Activation of Amylin Gene

Transcription by the LIM Domain

Homeobox Gene is/-l

Min Wang and Daniel J. Drucker

DeDartments of Medicine (D.J.D.). Clinical Biochemistry (M.W.),

and Genetics (D.J.D.) ’ ”
Banting and Best Diabetes Centre

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

The Toronto Hospital
University of Toronto
Toronto, Canada M5G 2C4

The amylin (IAPP) and insulin genes are coexpressed INTRODUCTION

in the pancreatic p-cell and share related promoter
elements that may bind similar islet transcription fac- The phenotypically distinct endocrine cell populations
tors. The observation that these promoter elements of the pancreatic islets represent useful models for the
contain AT-rich subdomains suggests that ho- analysis of the mechanisms underlying the control of
meobox proteins may be important for the regulation hormone gene transcription. Analysis of the molecular
of both insulin and amylin gene transcription. We determinants of islet and p-cell-specific gene tran-
show here that the LIM domain homeobox protein scription currently involves the elucidation of enhancer
isl-l activates the rat amylin promoter in both fibro- sequences and cognate transcription factors that me-
blast and islet cell lines. Mutation of the rAMY pro- diate cell-specific gene transcription (i-6). The rat in-
moter TAAT motifs was associated with a marked sulin gene has been analyzed in considerable detail
reduction in both basal and isl-l-dependent tran- and appears to bind a number of distinct transcription
scriptional activity. The isl-l homeodomain binds to factors, which function cooperatively to regulate
the AT-rich AMY element (-156 to -137) in the hu- P-cell-specific insulin gene transcription. In contrast,
man amylin (hAMY) gene promoter, and electro- much less is known about the islet- or intestine-spe-
phoretic mobility shift assay experiments using isl-l- cific control of glucagon and somatostatin gene ex-
specific antiserum detected the formation of an pression, and even less information is available about
hAMY-isl-l complex using nuclear extract from the factors important for regulation of amylin gene
InRl-G9 islet cells. Although isl-l binds to both the transcription (7, 8).
insulin and amylin gene promoter elements in vitro, The common embryological origin of the different
these sequences display marked differences in their islet cell types suggests that the control of hormone
relative transcriptional properties when ligated adja- gene transcription in the endocrine pancreas may be
cent to a heterologous promoter and transfected into dependent, in part, on sets of shared transcriptional
InRl -G9 islet cells. The insulin gene E2 sequence that regulators expressed in all four islet cell types (6,
binds isl-l (-239 to -299) functions as a negative 9-14). Comparison of the DNA sequences in the prox-
element, whereas the hAMY sequence activates the imal promoters of the islet hormone genes has iden-
thymidine kinase promoter in islet, but not nonislet, tified a number of AT-rich sequences in the insulin,
cell lines. Transfection of isl-l -depleted isl-l (AS)- amylin, glucagon, and somatostatin gene promoters
InRl -G9 cell lines demonstrated that the E2 element (9, 15). These sequences contain one or more copies
continued to repress thymidine kinase promoter ac- of a TAAT motif that forms a core consensus sequence
tivity, whereas the positive transcriptional activity for binding of homeobox transcription factors. Exper-
mediated by the AMY element was considerably re- imental approaches used for the identification of ho-
duced in isl-l (AS)-InRl-G9 cell lines. These data meobox proteins expressed in the islets include
demonstrate that highly similar elements in islet hor- screening cDNA expression libraries with multimerized
mone gene promoters display differential functional TAAT-containing probes (1) and the use of RT-PCR
properties and support a role for the isl-l homeodo- strategies, employing oligonucleotide primers com-
main protein in the regulation of amylin, but not in- plementary to conserved homeodomain sequences.
sulin, gene transcription. (Molecular Endocrinology The results of these experiments have demonstrated
lo: 243-251,1996) that more than a dozen distinct homeobox genes are
expressed in islets and islet cell lines (11, 16).
o&w?-8809/96/$3.00/O Several homeobox genes expressed in the endo-
Molecular Endocrinology
Copyright 0 1996 by The Endocrine Society crine pancreas have been shown to be candidate reg-

243
MOL END0 . 1996 VollONo.3
244

ulators of insulin gene transcription. DNA-binding and mobility shift assay (EMSA) experiments. This fusion
transfection experiments have shown that genes such protein contains the isl-l homeodomain and 3’-se-
as Imx-1, cdx-3, and IPF-l/STF-l/IDX-1 (PDX-1) not quences but not the LIM domains (15), as the isl-l LIM
only bind to the TAAT motifs in the insulin promoter domains have been shown to inhibit isl-l binding in
but also activate insulin gene transcription (1, 1 l-l 3). vitro (22). The human amylin (hAMY) probe binds isl-l ,
Furthermore, the PDX-1 gene appears to be a deter- and this binding was effectively diminished by increas-
minant of pancreatic development, as mice lacking ing concentrations of excess unlabeled specific AMY
PDX-1 fail to develop a pancreas (17). competitor DNA (Fig. IA). Competition for isl-l binding
Although an increasing number of homeobox genes to AMY sequences was also observed with the insulin
have been isolated from islets and islet cell lines, the gene E2 (similar to the FLAT element) and Pl se-
genetic targets for these transcription factors have not quences, although these oligonucleotides were not as
been clearly identified. For example, although the ho-

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

effective as the AMY sequence in displacing isl-l bind-
meobox gene isl-l was originally isolated from islet ing. In contrast, the Ga oligonucleotide containing an
cells by expression cloning using AT-rich sequences AT-rich sequence from the rat proglucagon gene pro-
from the rat insulin promoter (18) a role for isl-l in the moter (15, 23) effectively competed for isl-l binding to
regulation of insulin gene transcription has not been the AMY probe and appeared to exhibit comparable
established (1, 6). Although isl-l binds to rat insulin affinity for isl-l binding. The proglucagon gene Gb and
promoter sequences in vitro, isl-l was originally not Gc sequences also competed for isl-l binding with
detected in DNA-protein complexes formed between slightly reduced affinity, whereas no competition was
insulin gene TAAT sequences and nuclear extracts observed with lOOO-fold molar excess GATA oligonu-
prepared from insulin-producing islet cell lines (6). cleotides (Fig. 1A). To assess the efficacy of isl-l bind-
Subsequent experiments with isl-l -specific antisera ing to a second potential binding site in an islet p-cell-
demonstrated that immunoreactive isl-l is expressed specific promoter, we carried out an EMSA experiment
not only in p-cells but in all four islet cell types (19, 20), using the insulin gene proximal PI sequence. As pre-
raising the possibility that islet hormone genes distinct viously described, the isl-l homeodomain also binds
from insulin may also be targets of isl-l action (15). the PI probe (6); however, the binding is easily dimin-
Although current evidence suggests that the insulin ished in the presence of excess competitor AMY or E2
gene is not a major target for isl-l action, it remains
sequences (Fig. 1 B), consistent with the recent dem-
possible that isl-1, by acting on distinct genetic tar- onstration that the proximal Pl sequence is likely the
gets, does play a role in the regulation of gene tran-
major target for PDX-1 binding.
scription in the pancreatic p-cell. As AT-rich se-
The observation that the isl-l homeodomain binds
quences (that bind nuclear proteins) have recently
sequences in the hAMY promoter prompted us to
been identified in the 5’-flanking region of the amylin
ascertain whether full length isl-I, as synthesized in
gene (Refs. 9 and 21 and Table 1) we hypothesized
islet cells, could also bind to the same hAMY se-
that isl-l expression in the p-cell may contribute to the
quence in vitro. Nuclear extracts were prepared from
regulation of amylin gene expression. To examine this
the hamster InRl -G9 islet cell line that was previously
possibility, we have carried out DNA-binding and
shown to express the isl-l gene and contains immu-
transfection studies to determine whether isl-l is a
noreactive nuclear isl-l (24). The insulin gene E2 se-
candidate regulator of the amylin gene promoter.
quence forms a number of distinct complexes with
InRl -G9 extract, and addition of isl-l -specific antisera
to the binding reaction supershifted a high molecular
RESULTS weight, slowly migrating complex (Fig. 2A). This slowly
migrating supershifted complex was not seen with the
To determine whether isl-l binds potential target se- insulin gene PI probe, although PI sequences bind
quences in the human amylin promoter, we prepared the isl-l homeodomain in vitro (Fig. IB). The hAMY
a TrpE-isl-l fusion protein for use in electrophoretic probe also formed complexes with InFil-G9 extract

Table 1. TAAT Sequences in the Insulin, Glucagon, and Amylin Gene Promoters
Gel%? Name Location Sequence
rlns I E2 -230 to -208 GCCCCTTGTTAATAATCTAATTA
Pl -85 to -53 GCCCT~GGGCCAAACGGCAA

hAmylin AMY -156 to -137 GAGTTAATGTAATAATGACC

rAmylin rAMY -162 to -136 GCwATTTACCTAAGTGTmGTG

rAMY(Mut) GCGCATATTTACCTAAGTGTGCATGTG

rGlu Ga -60 to -36 GCGmATCTGCAAGGCTAAACAG

Gc -73 to -49 ATTTATATTGTCAGCGmATCTG
Gb -95 to -69 CCCCATTATTTACAGATGAGAAATTTA
Amylin Gene Transcription 245

inution of complexes C and D, whereas the E2, Pl,

and Ga/Gb/Gc sequences were much less effective in
diminishing the formation of complexes C and D (Fig.
3B). The pattern of complex formation and competi-
tion obtained with the insulin gene E2 probe was
somewhat different (Fig. 3C). Complexes A and B were
more effectively competed by the E2 probe, whereas
the formation of complexes C, D, and E was much less
distinct with the E2 compared with the AMY probes
(Fig. 3). These observations suggest that the E2 and
AMY probes may exhibit varying affinities for DNA

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

binding to similar proteins, or alternatively, complexes
A-E may contain one or more proteins, depending on
the specific probe used for these studies.
The results of these binding experiments suggested
that isl-l may represent one component of a complex
that forms on the AT-rich sequence of the amylin gene
promoter. To determine whether isl-l directly acti-
Fig. 1. EMSA Analysis of isl-l Binding vates the amylin promoter we transfected BHK fibro-
A, Binding to the AMY element in the human amylin gene
blasts with rat amylin-luciferase plasmids in the pres-
promoter. B, Binding to the Pl element in the insulin gene
ence and absence of isl-1. Isl-l increased the
promoter. Increasing amounts (20-, 200-, or 1 OOO-fold molar
excess) of designated unlabeled oligonucleotides (shown at transcriptional activity of - 1 SOrAMY-LUC more than
the top of each panel, see Table 1) were used to compete for 3-fold, whereas deletion (-127rAMY-LUC) or muta-
isl-l binding. The arrowhead designates complexes formed tion (-164rAMY(Mut)-LUC) of the AT-rich promoter
with the AMY (A) or Pl (B) probes, respectively. Comp, Com- sequences resulted in a loss or marked diminution of
petitor DNA sequence; FP, free probe. In each reaction, isl-l -dependent activation (Fig. 4A). Similarly, the
10,000 cpm of end-labeled, double-stranded oligonucleotide basal transcriptional activity of the -127rAMY-LUC
and 2 pg unpurified bacterial extract containing the TrpE-isl-l and - 164rAMY(Mut)-LUC plasmids was markedly
fusion protein were used.
lower than the activity of the - 1 SOrAMY-LUC plasmid
(which contains the TAAT motifs) in InRl-G9 islet cells
that migrated in comparable positions to the com- (Fig. 4B). Furthermore, a similar pattern (compared
plexes detected with the insulin gene E2 probe, and a with BHK fibroblasts) of isl-l-dependent activation of
faint supershift of a high molecular weight complex the rAMY promoter was obtained after transfection of
was also observed with isl-l antisera (Fig. 2a, lane 6). InR1 -G9 cells with the reporter gene (- 1 SOrAMY-LUC)
An identical supershift was also observed with the containing the intact TAAT motifs (Fig. 4C).
proglucagon gene Ga sequence (Fig. 2a), as well as To further assess the enhancer-like properties of the
with the Gb probe (after a longer exposure of the TAAT motifs in the amylin promoter, the hAMY se-
autoradiograph; see Ref. 15). Although minor shifts of quences that bind isl-l were ligated adjacent to the
the complexes designated A and B were also ob- thymidine kinase (TK) promoter in a chloramphenicol
served in the presence of antisera, the shifts in the acetyltransferase (CAT) reporter plasmid (26). As a
mobility of bands A and B were also observed with control, we also prepared similar TK-CAT plasmids
preimmune serum (Fig. 2b, lane 3, designated PI). containing the insulin gene E2 sequences. The amylin
As several islet hormone genes contain AT-rich se- (AMY) and (E2)-TK-CAT plasmids were transfected
quences in their proximal promoter regions (Table 1 into BHK and NIH 3T3 fibroblasts, JEG choriocarci-
and Refs. 1.5 and 25), we compared the relative affinity noma cells and InRl-G9 islet cells (Fig. 5). Transfec-
of these AT-rich sequences for isl-l binding using tion of InRl-G9 cells with (AMY)-TK-CAT plasmids
InRl-G9 extract and both hAMY and E2 probes (Fig. containing AMY sequences tandemly ligated in differ-
3). Both the hAMY and E2 sequences were highly ent orientations adjacent to the TK promoter resulted
effective competitors for isl-l binding. The formation in significant activation of TK-CAT activity, compared
of the slowly migrating isl-l complex was slightly di- with the values obtained after transfection with the
minished by excess proglucagon gene Ga/Gb/Gc se- control TK-CAT plasmid alone. Only minor changes in
quences, but the rat insulin gene Pl was only a weak CAT activity were observed after transfection of the
competitor for isl-l binding (Fig. 3A). Although excess non-islet cell lines with the identical (AMY)-TK-CAT
unlabeled hAMY and E2 oligonucleotides also mark- plasmids (Fig. 5). In contrast, the insulin gene E2 se-
edly diminished the formation of complexes A and B quences mediated repression of TK promoter activity,
with the AMY probe (Fig. 3, A and B), only partial and this repression was most marked in the InRl-G9
attenuation of complex A and B formation was ob- islet cell line (Fig. 5).
served after competition with the Pl or proglucagon The transfection data (shown in Figs. 4 and 5) are
gene Ga/Gb/Gc sequences. Furthermore, competition consistent with the hypothesis that the AMY element
with excess hAMY sequences resulted in marked dim- binds one or more positive regulators of amylin gene
MOL END0 1996 VollONo.3
246

Pl AMY Ga Gb
Probe+ E2
nnnnn Antisera

Anllbody + - + m + - + - + - + I I
-AB isl-l PI

Ab+IsI-1 +

ISI-l---$

B-B

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

Free,
Probe
E 2 Probe
(b)
12345676 9 10

Nuclear Extract: InRl-G9 Fgum 2

b)
Fig. 2. Islet Hormone Gene Promoter Elements Bind Endogenous Full-Length isl-l in InRl -G9 Islet Cell Nuclear Extracts
The sequence of the specific probes used in the EMSA reactions are shown in Table 1. Ab+isl-1 designates the supershifted
complex seen with immune, but not preimmune, isl-l antisera. Thearrow shows the position of the slowly migrating isl-l complex
that is supershifted by isl-l antiserum. A-D represent additional DNA-protein complexes not yet definitively identified.

transcription. Nevertheless, as EMSA experiments us- ent isl-l(AS)-InRl-G9 cell lines with the identical
ing the AMY element and InRl-G9 extract identified (AMY)-TK-CAT plasmids (Fig. 5). In contrast, the insu-
multiple complexes that interact with hAMY se- lin gene E2 element repressed TK-CAT activity in both
quences (Figs. 2 and 3), it is difficult to isolate the role wild type and isl-l(AS)-InRl-G9 cell lines, with the
of isl-l in the regulation of isl-l promoter activity degree of repression only slightly greater in the isl-
through the AMY element. To determine the contribu- l(AS)-InRl-G9 cell lines (Fig. 5B). These results sug-
tion of isl-l to the regulation of amylin gene transcrip- gest that isl-l contributes to the transcriptional acti-
tion, we carried out a series of transfections using wild vation of the amylin gene promoter in islet cells by
type and isl-l-depleted InRl-G9 cells. The isl-l(AS)- interaction with the AMY promoter element.
In!?1 -G9 cell lines were created by transfecting a se-
ries of four distinct isl-l antisense expression vectors
into InRl-G9 cells. These antisense cell lines display
markedly reduced levels of isl-l mRNA transcripts and DISCUSSION
immunoreactive isl-l protein as assessed by a com-
bination of Northern and Western blot analyses (15). The coexpression of insulin and amylin in the islet
The results of these transfection experiments are p-cell, taken together with the identification of similar
shown in Fig. 5B. In contrast to the 3.5 to 4-fold nucleotide sequences in the insulin and amylin pro-
activation of TK-CAT transcriptional activity by the moters, suggested that these genes may share com-
AMY sequences detected in wild type InRl-G9 cells mon transcriptional regulators that modulate gene ex-
(Fig. 5A), only a 1.2- to 1.8-fold activation of TK-CAT pression in p-cells (9). Although the molecular control
activity was observed after transfection of two differ- of insulin gene transcription remains the subject of
Amylin Gene Transcription 247

300x

(A) Compebtor + _ Ez Pl PAW G3 l3 Gc GATA

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

Free _
Probe

1 2 3 4 a a 7 a
Nuclear Extract: I”Rl-GS Probe: N.W

500X

(B)
co.4 w 3wx
Compelitor+ _ E2 PI AMY Ge a Oc GATA

1 2 3 4 5 a 7 a 9
N”C!ea,
Exlras, ,“R,09 PldLm Auv
Fig. 3. Specificity of DNA-Protein Complex Formation Using the AMY (A and B) or E2 (C) Probes in EMSA Experiments with
InRl -G9 Islet Extracts
The binding reactions were carried out in the presence of either 300-fold (A and C) or 500-fold (B) molar excess of unlabeled
competitor oligonucleotide (sequences shown in Table 1). The arrow shows the position of the slowly migrating isl-l complex that
is supershifted by isl-l antiserum (isl-l + Ab). A-E represent additional DNA-protein complexes not yet definitively identified.

intense investigation, much less is known about the ing sites for homeobox genes, located at position
regulation of amylin gene expression. Amylin- -155to-137and-152to-134inthehumanandrat
luciferase reporter genes exhibit relatively greater tran- amylin promoters, respectively (21, 27). These regions
scriptional activity in islet compared with non-islet cell are similar in sequence to the FLAT element in the
lines, and the preferential expression in p-cells is seen insulin gene (9), and DNA-binding studies using ham-
with reporter plasmids containing as little as 189 or ster insulinoma nuclear extracts have shown that the
248 bp of human or rat .5’-flanking sequences, respec- FLAT element efficiently competes for protein binding
tively (27). Both the human and rat amylin genes con- to the human amylin gene AX sequence, from -176 to
tain an AT-rich sequence, consistent with known bind- -116 (9). These observations strongly suggest that
MOL END0 1996 VollONo.3
248

Relative CAT Activity

A

BHK fibroblasts
T is/- I

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

B
InRl -G9 islet cells

AMY-1
E-2
isl-l(AS)lnRl-G9 A20

AMY-1
id-l(AS)lnRl-G9 820
E2-2
InRl-G9 islet cells

Fig. 5. Transcriptional Properties of TAAT Elements in

Heterologous Cell Lines
A, Transcriptional activities of the E2 and AMY elements in
islet and nonislet cell lines. The plasmids were transfected
into InRl-G9 islet cells, BHK and NIH 3T3 fibroblasts, and
JEG choriocarcinoma cells. The data shown represent the
Fig. 4. Transcriptional Activity of Rat Amylin-Luciferase
mean t SEM of three different transfections, each carried out
Plasmids in BHK Fibroblasts (A) and InRl-G9 Islet Cells (B
in triplicate. The copy number and orientation of the specific
and C)
E2 and AMY elements (adjacent to the TK promoter) are
A, Rat amylin-luciferase plasmids (10 pg) were cotrans-
shown with arrows. PUTKAT contains the TK promoter, but
fected into BHK fibroblasts with the CMV expression vector
no other enhancer elements. B, Transcriptional activity of the
pBAT7 alone (-) or with 10 pg of CMV-isl-l (+), SK-LUC is
TK-CAT plasmids in isl-l (AS)-InRl-G9 islet cell lines. The
the promoterless luciferase plasmid; -1 SOrAMY-LUC con-
plasmids shown in Fig. 5B were transfected into two different
tains 190 bp of rat amylin 5’-flanking sequences and 72 bp of isl-1 (AS)-InRl-G9 cell lines (A20 and B20) that exhibit re-
5’-untranslated region; - 164rAMY(Mut)-LUC contains 164
duced levels of isl-l mRNA and immunoreactive protein (15).
bp of rat amylin 5’-flanking sequences, incorporating the
The data shown represent the mean Itr SEM of three different
mutations in the TAAT motifs shown in Table 1, and 72 bp of
transfections, each carried out in triplicate.
5’untranslated region; -127rAMY-LUC contains 127 bp of
rat amylin 5’-flanking sequences and 72 bp of 5’-untrans-
lated region. The relative luciferase activity (mean 5 SEM) was
normalized to the values obtained with the promoterless Despite the formation of highly similar DNA-protein
plasmid SK-LUC. B, Relative transcriptional activities of the complexes with the amylin and insulin gene promoter
rat amylin-LUC plasmids in InRl-G9 islet cells. The relative sequences (Ref. 9 and Fig. 2), these elements appear
values for luciferase activity (mean 2 SEM) were normalized to to display unique functional activities when linked to
the luciferase activity obtained after transfection of the pro-
heterologous promoters. The results of our transfec-
moterless luciferase plasmid SK-LUC. C, Activation of rat
tion experiments demonstrated that the insulin gene
amylin-LUC plasmids by isl-l in InRl -G9 rfi%. The amylin-
luciferase plasmids described in (A) were cotransfected with E2 sequences (-230 to -208) appear to function as a
10 pg of pBAT7 (-) or with 10 pg of CMV-isl-l (+). The mean negative element, whereas the AMY sequences (- 156
luciferase values obtained for each plasmid without isl-l were to -137) function as a positive element and activate
assigned a relative value of 1. transcription from a heterologous promoter in InRl -G9
islet cells. These observations are in good agreement
with the data obtained using similar reporter plasmids
and the insulin gene FLAT elements and amylin gene
the AT-rich sequences in the insulin and amylin gene AX sequences cloned adjacent to the TK promoter in
promoters likely bind and are regulated by a number of transfected HIT cells (9). The AMY element used here
highly related, if not identical, homeobox transcription (20 bp) is much smaller than the AX element used in
factors. previous experiments (59 bp), and this may account
Amylin Gene Transcription 249

for some of the minor differences observed in EMSA vitro, the observation that the AMY element and isl-l
and transfection experiments. Despite the comparable form a slowly migrating complex suggests that isl-l
patterns of nuclear protein binding activity obtained may associate with other proteins on the amylin pro-
with the insulin and amylin gene AT-rich sequences moter in vivo. Although specific partners that bind isl-l
(Fig. 2 and Ref. 9), our transfection experiments clearly have not yet been identified, recent experiments dem-
demonstrate that the insulin and AMY sequences dis- onstrate that LIM domain proteins may form com-
play differential functional activity. This suggests that plexes with heterologous transcription factors, includ-
these elements may interact with the nuclear proteins ing members of the HLH family and POU-type
in a differential manner to account for the differences homeodomain proteins (29, 30), and the LIM domains
in transcriptional properties exhibited by these ele- have been implicated as important determinants of
ments. Alternatively, the binding proteins detected in homodimerization in vitro (31).

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

EMSA experiments may represent related yet distinct The amino-terminal LIM domains appear to inhibit
transcription factors that confer distinct functional
homeobox binding to target sites in various promoters
properties to the insulin and AMY elements.
(22,32). Truncation of the isl-l LIM domains enhanced
Consistent with our data demonstrating differential
binding of the isl-l homeodomain to a pool of AT-rich
functional properties of the E2 and AMY elements in
oligonucleotides (22), and a truncated isl-l protein was
transfection experiments, dissociation of endogenous
amylin and insulin gene expression in rat islets and more effective in activating transcription of a metallo-
immortalized islet cell lines has been observed in vivo thionein-CAT reporter plasmid, compared with a full
(28). lmmunocytochemical analysis of newborn rat is- length isl-l protein with intact LIM domains, providing
let cells demonstrated a small population of amylin- evidence that the LIM domain not only restrains DNA
immunopositive cells that did not contain immunore- binding but also inhibits transcriptional activation (22).
active insulin (28). The NHI-6F islet cell line exhibits a Inactivation of the LIM domains in the Xlim-1 protein
number of hormonal phenotypes, including variable increased Xlim activity, suggesting that the LIM do-
expression of the glucagon, insulin, and amylin genes; mains function to restrain Xlim activity in vivo (32). In
however, NHI-6F subclones consistently demonstrate vitro binding studies using either the isl-l homeodo-
high levels of amylin and proglucagon but not insulin main or full length isl-l to select consensus binding
mRNA transcripts, suggesting that despite the coex- sites demonstrated that the homeodomain alone se-
pression of the insulin and amylin genes in the normal lects a different population of oligonucleotides than
pancreatic p-cell, the control of insulin and amylin the full length isl-l protein (22). We also observed
promoter activity is likely differentially regulated (28). differences in relative DNA-binding properties with the
The coexpression of the amylin and proglucagon truncated isl-l protein (containing homeodomain and
genes in NHI-6F cells is particularly intriguing in light of carboxy-terminal sequences) compared with full
recent data demonstrating that the proximal proglu- length isl-l in InRl -G9 nuclear extracts. The TrpE-isl-l
cagon promoter contains isl-l binding sites that dis- homeodomain binding to the AMY probe was more
play enhancer-like activity in islet cell lines (15). The readily displaced by lower concentrations of AMY
enhancer activity of the distal proglucagon gene competitor oligonucleotides compared with E2 com-
TAAT-containing Gb/Gc sequence was markedly di- petitor sequences. In contrast, the E2 sequences were
minished after transfection of isl-l (AS)-InRl -G9 islet more effective competitors in displacing protein bind-
cells, suggesting a role for isl-l in the positive regula- ing to the AMY probe when full length isl-l was
tion of proglucagon gene transcription (15). Taken to- present in InRl-G9 extracts. These observations pro-
gether, these observations support the hypothesis vide indirect evidence that supports a role for the isl-l
that isl-l may functional as a positive regulator of islet
LIM domains in modulating homeodomain binding to
hormone gene transcription via interaction with AT-
the AMY promoter in vitro. Future studies should be
rich sequences in distinct islet gene promoters.
directed at elucidating the additional proteins that
Several lines of evidence suggest that isl-l is likely
form complexes with the AMY element, as well as
only one of several transcription factors that modulate
identifying the potential factors that interact with isl-l
amylin gene expression through the AT-rich AMY site
on the amylin promoter in viva.
in the amylin promoter. EMSA experiments with the
AMY probe detected several major complexes (A-E,
Figs. 2 and 3) that were more abundant than the slowly
migrating complex that contains immunoreactive isl-1. MATERIALS AND METHODS
Furthermore, the increased transcriptional activity me-
diated by the AMY sequences in InRl-G9 cells was
Generation of aTrpE-id-1 Fusion Protein
only partially diminished after transfection of the isl-l
(AS) InRl -G9 cell lines, in keeping with a role for one or
The isl-l cDNA (24) encoding the homeodomain and 3’-
more of the DNA-binding proteins (present in com- sequences from amino acid 118 to the stop codon was
plexes A-E identified in Fig. 3) in the control of amylin generated by PCR and inserted in the TrpE expression vector
promoter activity through the AMY site. Although the path11 to generate the plasmid TrpE-isl-1. The isl-l se-
isl-l homeodomain clearly binds the AMY sequence in quence was confirmed by DNA sequencing.
MOL END0 1996 VollONo.3
250

EMSA Experiments REFERENCES

The EMSA experiments were carried out as previously de- 1. German MS, Wang J, Chadwick RB, Rutter WJ 1992
scribed (15, 33). For experiments with antisera, 5 ~1 isl-l- Synergistic activation of the insulin gene by a LIM-homeo
specific (20) or preimmune antisera were added to the nu- domain protein and a basic helix-loop-helix protein:
clear extract. Nuclear extracts were prepared as described building a functional insulin minienhancer complex.
(34). The EMSA was performed as described in Ref. 33. The Genes Dev 6:2165-2176
double-stranded oligonucleotide sequences used in the 2. German MS, Blanar MA, Nelson C, Moss LG, Rutter WJ
EMSA experiments, as well as in the generation of the TK- 1991 Two related helix-loop-helix proteins participate in
CAT constructs, are shown in Table 1, with a 5’- BamHl separate cell-specific complexes that bind the insulin
overhang (top strand) and a 5 base 5’-Bglll overhang (bottom enhancer. Mol Endocrinol 5292-299
strand) incorporated for end-labeling. The GATA sequence 3. Cordle SR. Henderson E. Masuoka H. Weil PA. Stein R

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

used as nonspecific competitor DNA was 5’-TTCAACGTG- 1991 Pancreatic beta-ceil-type-specific transcription of
CAGCCGGAGATAAGGCCAGGCCCGAA-3’. the insulin gene is mediated by. basic helix-loop-helix
DNA-bindina proteins. Mol Cell Biol 11:1734-l 738
4. Peyton M, Moss LG, Tsai M-J 1994 Two distinct class A
helix-loop-helix transcription factors, E2A and BETAl,
Generation of Antisense Cell Lines, Plasmids, and form separate DNA binding complexes on the insulin
Cell Transfections gene E box. J Biol Chem 269:25936-25941
5. Emens LA, Landers DW, Moss LG 1992 Hepatocyte nu-
Four isl-l antisense expression plasmids containing vari- clear factor 101 is expressed in a hamster insulinoma line
ous lengths of isl-l 5’-untranslated, intron, and translated and transactivates the rat insulin I gene. Proc Natl Acad
sequences were used to generate stable isl-l (AS)-InRl -G9 Sci USA 89:7300-7304
6. Ohlsson H, Thor S, Edlund T 1991 Novel insulin promot-
cell lines as described (15). G418-resistant InRl -G9 clones
er-and enhancer-binding proteins that discriminate be-
were individually expanded, and endogenous isl-l gene
tween pancreatic alpha and p-cells. Mol Endocrinol
expression was characterized by Northern and Western
5:897-904
blotting (15, 24). InRl-G9 cells were transfected by the
7. Nishi M, Sanke T, Nagamatsu S, Bell GI, Steiner DF 1990
diethylaminoethyl-dextran method (35). The rat amylin 5’- Islet amyloid polypeptide. J Biol Chem 265:4173-4176
flanking sequences were generated by PCR from rat 8. Cooper GJS 1994 Amylin compared with calcitonin
genomic DNA using a common 3’-primer complementary gene-related peptide:Structure, biology and relevance to
to sequences in exon 1: 5-CCTPCAGGTITACCTTTCAGT- metabolic disease. Endocr Rev 15:163-201
GGGCAG-3’ generating sequences containing the first 83 9. German MS, Moss LG, Wang J, Rutter WJ 1992 The
bp of 5’-untranslated region (36). For the -lSOrAMY- insulin and islet amyloid polypeptide genes contain sim-
LUC plasmid, the 5’-primer is: 5’-CCGGATCCACA- ilar cell-specific promoter elements that bind identical
CAAAGGCACTCAGTA-3’; for - 164rAMY(Mut): 5’-CCG- D-cell nuclear complexes. Mol Cell Biol 12:1777-l 788
GATCCTGCGCATATTTTACCTAAGTGTGCATGTG-3’; and 10. Robinson GLW G, Peshavaria M, Henderson E, Shieh
for - 127rAMY-LUC:5’-CCGGATCCACACAAAGGCACT- S-Y, Tsai M-J, Teitelman G, Stein R 1994 Expression of
CAGTA-3’. All amylin genomic sequences generated by the trans-active factors that stimulate insulin control el-
PCR were verified by DNA sequencing. The CMV expres- ement-mediated activity appear to precede insulin gene
sion plasmid pBAT7 (1) was a gift from Michael German transcription. J Biol Chem 269:2452-2460
(San Francisco, CA). The CMV-isl-l expression vector was 11. Miller CP, McGehee Jr RE, Habener JF 1994 IDX-1:a new
generated by subcloning the rat isl-l coding sequences homeodomain transcription factor expressed in rat pan-
into the BamHIIXbal sites of pBAT7. Minienhancer TK-CAT creatic islets and duodenum that transactivates the so-
matostatin gene. EMBO J 13:1145-l 156
plasmids were constructed using the appropriate oligonu-
12 Ohlsson H, Karlsson K, Edlund T 1993 IPFl , a homeodo-
cleotides (Table 1) which were ligated into the BamHl site
main-containing transactivator of the insulin gene. EMBO
of PUTKAT adjacent to the TK promoter (26). TK-CAT J 12:4251-4259
plasmids were sequenced to ascertain oligonucleotide 13 Leonard J, Peers B, Johnson T, Ferrei K, Lee S,
copy number and orientation. CAT activity was assayed as Montminy MR 1993 Characterization of somatostatin
previously described (35). Transfection efficiencies were transactivating factor-l, a novel homeobox factor that
monitored by cotransfecting Rous sarcoma virus P-galac- stimulates somatostatin gene expression in pancreatic
tosidase, and CAT activity was normalized for variations in islet cells. Mol Endocrinol 7:1275-1283
protein concentration and transfection efficiency. The Iu- 14 Peers B, Leonard J, Sharma S, Teitelman G, Montminy
ciferase activities were measured as previously described MR 1994 Insulin expression in pancreatic islet cells relies
(37). on cooperative interactions between the helix loop helix
factor E47 and the homeobox factor STF-1. Mol Endo-
crinol 8:1798-l 806
Acknowledgments 15. Wang M, Drucker DJ 1995 The LIM domain homeobox
gene isl-l is a positive regulator of islet cell-specific
proglucagon gene transcription. J Biol Chem 270:12646-
We thank Feng Wang for expert technical assistance. 12652
16. Rudnick A, Ling TY, Odagiri H, Rutter WJ, German MS
Received April 18, 1995. Revision received November 20, 1994 Pancreatic beta cells express a diverse set of ho-
1995. Accepted December 4, 1995. meobox genes. Proc Natl Acad Sci USA 91:12203-
12207
Address requests for reprints to: Dr. D. J. Drucker, The 17. Jonsson J, Carlsson L, Edlund T, Edlund H 1994 Insulin-
Toronto Hospital, 200 Elizabeth Street CCRW3-838, Toronto, promoter-factor 1 is required for pancreas development
Canada M5G 2C4. in mice. Nature 371:606-609
Dr. Drucker is a Scientist of the Medical Research Council 18. Karlsson 0, Thor S, Norberg T, Ohlsson H, Edlund T 1990
(MRC) of Canada. This work was supported in part by the Insulin gene enhancer binding protein isl-l is a member
MRC and by operating grants from the Juvenile Diabetes of a novel class of proteins containing both a homeo-and
Foundation International. a Cys-His domain. Nature 344:879-882
Amylin Gene Transcription 251

19. Thor S, Ericson J, Brannstrom T, Edlund T 1991 The Betsholtz C, Nishi M, Steiner DF 1991 Islet amyloid
homeodomain LIM protein Isl-l is expressed in subsets polypeptide and insulin expression are controlled differ-
of neurons and endocrine cells in the adult rat. Neuron ently in primary and transformed islet cell lines. Mol
7:881-889 Endocrinol 5:143-l 48
20. Dong J, Asa SL, Drucker DJ 1991 Islet cell and extrapan- 29. Wadman I, Li J, Bash RO, Forster A, Osada H, Rabbitts
creatic expression of the LIM domain homeobox gene TH, Baer R 1994 Specific in viva association between the
isl-1. Mol Endocrinol 51633-1641 bHLH and LIM proteins implicated in human T cell leu-
21. Nishi M, Sanke T, Seino S, Eddy RL, Fan Y-S, Byers MG, kemia. EMBO J 13:4831-4839
Shows TB Bell GI. Steiner DF 1989 Human islet amvloid 30. Xue D, Tu Y, Chalfie M 1993 Cooperative interactions
polypeptide gene:.complete nucleotide sequence, dhro- between the Caenorhabditis elegans homeoproteins
mosomal localization, and evolutionary history. Mol uric-86 and met-3. Science 261:1324-1328
Endocrinol 3:1775-l 781 31. Feuerstein R, Wang X, Song D, Cooke NE, Liebhaber SA
22. Sanchez-Garcia I, Osada H, Forster A, Rabbitts TH 1993

Downloaded from https://academic.oup.com/mend/article/10/3/243/2713316 by guest on 07 October 2023

1994 The LIM/double zinc-finger motif functions as a
The cysteine-rich LIM domains inhibit DNA binding by protein dimerization domain. Proc Natl Acad Sci USA
the associated homeodomain in 1~1-1. EM60 J 12:4243- 91 :10655-l 0659
4250
32. Taira M, Otani H, Saint-Jeannet J-P, Dawid IB 1994 Role
23. Philippe J, Drucker DJ, Knepel W, Jepeal L, Misulovin Z,
of the LIM class homeodomain protein Xlim-1 in neural
Habener JF 1988 Alpha-cell-specific expression of the
and muscle induction by the Spemann organizer in
glucagon gene is conferred to the glucagon promoter
Xenopus. Nature 3721677679
element by the interactions of DNA-binding proteins. Mol
33. Varshavsky A 1987 Electrophoretic assay for DNA-
Cell Biol 8:4877-4888
binding proteins. Methods Enzymol 151551665
24. Wang M, Drucker DJ 1994 The LIM domain homeobox
34. Schreiber E, Matthias P, Muller MM, Schaffner W 1989
gene isl-l :Conservation of human, hamster, and rat com-
plementary deoxyribonucleic acid sequences and ex- Rapid detection of octamer binding proteins with ‘mini-
pression in cell types of nonneuroendocrine lineage. extracts’ prepared from a small number of cells. Nucleic
Endocrinology 134:1416-1422 Acids Res 17:6419
25. Leonard J, Serup P, Gonzalez G, Edlund T, Montminy M 35. Drucker DJ, Philippe J, Jepeal L, Habener JF 1987 Glu-
1992 The LIM family transcription factor Isl-l requires cagon gene 5’-flanking sequences promote islet cell-
CAMP response element binding protein to promote so- specific glucagon gene transcription. J Biol Chem 262:
matostatin expression in pancreatic islet cells. Proc Natl 15659-l 5665
Acad Sci USA 89:6247-6251 36. van Mansfield ADM, Mosselman S, Hoppener JWM,
26. Prost E, Moore DD 1986 CAT vectors for analysis of Zandberg J, van Teeffelen HAA M, Baas PD, Lips CJM,
eukaryotic promoters and enhancers. Gene 45:107-l 1I Jansz HS 1990 Islet amyloid polypeptide: structure and
27. De Wit L, van Mansfield ADM, van Teeffelen HAA M, Lips upstream sequences of the IAPP gene in rat and man.
CJM, Hoppener JWM 1993 Strong promoter activity of Biochim Biophys Acta 1087:235-240
human and rat islet amyloid polypeptide/amylin gene 37. Jin T, Drucker DJ 1995 The proglucagon gene upstream
constructs in mouse beta cells (pTC3). Biochem Biophys enhancer contains positive and negative domains impor-
Res Commun 192:840-848 tant for tissue-specific proglucagon gene transcription.
28. Madsen OD, Nielsen JH, Michelsen B, Westermark P, Mol Endocrinol 9:1306-l 320