Aquaculture 565 (2023) 739166

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Identification and pathogenetic study of tilapia lake virus (TiLV) isolated

from naturally diseased tilapia
Tao He a, Yu-Zhou Zhang a, Li-Hong Gao c, Bo Miao a, Ji-Shu Zheng c, De-Cheng Pu c,
Qing-Qing Zhang b, Wei-Wei Zeng d, De-Shou Wang b, Sheng-Qi Su a, *, Song Zhu a, b, *
a
College of Fisheries, Southwest University, Chongqing 400715, China
b
Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Sciences,
Southwest University, Chongqing 400715, China
c
Chongqing Academy of Agricultural Sciences, Chongqing 400715, China
d
Guangdong Provincial Key Laboratory of Animal Molecular Design and Precise Breeding, School of Life Science and Engineering, Foshan University, Foshan 528231,
China

A R T I C L E I N F O A B S T R A C T

Keywords: As an emerging pathogen, tilapia lake virus (TiLV) has caused severe socio-economic impacts and remains a
Tilapia lake virus devastating factor in wild and farmed tilapia. Early diagnosis and timely reporting of TiLV are very important
Tilapia and necessary. In the study, a TiLV infection event in a tilapia farm is studied and reported. Naturally diseased
Virus detection and isolation
tilapia with clinical signs such as anorexia, exophthalmia, skin abrasion and hemorrhage are collected. Multiple
Koch's postulates
Tissue tropism
tissue lesions of liver, spleen and kidney are observed by histopathological analysis, such as syncytial formation,
intracytoplasmic inclusion body and necrosis. No bacterial pathogens are identified from liver, spleen and kidney
of the diseased tilapia, while all of them show TiLV-positive. E-11 cells are employed for TiLV isolation, and
cytopathic effects are developed following incubation with supernatants of the homogenized tissues collected
from the diseased tilapia. Electron micrographs of the infected cells and purified TiLV show that nearly round-
shaped, enveloped viral particles (60–80 nm) can be identified. Segment 1 of the isolated TiLV has a high
sequence similarity to other isolates, but phylogenetic analysis shows that it is placed in a unique cluster.
Experimental infection with the isolated TiLV can cause high mortality (> 90%) in healthy Nile tilapia, with the
similar clinical signs and tissue lesions to those found in naturally infected tilapia. Moreover, vacuolation and
necrosis in brain, inclusion body and necrosis in heart, megalocytes and necrosis in intestine are observed in
experimentally infected tilapia. Muscle, spleen, liver, intestine, brain, heart, kidney and gill of the re-infected
tilapia show TiLV-positive, and liver, spleen and brain are the main target tissues. The data so far confirm a
TiLV-associated disease outbreak in China, enriching the relevant information of TiLV.

1. Introduction
As the second most farmed freshwater fish worldwide, tilapia has
become a primary source of dietary protein and economic income in
many developing countries (FAO, 2020; Hounmanou et al., 2018).
Tilapia is farmed in >100 countries with an estimated global production
of 6.8 million tons. China is the largest producer of tilapia, followed by
Indonesia, Egypt, Thailand, Philippines, etc. Tilapia is comprised of
>100 cichlid species, and Nile tilapia (Oreochromis niloticus) is the pre­
dominant cultured species (Bacharach et al., 2016; Hounmanou et al.,
2018). Previously, it was believed that there were few serious diseases
threatening tilapia farming, but this is no longer true over the past de­
cades. A variety of devastating infectious diseases have emerged with
the improperly expanded, intensive and diversified farming (Abu-Elala
et al., 2016; Surachetpong et al., 2020). Most disease reports in tilapia
are related to bacterial pathogens, notably Aeromonas hydrophila and
Streptococcus spp., with few reports of viral diseases until the emergence
of tilapia lake virus (TiLV) (Aich et al., 2022; Hounmanou et al., 2018;
Surachetpong et al., 2020).
In 2009, there was a sharp decline of tilapia production in Lake
Kinneret (Israel) from an average level of 257 tons to 8 tons per year
(Surachetpong et al., 2020). Subsequently, episodes of massive tilapia

* Corresponding authors at: College of Fisheries, Southwest University, Chongqing 400715, China.
E-mail addresses: sushengqi@swu.edu.cn (S.-Q. Su), zs20200801@swu.edu.cn (S. Zhu).

https://doi.org/10.1016/j.aquaculture.2022.739166
Received 8 July 2022; Received in revised form 21 November 2022; Accepted 14 December 2022
Available online 15 December 2022
0044-8486/© 2022 Elsevier B.V. All rights reserved.
T. He et al. Aquaculture 565 (2023) 739166

mortalities were quickly spread in wild and farmed tilapia all over Israel
and Ecuador (Eyngor et al., 2014; Ferguson et al., 2014). By April 2020,
16 countries across four continents have reported TiLV (Surachetpong
et al., 2020), such as Colombia (Contreras et al., 2021; Tsofack et al.,
2017), Egypt (Fathi et al., 2017) and Thailand (Dong et al., 2017b). In
fact, the geographic distribution of TiLV is much wider due to factors
such as limitation of veterinary services, lack of detection technologies
and thorough investigations (Abdullah et al., 2022; Debnath et al., 2020;
Jansen et al., 2018). Disease caused by TiLV has a high mortality up to
100%, leading to a series of serious socio-economic consequences (Ali
et al., 2020; Debnath et al., 2020; Hounmanou et al., 2018). A review on
the socio-economic challenges of TiLV in Sub-Saharan Africa reports
that if appropriate actions are not taken, >150,000 tons of tilapia and
the income source of at least 6 million people will be at risk (Hounma­
nou et al., 2018). Currently, there is no practicable measures to control
the disease (Aich et al., 2022; Surachetpong et al., 2020). Therefore,
early diagnosis and timely reporting of TiLV are urgently needed.
TiLV is an enveloped, single-stranded RNA virus consisting of 10
genomic segments. Only the segment 1 shares weak sequence similarity
to influenza C virus while the other segments show no homology to
known viruses (Abu Rass et al., 2022; Bacharach et al., 2016). Based on
sequence analysis, TiLV has been assigned as a new species, Tilapia
tilapinevirus, under genus Tilapinevirus and family Amnoonviridae (Adams
et al., 2017). TiLV is roughly circular with a diameter of 55–100 nm
(Del-Pozo et al., 2017; Eyngor et al., 2014). Presently, several proced­
ures have been developed for diagnosis of TiLV, including observation of
clinical symptoms and tissue lesions (Behera et al., 2018; Eyngor et al.,
2014), serological diagnosis (Hu et al., 2020; Piewbang et al., 2021),
molecular techniques (Sukonta et al., 2022; Waiyamitra et al., 2018),
and virus isolation in cell culture (Li et al., 2022; Tsofack et al., 2017).
In the study, a case of TiLV-associated disease outbreak in a tilapia
farm in Yangjiang is studied and reported. The diseased tilapia was
diagnosed by clinical signs, histopathology, pathogen isolation and
identification, molecular and ultrastructural techniques. Healthy Nile
tilapia was experimentally infected with the isolated TiLV to verify TiLV
fulfills Koch's postulates. Moreover, tissue tropism of the isolated TiLV
was checked. Our data will enrich the relevant information of TiLV, and
promote the diagnosis, prevention and control of the disease.
2. Materials and methods
2.1. Cell, fish and ethical statement
E-11 cells, a clone of SSN-1 cells (derived from the whole fry tissue of
Channa striatus; Iwamoto et al., 2000), were kindly provided by Prof.
Wei-Wei Zeng (Foshan University, Foshan, China) and maintained at
26 ◦ C in Lebovitz-15 medium (L-15; Gibco, USA) supplemented with
10% fetal bovine serum (FBS; Gibco, USA). Naturally diseased tilapia at
the moribund stage were collected from a tilapia farm in Yangjiang
(Guangdong, China). Healthy Nile tilapia used for experimental chal­
lenge were kindly provided by Prof. De-Shou Wang (Southwest Uni­
versity, Chongqing, China) and reared in recirculating aerated
freshwater tanks at 28 ◦ C. Animal experiments were performed
following the Guide for Care and Use of Laboratory Animals approved by
the Committee of Laboratory Animal Experimentation of Southwest
University.
2.2. Diagnosis of the diseased tilapia
2.2.1. Clinical signs and tissue pathology
In the tilapia farm, tilapia were farmed in 12 ponds (about 6600 m2/
pond) supplied with river water. At the time of the disease outbreak,
tilapia were approximately 25.0–35.0 cm in length and 1.0–1.3 kg in
weight. Clinical signs of the diseased tilapia included lethargy, loss of
appetite, slow movement, exophthalmia, skin abrasion and hemorrhage,
and gill congestion. The diseased tilapia at the moribund stage were
Table 1
Primers used in the study.
Primer name Primer sequences (from 5′ to 3′ ) Size (bp)
TiLV-D-F AGCAGCAGCAGGAGAAAGAG 358
TiLV-D-R ACCGTCCTGTTTCTGAATGG
S1-F gtgccgcgcggcagccatatgTGGG 1602
CATTTCAAGAAGGAGT
S1-R ctcgagtgcggccgcaagcttTTAG
CACCCAGCGGTGGG
TiLV-Q-F AGTGTGACAGTCGACGCAAT 128
TiLV-Q-R TCGACGCAGTTAATCCCAGG
β-actin-Ti-Q-F TACTAGGCCTCGCCACAGCA 151
β-actin-Ti-Q-R ATTGGTCCGGCGTCACTCAC
CCTCCATCGTCCACCGCAAA 590
β-actin-Ti-D-F
β-actin-Ti-D-R CCCAGGGATGAAGCCTCCCA
β-actin-E11-D-F GCCGCGACCTCACAGACTAC 234
β-actin-E11-D-R CCTCTGGGCAACGGAACCTC
carefully collected in plastic bags filled with pond water and oxygen,
and then rapidly transported to our laboratory. Tissue samples (liver,
spleen and kidney) from the healthy and diseased tilapia were collected,
and then fixed in 10% formalin for 24 h. Following dehydrated and
embedded in paraffin, the samples were sectioned at 5 μm thickness and
stained with Hematoxylin and Eosin (H&E) for microscopic analysis.
2.2.2. Pathogen detection
For bacterial detection, liver, spleen and kidney from the diseased
tilapia were collected in a sterile environment. The collected tissues
were separately homogenized and spread onto brain-heart extractive
medium (BHM) plates. The plates were then incubated at 30 ◦ C for 48 h.
For TiLV detection, total RNA of the collected tissues (approximately 30
mg/tissue) was extracted using 1 mL of RNAiso plus (Takara, Japan)
according to the manufacturer's instructions. Total RNA concentration
and quality were detected using a NanoDrop 2000 spectrophotometry
(Thermo Fisher Scientific, USA), and then used to synthesis cDNA using
Prime script RT reagent Kit (Takara, Japan) according to the manufac­
turer's protocol. PCR analysis using the specific primer pairs (TiLV-D-F
and TiLV-D-R (Nicholson et al., 2017), β-actin-Ti-D-F and β-actin-Ti-D-R;
Table 1) was performed for TiLV detection. The PCR cycling conditions
were denaturation at 95 ◦ C for 5 min, followed by 30 cycles at 95 ◦ C for
30 s, 60 ◦ C for 30 s, and 72 ◦ C for 40 s, with final elongation at 72 ◦ C for
10 min using a PCR thermocycler (MyCycler, Bio-Rad, USA). The PCR
products were electrophoresed in 1.5% agarose gel with ethidium bro­
mide and visualized under a Gel Documentation System (Bio-Rad, USA).
2.3. Virus isolation
E-11 cells were employed for virus isolation. Briefly, 500 mg of each
collected tissue was respectively homogenized with 5 mL of L-15 me­
dium (2% FBS), and then centrifuged at 12,000 ×g for 10 min. The su­
pernatants were collected and filtered through 0.22 μm filters
(Millipore, USA). The filtered samples were respectively inoculated into
confluent E-11 cells in 25 cm2 flasks and maintained at 26 ◦ C for 7 days.
Cytopathic effects (CPE) were observed daily, and the supernatants were
collected following 80% of the cells showed CPE for experimental
challenge study. Besides, the infected cells were collected with 1 mL of
RNAiso plus (Takara, Japan), and total RNA was extracted according to
the manufacturer's instructions. Concentration and quality of the RNA
were detected using a NanoDrop 2000 spectrophotometry (Thermo
Fisher Scientific, USA), and then used to synthesis cDNA using Prime
script RT reagent Kit (Takara, Japan) according to the manufacturer's
protocol. PCR analysis using the specific primer pairs (TiLV-D-F and
TiLV-D-R, β-actin-E11-D-F and β-actin-E11-D-R; Table 1) was performed
as described above to detect TiLV.

2
T. He et al. Aquaculture 565 (2023) 739166

Fig. 1. Clinical signs and histopathological analysis of the diseased tilapia. Typical clinical signs of the diseased tilapia, including exophthalmia (A), skin abrasion
(B), skin hemorrhage (C) and gill congestion (D); Histopathological sections of liver, spleen and kidney collected from healthy and diseased tilapia. (E) normal liver;
(F and G) liver of the diseased tilapia; syncytial cells formation (circles), intracytoplasmic inclusion body (arrows) and multifocal area of necrosis (arrowheads); (H)
normal spleen; (I and J) spleen of the diseased tilapia; MMCs (circles) and intracytoplasmic inclusion body (arrows); (K) normal kidney; (L and M) kidney of the
diseased tilapia; vacuolization (arrowheads), necrosis (arrows) and cell disintegration (circle).

2.4. Transmission electron microscope observation
Transmission electron microscope (TEM) observation was performed
to check the virions in E-11 cells according to Eyngor et al. (2014).
Briefly, cells were scraped from the flasks following infection for 5 days
and centrifuged at 2000 rpm for 5 min. The sedimental cells were fixed
with 2.5% glutaraldehyde for 24 h, and then rinsed five times in PBS
(pH 7.2). Following post-fixed in 1% OsO4, the pellet was dehydrated
with increasing concentrations of ethanol, washed with 100% propylene
oxide, treated with propylene oxide-Epon (3:1, v:v) for 30 min, followed
by propylene oxide-Epon (1:1, v:v) for 15 min. The pellets were
embedded in 100% Epon, and then thin sections (70 to 90 nm) were cut

3
T. He et al.
and placed on Formvar-coated copper grids. Finally, the sections were
observed under a TEM (JEM-1200EX II, JEOL, Japan) after staining with
uranyl acetate and lead citrate.
Besides, the collected culture supernatants were ultracentrifuged
through 25% (wt/vol) sucrose cushions at 145,000 g for 1 h using a
Beckman ultracentrifuge (Optima XPN-100, USA). The preliminarily
purified virions were examined under the TEM.
2.5. Phylogenetic analysis
The complete coding sequence (CDS) of TiLV segment 1 was cloned
using the specific primer pair (S1–F and S1-R; Table 1). Amplified DNA
products were purified using a GEL/PCR Purification Kit (TIANGEN,
China), and then ligated into the pET-28a (+) vector using a One Step
Cloning Kit (Vazyme, China). The recombinant plasmid containing
segment 1 (verified by colony PCR using vector primers) was sequenced
by Sangon Biological Engineering Technology Services Co., Ltd.
(Shanghai, China). The sequence was compared with the available se­
quences in NCBI using the MegaX software, and phylogenetic analysis on
genome segment 1 sequences of 33 TiLV isolates was performed using
Neighbor-Joining method (Saitou and Nei, 1987).
2.6. Experimental challenge
2.6.1. TiLV infection
Four hundred healthy Nile tilapia (length: 5.5 ± 0.9 cm; weight: 3.3
± 0.8 g) were separated into two groups (the control group and the TiLV
challenge group; 4 replicates/group) in a total of 8 tanks, with 50 fish/
tank. Tilapia in the control group were injected intraperitoneally with
supernatant (50 μL/fish) from uninfected E-11 cells, while fish in the
TiLV challenge group were injected with the same volume supernatant
from the infected E-11 cells. For each group, 3 tanks were used to record
mortality, and the fourth tank used for sample collection. Clinical signs
and mortality after TiLV challenge were monitored and recorded daily
for 14 days. At the end of the infection, all surviving fish were eutha­
nized using an overdose of eugenol solution. All samples were processed
at high temperature (120 ◦ C, 30 min) to prevent virus leakage.
2.6.2. Symptoms
Clinical signs of the re-infected tilapia were checked and recorded.
Tissue samples (liver, spleen, kidney, brain, heart and intestine) from
the healthy and infected tilapia were collected and fixed in 10%
formalin. Histopathological analysis and virus isolation were performed
as described in 2.2.1 and 2.3, respectively.
2.6.3. Tissue tropism
To check the tissue tropism of TiLV, tissue samples (muscle, eye,
spleen, liver, intestine, brain, heart, kidney and gill) from the infected
tilapia were collected. Total RNA of the collected tissues (approximately
30 mg/tissue) was extracted, and then used to synthesis cDNA. PCR
analysis was performed as described in 2.2.2. A SYBR Premix Ex Taq II
kit (Vazyme, China) and a StepOnePlus™ Real-Time PCR System
(Applied Biosystem, USA) were employed for real-time quantitative PCR
(RT-qPCR) using the specific primer pairs (TiLV-Q-F and TiLV-Q-R,
β-actin-Ti-Q-F and β-actin-Ti-Q-R; Table 1). The RT-qPCR cycling con­
ditions were denaturation at 95 ◦ C for 5 min, followed by 40 cycles at
95 ◦ C for 10 s and 60 ◦ C for 30 s. At the end of the reaction, melting curve
analysis was carried out from 65 ◦ C to 95 ◦ C with 0.5 ◦ C per 5 s incre­
ment. Relative expression was calculated using the 2-ΔΔCt method
(Schmittgen and Livak, 2008) and normalized to the expression of
β-actin in the same sample. Results were expressed as “fold change”
compared with the normalized expression of TiLV in intestine.
2.7. Statistical analysis
Six fish were collected for histopathological analysis each group. The
4
Aquaculture 565 (2023) 739166
survival rate is presented as the mean survival rate from three replicates
(50 fish/replicate). Six fish were employed for tissue tropism analysis,
and the results are presented as mean ± s.d. Statistical comparisons
between two groups were performed using the two-tailed unpaired
Student's t-test, and values of *P ≤ 0.05 and **P ≤ 0.01 were applied to
annotate statistical significance.
3. Results and discussion
Tilapia are worldwide farmed and served as an important protein
and income source for human beings, playing key roles in ensuring food
security and promoting economic development (FAO, 2020; Hounma­
nou et al., 2018). In recent decades, many devastating infectious dis­
eases have emerged in wild and farmed tilapia (Abu-Elala et al., 2016;
Surachetpong et al., 2020). TiLV is a novel Orthomyxo-like virus, which
was firstly isolated and identified at 2014 (Eyngor et al., 2014). TiLV has
caused lots of devastating events in at least 16 countries, and >45
countries are at high risk of TiLV, leading to serious socio-economic
consequences (Aich et al., 2022; Hounmanou et al., 2018). As the
largest producer and exporter of tilapia, China needs to strictly monitor
the occurrence of TiLV to ensure the healthy development of the tilapia
industry. Here, we investigated a TiLV-associated disease outbreak in a
tilapia farm in Yangjiang, China.
3.1. Diagnosis of the diseased tilapia
The routine diagnostic methods of fish diseases mainly included
clinical symptoms observation, histopathological analysis, antibody-
based immunological test, molecular biology detection, pathogen
isolation and identification. In May 2021, a large number of tilapia in a
farm in Yangjiang (Guangdong province, China) were died. Clinical
signs of the diseased tilapia at the moribund stage are lethargy, loss of
appetite, slow movement, exophthalmia (Fig. 1A), skin abrasion
(Fig. 1B), skin hemorrhage (Fig. 1C), and gill congestion (Fig. 1D). Liver,
spleen and kidney of the diseased tilapia were collected for histopath­
ological analysis. Liver (Fig. 1E), spleen (Fig. 1H) and kidney (Fig. 1K) of
healthy tilapia show normal structures. As shown in Fig. 1F and G, liver
of the diseased tilapia shows syncytial cells formation, intracytoplasmic
inclusion body and multifocal area of necrosis. For spleen of the diseased
tilapia, depletion of red blood cells, increase of melanomacrophage
centers (MMCs) and intracytoplasmic inclusion body can be observed
(Fig. 1I and J). As compared with the kidney of healthy tilapia, vacuo­
lization, necrosis and cell disintegration are present especially in renal
tubular epithelium in the kidney of diseased tilapia (Fig. 1L and M).
Similar clinical signs and histopathological phenomena have been
reported in TiLV infection, including anorexia and exophthalmia
(Ramirez-Paredes et al., 2021; Waiyamitra et al., 2021), skin abrasion
and hemorrhage (Tattiyapong et al., 2017; Waiyamitra et al., 2021),
syncytial cells and inclusion body formation in liver (Pierezan et al.,
2020), red blood cells depletion and MMCs increase in spleen (Waiya­
mitra et al., 2021), necrosis and cell disintegration of renal tubular
epithelium in kidney (Rakus et al., 2020). However, these clinical signs
and histopathological phenomena are not unique, which are generalized
among other viral and bacterial diseases (Aich et al., 2022). Therefore,
based on the clinical signs and histopathological results, it can be only
inferred that the diseased tilapia may be infected by TiLV. More diag­
nostic methods need to be performed to confirm the infection.
3.2. Pathogen detection
Most disease reports in tilapia are related to bacterial pathogens,
notably Aeromonas hydrophila and Streptococcus spp. (Aich et al., 2022;
Nicholson et al., 2020). Since 2009, disease caused by TiLV has been
outbreaking worldwide, leading to serious socio-economic conse­
quences (Eyngor et al., 2014; Hounmanou et al., 2018; Surachetpong
et al., 2020). Moreover, co-infection of TiLV with different bacterial
T. He et al. Aquaculture 565 (2023) 739166

Fig. 2. Pathogen detection of the diseased tilapia. (A) Bacterial pathogens detection; (B) TiLV detection.

Fig. 3. Isolation and identification of TiLV. (A) E-11

cells inoculated with supernatants of liver collected
from healthy tilapia for 7 days; (B) E-11 cells inocu­
lated with supernatants of liver collected from
diseased tilapia for 7 days show obvious CPE,
including cytoplasmic vacuolation, plaque formation,
cell aggregation and detachment; (C) PCR analysis of
the infected E-11 cells to confirm the presence of
TiLV; (D) Representative TEM micrographs of the
infected E-11 cells and the purified virion from su­
pernatants (inset).

5
T. He et al. Aquaculture 565 (2023) 739166

pathogens have been reported (Nicholson et al., 2020; Surachetpong

et al., 2017). Different species of bacterial pathogens have been detected
from TiLV-infected fishes (Abdullah et al., 2018; Amal et al., 2018;
Nicholson et al., 2020). For example, Nicholson et al. (2020) investi­
gated the TiLV-bacterial co-infection in farmed tilapia, and demon­
strated that TiLV-bacterial concurrent infections are occurred in 31% of
the fish, especially TiLV-Aeromonas spp. co-infection (Nicholson et al.,
2020). Therefore, the possible involvement of bacterial pathogens needs
to be detected during TiLV infection.
For bacterial pathogens detection, tissues (liver, spleen and kidney)
from the diseased tilapia were separately homogenized and spread onto
BHM plates. As shown in Fig. 2A, no bacterial colonies can be observed
from the plates after incubation for 48 h at 30 ◦ C, indicating that the
diseased tilapia is non-bacterial infection. Subsequently, PCR analysis
was performed for TiLV detection. As shown in Fig. 2B, all of liver,
spleen and kidney collected from 12 diseased tilapia are TiLV-positive.
Therefore, the diseased tilapia may be only attributed to TiLV infection.

3.3. Isolation of TiLV

Virus isolation using sensitive cell lines is also an effective way to

directly detect viral infection. Different cell lines have been used for
isolation and propagation of TiLV, such as E-11 cells (Eyngor et al.,
2014), TiB cells (Wang et al., 2018), and OnH cells (Yadav et al., 2021).
E-11 cells, a clone of SSN-1 cells (derived from the whole fry tissue of
Channa striatus) (Iwamoto et al., 2000), are the first cell line used to
successfully isolate TiLV (Eyngor et al., 2014). To further confirm TiLV
as the primary cause of the diseased tilapia, supernatants of the ho­
mogenized tissues (liver, spleen and kidney) were respectively inocu­
lated into confluent E-11 cells to isolate TiLV.
E-11 cells inoculated with supernatants of liver collected from
healthy tilapia show normal morphological features (Fig. 3A). After
incubation with supernatants of liver collected from diseased tilapia for
7 days, obvious CPE were observed in E-11 cells, including cytoplasmic
vacuolation, plaque formation, cell aggregation and detachment
(Fig. 3B). Similar CPE have been reported by previous studies (Eyngor
et al., 2014; Tattiyapong et al., 2017). E-11 cells inoculated with su­
pernatants of spleen and kidney collected from diseased tilapia also
showed the same CPE (not shown). The infected cells were collected and
subjected to PCR analysis to confirm the presence of TiLV. As shown in
Fig. 3C, all samples show a positive PCR product on 1.5% agarose gel,
confirming the presence of TiLV. To further support for TiLV infection,
the infected cells were observed under a TEM. As shown in Fig. 3D, lots
of electron-dense particles can be obviously observed in the cytoplasm.
Supernatants of the infected cell cultures were purified by ultracentri­
fugation through a 25% sucrose cushion, and then examined using TEM.
Nearly round-shaped, enveloped viral particles (60–80 nm in diameter)
with a central variable electron-dense core can be identified from the
electron micrographs. Combining the above diagnostic results, it can be
concluded that the diseased tilapia is attributed to TiLV infection.
3.4. Phylogenetic analysis using genome segment 1
TiLV is an RNA virus consisting of 10 genomic segments, and every
segment contains open reading frames (ORFs) flanked by non-coding
regions at the 3′ and 5'ends (Acharya et al., 2019). Among the 10 seg­
ments, only segment 1 shows weak sequence homology (37% segment
coverage, ~17% amino acid identity) to the influenza C virus PB1
subunit, and is presumed to encode for the RNA polymerase of TiLV. The
other segments have no recognizable homology to known viruses
(Bacharach et al., 2016). As the largest segment in TiLV genome,
segment 1 (1641 bp) has been used for phylogenetic analysis of TiLV in
previous studies (Chaput et al., 2020; Debnath et al., 2020; Taengphu
et al., 2020).
For phylogenetic analysis, the complete CDS of TiLV segment 1 was
sequenced and submitted to GenBank (accession number: ON863686).
Fig. 4. Phylogenetic tree of the isolated TiLV segment 1 (ON863686) and 32
available TiLV segment 1 sequences in NCBI using Neighbor-Joining method.
Influenza C virus PB1 sequence is used as a foreign reference gene. The boot­
straps <50 are not shown.
Nucleotide BLAST shows that the nucleotide sequence similarity of
ON863686 to other available sequences in NCBI of TiLV segment 1 is
between 95.06% and 96.92%. Phylogenetic tree (Fig. 4) was constructed
based on the 33 available sequences of TiLV segment 1, and influenza C
virus PB1 sequence was used as a foreign reference gene. Result shows
that the isolated TiLV in present study is placed in a small and unique
cluster.
3.5. Experimental infection of TiLV
The pathogen confirmation should fulfill Koch's postulates. It is
necessary to verify that a pathogen isolated from natural outbreaks can
cause same infection when used to challenge healthy animals. Besides,
the pathogen can be re-isolated from the experimentally infected ani­
mals (Tattiyapong et al., 2017). To confirm the isolated TiLV in present
study fulfills the Koch's postulates, healthy Nile tilapia were experi­
mentally infected with the isolated TiLV. Clinical symptoms, mortality,
re-isolation of TiLV and histopathological analysis were performed.
As shown in Fig. 5A-D, similar clinical signs of the re-infected tilapia
to naturally diseased tilapia are obviously appeared, including exoph­
thalmia (Fig. 5B), skin abrasion (Fig. 5C) and skin hemorrhage (Fig. 5D).
The cumulative mortality of the re-infected tilapia is higher than 90% at
14th day post-infection (dpi), while that is <5% for the control group
(Fig. 5E). Different mortalities caused by TiLV have been reported in
different parts of the world (Behera et al., 2018; Fathi et al., 2017;
Ferguson et al., 2014). For examples, high mortality ranging from 10%
to 80% was described in Ecuador (Ferguson et al., 2014), higher than

6
T. He et al. Aquaculture 565 (2023) 739166

Fig. 5. Experimental infection of tilapia with the isolated TiLV. (A) The re-infected tilapia at 7 dpi; exophthalmia (B), skin abrasion (C) and skin hemorrhage (D) of
the re-infected tilapia; (E) Survival curves for tilapia injected intraperitoneally with supernatant (50 μL/fish) from uninfected (the “control” group) and infected (the
“TiLV challenge” group) E-11 cells; E-11 cells inoculated with supernatants of liver collected from healthy (F) and experimentally infected (G) tilapia for 7 days.

Fig. 6. Histopathological analysis of the experimentally TiLV-infected tilapia. (A) normal liver; (B) liver of the re-infected tilapia; syncytial cells formation (circles),
inclusion body (arrows) and necrosis (arrowheads); (C) normal spleen; (D) spleen of the re-infected tilapia; melanomacrophage centers (MMCs), inclusion body
(arrows) and MMCs infiltration (arrowheads); (E) normal kidney; (F) kidney of the re-infected tilapia; vacuolization (arrowheads), necrosis (arrows) and cell
disintegration (circle); (G) normal brain; (H) brain of the re-infected tilapia; vacuolation and multifocal area of necrosis (arrows); (I) normal heart; (J) heart of the re-
infected tilapia; red blood cells depletion, inclusion body (arrows) and necrosis (arrowheads); (K) normal intestine; (L) intestine of the re-infected tilapia; megalocytes
(arrows) and necrosis (arrowheads). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

7
T. He et al. Aquaculture 565 (2023) 739166

3.6. Tissue tropism of TiLV

According to the above results, tissue lesions can be identified in

different tissues of TiLV-infected tilapia, suggesting that many organs
may be the target tissues for viral transcription and replication. To check
the target tissues and viral tropism, different tissues of the infected
tilapia were collected and subjected to PCR and RT-qPCR analysis,
respectively. As shown in Fig. 7A, positive TiLV bands with different
brightness are identified for muscle, spleen, liver, intestine, brain, heart,
kidney and gill of the infected tilapia. RT-qPCR analysis was performed
to quantify TiLV in different tissues, and results were expressed as “fold
change” compared with the normalized expression of TiLV in intestine
(Fig. 7B). Data show that liver is the primary target tissue of TiLV, and
followed by spleen, brain, heart.
TiLV has been detected in multiple tissues, such as liver, spleen,
kidney, gills, heart and muscle, while liver and brain are considered to
be the main target tissues (Bacharach et al., 2016; Saranya and Sudha­
karan, 2020; Waiyamitra et al., 2021). Nevertheless, different results
have also been reported in previous studies (Mugimba et al., 2018;
Pierezan et al., 2020). For example, Mugimba et al. (2018) investigated
the TiLV infection in Nile tilapia from Lake Victoria. They demonstrated
that the main prevalence of TiLV is in kidney, spleen and heart, while the
prevalence is low in liver and absent in brain (Mugimba et al., 2018).
Potential reasons for the different target tissues of TiLV are unknown,
may be attributed to the different TiLV isolates and fish species. The
main target tissues of TiLV isolated in present study are liver, spleen and
brain, which can be used for TiLV detection.
Fig. 7. Tissue tropism of TiLV checked by PCR (A) and RT-qPCR (B) analysis.
For RT-qPCR analysis, results are expressed as “fold change” compared with the
4. Conclusion
normalized expression of TiLV in intestine. Data are presented as mean ± SD.
*P ≤ 0.05 and **P ≤ 0.01, as compared with the normalized expression of TiLV
in intestine. In the study, a natural TiLV infection event is reported. The infection
is confirmed by clinical signs, histopathological analysis, pathogen
detection and virus isolation. Although segment 1 of the isolated TiLV
80% in Israel (Eyngor et al., 2014), 20%–90% in Thailand (Sur­
has a high sequence similarity to other isolates, phylogenetic analysis
achetpong et al., 2017), and 80%–90% in India (Behera et al., 2018).
shows that it is placed in a unique cluster. Experimental infection with
The potential reasons of the wide variation in mortality are unknown,
the isolated TiLV can cause disease in Nile tilapia, with the similar
may be attributed to the species (Barria et al., 2020; Ferguson et al.,
clinical signs and tissue lesions to those found in the naturally infected
2014), life stages (Dong et al., 2017a; Huamancha Pulido et al., 2019)
tilapia. Besides, TiLV can be re-isolated from the experimentally infected
and weight (Roy et al., 2021) of tilapia. For example, previous studies
tilapia, verifying that TiLV infection fulfills Koch's postulates. Liver,
reported that TiLV can affect fish at all stages but mortalities are higher
spleen and brain are the main target tissues of the isolated TiLV, and can
mainly in early developmental stages (larvae, fry and fingerlings) due to
be used for TiLV detection.
the low immunity (Del-Pozo et al., 2017; Surachetpong et al., 2017;
Tattiyapong et al., 2017).
Author statement
Subsequently, TiLV was re-isolated using E-11 cells from the tissues
collected from the re-infected tilapia. E-11 cells inoculated with super­
He Tao: Investigation, Data curation, Writing-original draft; Zhang
natants of liver collected from healthy tilapia show normal morpho­
Yu-Zhou: Investigation, Validation, Data curation; Gao Li-Hong: Re­
logical features (Fig. 5F). Similar CPE (Fig. 5G) were observed following
sources, Supervision, Writing-reviewing & editing; Miao Bo: Investiga­
incubation with supernatants of liver collected from the re-infected
tion, Validation; Zheng Ji-Shu: Validation, Data curation; Pu De-Cheng:
tilapia, indicating that TiLV can be re-isolated from the experimentally
Resources, Supervision; Zhang Qing-Qing: Validation, Data curation;
infected tilapia.
Zeng Wei-Wei: Resources, Supervision; Wang De-Shou: Conceptualiza­
For histopathological analysis, tissue samples (liver, spleen, kidney,
tion, Resources, Supervision; Su Sheng-Qi: Methodology, Supervision,
brain, heart and intestine) from the re-infected tilapia were collected
Writing-reviewing & editing; Zhu Song: Conceptualization, Resources,
and subjected to section observation. Liver (Fig. 6A), spleen (Fig. 6C),
Supervision, Writing-reviewing & editing.
kidney (Fig. 6E), brain (Fig. 6G), heart (Fig. 6I) and intestine (Fig. 6K) of
healthy tilapia show normal structures. Following infection with TiLV,
Declaration of Competing Interest
the same histological changes can be identified from the liver (Fig. 6B),
spleen (Fig. 6D) and kidney (Fig. 6F) compared that collected from the
The authors declare that they have no competing interests.
naturally diseased tilapia. Moreover, vacuolation and multifocal area of
necrosis in brain (Fig. 6H), red blood cells depletion, inclusion body and
Data availability
necrosis in heart (Fig. 6J), large numbers of megalocytes and necrosis in
intestine are observed from the sections of the experimentally infected
Data will be made available on request.
tilapia. Similar histopathological phenomena have been reported in
previous studies (Pierezan et al., 2020; Ramirez-Paredes et al., 2021;
Acknowledgements
Yamkasem et al., 2021), indicating that experimental infection of TiLV
can cause disease in tilapia.
This work was supported by the Agricultural Technology Innovation
Project of Chongqing in 2022, Natural Science Foundation of Chongqing

8
T. He et al.
(cstc2021jcyj-msxmX0450), National Key Research and Development
Program of China (2019YFD0900305-03), Fundamental Research Funds
for the Central Universities (SWU120034), and China Postdoctoral Sci­
ence Foundation (2020M683222 and 2021T140567).
References
Abdullah, A., Ramly, R., Ridzwan, M.S.M., Sudirwan, F., Abas, A., Ahmad, K., Murni, M.,
Kua, B.C., 2018. First detection of tilapia lake virus (TiLV) in wild river carp
(Barbonymus schwanenfeldii) at Timah Tasoh Lake, Malaysia. J. Fish Dis. 41,
1459–1462.
Abdullah, A., Pazai, A.M.M., Ridzuan, M.S.M., Sudirwan, F., Hashim, S., Abas, A.,
Murni, M., Roli, Z., Ramly, R., Firdaus-Nawi, M., 2022. Persistent detection of tilapia
lake virus in wild tilapia and tinfoil barbs. Vet. World 15, 1097–1106.
Abu Rass, R., Kustin, T., Zamostiano, R., Smorodinsky, N., Ben Meir, D., Feder, D.,
Mishra, N., Lipkin, W.I., Eldar, A., Ehrlich, M., Stern, A., Bacharach, E., 2022.
Inferring protein function in an emerging virus: detection of the nucleoprotein in
tilapia lake virus. J. Virol. 96 (6) e01757–21.
Abu-Elala, N.M., Abd-Elsalam, R.M., Marouf, S., Abdelaziz, M., Moustafa, M., 2016.
Eutrophication, ammonia intoxication, and infectious diseases: interdisciplinary
factors of mass mortalities in cultured Nile tilapia. J. Aquat. Anim. Health 28,
187–198.
Acharya, V., Chakraborty, H.J., Rout, A.K., Balabantaray, S., Behera, B.K., Das, B.K.,
2019. Structural characterization of open reading frame-encoded functional genes
from tilapia lake virus (TiLV). Mol. Biotechnol. 61, 945–957.
Adams, M.J., Lefkowitz, E.J., King, A.M.Q., Harrach, B., Harrison, R.L., Knowles, N.J.,
Kropinski, A.M., Krupovic, M., Kuhn, J.H., Mushegian, A.R., Nibert, M.,
Sabanadzovic, S., Sanfacon, H., Siddell, S.G., Simmonds, P., Varsani, A., Zerbini, F.
M., Gorbalenya, A.E., Davison, A.J., 2017. Changes to taxonomy and the
international code of virus classification and nomenclature ratified by the
international committee on taxonomy of viruses (2017). Arch. Virol. 162,
2505–2538.
Aich, N., Paul, A., Choudhury, T.G., Saha, H., 2022. Tilapia lake virus (TiLV) disease:
current status of understanding. Aquacult. Fish. 7, 7–17.
Ali, S.E., Jansen, M.D., Mohan, C.V., Delamare-Deboutteville, J., Charo-Karisa, H., 2020.
Key risk factors, farming practices and economic losses associated with tilapia
mortality in Egypt. Aquaculture 527.
Amal, M.N.A., Koh, C.B., Nurliyana, M., Suhaiba, M., Nor-Amalina, Z., Santha, S.,
Diyana-Nadhirah, K.P., Yusof, M.T., Ina-Salwany, M.Y., Zamri-Saad, M., 2018.
A case of natural co-infection of tilapia lake virus and Aeromonas veronii in a
Malaysian red hybrid tilapia (Oreochromis niloticus x O. mossambicus) farm
experiencing high mortality. Aquaculture 485, 12–16.
Bacharach, E., Mishra, N., Briese, T., Zody, M.C., Tsofack, J.E.K., Zamostiano, R.,
Berkowitz, A., Ng, J., Nitido, A., Corvelo, A., Toussaint, N.C., Nielsen, S.C.A.,
Hornig, M., Del Pozo, J., Bloom, T., Ferguson, H., Eldar, A., Lipkin, W.I., 2016.
Characterization of a novel orthomyxo-like virus causing mass die-offs of tilapia.
mBio 7.
Barria, A., Trong Quoc, T., Mahmuddin, M., Benzie, J.A.H., Chadag, V.M., Houston, R.D.,
2020. Genetic parameters for resistance to tilapia lake virus (TiLV) in Nile tilapia
(Oreochromis niloticus). Aquaculture 522.
Behera, B.K., Pradhan, P.K., Swaminathan, T.R., Sood, N., Paria, P., Das, A., Verma, D.K.,
Kumar, R., Yadav, M.K., Dev, A.K., Parida, P.K., Das, B.K., Lal, K.K., Jena, J.K., 2018.
Emergence of tilapia lake virus associated with mortalities of farmed Nile Tilapia
Oreochromis niloticus (Linnaeus 1758) in India. Aquaculture 484, 168–174.
Chaput, D.L., Bass, D., Alam, M.M., Al Hasan, N., Stentiford, G.D., van Aerle, R.,
Moore, K., Bignell, J.P., Hague, M.M., Tyler, C.R., 2020. The cegment matters:
Probable reassortment of tilapia lake virus (TiLV) complicates phylogenetic analysis
and inference of geographical origin of new isolate from Bangladesh. Viruses-Basel
12.
Contreras, H., Vallejo, A., Mattar, S., Ruiz, L., Guzman, C., Calderon, A., 2021. First
report of tilapia lake virus emergence in fish farms in the department of Cordoba,
Colombia. Vet. World 14, 865–872.
Debnath, P.P., Delamare-Deboutteville, J., Jansen, M.D., Phiwsaiya, K., Dalia, A.,
Hasan, M.A., Senapin, S., Mohan, C.V., Ha Thanh, D., Rodkhum, C., 2020. Two-year
surveillance of tilapia lake virus (TiLV) reveals its wide circulation in tilapia farms
and hatcheries from multiple districts of Bangladesh. J. Fish Dis. 43, 1381–1389.
Del-Pozo, J., Mishra, N., Kabuusu, R., Cheetham, S., Eldar, A., Bacharach, E., Lipkin, W.
I., Ferguson, H.W., 2017. Syncytial hepatitis of tilapia (Oreochromis niloticus L.) is
associated with Orthomyxovirus-like virions in hepatocytes. Vet. Pathol. 54,
164–170.
Dong, H.T., Ataguba, G.A., Khunrae, P., Rattanarojpong, T., Senapin, S., 2017a. Evidence
of TiLV infection in tilapia hatcheries from 2012 to 2017 reveals probable global
spread of the disease. Aquaculture 479, 579–583.
Dong, H.T., Siriroob, S., Meemetta, W., Santimanawong, W., Gangnonngiw, W.,
Pirarat, N., Khunrae, P., Rattanarojpong, T., Vanichviriyakit, R., Senapin, S., 2017b.
Emergence of tilapia lake virus in Thailand and an alternative semi-nested RT-PCR
for detection. Aquaculture 476, 111–118.
Eyngor, M., Zamostiano, R., Tsofack, J.E.K., Berkowitz, A., Bercovier, H., Tinman, S.,
Lev, M., Hurvitz, A., Galeotti, M., Bacharach, E., Eldar, A., 2014. Identification of a
novel RNA virus lethal to tilapia. J. Clin. Microbiol. 52, 4137–4146.
FAO, 2020. The State of World Fisheries and Aquaculture 2020. FAO, Rome, Italy.
Fathi, M., Dickson, C., Dickson, M., Leschen, W., Baily, J., Muir, F., Ulrich, K.,
Weidmann, M., 2017. Identification of tilapia lake virus in Egypt in Nile tilapia
affected by 'summer mortality' syndrome. Aquaculture 473, 430–432.
9
Aquaculture 565 (2023) 739166
Ferguson, H.W., Kabuusu, R., Beltran, S., Reyes, E., Lince, J.A., del Pozo, J., 2014.
Syncytial hepatitis of farmed tilapia, Oreochromis niloticus (L.): a case report. J. Fish
Dis. 37, 583–589.
Hounmanou, Y.M.G., Mdegela, R.H., Dougnon, T.V., Achoh, M.E., Mhongole, O.J.,
Agadjihouèdé, H., Gangbè, L., Dalsgaard, A., 2018. Tilapia lake virus threatens
tilapiines farming and food security: socio-economic challenges and preventive
measures in Sub-Saharan Africa. Aquaculture 493, 123–129.
Hu, H., Zeng, W., Wang, Y., Wang, Q., Bergmann, S.M., Yin, J., Li, Y., Chen, X., Gao, C.,
Zhang, D., Liu, C., Ren, Y., Shi, C., 2020. Development and application of a
recombinant protein-based indirect ELISA for detection of anti-tilapia lake virus IgM
in sera from tilapia. Aquaculture 520.
Huamancha Pulido, L.L., Marcela Mora, C., Luis Hung, A., Don, H.T., Senapin, S., 2019.
Tilapia lake virus (TiLV) from Peru is genetically close to the Israeli isolates.
Aquaculture 510, 61–65.
Iwamoto, T., Nakai, T., Mori, K., Arimoto, M., Furusawa, I., 2000. Cloning of the fish cell
line SSN-1 for piscine nodaviruses. Dis. Aquat. Org. 43, 81–89.
Jansen, M.D., Dong, H.T., Mohan, C.V., 2018. Tilapia lake virus: a threat to the global
tilapia industry? Rev. Aquac. 11 (3), 725–739.
Li, B., Zheng, S.C., Wang, Y.Y., Wang, Q., Li, Y.Y., Yin, J.Y., Ren, Y., Shi, C.B., Zhao, Z.Y.,
Jiang, Z.Y., Bergmann, S.M., Zeng, W.W., 2022. Susceptibilities of ten fish cell lines
to infection with tilapia lake virus. Microb. Pathog. 166.
Mugimba, K.K., Chengula, A.A., Wamala, S., Mwega, E.D., Kasanga, C.J., Byarugaba, D.
K., Mdegela, R.H., Tal, S., Bornstein, B., Dishon, A., Mutoloki, S., David, L.,
Evensen, O., Munang'andu, H.M., 2018. Detection of tilapia lake virus (TiLV)
infection by PCR in farmed and wild Nile tilapia (Oreochromis niloticus) from Lake
Victoria. J. Fish Dis. 41, 1181–1189.
Nicholson, P., Fathi, M.A., Fischer, A., Mohan, C., Schieck, E., Mishra, N., Heinimann, A.,
Frey, J., Wieland, B., Jores, J., 2017. Detection of Tilapia Lake virus in Egyptian fish
farms experiencing high mortalities in 2015. J. Fish Dis. 40, 1925–1928.
Nicholson, P., Mon-on, N., Jaemwimol, P., Tattiyapong, P., Surachetpong, W., 2020.
Coinfection of tilapia lake virus and Aeromonas hydrophila synergistically increased
mortality and worsened the disease severity in tilapia (Oreochromis spp.).
Aquaculture 520.
Pierezan, F., Yun, S., Piewbang, C., Surachetpong, W., Soto, E., 2020. Pathogenesis and
immune response of Nile tilapia (Oreochromis niloticus) exposed to tilapia lake virus
by intragastric route. Fish Shellfish Immunol. 107, 289–300.
Piewbang, C., Tattiyapong, P., Techangamsuwan, S., Surachetpong, W., 2021. Tilapia
lake virus immunoglobulin G (TiLV IgG) antibody: immunohistochemistry
application reveals cellular tropism of TiLV infection. Fish & Shellfish Immunol. 116,
115–123.
Rakus, K., Mojzesz, M., Widziolek, M., Pooranachandran, N., Teitge, F.,
Surachetpong, W., Chadzinska, M., Steinhagen, D., Adamek, M., 2020. Antiviral
response of adult zebrafish (Danio rerio) during tilapia lake virus (TiLV) infection.
Fish Shellfish Immunol. 101, 1–8.
Ramirez-Paredes, J.G., Paley, R.K., Hunt, W., Feist, S.W., Stone, D.M., Field, T.R.,
Haydon, D.J., Ziddah, P.A., Nkansa, M., Guilder, J., Gray, J., Duodu, S., Pecku, E.K.,
Awuni, J.A., Wallis, T.S., Verner-Jeffreys, D.W., 2021. First detection of infectious
spleen and kidney necrosis virus (ISKNV) associated with massive mortalities in
farmed tilapia in Africa. Transbound. Emerg. Dis. 68, 1550–1563.
Roy, S.R.K., Yamkasem, J., Tattiyapong, P., Surachetpong, W., 2021. Weight-dependent
susceptibility of tilapia to tilapia lake virus infection. Peerj 9.
Saitou, N., Nei, M., 1987. The neighbor-joining method-A new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Saranya, S.R., Sudhakaran, R., 2020. Report on prevalence of tilapia lake virus infection
in tilapia fishes (Oreochromis niloticus). Biocatal. Agricult. Biotechnol. 27.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT
method. Nat. Protoc. 3, 1101–1108.
Sukonta, T., Senapin, S., Taengphu, S., Hannanta-anan, P., Kitthamarat, M., Aiamsa-
at, P., Chaijarasphong, T., 2022. An RT-RPA-Cas12a platform for rapid and sensitive
detection of tilapia lake virus. Aquaculture 560.
Surachetpong, W., Janetanakit, T., Nonthabenjawan, N., Tattiyapong, P.,
Sirikanchana, K., Amonsin, A., 2017. Outbreaks of tilapia lake virus infection,
Thailand, 2015-2016. Emerg. Infect. Dis. 23, 1031–1033.
Surachetpong, W., Roy, S.R.K., Nicholson, P., 2020. Tilapia lake virus: the story so far.
J. Fish Dis. 43, 1115–1132.
Taengphu, S., Sangsuriya, P., Phiwsaiya, K., Debnath, P.P., Delamare-Deboutteville, J.,
Mohan, C.V., Ha Thanh, D., Senapin, S., 2020. Genetic diversity of tilapia lake virus
genome segment 1 from 2011 to 2019 and a newly validated semi-nested RT-PCR
method. Aquaculture 526.
Tattiyapong, P., Dachavichitlead, W., Surachetpong, W., 2017. Experimental infection of
tilapia lake virus (TiLV) in Nile tilapia (Oreochromis niloticus) and red tilapia
(Oreochromis spp.). Vet. Microbiol. 207, 170–177.
Tsofack, J.E.K., Zamostiano, R., Watted, S., Berkowitz, A., Rosenbluth, E., Mishra, N.,
Briese, T., Lipkin, W.I., Kabuusu, R.M., Ferguson, H., del Pozo, J., Eldar, A.,
Bacharach, E., 2017. Detection of tilapia lake virus in clinical samples by culturing
and nested reverse transcription-PCR. J. Clin. Microbiol. 55, 759–767.
Waiyamitra, P., Tattiyapong, P., Sirikanchana, K., Mongkolsuk, S., Nicholson, P.,
Surachetpong, W., 2018. A TaqMan RT-qPCR assay for tilapia lake virus (TiLV)
detection in tilapia. Aquaculture 497, 184–188.
Waiyamitra, P., Piewbang, C., Techangamsuwan, S., Liew, W.C., Surachetpong, W.,
2021. Infection of tilapia tilapinevirus in Mozambique Tilapia (Oreochromis
mossambicus), a globally vulnerable fish species. Viruses-Basel 13.
T. He et al.
Wang, Y., Wang, Q., Zeng, W., Yin, J., Li, Y., Ren, Y., Shi, C., Bergmann, S.M., Zhu, X.,
2018. Establishment and characterization of a cell line from tilapia brain for
detection of tilapia lake virus. J. Fish Dis. 41, 1803–1809.
Yadav, M.K., Rastogi, A., Criollo Joaquin, M.P., Verma, D.K., Rathore, G.,
Swaminathan, T.R., Paria, A., Pradhan, P.K., Sood, N., 2021. Establishment and
10
Aquaculture 565 (2023) 739166
characterization of a continuous cell line from heart of Nile tilapia Oreochromis
niloticus and its susceptibility to tilapia lake virus. J. Virol. Methods 287.
Yamkasem, J., Piewbang, C., Techangamsuwan, S., Pierezan, F., Soto, E.,
Surachetpong, W., 2021. Susceptibility of ornamental African cichlids Aulonocara
spp. to experimental infection with tilapia lake virus. Aquaculture 542.