4) 145. (4) 186. (4) 23. (1) 64. (a) 105. (2) 146. (2) 187. (1) 24. 3) 85. 2) 106. (4) 147. (4) 188. (1) 25. 3) 68. (1) 107. (4) 148. (2) 189. 2) 26. 2) 87. (a) 108. (3) 149. (3) 190. @) 27. @) 68. 2) 109. (2) 4150. (1) 191. @) 28. 3) 62. @) 110. (4) 151. (4) 192 @) 23. 3) 70. () 111.) 182.2) 1932) 30. (4) ™ 4) 112. @) 153. (3) 194 (1) 31. (1) 72. @) 113. @) 4154. (4) 195. (4) 32. (1) 73. @) 114. (1) 155. (3) 196. (4) 33. (4) 7% @) 115. (4) 156. (2) 197.8) 34. (1) 75. (a) 116. (3) 187. 2) 198. (1) 36. (2) 78. 3) 117.2) 158. (3) 199. (4) 36. 3) 7 @) 118. 4) 159. (3) 200. (2) 37. @) 73. (a) 118.2) 160. (4) 38. (1) 79. (3) 120. (3) 38. (2) 80. 2) 40. (1) (1)CST-2_(Code-A) (Answers & Solutions) AIM - 720, 04/04/2024 @® Aakash Medicall IIT-JEE| Foundations CODE-A CN WF Corporate Office: Aakash Tower, 8, Pusa Road, New Delhi-1 10005, Ph.011-47623456 (Aduanced INTENSE Wlastery for 120) MM : 720 cst-2 Time : 3 Hrs. 20 Min. CHE SECTION-A’ 4. Answer (2) + 2CH, +0, 88284 20H,0H 2CH,CH, +30, 902M", 2c H,COOH + 24,0. Moo, 20 THK 10128 tm . U +HO—S>CO+3H, 2. Answer (1) For isomeric alkenes more is the number of ‘ashydrogen atoms more is the stability of alkene and lesser is the value of heat of hydrogenation. 3. Answer (3) Arginine and Lysine are essential amino acids. 4. Answer (3) NH, (Benzylamine) is more basic than oo pair of nitrogen is in conjugation with benzene x- electron cloud 5. Answer (2) Kjeldahl's method is not applicable for the estimation of nitrogen in case of nitrogen in ring and nitrogen present in nitro and azo groups. (Aniline) because in aniline, the lone 6 10. TRY, Answer (3) * According to resonance theory, resonance structures (canonical forms) contribute for the actual structure but do not have any real existence. * Energy of actual structure is less than that of any of the canonical forms. ‘Answer (4) The balanced redox reaction is 2MnO; +B” + H,O—»2Mn0, +BrO; + 20H" 2K=2,y=2,2=1 ‘Answer (2) nO | Som | has 2-0 -0-) bonds o71lNo ° ‘Answer (1) 2.24 = 24a, Number of molecules = £0 xN, =0.1Na ‘Answer (2) 2H, + 0, ——>2H,0 srl 0.328'mo1 02s limiting reagent “= 1 mol Os gives > 2 mol HO 0.125 mol Oe will give -> 0.25 mol Hz 25% 18 5g H:0 (2)AIM 720 11. Answor(3) ‘The reaction follows frst order kinetics. 2.303 a 2.303 og 2 «ax 100 10 12. Answer (4) NH} belongs to zero group of cations. 13. Answer (3) Ne belongs to group cations hence NiS will have higher solubility 14. Answer (4) 2H:0 -» 02+ 44" + 4e- 10 Motes of 0» generated = 12-25 Volume of O» generated at STP = 2.5 «22.4 56 15. Answer (2) [Fe(SCN)}* is blood re colour spocis, 16. Answer (3) CH; of, COOK COOH amok FT AES 17. Answer (1) Generally boling pont increases down the git. Bul due to high elocrenegativiy and smal sizeof nitrogen, NHs exhibits hydrogen bonding in sok as well asin liquid stato. Because of this I has higher boing point than that of PHs and ASH Compound Bolling point) Nis 238.5 PH 185.5 Ast 2106 sb 2546 ails 280.0 18. Answer (3) Lead nitrate on heating gives NOr gas. 19. 20. 24 22. 23, 24, CST.2_(Code-A)_ (Answers & Solutions) ‘Answer (3) ‘The effect of the following groups in increasing acidity order is F NO2CH:COOH > NC - CH:COOH > FCHsCOOH Answer (1) tet Wt Ny In BrH, there are two bridging hydrogen atom The four terminal B— H bonds are regular two centre-two electron bonds. ‘Therefore, there are two 3c - 2e~ bonds and four 20~2e" bonds Answer (4) x2 mechanism is a single step reaction in which incoming nucleophile and teaving group come and leave simultaneously CHsCH:C! > (CH:).CHCI > (CHs)sCCL Answer (1) + Prosence of electron withdrawing group tke NO: at ortho and para positions increases the reactivity of haloarenes. ol on No, No, No, é positive charge on sp? hybridised carbon atom, ‘Answer (1) When inert gas is added at constant pressure, the equilibrium will move in the direction which have of morefhigher stoichiometry of gases. ‘Answer (3) Lewis acids are those compounds which can accept the electron palr. €.9. BF, AICk, SOs and Mg? (3)CST-2_(Code-A) (Answers & Solutions) AIM - 720, 26. 26. 27. 28. 29. 30. Answer (3) CHO CH,OH COONa & ‘Answer (2) 9° oly Sui wscye i (C.H.0) ° ‘ONa Answer (2) ‘Substances H20 NHs Hcl Ne Answer (3) ° or Aas ona + cH ° Frat ie pchlaale (C)H,,0,) AvagH® (kmot-) 40.79 23.35 16.15 5.59 More is the number of unpaired electrons, more is the spin only magnetic moment. Species [MnCe]}- [Fe(CN}s [Fer Answer (3) No. of unpaired electrons 4 1 5 For isoelectronic species Size « 4 Zon ‘Answer (4) Z= 109. [Meitnerium “IN un" pil enn Unnitennium 34 32, 33, 34, 36, 36, 37, 38, Answer (1) In graphite, each carbon atom in hexagonal ring undergoes sp? hybridisation and makes three sigma bonds with three neighbouring carbon atoms. Fourth electron forms a = bond. The electrons are delocalised over the whole sheet. Electrons are mobile and therefore, graphite conducts electricity along the sheet Answer (1) ° Answer (4) a. Bent T Shape a \ Sy Volume Independent concentration terms are temperature independent Answer (2) ATi= Kom _ Ky We «1000 Mx W, at, ws Ma 188x5%1000 _ 69 4 mor! 0.46250 SECTIONS ‘Answer (3) The cyclic species which contains (4n + 2)x electrons in conjugation are aromatic species (n=0,1,2,...) Answer (2) Cellulose is composed of f-D-glucose units. Answer (1) Primary amines give positive carbylamine or isocyanide test NH, NC * cre, “on? (4)AIM - 720 CST-2_(Code-A)_(Answers & Solutions) 38. Answer (2) 9 198 gges (1) Forn=3 4 I= 0to(n—1) 89527 «10-5 =0,1,2 S=3x 105 Ui) Kop = (A) (8X-P 40. 44 42, 43, 44, So, for! = 2 minimum value of n has to be 3 Energies of the orbitals in the same subshell decrease with increase in the atomic number (Zor 4.@., Ezs (H) > E2s (Li) > Eze (Na) > Ezs (K) The energy of the orbitals in hydrogen atom increases as follows: (2) (3) 1s < 2s = 2p <3s= 3p =3d<4s at (4) dy dy _a ofbitals have four lobes Whereas, d,, has two lobes along z-axis with a ring of high electron density in the xy plane ‘Answer (1) Manganate ion is paramagnetic in nature, due to presence of one unpaired electron, ‘Answer (1) P-P-P bond angle is Ps is 60°, Answer (3) Ces Spee oe 2 ‘eNirbenenc ct ‘Answer (3) Group reagent for group-lV cations used in qualitative analysis is HzS in presence of NH:OH. ‘Answer (4) (Kao = (") 06) 4 10" =(8)(S) 4x 10-2 = $2 S=2% 104 (i) Kop = (A) (OP 1.08 « 10-8 = (S) (25 108 x 10-5 = 4s! 45, 46. 47. = (S) (38)? 278 St= 16 «1078 S=2% 107 Answer (1) —>H,0 aH =-200 ksimol CcHy So, —6C0, +3H,0 ‘AHe ==4000 ksfmal CyHyp + 90, —46C0, +6H,0 ‘aHs = 4200 ks/mol CH, +3H,—>C,H,, AH X= 34H; + AH2 - AHS x = [3(-200) + (-4000)] - (4200) 600 - 4000 + 4200 = -400 ki per mol ‘Answer (1) Spin only magnetic moment= «fa(n+2) B.M Hore, n = number of unpaired electrons Answer (3) aif 207 Hy Br — I, Ps Ey, Ey 288i | a] (ey) 0.0501), 4 Ej, 0 Oh i he 2 Gay 0.059%, ag Ey jy ep lostt0) Exe jy, = 0.05913 E,ejg, =-O.773.V (5)CST-2_(Code-A) (Answers & Solutions) 48. 49, 51. 62. 53, 54, 56. 56. 87. ‘Answer (4) Allene as a whole is non-planar AW aa H.C = C = CH, oP apt Answer (3) Graph of concentration and time for first order reaction never reaches to zero concentration. ‘SECTION-A. Answer (2) Vessels are absent in gymnosperms. These are the characteristic feature of angiosperms. Answer (1) Collenchyma is absent in monocotyledonous plants. Itis found in young stem and leaf petiole to provide mechanical support and resist bending of stems and tearing of young leaves. Answer (1) Gibberellin induces stem elongation in rosette Plants such as cabbage, just before the reproductive phase. Elongation in internodes takes place enormously due to this plant hormone known as bolting ‘Answer (2) In an angiospermic ovule, chalaza is present ‘opposite to micropylar end representing the basal Part of ovule, Answer (1) Insect pollinated flowers have slicky pollen grains Foul odoured flowers are pollinated by flies and beetles. ‘Answer (3) Volvox, Eudorina, Spirogyra and Ulothrix are examples of green algae. Volvox, Eudorina — Colonial forms. Ulothrix, Spirogyra — Filamentous forms. Mode of reproduction in algae are vegetative, asexual and sexual ‘Answer (4) Chiorella is green alga and is a good source of protein It is also used as food supplement by space travellers, AIM - 720, 50. Answer (1) More the number of a-Hydrogen atom, more will be the hyperconjugative structures (ie, more stability) (1) 08,64, -8-€H, = ee nyrogen atoms cH, oh, @) Hc-O% BH- EH cl, = tu hydrogen atom cH, CH, CH, ~ CH, ~ CH ~CH, ~ CH, = 4u hydrogen atoms H, CH, = 2u hydrogen atoms 58. Answer (3) Wine and beer are produced without distillation whereas whisky, brandy and rum are produced by distillation of the fermented broth 59, Answer (4) Mutualism is the population interaction in which both the interacting species are benefitted. Interaction SpeciesA Species B Matualism + + ‘Amensalism — — 0 Commensalism + 0 Predation + - 60, Answer (4) Anthropogenic ecosystem exhibits the presence of simple food chain, It is not a self-regulatory ecosystem. Answer (1) The DNA fingerprinting technique involves Southern blot hybridisation using radiolabelled VNTR as a probe. It includes 6 ()) Isolation of DNA (ii) Digestion of | DNA by restriction endonucleases (il) Separation of DNA fragments by electrophoresis, (iv) Transferring (blotting) of separated DNA fragments to synthetic membranes, such as nitrocellulose or nylon (v) Hybridisation using labelled VNTR probe (vi) Detection of hybridised DNA fragments by autoradiography (6)AIM - 720 CST-2_(Code-A)_(Answers & Solutions) 62. Answer 2) 72. Answer @) ih ln y geno codes for permease, which alows | Nutleols, gogl complex and ER reform during the entry of lactose into the cell. Lactose acts as telophase. an inducer which blocks the repressor and allows | 73. Answer (3) the expression of siuctual genes. As there Ts | The order of Man, Mango and Potato are Primata, non-eense mutation in the fsc'y gene, permease Sapindales and Polymoniales respectively. Ghaye wil not be produced and tus lactose | 74. Answer (4) Wwouldrnotbe able enterthecellanditwilnotbe | Iniatoms, the walls are embedded with silica and catabolzed thus have indestructible wals ca. Answer 2) 75. Answer) ; MIW. Bojerinck demonstrated thatthe extract of DNA ~ 5'— ATGCTCGACCCGAAGGCCACGTAA - 3° the infected plants of tobacco could cause RNA +51 ~ AUGCUCGACCCGAAGGCCACGUAA 9 infection in heathy plants and called the fuid as Protcin > Met Lou-AspProLye-A-Thr ve, ering um sn newer 64. Answer (4) Calyx and corolla are first and the second whorls Polymersation of nucleotides by DNA polymerase | of flower and individual members of them are is tomplata dopendent called sepals and petals respectively 65. Answer 2) TT. Anawer 4} Staminode represents sterile stamen. When Cyclic photophosphorylation occurs under low stamens get altached to petals (corolla) it is Tight infers and anaerobic condone. tejeo | amene get ttached to, pals (cool occurs when only ight of wavelengths beyond 680 | 7— rere ta fim are available for excitation Brinjal comes under Solanaceae family which is 66. Answer (1) also called as potato family. Some of the floral Chiorophyll ais the chet pigment associated with | sharacters of Solanaceae are. actnomorphe, lop a Pypegynus and vat astvaton bah ea 67. Answer (@) 79, Answer (@) Mitochondria have 708. type of ribosomes. Gregor. Mendel conducted hybridisation Subunis of 708 type of ibosomes are 50S 4m LL. GBitperinigh on garden pea for seven years fom 20s 1866 to 1863, during the mid-nineteenth century. 60. Answer 2) ea was selected by Mendel because Ithas mary Gist atematve tats Inner membrane of mtochondiia forms a umber | fyetnei aoiecey Y ataracters in pea plant for of infoldings cated cristae, Colg) apparatus | Mendel selected 7. characters, in ps consist of smaltdise shaped structures called | go sami cistemae. A number of organised flattened Experimental verification of the chromosomal membranous sacs called the thylakotds, sare theory of inheritance was done by T.H. Morgan. present hora, Fat membranous Woutes |g, eon called the stroma lamellae connect the thylakoids nswer Sine dies teaee ie Becarannton proces ous rot osu ding 69. Answer @) 82. Answer 2) Extremities or ends of chromosomes are called | Phenyketonura isan autosomal recessive tat feomoree Colour blindness laa sexlnked rooecshe disorder. 70, Answer (8 inswer (4) Tumer's syndrome is a result of aneuploidy. Chloroplast duplication occurs in Gr phase ofthe | yyrerac pcre ® a*esullel aneupiidy calleyele Myo 71. Answer (1) 83. Answer (4) In Anaphase 1, the homologous chromosomes The historic Convention on Biological Diversity separate, start moving toward the peles, while | (The Earth Summ) was held in Rio de Janeiro in Sister chromatids romain assockted ai ther | 1992. centromere, 84. Answer (2) During mitotic anaphase and anaphase II of meiosis, the centromeres split and the chromatids start moving towards the opposite poles. The increasing order of species diversity of birds ‘among different countries is as follows. Greenland < New York < India < Columbia. 7)CST-2_(Code-A) (Answers & Solutions) 8s. 86. 87. 88, 89. 90. 101 102. ‘Answer (3) Law of independent Assortment is based on the observation of dihybrid cross conducted by Mendel SECTION -B Answer (1) Cambium ring is actively cut off cells on the inner side towards pith mature into secondary xylem and on the outer side (towards periphery) mature into secondary phloem. ‘Amount of secondary xylem produced is more than secondary phloem Secondary medullary rays are narrow bands of parenchyma pass through secondary xylem and phloem in radial direction, ‘All tissues outside vascular cambium constitute bark, Answer (2) Abscisic acid is a carotenoid derivative, ‘Auxins are indole compounds. Ethylene is a gaseous hormone. Kinetin is adenine derivative plant regulator, Answer (1) In Pea and Beans, endosperm is completely consumed during embryo development, so called non-endospermic seeds. In angiosperms, each division is followed by wall formation in cellular mode of development of endosperm. ‘Answer (2) Porphyra, Gelidium and Gracilaria are the examples of red algae and they have floridean starch as stored food. Answer (2) Cyclosporin A is used as an immunosuppressive agent in organ-transplant patients andis produced by Trichoderma polysporum. growth 1 92, 93, 94, 95, 96, 97. 98. 99, AIM - 720, Answer (3) Female wasp uses the fig fruit as an oviposition site (egg laying) and in return, fig gets pollinated So here both are benefited which represents mutualism Answer (4) Stratieation ecosystem Answer (3) The RNA polymerase il transcribes the precursor of mRNA ie, hnRNA ‘Answer (4) The debate between proteins versus DNA as the genetic material was unequivocally resolved from Hershey-Chase experiment Answer (3) Meiosis is a reductional division whereas mitosis is an equational division. Gametic chromosome number would be equal to that of mother cell it they are formed through mitotic division Answer (4) Plasma membrane helps in transport of molecules across it ‘Answer (3) Mycoplasma can pass through bacteriological fiters and lack cell wall. They are the smallest living cells known Answer (2) ‘Axle placentation is shown by lemon, tulip, ‘Asparagus, chill, onion, tobacco and Colchicum ‘Answer (3) Ubiquinone receives electrons from complex | and complex I Is the structural aspect of an 100. Answer (2) Thalassemia is a recessive autosomal trait therefore it can be transmitted from parents to the offspring when both male and female individuals are carriers for the gene. ‘SECTION-A Answer (2) Connective tissues are most abundant and widely distributed in the body of complex animals. They are named connective tissues because of their special function of linking and supporting other tissues/organs of the body. Answer (3) S.L. Miller created discharge in a closed flask containing CHs, NHs, He and water vapour at 800°C. He observed the formation of amino acids, In similar experiments, others observed formation of sugars, nitrogenous bases, pigments and fats. 103. Answer (3) After 500 million years of formation of Earth, life appeared on this planet 104. Answer (4) ‘The body cavity of frogs accomodate different organ systems such as digestive, circulatory, respiratory, etc. (8)aM +720 CST.2_(Code-A)_ (Answers & Solutions) 108. 106. 107. 108. 109. 110. ‘The digestive system consists of alimentary canal and digestive glands. Digested food is absorbed by the numerous finger-like folds in the inner wall of intestine called villi and microvilli, The undigested solid waste moves into the rectum and passes out through cloaca, Answer (2) Each restriction endonuclease recognises a specific palindromic nucleotide sequence in the DNA. Palindromes are groups of letters that form the same words when read both forward and backward when orientation of reading is kept same. Answer (4) Using conventional methods of diagnosis (serum and urine analysis, etc.) early detection of diseases is not possible. ‘Answer (4) Cranial bones ~ 8 Facial bones — 14 ‘Skull bones ~ 29 Ribs ~ 24 ‘Answer (3) Pleranodon is an extinct fying reptile. Brachiosaurus were early long necked plant eaters and Stegosaurus had plated back and spikes at the end ofthe tal ‘Answer (2) In our body, the neural system and the endocrine system jointly coordinate and integrate all the activities of organs so that they function in a synchronised fashion The neural system provides an organised network of pointto-point connections for a quick coordination. The endocrine system provides chemical integration through hormones. Answer (4) During each cardiac cycle, two prominent sounds are produced which can be easily heard through a stethoscope. The first heart sound (lub) is associated with the closure of tricuspid and bicuspid valves whereas the second heart sound (dub) is associated with the closure of semilunar valves mn 112 113. 114. 116. 116, 417. 118. ‘Answer (2) Our lungs remove 200 mL. CO2 per minute under normal physiological conditions 60 * 200 mL = 12000 mLihour = 12 Uhour. Answer (2) Salamandra is an amphibian and amphibians have a three-chambered heart with two atria and a single ventricle. Four-chambered heart is present in crocodiles, birds and mammals. Answer (2) Blood is a fluid connective tissue containing plasma, red blood cells (RBCs), white blood cells (WBCs) and platelets. Fibroblasts are absent in blood, It is the main circulating fluid in our body that helps in the transport of various substances. Answer (1) + Flagellar movement helps in the swimming of spermatozoa, maintenance of water current in the canal system of sponges and in locomotion of protozoans like Euglena. + Ciliary movement assists in passage of ova through the female reproductive tract. + Leucocytes in blood exhibit amoeboid movement, Answer (4) + Animals that have had their DNA manipulated to possess and express an extra gene are known as transgenic animals. + Transgenic rats, rabbits, pigs, sheep, cows and fishes have been produced, athough over 95 per cent of all existing transgenic animals are mice. ‘Answer (3) Better awarenoss about sex related matters, increased number of medically assisted deliveries and better post-natal care lead to decreased maternal and infant mortality rates. ‘Answer (2) Spongillais a fresh water invertebrate ‘Answer (4) Fusion of male and female gametes is called fertilization, leading to formation of zygote. This is followed by formation and development of blastocyst and its attachment to the uterine wall called implantation (9)CST-2_(Code-A) (Answers & Solutions) 119. 120. 121 122, 123. 124, 126. ‘Answer (2) 1 Growth hormone ~ Acromegaly 4 Thyroxine ~ Gretinism + Ant-diuretic hormone — Diabetes insipidus 4 insulin — Diabetes metitus ‘Answer (3) The immature male germ cells (spermatogonia) produce sperms by spermatogenesis that begins at puberty in following sequence: Spermatogonia > Primary spermatocytes —> Secondary spermatocytes > Spermatids —> ‘Spermatozoa (sperms) ‘Answer (2) ori is @ sequence from where replication starts This sequence is also responsible for controlling the copy number of linked DNA. Solectable markers help in identitying and eliminating non-transformants and selectively permitting the growth of transformants. ‘Answer (2) ‘The host cell can be made competent to take up ‘DNA by treatment with calcium ions. ‘Answer (3) In ctenophores, reproduction takes place by sexual means only. In cnidarians, cnidoblasts (stinging cells) are present Answer (4) To legally check the increasing menace of female focticide, there is statutory ban on amniocentesis, in India. Amniocentesis is used to test for the Presence of certain genetic disorders such as down syndrome, haemophilia, etc. Answer (4) Three kinds of co-factors may be identified as prosthetic groups, co-enzymes and metal ions. Prosthetic groups are organic compounds and are distinguished from other co-factors in that they are tightly bound to the apoenzyme. ‘The essential components of many co-enzymes are vitamins 126. 127. 128. 129. 130. 131 132, AIM - 720, Answer (4) ‘Component ‘% of the total cellular mass Water 70-90 Proteins 10-15 Carbohydrates 3 Lipids 2 Nucleic acids 57 Tons. 1 Answer (2) In cockroaches, forewings are called tegmina ‘Tegmina arises from the mesothorax and they are not present in the abdomen: ‘Answer (4) The parturition is induced by @ complex neuroendocrine mechanism. The signals for parturition originate from the fully developed foetus and the placenta which induce mild uterine contractions called foetal ejection reflex. This triggers the release of oxytocin from maternal pituitary for stronger uterine contractions for childbirth “Answer (1) Since DNA fragments are negatively charged molecules, they can move towards the anode under an electric field through a medium, ‘Answer (3) Plasmids and bacteriophages have the abilly to replicate within bacterial cells independent of the control of chromosomal DNA. ‘Answer (2) ‘The maximum volume of air @ person can breathe in after a forced expiration is vital capacity. This includes TV + ERV + IRV. ‘Answer (4) ae 0, +H,0; H,c0, e = HCO; [S02 ane HW Carbonic anhydrase is the enzyme which catalyses the breakdown of carbonic acid. Zn’? is, the co-factor of this enzyme. This enzyme is present in very high concentration in RBCs. This enzyme accelerates the reaction rate by about 10, milion times. (10)aM 133. 134. 136. 136. 4137. 138. +720 Answer (1) ‘The myelinated nerve fibres are enveloped with ‘Schwann cells, which form a myelin sheath around axon. The gap between two adjacent myelin sheaths is called node of Ranvier. Myelinated nerve fibres are found in spinal and cranial nerves. Unmyelinated nerve fibre is enclosed by a ‘Schwann cell that does not form a myelin sheath around the axon, and is commonly found in autonomous and somatic neural systems. Answer (4) Plasmodium enters the human body as sporozoites (infectious form) through the bite of an infected female Anopheles mosquito, ‘Gametocytes are produced in the body of human host. Answer (1) Diseases which are easily transmitted from one person to another are called infectious diseases. Polio, diphtheria and pneumonia are infectious: diseases. Polio Is a viral disease. Diphtheria and pneumonia are bacterial diseases. ‘Among non-infectious diseases, cancer is the major cause of death. SECTION-B Answer (4) Enzymes are divided into 6 classes each with 413, sub classes and named accordingly by a four-digit number. Answer (2) Parathyroid hormone stimulates reabsorption of Ca? by the renal tubules and increases Ca’ absorption from the digested food. PTH is a hypercalcemic hormone ie.,it increases the blood Ca” levels. ‘Thyrocalcitonin is hypocalcemic hormone so along with PTH it plays a significant role in calcium balance in the body. Answer (2) AIDS is a sexually transmitted infection. Down's syndrome, haemophilia, sickle-cell anemia, etc. fare genetic disorders. Cancer is non-genetic and non- infectious disease. 139. 140. 141 142. 143. 144. 145. CST.2_(Code-A)_ (Answers & Solutions) ‘Answer (3) In 1900, the world population was around 2000 millon. In the year 1947, the population of India was approximately 360 million and reached to the billion mark by 2000 and crossed 1.2 billion in May 2011 Answer (1) ELISA is based on the principle of antigen- antibody interaction. Answer (2) ‘cin binding sites Hea ATP binding sites [cross arm Answer (2) ‘The thorn of Bougainville and tend of Cucurbita represent homology. Homology is based on divergent evolution. Homology inaicates common ancestry Answer (2) Monocytes, Neutrophils and Macrophages are phagocyt Macrophages are derived from monocytes. Answer (1) Lactation helps the mother in feeding the new- born, The milk produced during the lactation contains several antibodies absolutely essential to develop resistance for the new-born babies. So, breast-feeding during the initial period of growth of infant is recommended by doctors for bringing up a healthy baby. ‘Answer (4) + Innate immunity is a non-specific type of defence, which is provided by different types of barriers. These barriers prevent the entry of the foreign agents into our body. + There are 4 types of barriers: 1. Physical barriers — Skin on our body and mucus coating of the epithelium lining the respiratory, gastrointestinal and urogenital tracts. (11)CST-2_(Code-A) (Answers & Solutions) 146. 147. 151 152. 2. Physiological barriers — Acid in the stomach, saliva in mouth, tears from the eyes-all prevent microbial growth. 3, Cellular barriers — Certain types of leukocytes (WBCs) of our body like neutrophils (PMNLs), monocytes and natural killer cells in the blood as well as macrophages in tissues can phagocytose and destroy microbes. 4, Cytokine barriers - Virus-infected cells secrete proteins called interferons which protect non-infected cells from further viral infection. Answer (2) Frogs respire on tand and in the water by two different methods. In water, skin acts as aquatic respiratory organ. On land, the buccal cavity, skin and lungs act as the respiratory organs. During aestivation and hibemnation of frogs, gaseous exchange takes place through skin Answer (4) Asthma may be attributed to allergic reaction of the mast cells in the lungs. PHY: SECTION-A ‘Answer (4) In vacuum, all have same velocity equal o ¢. ‘Answer (2) 149. 160. AIM - 720, 148. Answer (2) Osmoreceptors in the body are activated by changes in blood volume, body fluid volume and ionic concentration. An excessive loss of fluid from the body can activate these receptors which stimulate the hypothalamus to release antidiuretic, hormone or vasopressin from — the neurohypophysis. Answer (3) Neural system of all animals is composed of highly specialised cells called neurons which can detect, receive and transmit different kinds of stimuli Neural system is present from aschelminths to chordates. porifers. Coelenterates have tissue level of organisation and Platyhelminthes show organ level of body organisation, Neurons are absent in Answer (1) A= Urochordata B = Cephalochordata In Urochordata, notochord is present only in larval tail, while in Cephalochordata, it extends from head to tall region. 153, Answer (3) B=(u-1)A So, Bs > 82> 8: 154. Answer (4) d=1mm= 10m D pez 104m 20 Pay 155. Answer (3) 2g _ 39 52 7 (12)AIM 720 CST.2_(Code-A)_ (Answers & Solutions) 156. Answer (2) iso, due to rotation of earth value of ‘g' varies as 2 g' = g—Ro*cosa 4x4 2 i aoa“ == Amis! = and tangential (where, 0 is the latitude angle) acceleration would be zero for uniform circular | 164. Answer (3) 187. 168. 159, 160. 161 162. 163. motion. ‘Answer (2) According to Galileo's ratio distance covered in consecutive second = 1:3:5:7 Distance covered in 1* second = Hi9 Distance covered in 2 second = 3H/9 Distance covered in 3° second = SHI9 where H is total height. Hence total time of fall is 3 sec, Answer (3) In uniform circular motion the acceleration of particle is varying but its speed remains constant. Answer (3) Translational kinetic energy of n moles of monoatomic gas ar Boer ana Answer (4) We know, P @=(10)(4) = 40 W Answer (2) Radius of gyration is radius /., length = OGS unit is centimetre (cm), Answer (3) Larger plastic region signifies better malleabilty of a material A body regains its original shape and size after removal of deforming forces only within elastic region. ‘Answer (1) Variation of g with distance from centre of earth (r) can be presented as 165. 166. 167 168, 169, Relative density = 42nsly of substance A Gensity of substance B RD = [MLTY Answer (2) 12400 5 aon = 12400 4 - 5000 A 248 = 500 nm ‘Answer (2) In nuclear fission energy is released When a nucleus is broken into two or more smaller nuclei itis called fission. Answer (1) When trivalent impurity is added to silicon then resulting material is p-type semiconductor. ‘Answer (3) Ds, Ds & De is forward biased and De is reverse biased Equivalent resistance for Ds, Ds & Ds branch 2x2 44-50 242 5 5x10 S10 Net equivalent resistance 50 Current (= 22-30 Answer (2) pt R volume(V 2a¢ AR 100 = 244100 R z Percentage increase in resistance = 2 * 0.2% A% (13)CST-2_(Code-A)_(Answers & Solutions) 170. Answer (4) 2000 400.0 _—! 100 V Vj 10.1 R, 600 6 Total power = P; + P2= Ri + PR -(4} «(200-400 (5) x(2v0-400 = 000 _ 50 y e673 471. Answer (1) The resistance of an ideal voltmeter is infinite. 172. Answer (2) Formula for radius of circle in magnetic field is Rom siven by R= Te For proton: mass ms, charge qo For alpha particle: mass 4m», charge 2. 173, Answer (2) ax ij & H 1 0 |=i(3-0)-j(-3)+K(2+0) 12-3 =3143]+36 l= V3? +3? +3? = 3V3Nm AIM 720 174, Answer (2) For any type of collision the kinetic energy may or may not be conserved but linear momentum is conserved 475. Answer (4) Linear momentum is conserved Syev 4 Loss of kinetic energy = Gain in elastic potential energy Aimy? Amv’ 2 16-10 2 1 2 32 2 SOD J Simi =1K 7 4 BRS iB x=y, 8K 176, Answer (1) L=1H 177 Answer (2) 1 (14)AIM 720 CST.2_(Code-A)_ (Answers & Solutions) 178. Answer (1) When angle of contact is acute then liquid wets the solid 4179, Answer (1) DKK K,+K, 22 (3x6)K? @+OK =4K Answer (3) PV= nRT =4Kk 180. For isochoric process V= constant Answer (2) Work done by gas = Area under P - V graph Pet, 181 = Pe[lex10*) + (12x10°))«(0.3) 1220%10° 0.3 2 =3% 105d 182. Answer (3) Total energy of a particle executing SHM is constant, 183. Answer (2) 1m Distance between two adjacent node and antinode a 4 at a = 025m ‘Answer (3) Due to electrostatic repulsion and absence of gravity, between the balls, angle between the string will be x rad. ‘Answer (2) ka 184. 185. v SECTION-B 186. Answer (4) For pure rolling v = Rw and vror = 2 Veo Ae? 187. Answer (1) Fea = 0 B or, 4(4) + 10(v) = 0 2V=—1.6 mis constant ie.) = By Hence, speed = 1.6 mis 188. Answer (1) 0.75 andj. = 0.9 => block will not Contact force = y{(mgcos®)’ +(mgsine)* = mg 189, Answer (2) f=20cm f=100m oom 20cm d= 100m Answer (2) 428 9 nae _(V25+¥f8)" _ 64 ‘on (25 -vf8)° Answer (3) LC=1MSD-1VSD = 02-202 30 190. hy 4 =16 191 (15)CST-2_(Code-A)_(Answers & Solutions) 192. Answer (3) K.E = — (Total energy) = 151 eV P.E=2 (Total energy) =2(-1.51 V)=-3.02 6 193. Answer (2) y-(AsB)- A y=(0-1)5 yottet 494. Answer (1) Gauge pressure = absolute pressure-atmospheric pressure = pgh = 1,03 x 103 x 40 x 2000 = 206 « 108 Pa = 206 atm 195. Answer (4) “Av WaT 196. Answer (4) After long time capacitor will be fully charged, hence no current will pass through it. vioveoev = — (i) Ra 2R+R BR Potential across capacitor = /* R Vip’ ; Ve = gaxr = Ai) Charge on the capacitor a-cvsa-cx 3 AIM - 720, 197. Answer (3) 8.81077 «100 x2 “4x07 =22* 109m x2 =44mm 198. Answer (1) Pp *aegr? ExP Ear 199, Answer (4) Ms Ns ve Np 0 * Vo= 10 *-100 000 v 8Pa Vsls= 0.8 Vole 1000 x Is = 0.8 x 2A x 100 1.6 x 100 ~7000— 200. Answer (2) Is = =0.16A J pot? 1 pot? = Bol = +Bal? penne a (16)