ISE Genetics: From Genes to Genomes

(ISE HED WCB CELL & MOLECULAR

BIOLOGY) - eBook PDF
Visit to download the full and correct content document:
https://ebooksecure.com/download/ise-genetics-from-genes-to-genomes-ise-hed-wcb
-cell-molecular-biology-ebook-pdf/
 SEV ENTH E D ITI O N

Genetics
From Genes to Genomes

Michael L. Goldberg
CORNELL UNIVERSITY

Janice A. Fischer
THE UNIVERSITY OF TEXAS AT AUSTIN

Leroy Hood
THE INSTITUTE FOR SYSTEMS BIOLOGY

Leland H. Hartwell
FRED HUTCHISON CANCER CENTER
GENETICS

Published by McGraw Hill LLC, 1325 Avenue of the Americas, New York, NY 10121. Copyright ©2021
by McGraw Hill LLC. All rights reserved. Printed in the United States of America. No part of this publication
may be reproduced or distributed in any form or by any means, or stored in a database or retrieval system,
without the prior written consent of McGraw Hill LLC, including, but not limited to, in any network or other
electronic storage or transmission, or broadcast for distance learning.

Some ancillaries, including electronic and print components, may not be available to customers outside the
United States.

This book is printed on acid-free paper.

1 2 3 4 5 6 7 8 9 LWI 24 23 22 21 20

ISBN 978-1-260-57582-8
MHID 1-260-57582-9

Cover Image: ©H Art/Shutterstock

All credits appearing on page or at the end of the book are considered to be an extension of the copyright page.

The Internet addresses listed in the text were accurate at the time of publication. The inclusion of a website
does not indicate an endorsement by the authors or McGraw Hill LLC, and McGraw Hill LLC does not
guarantee the accuracy of the information presented at these sites.

mheducation.com/highered
 About the Authors

Dr. Michael Goldberg is a Professor at Cornell University, where he teaches

introductory genetics and human genetics. He was an undergraduate at Yale University
and received his Ph.D. in biochemistry from Stanford University. Dr. Goldberg per-
formed postdoctoral research at the Biozentrum of the University of Basel
(Switzerland) and at Harvard University, and he received an NIH Fogarty Senior
International Fellowship for study at Imperial College (England) and fellowships
from the Fondazione Cenci Bolognetti for sabbatical work at the University of Rome
©Michael Goldberg
(Italy). His current research uses the tools of Drosophila genetics and the biochem-
ical analysis of frog egg cell extracts to investigate the mechanisms that ensure proper
cell-cycle progression and chromosome segregation during mitosis and meiosis.

Dr. Janice Fischer is a Professor at The University of Texas at Austin, where she
is an award-winning teacher of genetics and Director of the Biology Instructional
Office. She received her Ph.D. in biochemistry and molecular biology from Harvard
University, and did postdoctoral research at The University of California at Berkeley,
Harvard University, and The Whitehead Institute at MIT. In her research, Dr. Fischer
used Drosophila first to study how tissue-specific transcription works, and then to
examine the roles of ubiquitin and endocytosis in cell signaling during development.
©Janice Fischer

Dr. Lee Hood received an M.D. from The Johns Hopkins University School of
Medicine and a Ph.D. in biochemistry from the California Institute of Technology.
His current research interests include cancer biology, the development of biological
instrumentation (for example, the protein sequencer and the automated fluorescent
DNA sequencer), genomics, systems biology and systems medicine. His early research
played a key role in unraveling the mysteries of antibody diversity. More recently he
has pioneered systems approaches to biology and medicine and has pioneered scien-
tific (quantitative) wellness and the analyses of individuals with genomics/phenomics.
©Lee Hood
Dr. Hood has taught molecular evolution, immunology, molecular biology,
genomics, biochemistry, and systems biology and has coauthored textbooks in
biochemistry, molecular biology, immunology, and systems biology and medicine, as
well as The Code of Codes—a monograph about the Human Genome Project. He was
one of the first advocates for the Human Genome Project and directed one of the
federal genome centers that sequenced the human genome. Dr. Hood is currently a
Professor and cofounder of the cross-disciplinary Institute for Systems Biology in
Seattle, Washington.
Dr. Hood is also Senior Vice President and Chief Science Officer of Providence
St. Joseph Health. Dr. Hood has received a variety of awards, including the Albert
Lasker Award for Medical Research (1987), the Distinguished Service Award from
the National Association of Teachers (1998), and the Lemelson/MIT Award for
Invention (2003). He is the 2002 recipient of the Kyoto Prize in Advanced
Biotechnology—an award recognizing his pioneering work in developing the protein
and DNA synthesizers and sequencers that provided the technical foundation of mod-
ern biology. He received the Medal of Science from President Obama in 2011. He is
deeply involved in K–12 science education. His hobbies include running, exercise,
and reading.

iii
Brief Contents

Preface ix

PART I 15 Ploidy 460

Basic Principles: How Traits Are Transmitted 1 16 Bacterial Genetics 478
1 Mendel’s Principles of Heredity 1 17 Organellar Inheritance 511
2 Extensions to Mendel’s Laws 28
3 Chromosomes and Inheritance 68 PART V
4 Sex Chromosomes 91 How Genes Are Regulated 535
5 Linkage, Recombination, and Gene 18 Gene Regulation in Prokaryotes 535
Mapping 118
19 Gene Regulation in Eukaryotes 570
20 Epigenetics 599
PART II
What Genes Are and What They Do 165
PART VI
6 DNA Structure, Replication, and
Recombination 165 Using Genetics 619

7 Mutation 203 21 Manipulating the Genomes of Eukaryotes 619

8 Using Mutations to Study Genes 229

22 Genetic Analysis of Development 648

9 Gene Expression: The Flow of Information

23 The Genetics of Cancer 683
from DNA to RNA to Protein 257
PART VII
PART III Beyond the Individual Gene and Genome 714
Analysis of Genetic Information 303 24 Variation and Selection in Populations 714
10 Digital Analysis of DNA 303 25 Genetic Analysis of Complex Traits 747

11 Genome Annotation 327

Guidelines for Gene Nomenclature A-1
12 Analyzing Genomic Variation 352 Brief Answer Section B-1
Glossary G-1
Index I-1
PART IV
How Genes Travel on Chromosomes 395

13 The Eukaryotic Chromosome 395

14 Chromosomal Rearrangements 425
iv
 Contents

About the Authors iii 4.2 Gametogenesis 96

Preface ix 4.3 Sex Linkage 98
Acknowledgments xvi 4.4 Sex-Linked and Sexually Dimorphic Traits in
Humans 102
PART I 4.5 Human Intersexuality 106
■ Fast Forward: Transgenic Mice Prove that SRY
Basic Principles: How Traits Is the Maleness Factor 94
Are Transmitted 1 ■ Fast Forward: Visualizing X-Chromosome
Inactivation in Transgenic Mice 105

Lawrence Manning/Corbis chapter 5

chapter 1 Linkage, Recombination, and Gene Mapping 118
Mendel’s Principles of Heredity 1 5.1 Gene Linkage and Recombination 119
5.2 Recombination: A Result of Crossing-Over
1.1 The Puzzle of Inheritance 2
During Meiosis 123
1.2 Genetic Analysis According to Mendel 4
5.3 Mapping: Locating Genes Along a
1.3 Mendelian Inheritance in Humans 14 Chromosome 128
5.4 The Chi-Square Test and Linkage Analysis 137
chapter 2 5.5 Tetrad Analysis in Fungi 141
Extensions to Mendel’s Laws 28 5.6 Mitotic Recombination and Genetic
2.1 Extensions to Mendel for Single-Gene Mosaics 149
Inheritance 29 ■ Fast Forward: Mapping the Crossovers that

2.2 Extensions to Mendel for Two-Gene Generate the Chromosomes of Individual

Inheritance 38 Human Sperm 135
2.3 Extensions to Mendel for Complex Trait ■ Fast Forward: Gene Mapping Has Led to
Inheritance 48 Treatments for Cystic Fibrosis 137
2.4 A Comprehensive Example: Dog Coat Color ■T ools of Genetics: The Chi-Square Test for
Genes 52 Goodness of Fit 140
■ Genetics and Society: Mitotic Recombination
chapter 3 and Cancer 151
Chromosomes and Inheritance 68
3.1 Chromosomes: The Carriers of Genes 69
PART II
3.2 Mitosis: Cell Division that Preserves What Genes Are and What
Chromosome Number 72 They Do 165
3.3 Meiosis: Cell Divisions that Halve
Chromosome Number 77
■ Genetics and Society: Prenatal Genetic
Diagnosis 71 Adrian Neal/Getty Images

chapter 6
chapter 4 DNA Structure, Replication, and
Sex Chromosomes 91 Recombination 165
4.1 Sex Chromosomes and Sex 6.1 Experimental Evidence for DNA as the Genetic
Determination 92 Material 166

v
vi Contents

6.2 The Watson and Crick Double Helix Model of

DNA 170 PART III
6.3 Genetic Information in Nucleotide
Analysis of Genetic
Sequence 176
Information 303
6.4 DNA Replication 178
6.5 Homologous Recombination at the DNA
Level 185
6.6 Site-Specific Recombination 193 ©CBS Photo Archive/Getty Images

chapter 10
chapter 7
Digital Analysis of DNA 303
Mutation 203
10.1 Fragmenting DNA 304
7.1 Mutations: Primary Tools of Genetic 10.2 Cloning DNA Fragments 309
Analysis 204
10.3 Sequencing DNA 313
7.2 Molecular Mechanisms that Alter DNA
10.4 Sequencing Genomes 317
Sequence 209
■T ools of Genetics: Serendipity in Science: The
7.3 DNA Repair Mechanisms 218
Discovery of Restriction Enzymes 306
■ Fast Forward: Trinucleotide Repeat
Diseases 216
chapter 11
chapter 8 Genome Annotation 327
Using Mutations to Study Genes 229 11.1 Finding the Genes in Genomes 328
11.2 Genome Architecture and Evolution 333
8.1 What Mutations Tell Us About Gene
Structure 230 11.3 Bioinformatics: Information Technology and
Genomes 341
8.2 What Mutations Tell Us
About Gene Function 238 11.4 A Comprehensive Example: The Hemoglobin
Genes 342
8.3 A Comprehensive Example: Mutations that
Affect Vision 245
chapter 12
chapter 9 Analyzing Genomic Variation 352
Gene Expression: The Flow of 12.1 Variation Among Genomes 353
Information from DNA to RNA 12.2 Genotyping a Known Disease‑Causing
to Protein 257 Mutation 357
9.1 The Genetic Code 258 12.3 Sampling DNA Variation in
a Genome 362
9.2 Transcription: From DNA
to RNA 267 12.4 Positional Cloning 368
9.3 Translation: From mRNA to Protein 275 12.5 The Era of Whole-Genome
Sequencing 374
9.4 Differences in Gene Expression
■ Fast Forward: Genetic Genealogy 366
Between Prokaryotes and
Eukaryotes 283 ■T ools of Genetics: The Lod Score
9.5 The Effects of Mutations on Gene Expression Statistic 372
and Function 286
■ Genetics and Society: HIV and Reverse
Transcription 271

PART IV
How Genes Travel on
Chromosomes 395
(left): Texas A&M University/FEMA/HandoutGetty Images;
(right): ©Alpha/ZUMAPRESS/Newscom
chapter 13
The Eukaryotic Chromosome
13.1 Chromosomal DNA and Proteins 396
13.2 Chromosome Structure and Compaction 397
13.3 Chromosomal Packaging and Gene
Expression 402
13.4 Replication of Eukaryotic Chromosomes 408
13.5 Chromosome Segregation 411
13.6 Artificial Chromosomes 414
chapter 14
Chromosomal Rearrangements 425
14.1 Rearrangements of Chromosomal DNA 426
14.2 The Effects of Rearrangements 430
14.3 Transposable Genetic Elements 440
14.4 Genome Restructuring and Evolution 447
■ Fast Forward: Programmed DNA Rearrangements
and the Immune System 428
chapter 15
Ploidy 460
15.1 Aberrations in Chromosome Number:
Aneuploidy 461
15.2 Variation in Number of Chromosome Sets:
Euploidy 464
15.3 Whole-Genome Duplication as a Driver of
Evolution 470
chapter 16
Bacterial Genetics 478
16.1 The Enormous Diversity of Bacteria 479
16.2 Bacterial Genomes 480
16.3 Bacteria as Experimental Organisms 485
16.4 Gene Transfer in Bacteria 487
16.5 Using Genetics to Study Bacterial Life 499
Contents vii
16.6 A Comprehensive Example: How N. gonorrhoeae
Became Resistant to Penicillin 501
■ Genetics and Society: The Human Microbiome
Project 484
chapter 17
Organellar Inheritance 511
17.1 Mitochondria and Their Genomes 512
17.2 Chloroplasts and Their Genomes 515
395 17.3 The Relationship Between Organellar and
Nuclear Genomes 517
17.4 Non-Mendelian Inheritance of Mitochondria
and Chloroplasts 519
17.5 Mutant Mitochondria and Human Disease 524
■ Fast Forward: Mitochondrial Eve 524
PART V
How Genes Are
Regulated 535
©Courtesy of Mattias Ormsestad
and Eric Roettinger/Kahi Kai
chapter 18
Gene Regulation in Prokaryotes 535
18.1 The Elements of Prokaryotic Gene
Expression 536
18.2 Regulation of Transcription Initiation via DNA-
Binding Proteins 537
18.3 RNA-Mediated Mechanisms of Gene
Regulation 549
18.4 Discovering and Manipulating Bacterial Gene
Regulatory Mechanisms 553
18.5 A Comprehensive Example: Control of
Bioluminescence by Quorum Sensing 558
chapter 19
Gene Regulation in Eukaryotes 570
19.1 Overview of Eukaryotic Gene Regulation 571
19.2 Control of Transcription Initiation Through
Enhancers 571
19.3 Regulation After Transcription 582
19.4 A Comprehensive Example: Sex Determination
in Drosophila 587
■T ools of Genetics: The Gal4/UASG Binary Gene
Expression System 578
viii Contents
chapter 20
Epigenetics 599
20.1 Genomic Imprinting 600
20.2 Inheritance of Programmed Gene Repression
Through Cell Division 604
20.3 Transgenerational Epigenetic
Inheritance 607
20.4 A Comprehensive Example: Epigenetic
Inheritance in Mice 609
PART VI
Using Genetics 619
©Michael Goldberg, Cornell
University, Ithaca, NY
chapter 21
Manipulating the Genomes of
Eukaryotes 619
21.1 Creating Transgenic Organisms 620
21.2 Uses of Transgenic Organisms 623
21.3 Targeted Mutagenesis 627
21.4 Human Gene Therapy 634
■ Tools of Genetics: Cloning by Somatic Cell
Nuclear Transfer 625
■ Tools of Genetics: How Bacteria Use CRISPR/
Cas9 to Vaccinate Themselves Against
Viruses 633
■ Genetics and Society: Should We Alter Human
Germ-Line Genomes? 638
chapter 22
Genetic Analysis of Development 648
22.1 Model Organisms: Prototypes for
Developmental Genetics 649
22.2 Mutagenesis Screens 650
22.3 Determining Where and When Genes
Act 656
22.4 Ordering Genes in a Pathway 659
22.5 A Comprehensive Example: Body Plan
Development in Drosophila 661
chapter 23
The Genetics of Cancer 683
23.1 Characteristics of Cancer Cells 684
23.2 The Genetic Basis of Cancers 686
23.3 How Cell Division Is Normally Controlled 689
23.4 How Mutations Cause Cancer 695
23.5 Personalized Cancer Treatment 701
■T ools of Genetics: Analysis of Cell-Cycle
Mutants in Yeast 693
PART VII
Beyond the Individual Gene
and Genome 714
©Sue Flood/Oxford
Scientific/Getty Images
chapter 24
Variation and Selection in Populations 714
24.1 The Hardy-Weinberg Law: Predicting
Genetic Variation in “Ideal” Populations 715
24.2 What Causes Allele Frequencies to
Change in Real Populations? 721
24.3 Ancestry and the Evolution of Modern
Humans 731
chapter 25
Genetic Analysis of Complex Traits 747
25.1 Heritability: Genetic Versus Environmental
Influences on Complex Traits 748
25.2 Mapping Quantitative Trait Loci (QTLs) 757
■T ools of Genetics: The Chi-Square Test for
Independence 764
Guidelines for Gene Nomenclature A-1
Brief Answer Section B-1
Glossary G-1
Index I-1

A Note from the Authors
The science of genetics is less than 150 years old, but its
accomplishments within that short time have been aston-
ishing. Gregor Mendel first described genes as abstract
units of inheritance in 1865; his work was ignored and
then rediscovered in 1900. Thomas Hunt Morgan and his
students provided experimental verification of the idea
that genes reside within chromosomes during the years
1910–1920. By 1944, Oswald Avery and his coworkers
had established that genes are made of DNA. James
Watson and Francis Crick published their pathbreaking
structure of DNA in 1953. Remarkably, less than 50 years
later (in 2001), an international consortium of investiga-
tors deciphered the sequence of the 3 billion nucleotides in
the h­ uman genome. Twentieth-century genetics made it
possible to identify individual genes and to understand a
great deal about their functions.
Today, scientists are able to access the enormous
amounts of genetic data generated by the sequencing of
many organisms’ genomes. Analysis of these data will re-
sult in a deeper understanding of the complex molecular
interactions within and among vast networks of genes, pro-
teins, and other molecules that help bring organisms to life.
Finding new methods and tools for analyzing these data will
be a significant part of genetics in the twenty-first century.
Our seventh edition of Genetics: From Genes to Genomes
emphasizes both the core concepts of genetics and the
cutting-edge discoveries, modern tools, and analytical meth-
ods that will keep the science of genetics moving forward.
The authors of the seventh edition have worked to-
gether in revising every chapter in an effort not only to
provide the most up-to-date information, but also to pro-
vide continuity and the clearest possible explanations of
difficult concepts in one voice.
Our Focus—An Integrated Approach
Genetics: From Genes to Genomes represents a new approach
to an undergraduate course in genetics. It reflects the way
we, the authors, currently view the molecular basis of life.
We integrate:
∙∙ Formal genetics: the rules by which genes are
transmitted.
∙∙ Molecular genetics: the structure of DNA and how it
directs the structure of proteins.
∙∙ Digital analysis and genomics: recent technologies
that allow a comprehensive analysis of the entire gene
set and its expression in an organism.
Preface
Last A-Head ix
∙∙ Human genetics: how genes contribute to health and
diseases, including cancer.
∙∙ The unity of life-forms: the synthesis of information
from many different organisms into coherent models.
∙∙ Molecular evolution: the molecular mechanisms by
which biological systems, whole organisms, and
populations have evolved and diverged.
The strength of this integrated approach is that students
who complete the book will have a strong command of
­genetics as it is practiced today by both academic and cor-
porate researchers. These scientists are rapidly changing
our understanding of living organisms, including ourselves.
Ultimately, this vital research may create the ability to re-
place or correct detrimental genes—those “inborn errors of
metabolism,” as researcher Archibald Garrod called them
in 1923, as well as the later genetic alterations that lead to
the many forms of cancer.
The Genetic Way of Thinking
Modern genetics is a molecular-level science, but an under-
standing of its origins and the discovery of its principles is
a necessary context. To encourage a genetic way of think-
ing, we begin the book by reviewing Mendel’s principles
and the chromosomal basis of inheritance. From the outset,
however, we aim to integrate organism-level genetics with
fundamental molecular mechanisms.
Chapter 1 ties Mendel’s studies of pea trait inheritance
to the actions of enzymes that determine whether a pea is
round or wrinkled, yellow or green, etc. In the same chapter,
we point to the relatedness of the patterns of ­heredity in all
organisms. Chapters 2 through 5 cover extensions to
Mendel, chromosomes and inheritance, and the fundamen-
tals of gene linkage and mapping. Starting in Chapter 6, we
focus on the physical characteristics of DNA, on mutations,
and on how DNA encodes, copies, and transmits biological
information.
Beginning in Chapter 10, we move into the digital rev-
olution in DNA analysis with a look at modern genetic
techniques, including gene cloning, PCR, microarrays, and
high-throughput genome sequencing. We explore how
­bioinformatics, an emergent analytical tool, can aid in dis-
covery of genome features. This section concludes in
Chapter 12 with case studies leading to the discovery of
human disease genes.
The understanding of molecular and computer-based
techniques carries into our discussion of chromosome
specifics in Chapters 13 through 17, and also informs our
ix
x Preface

analysis of gene regulation in Chapters 18 through 20. Figure illustrations break down complex processes
Chapter 21 describes the most recent technology that sci- into ­step-by-step illustrations that lead to greater
entists can use to manipulate genomes at will—for research student understanding. All illustrations are rendered
and practical purposes including gene therapy. Chapter 22 with a consistent color theme—for example, all
explains the use of genetic tools at the molecular level to presentations of phosphate groups are the same color,
uncover the complex interactions of eukaryotic develop- as are all presentations of mRNA.
ment. In Chapter 23, we explain how our understanding of ∙∙ Accessibility Our intention is to bring cutting-edge
genetics and the development of molecular genetic tech- content to the student level. A number of more
nologies is enabling us to comprehend cancer and in some complex illustrations are revised and segmented to
cases to cure it. help the student follow the process. Legends have been
Chapters 24 and 25 cover population genetics, with a streamlined to highlight only the most important ideas,
view of how molecular tools have provided information on and throughout the book, topics and examples have
species relatedness and on genome changes at the molecular been chosen to focus on the most crucial information.
level over time. In addition, we explain how bioinformatics ∙∙ Problem Solving Developing strong problem-solving
can be combined with population genetics to trace ­human skills is vital for every genetics student. The authors
ancestry and to identify the genes that control complex traits. have carefully created problem sets at the end of each
Throughout our book, we present the scientific reason- chapter that allow students to improve their problem-
ing of some of the ingenious researchers of the field—from solving abilities, often in the context of current
Mendel, to Watson and Crick, to the collaborators on the discoveries in genetics.
Human Genome Project. We hope student readers will see ∙∙ Solved Problems These cover topical material with
that genetics is not simply a set of data and facts, but also a complete answers that provide insight into the step-
human endeavor that relies on contributions from excep- by-step process of problem solving.
tional individuals. ∙∙ Problems More than 700 questions involving a variety
of levels of difficulty develop excellent problem-
solving skills. The problems are organized by chapter
Student-Friendly Features section and in order of increasing difficulty within
each section for ease of use by instructors and
As digital components of the text become more and more
students. The companion online Study Guide and
crucial, we are very excited that Janice Fischer, a textbook
Solutions Manual, completely revised for the seventh
author, will continue in the seventh edition in a dual role as
edition by Michael Goldberg and Janice Fischer,
Digital Editor! Janice will ensure the important consistency
provides detailed analysis of strategies to solve all of
between text and digital.
the end-of-chapter problems. Many of the more
We have taken great pains to help the student make the
difficult problems could be adapted easily for use
leap to a deeper understanding of genetics. Nu­merous
as case studies in the classroom. Solved Problems 223
­features of this book were developed with that goal in mind.
∙∙ One Voice
Genetics Genes to Genomes S O LV E D P R O B L E M S
has a friendly, engaging
reading style that helps Solved Problem I Depending on its tautomeric state, 5-BU can some-
students master the concepts The DNA sequence of one strand of a gene from three in- times behave like thymine and sometimes like cyto-
throughout this book. The dependently isolated mutants is given here (5′ ends are at sine. 5-BU is a two-way mutagen. A reversion (C⋮G
left). Using this information, what is the sequence of the → T:A) can occur if 5-BU is incorporated into DNA
writing style provides the wild-type gene in this region? in the C-like state (the DNA will have a 5-BU⋮G)
student with the focus and mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCG
base pair, and then 5-BU acts like a T during the next
round of replication, resulting in a 5-BU:A base pair.
continuity required to make mutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCG Following the next round of DNA replication, the
the book successful in the mutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG result will be T:A.
classroom. b. Hydroxylamine changes C to hydroxylated C (C* in
Answer Fig. 7.13b), and C* can pair only with A. As shown in
∙∙ Visualizing Fig. 7.13b, hydroxylamine can cause a C⋮G →T:A
Each independently derived mutation will be caused by a
Genetics The highly different single base change. When you find a base that dif- substitution. Because it cannot modify a T:A base
specialized art program fers in only one of the three sequences, that different base pair, hydroxylamine is a one-way mutagen.
is the mutation. Determine the wild-type sequence by find- c. Ethylmethane sulfonate (EMS) modifies (ethylates)
developed for this book ing the base that is present at that position in the other two G within a DNA molecule. Figure 7.13b shows that if
integrates photos and line art sequences (underlined in the following). The wild-type ethylated G (G*) pairs with T during replication, a
sequence is therefore: G⋮C → A:T substitution results in the next round of
in a manner that provides replication. Because it cannot modify an A:T base
the most engaging visual 5′ ACCGTAGTCGACTGGTAAACTTTGCGCG 3′
pair, EMS is a one-way mutagen.
presentation of genetics Solved Problem II
d. Nitrous acid changes C to U and also A to hypoxan-
thine (H), a base that pairs C. Figure 7.13b shows
available. Our Feature So-called two-way mutagens can induce both a particular how these nitrous acid-induced alterations can cause
mutation and (when added subsequently to cells whose (after DNA replication) both C⋮G → T:A and
chromosomes carry this mutation) a true reversion of the T:A → C⋮G substitutions; either of these changes
mutation that restores the original DNA sequence. In con- can revert the other. Thus, nitrous acid is a two-way
trast, one-way mutagens can induce mutations but not exact mutagen.
reversions of these mutations. Based on Fig. 7.13, which of e. Proflavin can add any single base pair or delete any
 Changes in the Seventh Edition:
A Chapter-by-Chapter Summary
The seventh edition has been revised and modernized sig-
nificantly as compared with the sixth edition. We scruti-
nized the entire text and clarified the language wherever
possible. In total, we created more than 30 new figures and
tables, and revised many more in addition. We also wrote
more than 100 new end-of-chapter problems, and revised
many other problems for clarity.
Based on user feedback, we eliminated Chapter 1 in the sev-
enth edition, which allowed space to split three long chapters
in the sixth edition into two separate chapters, and to create a
new chapter. Chapter 4 in the sixth edition became Chapter 3
(Chromosomes and Inheritance) and Chapter 4 (Sex
Chromosomes) in the seventh edition. Chapter 7 in the sixth
edition became Chapter 7 (Mutation) and Chapter 8 (Using
Mutations to Study Genes) in the seventh edition. Chapter 13
in the sixth edition became Chapter 14 (Chromosomal
Rearrangements) and Chapter 15 (Ploidy) in the seventh edi-
tion. And a new Chapter 20 (Epigenetics) contains expanded
coverage of this fast-moving field. The entire Solutions
Manual and Study Guide was corrected and revised for clarity.
Along with the numerous text changes, Janice Fischer spent
a great deal of time helping to update the test bank and ques-
tion bank content to align with the new edition. Author
Janice Fischer recorded video tutorials for the sixth edition
that will be included with the seventh edition. These tutori-
als explain topics that are often difficult to understand.
Every chapter of the seventh edition was improved signifi-
cantly from the sixth edition. The most important changes in
the seventh edition are summarized below:
Chapter 4 Sex Chromosomes
∙∙ New section Human Intersexuality.
Chapter 5 Linkage, Recombination, and Gene Mapping
∙∙ Clarified analysis of three-point testcrosses.
Chapter 9 Gene Expression
∙∙ Updated Wobble rules.
Chapter 10 Digital Analysis of DNA
∙∙ Clarified explanation of whole-genome shotgun
sequencing.
Chapter 11 Genome Annotation
∙∙ Clarified overview of DNA sequence organization of
chromosomes.
Chapter 12 Analyzing Genomic Variation
∙∙ New coverage of genetic genealogy.
∙∙ New explanation of Illumina high-throughput DNA
sequencing technology.
Chapter 13 The Eukaryotic Chromosome
∙∙ New coverage of the role of condensins in shaping
chromosomes.
∙∙ Updated information about the mechanism of
X-chromosome inactivation.
∙∙ Updated coverage of yeast synthetic chromosomes.
Chapter 19 Gene Regulation in Eukaryotes
∙∙ New coverage of topologically associating domains
(TADs) and chromatin conformation capture
technology.
∙∙ Epigenetics section moved in revised form into new
Chapter 20.
Chapter 20 Epigenetics (New!)
∙∙ Genomic imprinting in mammals.
∙∙ Transmission of programmed gene repression through
cell division.
∙∙ Transgenerational epigenetic inheritance.
∙∙ Intergenerational inheritance of acquired traits in
mammals.
Chapter 21 Manipulating the Genomes of Eukaryotes
∙∙ Updated coverage of CRISPR/Cas9 technology.
∙∙ Updated material on transgenic animals for human
drug production and consumption.
∙∙ Updated coverage of human gene therapy.
Chapter 23 The Genetics of Cancer
∙∙ Coverage of new cancer therapies that strengthen the
body’s immune surveillance (CAR-T cell therapy and
PD-1/PD-L1 antibody treatment).
Chapter 25 Genetic Analysis of Complex Traits
∙∙ Clarified and updated material on human GWAS
analysis.
xi
 of20
Guided Tour
chapterMammalian Cells Retain Memories
Inactivated X Chromosomes
ze
In Chapters 4 and 13, you saw that when early embryos of

t is
Epigenetics
mammalian females contain approximately 500–1000
cells, a random one of the two X chromosomes becomes
ere. facultative heterochromatin—a Barr body—in each cell.
With the exception of a few genes (mostly in the pseudoau-
e
tosomal regions), the entire Barr body chromosome is
en Integrating
silenced. Genetic Concepts
Genetics:You will From recall
Genesthat totheGenomes
long noncoding takes anRNA (lncRNA)
integrated approach in its presentation of genetics, thereby giving students a
Courtesy Randy L. Jirtle, Ph.D. Originally published in B. Weinhold,
Xist is command
strong key to Barr body formation.
of genetics The Xist
as it is practiced lncRNA
today
“Color byby is Linkedand
Soy:academic
Genistein corporate
to Epigenetic Effects,” researchers.
Environ Health Principles are related through-
transcribed
out the text from the one essays,
in examples, X chromosome that Perspect.
case histories, will
andbecome
2006 Apr., 114(4): A240. Environews, Science Selections
connections sections toVYmake sure students fully understand the rela-
the Barr body.
tionships between Thetopics.
Xist lncRNA binds the X chromosome Despite having the same agouti genotype (A a), the coat
colors of these mice differ. In the yellow (mutant) mouse, the AVY
from which it was transcribed, spreads along its length,
epiallele and
is unmethylated, while in the gray (normal) mouse, AVY
recruits histone modifying enzymes to the chromatin (re-
is hypermethylated.
call Fig. 13.16). Consequently, the chromatin of the inac-
tiveChapter
X is covered Outline
with histone marks such as H3K9me c h a pt e r o u t l i n e
and
H3K27me
Every chapter thatopens
closewith chromatin and recruit DNMTs
a brief outline ● 20.1 Genomic that Imprinting
THE SEQ methylate
U EofN the O FCpG
C E chapter DNA islands.
contents.
base pairs in genes is the ● 20.2 Inheritance of Programmed Gene
ultimate, but Remarkably,
not only, carrierinofallgenetic information. of each ofRepression
the descendants those Through Cell Division
Geneticists have known for a long time that somatic cells 20.3 Transgenerational Epigenetic Inheritance
original 500–1000 female embryonic cells, the same
●

or gametes can also transmit information between genera- 20.4 A Comprehensive Example: Epigenetic
X chromosome (either the maternal X or the paternal X) at the A Locus in Mice
●

tions of cells or organisms—information not contained in Inheritance

becomes
the base-pair sequencethe Barr body
of DNA—about the following
levels at whicheach cell division
genes are(revisit
expressed.Fig. Such 4.13).
information What is the
transfers agent of this cellular
are known
as epigenetic
memory? phenomena: heritable, self-perpetuating inactive (“off” in the normal 604 grayChapter mouse). 20 The Epigenetics
remark-
changes in gene expression not caused by mutation in the able differences in phenotype result from the fact that the
We do not yet know the answer to “on”
base-pair sequence of DNA.
this orimportant
“off” information obtained from the egg is cop-
question.
The two mice in the One possibility
photograph have anisidentical
that the gen- inactive
ied in all X ofmighta mouse’s somatic cells. Keep in mind that
otype: In transmit
addition to “off” information at have
the replication thefork through
a null allele (a), they both a gain- base-pair
20.2 Inheritance of Programmed
sequence of the AVY allele is the same in the The answe
continued association of Xist with the chromosome. How- What is different is heritable epigene-
two mice pictured.
VY
of-function mutant allele of the agouti gene (A ) that causes cells are newly
normally gray
ever,mice to todate,
be yellow and obese.
scientists haveYet the
obviously look different. The mutant AVY allele is caused by
nottwo mice
determined tic information
whether the about whether
promoter in the mutant allele is active.
or notGene Repression Through Cell
the retrotransposon
information ab
XistoflncRNA
the insertion dissociates
a retrotransposon near thefrom normalthe geneDNAA duringTwo replica-
themes emerge in this chapter. Division
First, transmission of generations of
promoter.tion. Learning
The Another
retrotransposon Objectives
possibility
has its own is that CpG
promoter andmethylation
a “cellular marksmemory” of a gene’s expression state usually they should be
on Learning
transcriptional the inactive
regulatory X DNA
region.
Objectives Theappear arebefore
phenotypiccopied atsection,involves collaboration
the replication
differences
each and are care- fork, between three factors: modified cyto- depending on
between the two mice reflect whether A gene transcription sine residues in DNA, modified l earhistone
n i n gtail amino
ectiacids
vesin made in the ne
andfullythatwritten
a feedback
to clearlyloopoutlinesimilar to that shown
­expectations. in Figure
chromatin, and small RNA molecules. Second, epigenetic
o bj
is driven by the normal A gene promoter or by the stronger the same on/of
promoter 20.9b reconstructs the
of the retrotransposon. In therepressive
yellow and obesehistone information—the
modifications.combination of these molecular factors that
1. Describe the epigenetic phenomenon that helps
Whatever
mouse at the the mechanism
left, the retrotransposon’s promoter ofis the
activememory,
and it probably
determines whether a gene is “on” or “off”—can change. cause activator
differentiated cells maintain their fates through cell
needs
“takes over” to allow
transcription of the transcription
A gene,
Xist because Xist
causing overproduc- Some transcripts
changes in epigenetic information are programmed: that cytoplasm can
divisions.
tion of thearegene product
likely in pigment-making
needed cells and mis-
to help reinitiate is, theyformation
Barr body are predetermined events during an organism’s devel- after DNA rep
hyl-
expression in the brain. In the normal gray mouse, the opment. Other epigenetic changes, 2. Discuss mechanisms
like variations by which the memory of
in the on/off ever, an epigen
after DNA replication. information at AVY, are initiated byconstitutive
chance or byheterochromatin
the environ- is transmitted through cell
NA
retrotransposon’s promoter is silenced (repressed long-term) lular memory
so ment. For this reason, scientists aredivisions.fascinated by the possibil-
othA gene transcription occurs from its normal promoter. ity that our individual human experiences—for example, what that repress tra
Information transmitted to the mice from their mothers 3. Speculate as to how the memory of the inactive
in.
through
essen tial con cepts
the eggs determines whether the retrotransposon’s
20.2 we eat or how we are treated by others—may alter epigenetic
vi- information that could be passed X chromosome
on to future generations.may be retained in the somatic cells of
promoter is active (“on” in the yellow, obese mouse) or
• Some histone marks that cause gene repression can be mammalian females. Establishmen
ory.
copied, though inefficiently, at the replication fork
re- because the enzyme that modifies the histone protein One well-stud
599
tes also binds the mark it makes. Marks retained by histones Hox (homeobo
to- In the previous section, you saw that genomic imprinting Hox genes enc
recycled at the replication fork attract the same
ies modifying enzymes, which then copy the mark onto
occurs before fertilization in germ-line cells of a parent. that set up the
use unmarked histones. The marked chromosomes transmit the cellular memory each segment
the (in the formConcepts
Essential of methylated cytosines in DNA) to progeny “know” which
• Feedback loops between DNA methylation and histone
ed- via the gametes. It is important to understand that imprint- lar combinatio
methylation help provide a cellular memory of After each section, the most important points of content are now
m- programmed gene silencing in heterochromatin.
ing affects only a few genes with sex-specific ICRs; it is This method fo
provided in concise, bulleted statements to reinforce crucial
rare for a gene to be inherited through gametes with infor- cells depends c
concepts and learning objectives for students.
mation about whether it should be expressed. of Hox genes i
In this section, we discuss several important epigenetic Many Hox
phenomena in which genes can transmit information about DNA sequenc
their silenced transcriptional status to subsequent genera- ment), which b
tions of cells through mitosis, but not to subsequent genera- repressor pro
tions of individuals through the gametes. However, just as repressive com
xii
in genomic imprinting, the cellular memories in all of these subunits is a hi
cases are “programmed,” meaning that transmission of a specific lysi
these memories is not specific to any one individual, but the specific h
 Guided Tour xiii
484 Chapter 16 Bacterial Genetics

GENETICS AND SOCIETY

Genetics and Society Essays
The Human Microbiome Project
Established in 2008 and funded by the U.S. National Institutes
Dramatic essays explore the social and ethical
of Health, the Human Microbiome Project (HMP) is one of sev- ­issues created by the multiple applications of
eral international consortia aiming to understand the complex
relationship between our bodies and the trillions of microorgan- modern genetic ­research.
isms that inhabit them.
The HMP has already achieved its first goal of describing
the diversity of the organisms that make up the human microbi-
ome. Investigators analyzed the microbial metagenomes lo-
cated at several different sites in the bodies of more than
250 people from around the globe. These studies focused on
the sequence of the gene encoding the 16S rRNA of the ribo-
somal small subunit of these bacteria, because these sequences
diverge substantially in different bacterial species and thus
serve as markers for those species. The results showed that a
single person can harbor up to 1000 different bacterial species, Anna Smirnova/Alamy
but people vary widely in the types of bacteria that make up
their microbiome. It appears that, worldwide, more than 10,000 raised in sterile environments. Surprisingly, germ-free mice can
different bacterial species colonize human bodies. The research- survive although they are not normal: They have altered immune
ers of the HMP have already sequenced the complete genomes systems, poor skin, and they need to eat more calories than do
of many of these kinds of bacteria. normal mice to maintain a normal body weight. Researchers can
The second phase of the HMP began in 2014, and is populate germ-free mice with a single bacterial species or a
TOOLS OF GENETICS
aimed ultimately at determining whether changes in the mi- complex microbial community, and thus determine how microbi-
crobiome are the causes or effects of diseases or other im-
portant traits in humans. Diseases potentially linked to Vaccinate
How Bacteria the
omes influence physiological states. Problem 8 at the end of this
chapter will allow youAgainst
Themselves to exploreViruses
this approach
withby discussing an
CRISPR/Cas9
Tools of
microbiome include cancer, acne, psoriasis, diabetes, obesity,
and inflammatory bowel disease; some investigators have
experiment performed with germ-free mice that asks if the mi-
At the CRISPR locus of bacterial genomes, short direct repeats are
crobiome plays a causal role in human obesity.
interrupted at regular intervals by unique spacer sequences (Fig. A).
and the Cas9 enzyme cooperate to cleave the viral genome
(Fig. A). The 5' end of the crRNA base pairs with its target DNA
Genetics Essays
suggested that the composition of microbiomes could also If microbial communities indeed contribute to disease
The spacers are fragments of bacteriophage genomes captured by
influence the mental health of their hosts. The first step in
in the bacteriophage chromosome, while the 3' end of the
states in humans, then future therapeutics might aim to alter Current readings explain
the host cell and integrated into the host genome by the action of crRNA base pairs with tracrRNA. A stem loop in the tracrRNA
these studies will be to establish whether statistical correla- resident microbiomes. Thus, the flip side of the HMP is to inves-
two bacterially encoded proteins (Cas1 and Cas2). The repeats
tions exist between specific kinds of microbial communities
binds to Cas9. Thus, the crRNA and tracrRNA together bring
tigate how human interventions might change bacterial com-
various techniques and
within the CRISPR arrays are added by these endonucleolytic
and disease states. How can researchers establish whether a
Cas9 enzyme to the target sequence in the viral genome. Cas9
munities. How effective are dietary changes or dietary additives
enzymes during the capture and integration process (not shown). cleaves the phage chromosome, preventing infection. tools used by geneticists,
statistical correlation between microbiomes and diseases re- such as probiotics in effecting long-lasting alterations in micro-
flects a cause or an effect?
Viral immunity begins with transcription of the CRISPR ar-
biomes? If acute infections are treated with
ray into long RNA molecules called pre-crRNAs that are pro-
Notice that the crRNAs are always adjacent to PAM sites in
antibiotics, how will
the invading bacteriophage DNAs. However, the Cas1 and
including examples of
One powerful method for establishing the cause
cessed
of microbiome changes is the use of germ-free
into and effect
short
mice born
(24–48 bacterial
and
nt) CRISPR
are already
communities changeThis
RNAs (crRNAs).
exploring
over time? Several
Cas2 HMP
proteins projects excluded the PAM sites from the viral
specifically applications in biology
chopping-up of the large RNA requires anotherthese
smallimportant
RNA questions.
genome fragments that were integrated into the CRISPR array
called tracrRNA (trans-acting CRISPR RNA) that is transcribed as spacers. In this way, Cas9 cleaves only invading viral DNA, and medicine.
from a gene in the host genome (Fig. A). The tracrRNA forms but not the CRISPR locus in the bacterial chromosome.
complementary base pairs with the repeat sequences in the For editing the chromosomes of eukaryotic organisms, re-
The human microbiome pre-crRNA. These double-strandedgut microbes helpare
RNA regions cause obesity,
cleaved by inflammatory
searchers join thediseases
crRNA andof tracrRNA together in a single RNA
RNAse III (at the black triangles) to produce the short crRNAs. molecule (anGenetics
sgRNA) that brings Cas9 to the site of interest in
The U.S. National Institutes of Health has undertaken
When an invadinga virustheinjects
digestive system, and even cancer.
its double-stranded DNA
The and
the eukaryotic genome (Fig. 21.13).
metagenomic analysis of the bacteria chromosome
that live on intothethe Society box The Human Microbiome Project discusses the
hu-host cell, a specific crRNA, the Chapter 12 Analyzing Genomic Variation
tracrRNA,
366
man body—the Human Microbiome Project. In one of progress of this endeavor in more detail.
Figure
the first experiments in this project, bacterial samples A The CRISPR/Cas9 locus vaccinates Streptococcus pyogenes bacteria against viruses.
were
taken from different tissues like gut and skin on and in the Extremophile metagenomes CRISPR
Repeats Spacers

bodies of 242 healthy individuals. This analysis revealed tracrRNA Scientists also cas9
analyzeFthe
A Smetagenomes
T F O R WA of Rbacteria
D that
more than 10,000 different bacterial species in total, and as live in extreme environments (extremophiles) because they
many as 1000 on a single individual. The most striking cas9 mRNAof genes for proteins that work under
harbor an abundance 3′
conclusion from this study is that individuals vary widely3′ unusual 5′conditions. These Genetic Genealogy
proteins
5′ can sometimes be use- Pre-crRNA

in the species of bacteria that they carry.
A major current goal of the microbiome project is to
determine how human microbiomes affect important traits
RNase III
of their hosts. Strong evidence already exists that human
5′
ful in the laboratory. For example,
Between 1976 and DNA
Taq1986, the polymerase,
so-called “Golden State Killer” The degree of genetic relatedness between any two individ-
committed at least 50 rapes and 12 murders in California. This uals can be estimated by the fraction of their (autosomal) DNA
the enzyme usedCas9
for PCR because it can withstand the hot
40-year-old cold case was reopened in 2018 as a consequence that they share (Fig. B). For example, your DNA comes from half
temperatures that denature DNA, comes from the bacterial
of people’s natural fascination with their genealogy; that is, in- of your mother’s DNA (in an egg) and half of your father’s DNA (in
species Thermus aquaticus,
formation first
aboutdiscovered
their ancestryinand thecurrent-day
hot relatives. a sperm); therefore, you share 50% of your DNA with each of your
Genealogy companies—the largest and best known of these parents. You also share 50% of your DNA with each of your sib-
being 23andMe and Ancestry.com—use microarray technology lings, on average: Each parent has two alleles of each SNP, and
similar to that shown in Fig. 12.15 to analyze the genomic DNA each child inherits a random one of those two SNP alleles.
submitted in the saliva of their clients to determine which alleles The power of genetic genealogy comes from two sources:
3′ 3′ Pre-crRNA processing
of many3′SNP loci they carry. 3′ First, microarrays look at a very large number of SNPs; and
5′ 5′ The basis of genetic 5′ genealogical analysis
5′ is that relatives second, companies performing genetic genealogy have de-
share haplotype blocks. You will see in Chapter 25 that haplotype 3′ veloped giant databases that catalog the SNP analysis of mil-
blocks are segments of DNA with particular sets of linked SNP lions of people. If you think about it, this information is more
alleles that tend to travel together from one generation to another massive than that in the CODIS database, which is restricted to
because they are flanked by recombination hotspots. (In other a small number of SSR loci in a smaller sample of people (indi-
words, the DNA within the haplotype block contains no hotspots
crRNAs viduals arrested for or convicted of crimes). It is therefore not
for crossing-over.) You learned in Chapter 5 that during spermato- surprising that law enforcement agencies are very interested
genesis in humans, on average one crossover occurs per chromo- in employing the power of genealogical databases.
some, and during oogenesis about two crossovers per In the case of the Golden State Killer, when investigators
chromosome (Fig. A, left). It therefore makes sense that the more compared samples of the suspect’s DNA taken from the crime
closely related two
tracrRNA people are, the more haplotype blocks they scenes with the database of a small genealogy company called
share, andcrRNA
the longer are their uninterrupted shared DNA seg- GEDmatch, they found matches with two individuals. The degree
ments (Fig. A, right). of relatedness indicated that these two people were likely the

Figure A Shared segments of autosomes among relatives. One pair of autosomes are shown for each individual. At left, the
colors indicate segments of chromosomes that could be passed down through two generations. Because of crossing-over during gamete
formation, one of your homologs
Viralcan contain segments from all four of your maternal grandparents’ homologs, and your other homolog can
chromosome
contain segments from all four of your paternal grandparents’ homologs. At right, the same information is presented in a different way;
5′ NGGblack indicates chromosomal segments shared by you and each of your relatives. Note that long stretches of shared haplotypes are the
PAM site
best evidence of genetic relatedness.
Homologous chromosomes can recombine You share more SNP alleles and longer DNA segments
in each
Viralgeneration.
DNA cleavage with closer relatives.

Maternal Maternal Paternal Paternal Maternal Maternal Paternal Paternal

Fast Forward
Grandmother Grandfather Grandmother Grandfather Grandmother Grandfather Grandmother Grandfather

This feature is one of the methods used to

integrate the Mendelian principles introduced
early in the content with the molecular content Aunt/Uncle Mother Father Aunt/Uncle Aunt/Uncle Mother Father Aunt/Uncle

that will follow.

You Sibling You Sibling

xiv Guided Tour

Visualizing Genetics
Full-color illustrations and photographs bring the printed word to life. These visual reinforcements support and further
clarify the topics discussed throughout the text.

F E AT U R E F I G U R E 1 0 . 7

Automated Sanger Sequencing

(a) Hybridization of template and primer. Many copies of a
cloned recombinant DNA are denatured (melted into single strands), Vector
using heat to break apart the hydrogen bonds joining the two strands.
One of these strands serves as the template. The recombinant DNA
is mixed with many molecules of an oligonucleotide primer (made in
Recombinant plasmid
a DNA synthesizer) whose sequence is complementary to ~20 bases
in the vector portion of the template strand. As the temperature is low-
ered, the templates and primers anneal (hybridize).
Human
DNA insert
Feature Figures
(b) Generating a nested set of
fragments. The hybrid template/ Special multipage spreads integrate line art, photos,
Melt into single strands
primer molecules are now mixed with
DNA polymerase, large amounts of the Hybridize with primer
and text to summarize in detail important genetic
four dNTPs, and much smaller amounts
of the four ddNTPs. Each ddNTP has a
concepts.
different-colored fluorescent tag. DNA
polymerase synthesizes a DNA strand Template
complementary to the template by add- Insert
ing nucleotides sequentially onto the 3′ Vector
C A C C G T C G
end of the primer. Synthesis terminates G T A G
when a dideoxynucleotide is added. A T
G C
The reaction generates a nested set of C C A G 3′ G
fragments, each with the same 5′ end
G C T + DNA polymerase 5′
A G Primer
but a different 3′ end. The terminating 5′ + dATP, dCTP, dGTP, dTTP
dideoxynucleotide at the 3′ end color- 3′ + ddATP, ddCTP, ddGTP, ddTTP
codes each product. After melting apart
the newly synthesized DNA and the
template, these products are electro-
phoresed on a special gel that can sep-
arate DNAs that differ in size by a (c) Dideoxynucleotide structure.
single nucleotide. As each fragment Because ddNTPs lack an -OH group on the
moves past a laser, the color of the deoxyribose 3′ carbon atom, DNA poly- (e) Image of a sequencing gel.
– Red dye merase cannot add any nucleotides onto a (d) Analyzing nested sets of Each lane displays the sequence of a
terminal base is detected.
H chain with a dideoxynucleotide at the 3′ end. products on gels. separate sample.
G C T C A G T Dideoxynucleotide Gel 3′
5′ H 3′ ddATP
G Gel
– Yellow dye A Adenine
H C
– O– O–
G C T C A G T G TO CH2
5′ H 3′ –
5′
O P
C O P O P O CH2
O
Direction of electrophoresis

O O O 4′ 1′
CH HC
H G DNA fragments
HC C2′
G C T C A G T G G 3′ electrophorese
5′ H 3′ A down the gel
H H
– Purple dye C No 3′–OH, Photomultiplier
H so terminates chain tube
G C T C A G T G G C
5′ H 3′ G dATP
Filter
– Green dye Adenine Output to wheel
H computer
G–
G C T C A G T G G C A O O– O– CH2
5′ H 3′ –
5′
Scanning
O P O P O P O CH2
O laser excites
T
O O O 4′
CH 1′ fluorescent dye
H HC
Detector HC C2′
G C T C A G T G G C A G 3′
5′ H 3′
5′ OH H
Primer Complementary to
(Sequence of 3′–OH needed
template strand of
newly synthesized for chain elongation
insert
DNA)

(continued)

314

(f) A DNA sequence trace from one gel lane. Yellow is pseudocolored as black for easier visualization. Base-calling software reads
out the sequence of the newly synthesized DNA strand.

5′ T G G C A G C T C A G C G G C T G G G C A A G C G C G T G 3′

Smaller Fragment size Larger

(e): ©Jean Claude Revy/Phototake; (f): Courtesy of Joshua J. Filter, Cornell University, Ithaca, New York

315
 Guided Tour xv
3.3 Meiosis: Cell Divisions that Halve Chromosome Number 85

TABLE 3.2 How Chromosome Behavior During Meiosis Explains Mendel’s Laws
(a) The Law of Segregation (b) The Law of Independent Assortment

F1 Homologous pair Homologous pair

F1 for seed color for seed shape
R r
(Y ) Yellow Round (R )
(y ) Green Wrinkled (r )

R R r r R R r r
Meiosis I
Anaphase
R R r r
Meiosis I Comparative Figures
Anaphase
OR
Comparison illustrations lay out the basic
Solved Problems 471

Y Y y y y y Y Y differences of often confusing principles.

essential concepts 15.3
Meiosis II • Many modern-day plant species have blocks of similar • Since the whole-genome duplication, the two copies of the
Meiosis
genes II in similar order on two different
repeated genes have mutated independently such that their base-
chromosomes. This fact suggests that the the entire pair sequences are no longer identical and their functions
Possible genome of an ancestral species became duplicated. may have diverged.
gametes Yellow Green Green Yellow
Possible
gametes round wrinkled round wrinkled
(Y R ) (y r ) (y R) (Y r)
Round (R ) Wrinkled (r )
S O LV E D P R O B L E M S

Solved Problem I males have aberrant dosages of ~10-fold fewer genes

Some aneuploid XYY men are completely normal, while than XO or XXY individuals do.
F2 other individuals have a variety of symptoms to varying c. Because all Y chromosomes must come from the
F2 degrees. These include greater-than-average height, devel- male parent, an XYY man must be the result of a
R r opmentalY delays,
R and
Y r learning
y R disorders.
yr YY sperm fertilizing an X egg. Nondisjunction (NDJ)
of the Y chromosome in meiosis II in the male germ
a. What would cause these symptoms in XYY males? line would generate YY gametes, as shown in the
Yb.R Females with Turner syndrome (XO) and males with
YY RR YY Rr Yy RR Yy Rr accompanying diagram. In contrast, NDJ during
R RR Rr Klinefelter syndrome (XXY) are sterile. In contrast, meiosis I in the male germ line would generate an
XYY males usually have normal fertility. Explain the XY gamete, not a YY gamete.
Y r difference.
YY Rr YY rr Yy Rr Yy rr Solved Problem II
r Rr rr c. Explain how mistakes during meiosis can lead to XYY
aneuploidy. Would the mistake occur in the male germ A company called AquaBounty Technologies created a vari-
ety of Atlantic salmon that grows faster than normal salmon
y R lineYy
orRR
in theYy
female
Rr germ
yy RRline?yy
Can
Rr you tell if the mis-
take occurred during meiosis I or meiosis II? because its genome contains a transgene—a modified
In an F1 hybrid, the round pea allele (R) is found on one
growth hormone gene made in the laboratory and inserted
chromosome, and the wrinkled pea allele (r) is on the
into the salmon’s genome. (You will learn in Chapter 21
homologous chromosome. The pairing between the two yr
Answer
Yy Rr Yy rr yy rR yy rr
how transgenic fish and other animals are made.) These
homologous chromosomes from prophase I through metaphase I
ensures that the homologs will separate to opposite spindle
Remember that aneuploidy affects phenotype through ab- AquAdvantage® salmon are the first transgenic animals ap-
One pair of homologous errant gene dosage.carries
chromosomes Effectstheofseed
geneshape
dosage in two other proved for human consumption (in 2019) by the U.S. Food
poles during anaphase I. The conclusion of meiosis II yields two
types of gametes: Half have R, and half have r, but no gametes
human
gene (alleles R and r). A secondaneuploidies—Turner syndrome and Klinefelter
pair of homologous chromosomes and Drug Administration. AquaBounty Technologies pro-
have both alleles. Thus, the separation of homologous carries the seed colorsyndrome—are
gene (alleles Yexplained in Fig.
and y). Each 15.1.
homologous vides only triploid females to fish farmers who raise AquAd-
chromosomes at meiosis I corresponds to the segregation of pair aligns at random at the metaphase plate during meiosis I, vantage® salmon. Should any transgenic fish escape into the
a. XYY males sometimes have an abnormal phenotype
independently of the other homologous pair. Thus, any two
alleles. As the Punnett square shows, fertilization of 50% R and wild, the transgene will not be transmitted to the natural
because
chromosome pairs can migrate they have
toward an extra
the poles dose of Y-linked genes in
during
50% r eggs with the same proportion of R and r sperm leads to diploid salmon population.
Mendel’s 3:1 ratio in the F2 generation. anaphase I in either of twoallequally
of theirlikely
somatic andAs
ways. germ-line
a result,cells.
a Like males
dihybrid individual will generate four equally likely types ofXYY males are
with Klinefelter syndrome (XXY), a. Explain how the use of triploid females prevents the
gametes. The Punnett squarelikelyaffirms
taller than
thataverage because their somatic cells
independent spread of the transgene. (Refer to Fig. 15.5b.)
have
assortment of traits carried by an extra dose of thechromosomes
nonhomologous PAR gene SHOX. b. In Atlantic salmon, x = 29. At what frequency would
b. Because
produces Mendel’s 9:3:3:1 ratio. the Y chromosome has only about one-tenth the triploid AquAdvantage® salmon produce balanced
as many genes as reside on the X chromosome, XYY gametes?
Normal Meiosis NDJ in Meiosis I NDJ in Meiosis II

XY XY XY
Meiosis I
(2 chromatids
per chromosome) X Y XY X Y
Meiosis II

Gametes
(1 chromatid
X X Y Y XY XY X X YY
per chromosome)

Figure for Solved Problem Ic

Solving Genetics Problems

The best way for students to assess and increase their un-
Solved Problems
derstanding of genetics is to practice through problem- Solved problems offer step-by-step guidance needed to
understand the problem-solving process.
solving. Found at the end of each chapter, problem sets
assist students in evaluating their grasp of key concepts and
allow them to apply what they have learned to real-life
issues. Problems
Problems are organized by chapter section and in order of
increasing difficulty to help students develop strong
problem-solving skills. Brief answers to the odd-numbered
problems can be found in the back of this text.
Acknowledgments

The creation of a project of this scope is never solely the
work of the authors. We are grateful to our colleagues who
answered our numerous questions, or took the time to share
with us their suggestions for improvement of the previous
edition. Their willingness to share their expertise and
expectations was a tremendous help to us.
∙∙ Eric Alani, Cornell University
∙∙ Preston Aldrich, Benedictine University
∙∙ Charles Aquadro, Cornell University
∙∙ James T. Arnone, William Paterson University
∙∙ Daniel Barbash, Cornell University
∙∙ Christine M. Beatty, Loyola University Chicago
∙∙ Andrew Clark, Cornell University
∙∙ Steven Fenster, Fort Lewis College
∙∙ Wayne Forrester, Indiana University
∙∙ Tom Fox, Cornell University
∙∙ Kathryn Gardner, University of Pittsburgh
∙∙ Jamie S. Lyman Gingerich, University of Wisconsin–
Eau Claire
∙∙ Shubha Govind, The City College of City University
of New York
∙∙ Nancy Hollingsworth, Stony Brook University
∙∙ Enamul Huq, The University of Texas at Austin
∙∙ Vishy Iyer, The University of Texas at Austin
∙∙ Alyssa Johnson, Louisiana State University
∙∙ Mark Kirkpatrick, The University of Texas at Austin
∙∙ Henry Lerner, Harvard Medical School
∙∙ Paul Macdonald, The University of Texas at Austin
∙∙ Kyle Miller, The University of Texas at Austin
∙∙ Debra Nero, Cornell University
∙∙ Kristin Patterson, The University of Texas at Austin
∙∙ Leslie Pick, University of Maryland
∙∙ Hong Qiao, The University of Texas at Austin
∙∙ Maureen Sanz, Molloy College
∙∙ Inder Saxena, The University of Texas at Austin
∙∙ Len Seligman, Pomona College
∙∙ Heidi Sleister, Drake University
∙∙ Sebastian M. Spencer, Pensacola Christian College
∙∙ Sibum Sung, The University of Texas at Austin
∙∙ James Thompson, University of Oklahoma
∙∙ Steve Vokes, The University of Texas at Austin
∙∙ Alain Bopda Waffo, Alabama State University
∙∙ Blerta Xhemalce, The University of Texas at Austin
Janice Fischer and Michael Goldberg would also like to
thank their genetics students at The University of Texas at
Austin and Cornell University for their amazing questions.
Many of their ideas have influenced the seventh edition. A
special thank-you to Mike McGee for his extensive feed-
back on this seventh edition. We would also like to thank
the highly skilled publishing professionals at McGraw-Hill
who guided the development and production of the seventh
edition of Genetics: From Genes to Genomes: Ian
Townsend and Michelle Vogler for their support; Elizabeth
Sievers for her organizational skills and tireless work to tie
up all loose ends; and Vicki Krug and the entire production
team for their careful attention to detail and ability to move
the schedule along.

xvi
 Guided Tour xvii

New to Connect®

Remote Proctoring & Browser-Locking Capabilities

New remote proctoring and browser-locking capabilities, hosted by Proctorio within Connect, provide control of the as-
sessment environment by enabling security options and verifying the identity of the student.

Seamlessly integrated within Connect, these services allow instructors to control students’ assessment experience by re-
stricting browser activity, recording students’ activity, and verifying students are doing their own work.

Instant and detailed reporting gives instructors an at-a-glance view of potential academic integrity concerns, thereby avoid-
ing personal bias and supporting evidence-based claims.

Writing Assignment
Available within McGraw-Hill Connect® and McGraw-Hill Connect® Master, the Writing Assignment tool delivers a
learning experience to help students improve their written communication skills and conceptual understanding. As an in-
structor you can assign, monitor, grade, and provide feedback on writing more efficiently and effectively.
Instructors: Student Success Starts with You
Tools to enhance your unique voice
Want to build your own course? No problem. Prefer to use our
turnkey, prebuilt course? Easy. Want to make changes throughout the
65%
Less Time
semester? Sure. And you’ll save time with Connect’s auto-grading too.
Grading

Study made personal

Incorporate adaptive study resources like
SmartBook® 2.0 into your course and help your
students be better prepared in less time. Learn
more about the powerful personalized learning
experience available in SmartBook 2.0 at
www.mheducation.com/highered
/connect/smartbook
Laptop: McGraw Hill; Woman/dog: George Doyle/Getty Images

Affordable solutions, Solutions for

added value your challenges
Make technology work for you with A product isn’t a solution. Real
LMS integration for single sign-on access, solutions are affordable, reliable,
mobile access to the digital textbook, and come with training and
and reports to quickly show you how ongoing support when you need
each of your students is doing. And with it and how you want it. Visit www.
our Inclusive Access program you can supportateverystep.com for videos
provide all these tools at a discount to and resources both you and your
your students. Ask your McGraw Hill students can use throughout the
representative for more information. semester.

Padlock: Jobalou/Getty Images Checkmark: Jobalou/Getty Images

Students: Get Learning that Fits You
Effective tools for efficient studying
Connect is designed to make you more productive with simple, flexible, intuitive tools that maximize
your study time and meet your individual learning needs. Get learning that works for you with Connect.

Study anytime, anywhere “I really liked this

Download the free ReadAnywhere app and access your app—it made it easy
online eBook or SmartBook 2.0 assignments when it’s to study when you
convenient, even if you’re offline. And since the app don't have your text-
automatically syncs with your eBook and SmartBook 2.0
assignments in Connect, all of your work is available book in front of you.”
every time you open it. Find out more at
www.mheducation.com/readanywhere - Jordan Cunningham,
Eastern Washington University

Everything you need in one place

Your Connect course has everything you need—whether reading on
your digital eBook or completing assignments for class, Connect makes
it easy to get your work done.

Calendar: owattaphotos/Getty Images

Learning for everyone

McGraw Hill works directly with Accessibility Services
Departments and faculty to meet the learning needs
of all students. Please contact your Accessibility
Services Office and ask them to email
accessibility@mheducation.com, or visit
www.mheducation.com/about/accessibility
for more information.

Top: Jenner Images/Getty Images, Left: Hero Images/Getty Images, Right: Hero Images/Getty Images
Genetics
From Genes to Genomes
PART I B asic P rinciple s: How Traits Are Transmitted
chapter
1
Mendel’s Principles
of Heredity
A Q U I C K G L A N C E at a family portrait reveals children
who resemble one parent or the other, or who look like
a combination of the two. Some children, however, look
unlike any of the assembled relatives and more like a
great-great-grandparent. What causes the similarities
and differences of appearance and the skipping of
­generations?
The answers lie in our genes, the basic units of bio-
logical information, and in heredity, the way genes trans-
mit traits from parents to offspring. Each of us starts out
as a single fertilized egg cell that develops, by division
and differentiation, into a mature adult made up of 1014
(a hundred trillion) cells that carry out all of our body’s
functions and control our outward appearance. Genes,
passed from one generation to the next, underlie the for-
mation of every heritable trait. Your genome—all the
genes you possess—controls traits as diverse as a cleft
chin; balding as you age; your hair, eye, and skin color;
and even your susceptibility to certain diseases. All such
traits run in families in predictable patterns that impose
some possibilities and exclude others.
Genetics, the science of heredity, pursues an expla-
nation of the mechanisms that determine inheritance.
Sometimes the relationship between gene and trait is
remarkably simple. A single change in a single gene, for
example, results in sickle-cell disease, a condition in
which the hemoglobin molecule found in red blood cells
is defective. In other cases, the correlations between genes
Lawrence Manning/Corbis
Although Mendel’s laws can predict the probability that an indi-
vidual will have a certain genetic makeup, the chance meeting of
particular male and female gametes determines an individual’s
genetic fate.
chapter outline
●● 1.1 The Puzzle of Inheritance
●● 1.2 Genetic Analysis According to Mendel
●● 1.3 Mendelian Inheritance in Humans
and traits are bewilderingly complex. One example is that
many genes interact to generate the characteristics we rec-
ognize as a friend’s face.
Gregor Mendel (1822–1884; Fig. 1.1), an Augustinian
monk and expert plant breeder, discovered the basic prin-
ciples of genetics in the mid-­nineteenth century. He pub-
lished his findings in 1866, just seven years after Darwin’s
On the Origin of Species appeared in print. Mendel worked
in a monastery in Austria (Fig. 1.2), where he examined
the inheritance of clear-cut alternative traits in pea plants,
such as purple versus white flowers or yellow versus green
seeds. In so doing, he inferred genetic laws that allowed
him to make verifiable predictions about which traits
would appear, disappear, and then reappear, and in which
generations.
Mendel’s laws are based on the hypothesis that
observable traits are determined by independent units of
inheritance that we now call genes. Today, a gene is rec-
ognized as a region of DNA that specifies a particular
protein or RNA. To Mendel, however, a gene was an
abstraction—an imagined particle that worked by an
unknown ­mechanism.
Four general themes emerge from our detailed dis-
cussion of Mendel’s work. First, variation in traits is
widespread in nature, reflecting immense genetic diver-
sity that provides the raw material for the continuous
1
2 Chapter 1   Mendel’s Principles of Heredity
evolution of life on the earth. Sec- Figure 1.1 Gregor Mendel.
ond, variation is essential for fol- Photographed around 1862
holding one of his experimental
lowing genes from one generation plants. Science Source
to the next. Third, variation is
inherited according to patterns—
Mendel’s genetic laws—that explain
why individuals in the same fam-
ily are similar in some traits but
different in others. Fourth, the laws
Mendel discovered about heredity
apply equally well to all sexually
reproducing organisms, whether
they are peas or people.
1.1 The Puzzle of Inheritance
learnin g objectiv es
1. Relate how Mendel’s experimental approach is similar
to the process of modern scientific inquiry.
2. Describe how Mendel cross-fertilized and self-fertilized
pea plants.
3. Explain why Mendel included reciprocal crosses within
his controlled breeding program of pea plants.
4. Predict the type of progeny produced by Mendel’s
crosses between pure-breeding plants with discrete,
antagonistic traits, such as purple versus white
flowers.
Gregor Mendel was the first person to combine data col-
lection, analysis, and theory in a successful pursuit of the
true basis of heredity. For many thousands of years before
that, the only genetic practice was the selective breeding
of domesticated plants and animals with desirable charac-
teristics. This process, called artificial selection, was of
immense importance to human history. For example, by
choosing plants that grew better or were easier to cultivate
as parents for the next generation, people gradually con-
verted weedlike species into rice, wheat, corn, and toma-
toes. Similar breeding schemes developed valuable herds
of sheep, pigs, and cattle, as well as hundreds of breeds
of dogs.
Despite its many achievements, artificial selection was
limited by its hit-or-miss nature: Parents chosen for their
desired characteristics did not always produce offspring
whose qualities were more, or even equally, favorable to
Figure 1.2 Mendel’s garden.
Biophoto Associates/Science Source
those of their parents. This unpredictability was not sur-
prising, because prior to Mendel, many misconceptions
clouded people’s thinking about heredity.
Mendel Devised a New Experimental
Approach
Two errors in interpreting the results of selective breeding
were particularly misleading. The first was the idea that
one parent contributes most to an offspring’s inherited fea-
tures. Nicolaas Hartsoeker, one of the earliest microsco-
pists, contended in 1694 that it was the male, by way of a
fully formed homunculus inside the sperm (Fig. 1.3). An-
other deceptive notion was the concept of blended inheri-
tance, the idea that parental traits become mixed and
forever changed in the offspring, as when blue and yellow
pigments merge to green on a painter’s palette. The theory
of blending may have grown out of a natural tendency for
parents to see a combination of their own traits in their
offspring. While blending could account for children who
look like a combination of their parents, it could not ex-
plain obvious differences between biological brothers and
sisters nor the persistence of variation within extended
families.
What did Mendel do differently from those who
preceded him? First, he chose the garden pea (Pisum
sativum) as his experimental organism (Fig. 1.4a and b).
Each pea flower has both male and female organs, which
made it easy to self-fertilize or cross-fertilize plants. In
self-fertilization (or selfing), both egg and pollen come
from the same plant, often from the same flower. Peas nor-
mally self-fertilize because of the proximity of egg and
pollen. To cross-fertilize (cross) two plants, Mendel
removed the male sex organs from the flowers of one plant
 1.1 The Puzzle of Inheritance 3

Figure 1.3 The homunculus: A misconception. Well into the
nineteenth century, many prominent microscopists believed they saw
a fully formed, miniature fetus crouched within the head of a sperm.
Klaus Guldbrandsen/SPL/Science Source
(to prevent selfing), and then he brushed pollen from the
other plant onto the female organs of the first plant
(Fig. 1.4c). Peas offered yet another advantage. For each
successive generation, Mendel could obtain large numbers
of individuals within a relatively short growing season.
Second, Mendel examined the inheritance of clear-cut
alternative states of particular traits—purple versus white
flower color, yellow versus green pea color. He could trace
unambiguously the transmission of such either-or traits, be-
cause no intermediate forms existed. (The opposite of these
so-called discrete traits are continuous traits, such as
height and skin color in humans. Continuous traits show
many intermediate forms.)
Third, Mendel collected and perpetuated lines of peas
that bred true. Matings within such pure-breeding
(or true-breeding) lines produce offspring carrying spe-
cific parental characteristics that remain constant from
generation to generation. These lines are also called
inbred because they have been mated only to each other
for many generations. Plants with white flowers always
produced offspring with white flowers; plants with purple
flowers produced only offspring with purple flowers.
Mendel called constant but mutually exclusive alterna-
tives, such as purple versus white flowers or yellow versus
green seeds antagonistic pairs, and he settled on seven
such pairs for his study (Fig. 1.5). In his experiments,
Mendel cross-fertilized pairs of plants to produce hybrids,
offspring of genetically dissimilar parents, for each an-
tagonistic pair. Figure 1.5 shows the a­ ppearance of the
hybrids he studied.
Fourth, Mendel made reciprocal crosses, in which
he reversed the characteristics of the male and female
parents, thus controlling whether a particular characteris-
tic was transmitted via the egg cell within the ovule or via
a sperm cell within the pollen. For example, he could use
pollen from a purple flower to fertilize the eggs of a white
flower and also use pollen from a white flower to fertilize
the eggs of a purple flower. Because the progeny of these

Figure 1.4 Mendel’s experimental organism: The garden pea. (a) Pea plants with white flowers. (b) The anthers produce pollen,
which generates sperm. Mature pollen lands on the stigma, a structure connected to the ovary (which becomes the pea pod). The pollen
then grows a tube that extends through the stigma to one of the ovules (immature seeds), allowing fertilization. (c) To prevent self-fertilization,
breeders remove the anthers from the female parents (here, the white flower) before the plant produces mature pollen. A paintbrush is used
to transfer pollen from the anthers of the male parent (here, the purple flower) to the female parent’s stigma. Each fertilized ovule becomes
an individual pea (mature seed) that can grow into a new pea plant. All of the peas produced from one flower are encased in the same pea
pod, but these peas form from different pollen grains and ovules. (a): Andrea Jones Images/Alamy

Cross-
fertilization:

pollen
transferred Anthers
onto stigma removed
Stigma of recipient previously
Anthers
( )
Seed
Ovules formation
( ) within
ovary
Seed
germination

(a) Pisum sativum (b) Pea flower anatomy (c) Cross-pollination

4 Chapter 1   Mendel’s Principles of Heredity

Figure 1.5 The mating of parents with antagonistic reciprocal crosses were similar, Mendel demonstrated
characteristics produces hybrids. Note that each of the hybrids that the two parents contribute equally to inheritance.
for the seven antagonistic pairs studied by Mendel resembles only Fifth, Mendel worked with large numbers of plants,
one of the parents. The parental characteristic that shows up in the
hybrid is the dominant characteristic.
counted all offspring, subjected his findings to numerical
Antagonistic Pairs Appearance of Hybrid
analysis, and then compared his results with predictions
(dominant characteristic) based on his models. He was the first person to study in-
heritance in this quantitative manner. Mendel’s careful
Seed color (interior) numerical analysis revealed patterns of transmission that
reflected basic laws of ­heredity.
Finally, Mendel was a brilliant practical experimental-
Yellow Green Yellow ist. When comparing tall and short plants, for example, he
made sure that the short ones were out of the shade of the
Seed shape tall ones so their growth would not be stunted. In short,
Mendel purposely set up a simplified black-and-white ex-
perimental system and then figured out how it worked. He
Round
looked at discrete traits that came in two mutually exclu-
Round Wrinkled
sive forms and asked questions that could be answered by
observation and computation.
Flower color

essential concepts 1.1

• Mendel established pure-breeding lines of peas in which

a specific characteristic would remain constant from one
generation to the next.
• When Mendel crossed pure-breeding lines with
alternative characteristics, the hybrid progeny always had
Purple White Purple the characteristics of one parent.
• In Mendel’s experiments, the hybrid progeny produced by
Pod color (unripe) reciprocal cross-fertilizations had the same
characteristics; it did not matter which parent was male
and which was female.

Green Yellow Green

1.2 Genetic Analysis According

Pod shape (ripe)
to Mendel

Round Pinched Round

learning objectives

1. Explain Mendel’s law of segregation and how it predicts

Stem length the 3:1 dominant-to-recessive phenotypic ratio among
the F2 generation of a monohybrid cross.
2. Distinguish between a monohybrid cross and a testcross.
3. Explain Mendel’s law of independent assortment and
how the 9:3:3:1 phenotypic ratio among the F2 of a
dihybrid cross provides evidence for this law.
Long Short Long
4. Interpret phenotypic ratios of progeny to infer how
particular traits are inherited.
Flower position 5. Predict the genotypic and phenotypic ratios among
progeny of complex multihybrid crosses using simple
rules of probability.
6. Cite the most common molecular explanations for
dominant and recessive alleles.
Along stem At tip of stem Along stem

In 1866, Gregor Mendel published in an obscure journal a
paper titled “Experiments on Plant Hybrids.” In it, Mendel
describes the transmission of visible characteristics in pea
plants, defines unseen but logically deduced units (genes)
that determine when and how often these traits appear, and
analyzes the behavior of genes in simple mathematical
terms to reveal previously unsuspected principles of hered-
ity. The paper would eventually become the cornerstone of
modern genetics. Let us examine its insights.
Monohybrid Crosses Reveal
the Law of Segregation
Once Mendel had isolated pure-breeding lines for several
sets of characteristics, he carried out a series of matings
between individuals that differed in only one trait, such as
seed color or stem length. In each cross, one parent has one
form of the trait, and the other parent has the antagonistic
characteristic. Figure 1.6 illustrates one such mating.
Mendel planted pure-breeding green peas and pure-
breeding yellow peas and allowed them to grow into the
parental (P) g­ eneration. When the plants had flowered,
he brushed the stigma of green-pea plant flowers with pol-
len from yellow-pea plants. He also performed the recipro-
cal cross, dusting yellow-pea plant stigmas with green-pea
pollen. He found that in both cases, the peas produced were
all yellow.
These yellow peas, progeny of the P generation, were
the first filial (F1) generation. To learn whether the green
characteristic had disappeared entirely or remained intact
Figure 1.6 A monohybrid cross. Crosses of pure-breeding
parental plants produce F1 hybrids, all of which resemble one of the
parents. Self-pollination of F1 plants yields an F2 generation with a
3:1 ratio of individuals resembling the two original parental types.
For simplicity, we do not show the plants that produce the peas or
that grow from the planted peas.
Generation
Parental (P)
(pure-breeding) Yellow peas Green peas
( : sperm) ( : eggs)
First filial (F1)
All yellow
Self-fertilization
Second filial (F2)
6022 yellow : 2001 green
3:1
1.2 Genetic Analysis According to Mendel 5
but hidden in these F1 yellow peas, Mendel planted them to
obtain mature F1 plants that he allowed to self-fertilize.
Such experiments involving hybrids for a single trait are
called monohybrid crosses. He then harvested and counted
the peas of the resulting second filial (F2) generation,
progeny of the F1 generation. The progeny of one series of
F1 self-fertilizations were 6022 yellow and 2001 green
F2 peas, an almost perfect ratio of 3 yellow : 1 green.
F1 plants derived from the reciprocal of the original cross
produced a similar 3:1 ratio of yellow to green F2 progeny.
Reappearance of the recessive characteristic
The presence of green peas in the F2 generation was irre-
futable evidence that blending had not occurred. If it had,
the information necessary to make green peas would have
been lost irretrievably in the F1 hybrids. Instead, the infor-
mation remained intact and was able to direct the forma-
tion of 2001 green peas in the second filial generation.
These green peas were indistinguishable from their green
grandparents.
Mendel concluded that two types of yellow peas must
exist: those that breed true like the yellow peas of the
P generation, and those that can yield some green offspring
like the yellow F1 hybrids. This second type somehow con-
tains latent information for green peas. He called the char-
acteristic that appeared in all the F1 hybrids—in this case,
yellow seeds—dominant (see Fig. 1.5) and the antagonis-
tic ­green-pea characteristic that remained hidden in the
F1 hybrids but reappeared in the F2 generation recessive. But
how did he explain the 3:1 ratio of yellow to green F2 peas?
Genes: Discrete units of inheritance
To account for his observations, Mendel proposed that for
each trait, every plant carries two copies of a unit of in-
heritance, receiving one from its maternal parent and the
other from the paternal parent. Today, we call these units of
inheritance genes. The pea plants in Mendel’s collection
had two copies of a gene for seed color, two copies of an-
other for seed shape, two copies of a third for stem length,
and so forth.
Mendel further proposed that each gene comes in alter-
native forms, and combinations of these alternative forms
determine the contrasting characteristics he was studying.
Today we call the alternative forms of a single gene alleles.
The gene for pea color, for example, has yellow and green
alleles; the gene for pea shape has round and wrinkled al-
leles. In Mendel’s monohybrid crosses, one allele of each
gene was dominant, the other recessive. In the P generation,
one parent carried two dominant alleles of the gene under
consideration; the other parent, two recessive alleles. The
F1 generation hybrids carried one dominant and one reces-
sive allele of the gene. Individuals having two different al-
leles of a single gene are monohybrids.
6 Chapter 1   Mendel’s Principles of Heredity

The law of segregation
If a plant has two copies of every gene, how does it pass
only one copy of each to its progeny? And how do the off-
spring then end up with two copies of these same genes,
one from each parent? Mendel answered these questions in
terms of the two biological mechanisms behind reproduc-
tion: gamete formation and the random union of gametes at
fertilization.
Gametes are the specialized cells—eggs within the
ovules of the female parent and sperm cells within the
pollen grains—that carry genes between generations.
Mendel imagined that during the formation of eggs and
sperm, the two copies of each gene in the parent separate
(or segregate) so that each gamete receives only one allele
for each trait (Fig. 1.7a). Thus, each egg and each sperm
receives only one allele for pea color (either yellow or
green).
At fertilization, a sperm with one or the other allele
unites at random with an egg carrying one or the other al-
lele, restoring the two copies of the gene for each trait in the
fertilized egg, or zygote (Fig. 1.7b). If the sperm carries
Figure 1.7 The law of segregation. (a) The two identical
alleles of pure-breeding plants separate (segregate) during gamete
formation. As a result, each sperm or egg carries only one of each
pair of parental alleles. (b) Cross-fertilization between pure-breeding
parents with antagonistic characteristics results in F1 hybrid zygotes
with two different alleles. For the seed color gene, a Yy hybrid
zygote will develop into a yellow pea.
(a) The two alleles for each trait separate during gamete
formation.
Gametes
(sperm or eggs)
Y
Grows into plant Gamete
formation
YY yellow pea Y Figure 1.8 The Punnett square: Visual summary of a cross.
from a pure-breeding
stock
y
Grows into plant Gamete
formation
yy green pea y P
from a pure-breeding
stock
(b) Two gametes, one from each parent, unite at random
at fertilization.
yellow and the egg green, the result will be a hybrid yellow
pea like the F1 monohybrids that resulted when pure-
breeding parents of opposite types mated. If the yellow-
carrying sperm unites with a yellow-carrying egg, the
result will be a yellow pea that grows into a pure-breeding
plant like those of the P generation that produced only
yellow peas. And finally, if sperm carrying the allele for
green peas f­ ertilizes a green-carrying egg, the progeny will
be a pure-breeding green pea.
Mendel’s law of segregation encapsulates this gen-
eral principle of heredity: The two alleles of each gene
separate (segregate) during gamete formation, and then
unite at random, one from each parent, at fertilization.
Throughout this book, the term segregation refers to such
equal segregation in which one allele, and only one allele,
of each gene goes to each gamete. Note that the law of
segregation makes a clear distinction between the somatic
cells (body cells) of an organism, which have two copies
of each gene, and the gametes, which bear only a single
copy of each gene.
The Punnett square
Figure 1.8 shows a simple way of visualizing the results of
the segregation and random union of alleles during gamete
formation and fertilization. Mendel invented a system of
symbols that allowed him to analyze all of his crosses in the
same way. He designated dominant alleles with a capital A,
B, or C and recessive ones with a lowercase a, b, or c.
­Modern geneticists have adopted this convention for nam-
ing genes in peas and many other organisms, but they often
choose a symbol with some reference to the trait in question—
a Y for yellow or an R for round. Throughout this book, we
present gene symbols in italics. In Fig. 1.8, we denote the
This Punnett square illustrates the combinations that can arise when
an F1 hybrid undergoes gamete formation and self-fertilization. The F2
generation has a 3:1 ratio of yellow to green peas.
YY yy
Gametes Y y

Gametes Zygote F1 Hybrid F1 (all identical) Yy Yy

(one sperm, one egg)

Seed Sperm 1/2 1/2

Y
Fertilization development F2
Yy Y y Each box:
Eggs 1/2 × 1/2 = 1/4
y Yy = yellow pea
showing 1/2 Y YY Yy
dominant trait
Y = yellow-determining allele of pea color gene 1/2 y yY yy
y = green-determining allele of pea color gene

dominant yellow allele with a capital Y and the recessive
green allele with a lowercase y. The pure-breeding plants
of the parental generation are either YY (yellow peas) or
yy (green peas). The YY parent can produce only Y gametes,
the yy parent only y gametes. You can see in Fig. 1.8 why
every cross between YY and yy produces exactly the same
result—a Yy hybrid—no matter which parent (male or
­female) contributes which particular allele.
Next, to visualize what happens when the Yy hybrids
self-fertilize, we set up a Punnett square (named after the
British mathematician Reginald Punnett, who introduced it
in 1906; Fig. 1.8). The square provides a simple and con-
venient method for tracking the kinds of gametes produced,
as well as all the possible combinations that might occur at
fertilization. As the Punnett square shows in the first col-
umn and the first row, each hybrid produces two kinds of
gametes, Y and y, in a ratio of 1:1. Thus, half the sperm and
half the eggs carry Y, while the other half of each gamete
type carries y.
Each box in the Punnett square in Fig. 1.8 containing
a colored pea represents one possible fertilization event.
At fertilization, 1/4 of the progeny will be YY, 1/4 Yy,
1/4 yY, and 1/4 yy. Because the gametic source of an al-
lele (egg or sperm) for the traits Mendel studied had no
influence on the allele’s effect, Yy and yY are equivalent.
This means that 1/2 of the progeny are yellow Yy hy-
brids, 1/4 YY true-breeding yellows, and 1/4 true-
breeding yy greens. The diagram illustrates how the
segregation of alleles during gamete formation and the
random union of egg and sperm at fertilization can
produce the 3:1 ratio of yellow to green that Mendel ob-
served in the F2 generation.
Mendel’s Results Reflect Basic
Rules of Probability
Though you may not have realized it, the Punnett square
illustrates two simple rules of probability—the product
rule and the sum rule—that are central to the analysis of
genetic crosses. These rules predict the likelihood that a
particular combination of events will occur.
The product rule
The product rule states that the probability of two or more
independent events occurring together is the product of the
probabilities that each event will occur by itself. With inde-
pendent events:
Probability of event 1 and event 2 =
Probability of event 1 × probability of event 2
Consecutive coin tosses are obviously independent
events; a heads in one toss neither increases nor decreases
1.2 Genetic Analysis According to Mendel 7
the probability of a heads in the next toss. If you toss two
coins at the same time, the results are also independent
events. A heads for one coin neither increases nor decreases
the probability of a heads for the other coin. Thus, the prob-
ability of a given combination is the product of their inde-
pendent probabilities. For example, the probability that
both coins will turn up heads is:
1/2 × 1/2 = 1/4
Similarly, the formation of egg and sperm are independent
events; in a hybrid plant, the probability is 1/2 that a given
gamete will carry Y and 1/2 that it will carry y. Because
fertilization happens at random, the probability that a par-
ticular combination of maternal and paternal alleles will
occur simultaneously in the same zygote is the product of
the independent probabilities of these alleles being pack-
aged in egg and sperm. Thus, to find the chance of a Y egg
uniting with a Y sperm, you simply multiply 1/2 × 1/2
to get 1/4. This is the same fraction of YY progeny seen in
the Punnett square of Fig. 1.8, which demonstrates that the
Punnett square is simply another way of depicting
the product rule. It is important to realize that each box
in the Punnett square represents an equally likely outcome
of the cross only ­because each of the two types of sperm
and eggs (Y and y) are produced at equal frequencies.
The sum rule
While we can describe the moment of random fertilization
as the simultaneous occurrence of two independent events,
we can also say that two different fertilization events are
mutually exclusive. For instance, if Y combines with Y, it
cannot also combine with y in the same zygote. A second
rule of probability, the sum rule, states that the probability
of either of two mutually exclusive events occurring is the
sum of their individual probabilities. With mutually exclu-
sive events:
Probability of event 1 or event 2 =
Probability of event 1 + probability of event 2
To find the likelihood that an offspring of a Yy hybrid
self-fertilization will be a hybrid like the parents, you add
1/4 (the probability of maternal Y uniting with paternal y)
and 1/4 (the probability of the mutually exclusive event
where paternal Y unites with maternal y) to get 1/2, again
the same result as in the Punnett square.
In another use of the sum rule, you could predict the
ratio of yellow to green F2 progeny. The fraction of F2 peas
that will be yellow is the sum of 1/4 (the event producing
YY) plus 1/4 (the mutually exclusive event generating Yy)
plus 1/4 (the mutually exclusive event producing yY)
to get 3/4. The remaining 1/4 of the F2 progeny will be
green. So the yellow-to-green ratio is 3/4 to 1/4, or more
simply, 3:1.
8 Chapter 1   Mendel’s Principles of Heredity
Further Crosses Verify
the Law of Segregation
The law of segregation was a hypothesis that explained the
data from simple crosses involving monohybrid peas, but
Mendel needed to perform additional experiments to check
its validity. Mendel’s hypothesis, summarized in Fig. 1.8,
made the testable prediction that the F2 should have two
kinds of yellow peas (YY and Yy) but only one kind of green
pea (yy). In addition, his hypothesis predicted that the YY
and Yy yellow peas in the F2 should be present in a ratio of
1 YY : 2 Yy.
To verify these expectations, Mendel allowed self-­
fertilization of all the plants in the F2 generation and
counted the types of F3 progeny (Fig. 1.9). He found
that the plants that developed from F2 green peas all
produced only green peas in the F3, and when the result-
ing F3 plants self-­fertilized, the next generation (the F4)
also produced green peas (not shown). This is what we
would expect of pure-breeding yy lines carrying two
copies of the recessive allele. The yellow peas were a
different story. When Mendel allowed 518 F2 plants that
developed from yellow peas to self-fertilize, he ob-
served that 166, roughly 1/3 of the total, were
pure-breeding yellow through several generations, but
the other 352 (2/3 of the total ­yellow F2 plants) were
hybrids because they gave rise to yellow and green
F3 peas in a ratio of 3:1. Therefore, as Mendel’s theory antic-
ipated, the ratio of YY to Yy among the 518 F2 yellow
pea plants was ­indeed 1:2.
It took Mendel years to conduct such rigorous exper-
iments on seven pea traits, but in the end, he was able to
conclude that the segregation of dominant and recessive
alleles during gamete formation and their random union
at fertilization could indeed explain the 3:1 ratios he ob-
served whenever he allowed hybrids to self-fertilize. His
results, however, raised yet another question, one of some
importance to future plant and animal breeders. Plants
Figure 1.9 Yellow F2 peas are of two types: Pure
breeding and hybrid. The distribution of Y and y alleles after
two generations of self-fertilization. The homozygous individuals of
each generation breed true, whereas the hybrids do not.
F1 Yy
Self-
fertilization
F2 YY Yy Yy
Self-
fertilization 3:1 3:1
F3 YY YY Yy Yy yy YY Yy Yy
(All)
showing a dominant characteristic, such as yellow peas,
can be either pure-breeding (YY) or hybrid (Yy). How can
you distinguish one from the other? For self-fertilizing
plants, the answer is to observe the appearance of the
next generation. But how would you distinguish
pure-breeding from hybrid individuals in species that do
not self-fertilize?
Testcrosses: A way to establish genotype
Before describing Mendel’s answer, we need to define a
few more terms. An observable characteristic, such as yel-
low or green pea seeds, is a phenotype, while the pair of
alleles present in an individual is its genotype. A YY or a yy
genotype is called homozygous, because the two copies of
the gene that determine the particular trait in question are
the same. In contrast, a genotype with two different alleles
for a trait is heterozygous; in other words, it is a hybrid for
that trait (Fig. 1.10). An individual with a homozygous
genotype is a homozygote; one with a heterozygous geno-
type is a heterozygote.
Note that the phenotype of a heterozygote (that is, of a
hybrid) defines which allele is dominant: Because Yy peas
are yellow, the yellow allele Y is dominant to the green y
allele. If you know the genotype and the dominance rela-
tion of the alleles, you can predict the phenotype accu-
rately. The reverse is not true, however, because some
phenotypes can derive from more than one genotype. For
example, the phenotype of yellow peas can result from
­either the YY or the Yy genotype.
With these distinctions in mind, we can look at the
method Mendel devised for deciphering the unknown gen-
otype responsible for a dominant phenotype. We’ll call this
genotype Y–; the dash represents the unknown second al-
lele, either Y or y. This method, called the testcross, is a
mating in which an individual showing the dominant phe-
notype, for instance, a Y– plant grown from a yellow pea, is
Figure 1.10 Genotype versus phenotype in homozygotes
and heterozygotes. The relationship between genotype and
phenotype with a pair of contrasting alleles where one allele (Y)
shows complete dominance over the other (y).
Genotype for the Seed Phenotype
Color Gene
YY
Homozygous dominant Yellow
yy Dominant Recessive
allele allele
Yy Yellow
Heterozygous
yy yy yy
Green
(All) Homozygous recessive
 1.2 Genetic Analysis According to Mendel 9

Figure 1.11 How a testcross reveals genotype. An
individual of unknown genotype, but dominant phenotype, is crossed
with a homozygous recessive individual. If the unknown genotype
is homozygous, all progeny will exhibit the dominant phenotype
(Cross A). If the unknown genotype is heterozygous, half the progeny
will exhibit the dominant trait, half the recessive trait (Cross B).
Cross A Cross B
Figure 1.12 A dihybrid cross produces parental types
and recombinant types. In this dihybrid cross, pure-breeding
parents (P) produce a genetically uniform generation of F1 dihybrids.
Self-fertilization or cross-fertilization of the F1 plants yields the
characteristic F2 phenotypic ratio of 9:3:3:1.
P
YY RR yy rr

P YY yy P Yy yy
Gametes YR yr

F1 F1
y y
F1 (all identical)
Y Yy Y Yy Yy Rr Yy Rr

y yy F2 1/4 1/4 1/4 1/4

YR Yr yR yr
Offspring all yellow Offspring 1:1 yellow to green

1/4 YR
crossed with an individual with the recessive phenotype, in YY RR YY Rr Yy RR Yy Rr
this case a yy plant grown from a green pea. As the Punnett 1/4 Yr
squares in Fig. 1.11 illustrate, if the dominant phenotype in YY Rr YY rr Yy Rr Yy rr
question derives from a homozygous YY genotype, all the
1/4 yR
offspring of the testcross will show the dominant yellow Yy RR Yy Rr yy RR yy Rr
phenotype. But if the dominant parent of unknown geno-
type is a heterozygous hybrid (Yy), half of the progeny are 1/4 yr
Yy Rr Yy rr yy Rr yy rr
expected to be yellow peas, and the other half green. In this
Each box:
way, the testcross establishes the genotype behind a domi- 1/4 × 1/4 = 1/16
nant phenotype. Type Genotype Phenotype Number Phenotypic
As we mentioned earlier, Mendel deliberately simpli- Ratio
fied the problem of heredity, focusing on traits that come in
Parental Y– R– yellow round 315 9/16
only two forms. He was able to replicate his basic monohy-
brid findings with corn, beans, and four-o’clocks (plants
with tubular, white or bright red flowers). As it turns out, Recombinant yy R– green round 108 3/16
his concept of the gene and his law of segregation can be
generalized to almost all sexually reproducing organisms. Recombinant Y– rr yellow wrinkled 101 3/16

Parental yy rr green wrinkled 32 1/16

Dihybrid Crosses Reveal the Law
of Independent Assortment
Having determined from monohybrid crosses that genes
are inherited according to the law of segregation, Mendel
turned his attention to the simultaneous inheritance of two
or more apparently unrelated traits in peas. He asked
how two pairs of alleles would segregate in a dihybrid
individual—that is, in a plant that is heterozygous for two
genes at the same time.
To construct such a dihybrid, Mendel mated true-
breeding plants grown from yellow round peas (YY RR)
with true-breeding plants grown from green wrinkled peas
(yy rr). From this cross he obtained a dihybrid F1 genera-
tion (Yy Rr) showing the two dominant phenotypes, yellow
and round (Fig. 1.12). He then allowed these F1 dihybrids
to self-fertilize to produce the F2 generation. Mendel could
Ratio of yellow (dominant) to green (recessive) = 12:4 or 3:1
Ratio of round (dominant) to wrinkled (recessive) = 12:4 or 3:1
not predict the outcome of this mating. Would all the
F2 progeny be parental types that looked like either the
original yellow round parent or like the green wrinkled
parent? Or would some new combinations of characteris-
tics occur that were not seen in the parental lines, such as
yellow wrinkled or green round peas? New phenotypic
combinations like these are called recombinant types.
When Mendel counted the F2 generation of one exper-
iment, he found 315 yellow round peas, 108 green round,
101 yellow wrinkled, and 32 green wrinkled. Both yellow
wrinkled and green round recombinant phenotypes did, in
10 Chapter 1   Mendel’s Principles of Heredity
fact, appear, providing evidence that some shuffling of the
alleles of different genes had taken place.
The law of independent assortment
From the observed ratios, Mendel inferred the biological
mechanism of that shuffling—the independent assortment
of gene pairs during gamete formation. Because the genes
for pea color and for pea shape assort independently, the
allele for pea shape in a gamete carrying Y could with equal
likelihood be either R or r. Thus, the presence of a particu-
lar allele of one gene, say, the dominant Y for pea color,
provides no information whatsoever about the allele of the
second gene. Each dihybrid of the F1 generation can there-
fore make four kinds of gametes: Y R, Y r, y R, and y r. In a
large number of gametes, the four kinds will appear in an
almost perfect ratio of 1:1:1:1, or put another way, roughly
1/4 of the eggs and 1/4 of the sperm will contain each of the
four possible combinations of alleles.
At fertilization then, in a mating of dihybrids, 4 differ-
ent kinds of eggs can each combine with any 1 of 4 differ-
ent kinds of sperm, producing a total of 16 possible
zygotes. Once again, a Punnett square is a convenient way
to visualize the process (Fig. 1.12). Using the same kind of
logic previously applied to the Punnett square for monohy-
brid crosses (review Fig. 1.8), each of the 16 boxes with
colored peas in the Punnett square for the dihybrid cross in
Fig. 1.12 represents an equally likely fertilization event.
Again, each box is an equally likely outcome only because
each of the different gamete types is produced at equal
frequency in each parent. Therefore, using the product
rule, the frequency of the progeny type in each box is
1/4 × 1/4 = 1/16.
If you look at the square in Fig. 1.12, you will see that
some of the 16 potential allelic combinations are identical.
In fact, only nine different genotypes exist—YY RR, YY Rr,
Yy RR, Yy Rr, yy RR, yy Rr, YY rr, Yy rr, and yy rr—because
the source of the alleles (egg or sperm) does not make any
difference. If you look at the combinations of traits
­determined by the nine genotypes, you will see only four
phenotypes—yellow round, green round, yellow wrinkled,
and green wrinkled—in a ratio of 9:3:3:1. If, however, you
look only at pea color or only at pea shape, you can see that
each trait is inherited in the 3:1 ratio predicted by Mendel’s
law of segregation. In the Punnett square, 12 yellow are
present for every 4 green F2 progeny, and 12 round are seen
for every 4 wrinkled. In other words, the ratio of each dom-
inant characteristic (yellow or round) to its antagonistic
recessive characteristic (green or wrinkled) is 12:4, or 3:1.
This means the inheritance of the gene for pea color is un-
affected by the inheritance of the gene for pea shape, and
vice versa.
The preceding analysis became the basis of Mendel’s
second general genetic principle, the law of independent
­assortment: During gamete formation, different pairs of
Figure 1.13 The law of independent assortment. In a
dihybrid cross, each pair of alleles assorts independently during
gamete formation. In the gametes, Y is equally likely to be found with
R or r (that is, Y R = Y r); the same is true for y (that is, y R = y r). As
a result, all four possible types of gametes (Y R, Y r, y R, and y r) are
produced in equal frequency.
Possible allele
Alleles in Gamete
parental cell formation
combinations
in gametes
Y R 1/4
Y r 1/4
Y
y
R
y R 1/4
r
y r 1/4
­ lleles segregate independently of each other (Fig. 1.13). The
a
independence of their segregation and the subsequent ­random
union of gametes at fertilization determine the phenotypes
observed. Using the product rule for assessing the probability
of independent events, you can see mathematically how the
9:3:3:1 phenotypic ratio observed in a dihybrid cross derives
from two separate 3:1 phenotypic ratios. If the two sets of
alleles assort independently, the yellow-to-green ratio in the
F2 generation will be 3/4 : 1/4, and likewise, the round-to-
wrinkled ratio will be 3/4 : 1/4. To find the probability that
two independent events such as yellow and round will occur
simultaneously in the same plant, you multiply as follows:
Probability of yellow round = 3/4 × 3/4 = 9/16
Probability of green round = 1/4 × 3/4 = 3/16
Probability of yellow wrinkled = 3/4 × 1/4 = 3/16
Probability of green wrinkled = 1/4 × 1/4 = 1/16
Thus, in a population of F2 plants, there will be a
9:3:3:1 phenotypic ratio of yellow round to green round to
yellow wrinkled to green wrinkled.
Branched-line diagrams
A convenient way to keep track of the probabilities of each
potential outcome in a genetic cross is to construct a
branched-line diagram (Fig. 1.14), which shows all the
possible genotypes or phenotypes for each gene in a
­sequence of columns. In Fig. 1.14, the first column shows
the two possible pea color phenotypes; the second column
demonstrates that each pea color can occur with either of
two pea shapes. Again, the 9:3:3:1 ratio of phenotypes is
apparent. You will see later that branched-line diagrams
are more convenient than Punnett squares for predicting the
outcomes of crosses involving more than two genes.
 1.2 Genetic Analysis According to Mendel 11

Figure 1.14 Following crosses with branched-line Figure 1.15 Testcrosses with dihybrids. Testcrosses
diagrams. A series of columns tracks every gene in a cross, involving two pairs of independently assorting alleles yield different,
providing an organized overview of all possible outcomes. This predictable results depending on the tested individual’s genotype.
branched-line diagram of a dihybrid cross generates the same Cross A Cross B
phenotypic ratios as the Punnett square in Fig. 1.12, showing that
the two methods are equivalent. P YY RR yy rr P YY Rr yy rr
Gene 1 Gene 2 Phenotypes
F1 F1
3/4 round 9/16 yellow round yr yr
3/4 yellow
1/4 wrinkled 3/16 yellow wrinkled
YR YR
Yy Rr Yy Rr
3/4 round 3/16 green round
1/4 green
1/4 wrinkled 1/16 green wrinkled Yr
Yy rr

Cross C Cross D
Testcrosses with dihybrids P Yy RR yy rr P Yy Rr yy rr
An understanding of dihybrid crosses has many applica-
tions. Suppose, for example, that you work for a nursery F1 F1
yr yr
that has three pure-breeding strains: yellow wrinkled, green
round, and green wrinkled. Your assignment is to grow
pure-breeding plants guaranteed to produce yellow round YR YR
Yy Rr Yy Rr
peas. How would you proceed?
One answer is to cross two of your pure-breeding strains yR Yr
(YY rr × yy RR) to generate a dihybrid (Yy Rr). Then self- yy Rr Yy rr
cross the dihybrid and plant only the yellow round peas. yR
Only one out of nine of such progeny—those grown from yy Rr
peas with a YY RR genotype—will be appropriate for your
yr
uses. To find these plants, you could subject each yellow yy rr
round candidate to a testcross for genotype with a green
wrinkled (yy rr) plant, as illustrated in Fig. 1.15. If the test-
cross yields all yellow round offspring (testcross A), you
can sell your test plant, because you know it is homozygous You could set up a Punnett square to answer the question.
for both pea color and pea shape. If your testcross yields Because for each trait there are two different alleles, the
1/2 yellow round and 1/2 yellow wrinkled (testcross B), or number of different eggs or sperm is found by raising 2 to
1/2 yellow round and 1/2 green round (testcross C), you know the power of the number of differing traits (2n, where n is
that the candidate plant in question is genetically homozygous the number of traits). By this calculation, each hybrid par-
for one trait and heterozygous for the other and must there- ent in this cross with 4 traits would make 24 = 16 different
fore be discarded. Finally, if the testcross yields 1/4 yellow kinds of gametes. The Punnett square depicting such a
round, 1/4 yellow wrinkled, 1/4 green round, and 1/4 green cross would thus contain 256 boxes (16 × 16).
wrinkled (testcross D), you know that the plant is a hete- Setting up such a square may be fine if you live in a
rozygote for both the pea color and the pea shape genes. monastery with a bit of time on your hands, but not if
you’re taking a 1 hour exam. It would be much simpler to
analyze the problem by breaking down the multihybrid
Mendel’s Laws Predict Probabilities, cross into four independently assorting monohybrid
crosses. Remember that the genotypic ratios of each mono-
Not Specific Outcomes hybrid cross are 1 homozygote for the dominant allele, to
Mendelian analysis makes accurate predictions about the 2 heterozygotes, to 1 homozygote for the recessive allele =
offspring of complex multihybrid crosses: matings be- 1/4 : 2/4 : 1/4. Thus, you can find the probability of
tween the F1 progeny of pure-breeding parents that differ in AA bb Cc Dd by multiplying the probability of each inde-
three or more traits. Suppose you want to predict the occur- pendent event: AA (1/4 of the progeny produced by Aa × Aa);
rence of one specific genotype in a cross involving inde- bb (1/4); Cc (2/4); Dd (2/4):
pendently assorting alleles of several genes. For example, if
1/4 × 1/4 × 2/4 × 2/4 = 4/256 = 1/64
hybrids heterozygous for four genes are allowed to self-
fertilize—Aa Bb Cc Dd × Aa Bb Cc Dd—what proportion of The Punnett square approach would provide the same
their progeny will have the genotype AA bb Cc Dd? ­answer, but it would be far more tedious.
12 Chapter 1   Mendel’s Principles of Heredity
If instead of a specific genotype, you want to predict
the probability of a certain phenotype, you can again use
the product rule as long as you know the phenotypic ratios
produced by each pair of alleles in the cross. For example,
if in the multihybrid cross of Aa Bb Cc Dd × Aa Bb Cc Dd
you want to know how many offspring will show the dom-
inant A characteristic (genotype AA or Aa = 1/4 + 2/4, or
3/4), the recessive b characteristic (genotype bb = 1/4), the
dominant C characteristic (genotype CC or Cc = 3/4), and
the dominant D characteristic (genotype DD or Dd = 3/4),
you simply multiply:
3/4 × 1/4 × 3/4 × 3/4 = 27/256
In this way, the rules of probability make it possible to pre-
dict the outcome of complex crosses.
You can see from these examples that particular prob-
lems in genetics are amenable to particular modes of analy-
sis. As a rule of thumb, Punnett squares are excellent for
visualizing simple crosses involving a few genes, but they
become unwieldy in the dissection of more complicated
matings. ­Direct calculations of probabilities, such as those in
the two preceding problems, are useful when you want to
know the chances of one or a few outcomes of complex
crosses. If, however, you want to know all the outcomes of a
multihybrid cross, a branched-line diagram is the best way to
go, because it will keep track of all the possibilities in an
organized fashion.
Mendel realized that because of the effects of chance,
his laws would make the most accurate predictions only
if he examined large numbers of pea plants. A simple
coin toss experiment illustrates his reasoning. With each
throw, the probability of the coin coming up heads is
equal to the likelihood it will come up tails. But if you
toss a coin 10 times, you may get 30% (3) heads and 70%
(7) tails, or vice versa. If you toss it 100 times, you are
more likely to get a result closer to the expected 50%
heads and 50% tails. The larger the number of trials, the
lower the probability that chance significantly skews the
data. In Chapter 5, we discuss mathematical methods for
assessing whether the chance variation observed in a
sample of individuals is compatible with a genetic
hypothesis.
Mendel’s Genius Was Unappreciated
Before 1900
Mendel’s insights into the workings of heredity were a
breakthrough of monumental proportions. By counting
and analyzing data from hundreds of pea plant crosses, he
inferred the existence of genes—independent units that
determine the observable patterns of inheritance for par-
ticular traits. His work explained the reappearance of hid-
den characteristics, disproved the idea of blended
inheritance, and showed that mother and father make an
equal genetic contribution to the next generation. The
model of heredity that he formulated was so specific he
could test predictions based on it by observation and ex-
periment.
Mendel was so far ahead of his time that none of his
contemporaries appreciated the importance of his research.
A key reason for the obscurity of Mendel’s work was that,
in the 1860s, no one had yet seen the structures within cells,
the chromosomes, that actually carry the genes. That would
happen only about 20 years later. If scientists had been able
to see these structures, they might have more readily ac-
cepted Mendel’s ideas. As Chapter 3 will describe, the be-
havior of the chromosomes during a kind of cell division
called meiosis is the underlying basis of Mendel’s laws.
Mendel’s work might have had an important influ-
ence on early debates about evolution if it had been more
widely appreciated. Charles Darwin (1809–1882), who
was unfamiliar with Mendel’s work, was plagued in his
later years by criticism that his explanations for the per-
sistence of variation in organisms were insufficient.
Darwin considered such variation a cornerstone of his
theory of evolution, maintaining that natural selection
would favor particular variants in a given population in
a given environment. If the selected combinations of
variant traits were passed on to subsequent generations,
this transmission of variation would propel evolution.
He could not, however, say how that transmission might
occur. Had Darwin been aware of Mendel’s ideas, he
might not have been backed into such an uncomfortable
corner.
For 34 years, Mendel’s laws lay dormant—untested,
unconfirmed, and unapplied. Then in 1900, 16 years af-
ter Mendel’s death, Carl Correns, Hugo de Vries, and
Erich von Tschermak independently rediscovered and ac-
knowledged his work (Fig. 1.16). The scientific commu-
nity had finally caught up with Mendel. Within a decade,
investigators had coined many of the modern terms we
have been using: phenotype, genotype, homozygote, hete-
rozygote, gene, and genetics, the label given to the twen-
tieth-century science of heredity. Mendel’s paper
provided the new discipline’s foundation. His principles
and analytic techniques endure today, guiding geneticists
and evolutionary biologists in their studies of genetic
variation.
Recessive Alleles Are Most Often
Nonfunctional, While Dominant
Alleles Are Usually Functional
We now know that most genes specify the proteins that
dictate the structure and function of cells. Recently,
two genes were identified that are likely to correspond
to Mendel’s genes for seed shape and seed color. The pea

Figure 1.16 The science of genetics begins with the rediscovery of Mendel. Working independently at the beginning of the
twentieth century, Correns, de Vries, and von Tschermak each came to the same conclusions summarized in Mendel’s laws. (a): NML/Science
Source; (b): INTERFOTO/Alamy; (c): SPL/Science Source; (d): Ullstein Bild/Getty Images
(a) Gregor Mendel (b) Carl Correns
shape gene specifies an enzyme known as Sbe1
(for Starch-branching enzyme 1). Sbe1 catalyzes the
conversion of amylose, an unbranched linear starch, to
amylopectin, a starch composed of branching chains
(Fig. 1.17a). The dominant R allele of the pea shape gene
determines a normal, functioning Sbe1 enzyme. In con-
trast, the recessive allele r specifies no Sbe1 enzyme. As a
result, RR homozygotes contain many branched starch
molecules, which allows the peas to maintain a rounded
Figure 1.17 Mendel’s pea shape and pea color genes.
(a) The R allele of the pea shape gene specifies the enzyme Sbe1,
which converts unbranched starch (amylose) to branched starch
(amylopectin). The r allele does not produce Sbe1. The buildup of
unbranched starch in rr peas ultimately causes seed wrinkling.
(b) The Y allele of the pea color gene specifies the enzyme Sgr,
which helps break down chlorophyll, resulting in yellow peas. The
y allele does not produce Sgr. Chlorophyll is not broken down in
yy peas, and they remain green.
(a) Biochemical function of Mendel’s pea shape gene
R : Sbe1 RR, Rr
r : No Sbe1 Sbe1
Amylose
Amylopectin
rr
(b) Biochemical function of Mendel’s pea color gene
Y : Sgr
y : No Sgr
YY, Yy O
Sgr
O
Breakdown product
Chlorophyll yy
1.2 Genetic Analysis According to Mendel 13
(c) Hugo de Vries (d) Erich von Tschermak
shape. In contrast, the recessive allele r specifies no Sbe1
enzyme. Sucrose builds up in homozygous recessive
rr peas because less of it is converted into starch. The ex-
cess sucrose modifies the osmotic pressure, causing water
to enter the young seeds. As the rr seeds mature, they
lose water, shrink, and wrinkle. The single dominant
allele in Rr heterozygotes apparently specifies enough
of the normal Sbe1 enzyme to prevent wrinkling.
The pea color gene determines an enzyme called
Sgr (for Stay green). Sgr performs one step in the path-
way leading to the breakdown of the green pigment
chlorophyll, a process that occurs naturally in peas as
they mature (Fig. 1.17b). The dominant Y allele speci-
fies Sgr, and the recessive y allele does not. Homozy-
gous YY or heterozygous Yy peas are yellow because
they each have enough Sgr to break down all the
chlorophyll. Homozygous yy peas stay green because
they lack the Sgr enzyme, and the chlorophyll
remains.
Two general principles emerge from these molecu-
lar discoveries. First, a specific gene determines a spe-
cific protein (in each of these cases, an enzyme). The
activity of the protein may affect the phenotype of the
pea plant in any number of ways, depending on the bio-
chemical pathway in which it functions. Second, a pat-
tern can be seen in both of these examples: The dominant
allele determines a normally functioning protein, while
the recessive allele does not specify a functional pro-
tein. You will see in Chapter 2 that this is the most com-
mon, although certainly not the only, molecular
explanation for why one allele is dominant to another
(recessive) allele.
14 Chapter 1   Mendel’s Principles of Heredity
essen tial con cepts 1.2
• Discrete units called genes control the appearance of
inherited traits; genes come in alternative forms called
alleles.
• A sexually reproducing organism’s body cells contain
two alleles for every gene. These alleles may be the
same (in a homozygote) or different (in a
heterozygote).
• Genotype refers to the alleles an individual
possesses; phenotype refers to the traits the
individual exhibits.
• The dominant allele controls the phenotype of a trait in
heterozygotes; the other allele in the heterozygote is
recessive. In monohybrid crosses, the dominant and
recessive phenotypes will appear in the progeny in a ratio
of 3:1.
• Alleles segregate during the formation of gametes, which
thus contain only one allele of each gene. Male and
female gametes unite at random at fertilization. These
two processes correspond to Mendel’s law of
segregation.
• The segregation of alleles of any one gene is independent
of the segregation of the alleles of other genes. This
principle is Mendel’s law of independent assortment.
According to this law, crosses between Aa Bb dihybrids
will generate progeny with a phenotypic ratio of 9 (A– B–) :
3 (A– bb) : 3 (aa B–) : 1 (aa bb).
• Most often, the dominant allele of a gene specifies a
functional product (a protein), while the recessive allele
determines either a nonfunctional version of the protein, or
no protein at all.
1.3 Mendelian Inheritance
in Humans
learnin g objectiv es
1. Analyze human pedigrees to determine whether a
genetic disease exhibits recessive or dominant
inheritance.
2. Explain why Huntington disease is inherited as a
dominant allele, while cystic fibrosis is caused by a
recessive allele.
Although many human traits clearly run in families, most
do not show a simple Mendelian pattern of inheritance.
Suppose, for example, that you have brown eyes, but both
your parents’ eyes appear to be blue. Because blue is nor-
mally considered recessive to brown, does this mean that
you are adopted or that your father isn’t really your father?
Not necessarily, because eye color is influenced by more
than one gene.
Like eye color, most common and obvious human
phenotypes arise from the interaction of many genes. In
contrast, single-gene traits in people usually involve an
abnormality that is disabling or life-threatening. Exam-
ples are the progressive neurological damage of Hunting-
ton disease and the clogged lungs and potential respiratory
failure of cystic fibrosis. A defective allele of a single
gene gives rise to Huntington disease; defective alleles
of a different gene are responsible for cystic fibrosis.
Table 1.1 lists some of the roughly 7000 such single-gene,
or Mendelian, traits known in humans. As you will see,
the allele that causes Huntington disease is dominant and
the normal (nondisease) allele of this gene is recessive.
The opposite is true for cystic fibrosis—the disease-
causing allele is recessive and the normal (nondisease)
allele is dominant.
Pedigrees Aid the Study of Hereditary
Traits in Human Families
Determining a genetic defect’s pattern of transmission is
not always an easy task because people make slippery ge-
netic subjects. Their generation time is long, and the fami-
lies they produce are relatively small, which makes
statistical analysis difficult. Humans do not base their
choice of mates on purely genetic considerations and no
controlled matings are possible.
Geneticists circumvent these difficulties by working
with a large number of families or with several generations
of a very large family. In this way, scientists can study the
large numbers of genetically related individuals needed to
establish the inheritance patterns of specific traits. A family
history, known as a pedigree, is an orderly diagram of a
family’s relevant genetic features, extending back to at
least both sets of grandparents and preferably through as
many additional generations as possible. From systematic
pedigree analysis in the light of Mendel’s laws, geneti-
cists can tell if a trait is determined by alternative
alleles of a single gene and whether a single-gene char-
acteristic is dominant or recessive to another characteristic.
Because Mendel’s principles are so simple and straight-
forward, a little logic can go a long way in ­explaining how
traits are inherited in humans.
Figure 1.18 shows how to interpret a family pedi-
gree diagram. Squares ( ) represent males, circles ( )
are females, diamonds ( ) indicate that the sex is un-
specified. Family members affected by the condition in
question are indicated by a filled-in symbol (for exam-
ple, ). A single horizontal line connecting a male and a
female ( ) represents a mating; a double connecting
line ( ) designates a consanguineous mating—that
 1.3 Mendelian Inheritance in Humans 15

TABLE 1.1 Some of the Most Common Single-Gene Traits in Humans

Disease Effect Incidence of Disease

Caused by a Recessive Allele

Thalassemia (chromosome 16 or 11)
Sickle-cell disease (chromosome 11)
Cystic fibrosis (chromosome 7)
Tay–Sachs disease (chromosome 15)
Phenylketonuria (PKU) (chromosome 12)
Caused by a Dominant Allele
Hypercholesterolemia (chromosome 19)
Huntington disease (chromosome 4)
Reduced amounts of hemoglobin: 1/10 in parts of Italy
anemia, bone and spleen enlargement
Abnormal hemoglobin: sickle-shaped red cells, anemia, 1/625 African-Americans
blocked circulation, increased resistance to malaria
Defective cell membrane protein: excessive mucus 1/2,000 Caucasians
production, digestive and respiratory failure
Missing enzyme: buildup of fatty deposit in brain that 1/3,000 Eastern European Jews
disrupts mental development
Missing enzyme: mental deficiency 1/10,000 Caucasians
Missing protein that removes cholesterol 1/122 French Canadians
from the blood: heart attack by age 50
Abnormal Huntingtin protein: progressive 1/25,000 Caucasians
mental and neurological damage,
neurologic disorders by ages 40–70

is, a mating between relatives; and a horizontal consistent with both possibilities. If the disease allele
line above a series of symbols ( ) indicates the is dominant, then the father and the affected son are
children of the same parents (a sibship) arranged and heterozygotes, while the mother and the unaffected son
numbered from left to right in order of their birth. Ro- are homozygotes for the recessive normal allele. If
man numerals to the left or right of the diagram indicate instead the disease allele is recessive, the father and af-
the generations. fected son are homozygotes for the recessive
To reach a conclusion about the mode of inheritance disease-causing allele, while the mother and the unaf-
of a family trait, human geneticists must use a pedigree fected son are heterozygotes.
that supplies sufficient information. For example, re- Several kinds of additional information could help
searchers could not determine whether the allele causing resolve this uncertainty. Human geneticists would par-
the disease depicted at the bottom of Fig. 1.18 is domi- ticularly want to know the frequency at which the trait in
nant or recessive to the normal (nondisease) allele solely question is found in the population from which the fam-
on the basis of the simple pedigree shown. The data are ily came. If the disease is rare in the population, then
the allele giving rise to the disease should also be rare,
and the most likely hypothesis would require that the
fewest genetically unrelated people carry the allele.
Figure 1.18 Symbols used in pedigree analysis. In the Only the father in Fig. 1.18 would need to have a domi-
simple pedigree at the bottom, I-1 is the father, I-2 is the mother, nant disease-causing allele, but both parents would need
and II-1 and II-2 are their sons. The father and the first son are both
to carry a recessive disease-causing allele (the father two
affected by the disease.
copies and the mother one). However, even the informa-
Male
tion that the condition is rare does not allow us to draw
Female Unaffected
the firm conclusion that it is inherited in a dominant
Sex unspecified fashion. The pedigree in the figure is so limited that we
Diseased Deceased cannot be sure the two parents are themselves unrelated.
5 3 14 Multiple progeny Consanguineous As we discuss later in more detail, related parents might
mating have both received the same rare recessive allele from
their common ancestor. This example illustrates why hu-
Mating line
Generation I man geneticists try to collect family histories that cover
Sibship line
1 2 Line of descent several generations.
Generation II We now look at more extensive pedigrees for the
1 2 Individual number within generation dominant trait of Huntington disease and for the recessive
16 Chapter 1   Mendel’s Principles of Heredity
condition of cystic fibrosis. The patterns by which these
traits appear in the pedigrees provide important clues that
can indicate modes of inheritance and allow geneticists to
assign genotypes to family members.
A Vertical Pattern of Inheritance Indicates
a Rare Dominant Trait
Huntington disease is named for George Huntington, the
New York physician who first described its course. This
illness usually shows up in middle age and slowly de-
stroys its victims both mentally and physically. Symp-
toms include intellectual deterioration, severe depression,
and jerky, irregular movements, all caused by the pro-
gressive death of nerve cells. If one parent develops the
symptoms, his or her children have a 50% probability of
suffering from the disease, provided they live suffi-
ciently long. Because symptoms are not present at birth
and manifest themselves only later in life, Huntington
disease is known as a late-onset genetic trait.
How would you proceed in assigning genotypes to
the individuals in the Huntington disease pedigree de-
picted in Fig. 1.19? First, you would need to find out if
the disease-­producing allele is dominant or recessive to
the normal allele. Several clues suggest that Huntington
disease is transmitted by a dominant allele of a single
gene. Everyone who develops the disease has at least one
parent who shows the trait, and in several generations,
approximately half of the offspring are affected. The
pattern of affected individuals is thus ­vertical: If you
trace back through the ancestors of any ­a ffected individ-
ual, you would see at least one affected person in each
generation, giving a continuous line of family members
with the disease. When a disease is rare in the popula-
Figure 1.19 Huntington disease: A rare dominant trait. All
individuals represented by filled-in symbols are heterozygotes (except
I-1, who could instead have been homozygous for the dominant HD
disease allele); all individuals represented by open symbols are
homozygotes for the recessive HD+ normal allele. Among the 14
children of the consanguineous mating, DNA testing shows that
some are HD HD, some are HD HD+, and some are HD+ HD+. The
diamond designation masks personal details to protect confidentiality.
I HD+ HD+
1 2
II
1 2
III
1 2 3 4 5 6
IV
1 2 3 4 5 6
14
V
1 2 3 HD
tion as a whole, a vertical pattern is strong evidence that
a dominant allele causes the condition; the alternative
would require that many unrelated people carry a rare
recessive allele. (A recessive trait that is extremely com-
mon might also show up in every generation; we exam-
ine this possibility in Problem 40 at the end of this
chapter.)
In tracking a dominant allele through a pedigree, you
can view every mating between an affected and an unaf-
fected partner as analogous to a testcross. If some of the
offspring do not have Huntington disease, you know the
parent showing the trait is a heterozygote. As an exercise,
you should check your own genotype assignments against
those in the caption to Fig. 1.19.
Notice also in the legend to Fig. 1.19 that human
­geneticists use different symbols than Mendel’s for alleles
of genes. In human genotypes, all alleles are written in
­uppercase. If the allele specifies a normally functioning
gene product, the allele symbol has a superscript +. Alleles
that specify no gene product or abnormal gene products
sometimes have no superscript at all, as in the Fig. 1.19
legend, but in other cases they have a superscript other than
+ that ­signifies a particular type of abnormal allele. (See
the Appendix Guidelines for Gene Nomenclature for
­further discussion of genetic notation.)
The gene that causes Huntington disease has been
identified and studied at the molecular level. In fact, in
1988 this was the first human disease gene identified molec-
ularly using methods that will be described in Chapter 12.
The protein product of the Huntington disease gene, called
Huntingtin or Htt, is needed for the proper physiology of
nerve cells, but the protein’s precise role in these cells is
not yet understood. The dominant disease allele (HD) spec-
ifies a defective Htt protein that over time damages nerve
cells (Fig. 1.20).
Figure 1.20 Why the allele for Huntington disease is
dominant. People who are HD HD or HD HD+ exhibit Huntington
disease because the HD allele produces an abnormal Htt protein that
damages nerve cells. Homozygotes for the normal allele (HD+ HD+)
produce only normal Htt protein and do not have the disease. The
disease allele (HD) is dominant because even when the normal
protein is present—in HD HD+ heterozygotes—the abnormal protein
damages nerve cells. HD HD homozygosity is possible because the
abnormal Htt protein retains some function of the normal protein.
HD HD+ HD HD
Normal Disease
3 4
7 8 9
HD+ Normal Htt protein
Abnormal Htt protein

The disease allele is dominant to the normal allele
because the presence of the normal Htt protein in hete-
rozygotes does not prevent the abnormal protein from
damaging the cells. It is important to note that this expla-
nation for the Huntington disease allele is only one of
many different molecular mechanisms that may result in
a disease allele that is dominant to the normal allele of a
particular gene.
No effective treatment yet exists for Huntington
disease, and because of its late onset, there was until
the 1980s no way for children of a Huntington parent to
know before middle age—usually until well after their
own childbearing years—whether they carried the
Huntington disease allele (HD). Most people with
the disease allele are HD HD + heterozygotes, so their
children would have a 50% probability of inheriting
HD and, before they are diagnosed, a 25% probability
of passing the defective allele on to one of their
children.
In the mid-1980s, with new knowledge of the gene,
molecular geneticists developed a DNA test that deter-
mines whether an individual carries the HD allele.
(This test will be explained in detail in Chapter 12.) If
the test shows the presence of HD, the prospective par-
ents might choose to conceive a child using in vitro
fertilization (IVF) technology (also described in Chap-
ter 12) that allows for genotyping of early-stage
embryos. Using IVF, only embryos lacking the HD dis-
ease allele would be introduced into the mother’s
womb.
A Horizontal Pattern of Inheritance
Indicates a Rare Recessive Trait
Unlike Huntington disease, most confirmed single-gene
diseases in humans are caused by recessive alleles. One
reason is that, with the exception of late-onset traits, delete-
rious dominant alleles are unlikely to be transmitted to the
next generation. For example, if people affected with Hun-
tington disease all died by the age of 10, the disease would
disappear from the population. In contrast, individuals can
carry one allele for a recessive disease without ever being
affected by any symptoms.
Figure 1.21 shows three pedigrees for cystic fibro-
sis, the most commonly inherited recessive disease
among Caucasian children in the United States. A dou-
ble dose of the recessive CF allele (meaning the absence
of a CF+ ­a llele) causes a disorder in which the lungs,
pancreas, and other organs become clogged with a thick,
viscous ­mucus that can interfere with breathing and di-
gestion. One in every 2000 white Americans is born
with cystic fibrosis.
Note two salient features of the cystic fibrosis ped-
igrees. First, the family pattern of people showing the
1.3 Mendelian Inheritance in Humans 17
Figure 1.21 Cystic fibrosis: A recessive condition. In (a),
the two affected individuals (VI-4 and VII-1) are CF CF; that is,
homozygotes for the recessive disease allele. Their unaffected
parents must be carriers, so V-1, V-2, VI-1, and VI-2 must all be
CF CF +. Individuals II-2, II-3, III-2, III-4, IV-2, and IV-4 are probably
also carriers. We cannot determine which of the founders (I-1 or I-2)
was a carrier, so we designate their genotypes as CF +–. Because
the CF allele is relatively rare, it is likely that II-1, II-4, III-1, III-3, IV-1,
and IV-3 are CF +CF + homozygotes. The genotype of the remaining
unaffected people (VI-3, VI-5, and VII-2) is uncertain (CF +–). (b and
c) These two families demonstrate horizontal patterns of inheritance.
Without further information, the unaffected children in each
pedigree must be regarded as having a CF +– genotype.
(a) I
1 2
II
1 2 3 4
III
1 2 3 4
IV
1 2 3 4 (b) I
1 2
V
1 2
II
1 2 3 4 5 6
VI
1 2 3 4 5
(c) I
1 2
VII
1 2
II
1 2 3 4 5
trait is often horizontal: The parents, grandparents,
and great-grandparents of children born with cystic fi-
brosis do not themselves ­m anifest the disease, while
several brothers and sisters in a single generation may.
A horizontal pedigree pattern is a strong indication
that the trait is recessive. The unaffected parents are
heterozygous carriers: They bear a dominant normal
allele (CF+) that masks the effects of the recessive ab-
normal one. An estimated 12 million Americans are
carriers of a recessive CF allele. Table 1.2 summarizes
some of the clues found in pedigrees that can help you
decide whether a trait is caused by a dominant or a re-
cessive allele.
The second salient feature of cystic fibrosis pedigrees is
that many of the couples who produce afflicted children are
blood relatives; that is, their mating is consanguineous
(as indicated by the double line). In Fig. 1.21a, the consan-
guineous mating in generation V is between third cousins.
Of course, children with cystic fibrosis can also have unre-
lated carrier parents, but because relatives share genes, their
offspring have a much greater than average chance of re-
ceiving two copies of a rare allele. Whether or not they are
related, carrier parents are both heterozygotes. Each child of
two carrier parents thus has a 1/4 chance of suffering from
cystic fibrosis.
You can gauge your understanding of this inher-
itance pattern by assigning a genotype to each person in
Fig. 1.21 and then checking your answers against the
18 Chapter 1   Mendel’s Principles of Heredity
TABLE 1.2 How to Recognize Dominant
and Recessive Traits in Pedigrees
Dominant Traits
1. Affected children always have at least one affected parent.
2. Dominant traits show a vertical pattern of inheritance: The
trait shows up in every generation.
3. Two affected parents can produce unaffected children, if
both parents are heterozygotes.
Recessive Traits
1. Affected individuals can be the children of two unaffected
carriers, particularly as a result of consanguineous matings.
2. All the children of two affected parents should be affected.
3. Rare recessive traits show a horizontal pattern of
inheritance: The trait first appears in one or more members
of one generation and is not seen in earlier generations.
4. Recessive traits may show a vertical pattern of inheritance
if the trait is extremely common in the population.
caption. Note that for several individuals, such as the
generation I individuals in part (a) of the figure, it is
impossible to assign a full genotype. We know that one
of these people must be the carrier who supplied the
original CF allele, but we do not know if it was the male
or the female. As with an ambiguous dominant pheno-
type in peas, the unknown second allele is indicated by
a dash (–).
Figure 1.22 Why the cystic fibrosis disease allele is recessive. The CFTR protein regulates the passage of chloride ions (green
spheres) through the cell membrane. Homozygotes for a cystic fibrosis disease allele (CF CF) have the disease because recessive disease
alleles either specify no CFTR protein as shown, or encode abnormal CFTR proteins that do not function at all or function less well than the
normal protein (not shown). Disease alleles (CF) are recessive because CF CF+ heterozygotes produce sufficient CFTR from the normal (CF+)
allele for normal lung function.
CF + CF + or CF CF +
Outside of the cell
Lipid bilayer of
cell membrane
Inside of the cell CFTR protein
Cl– ions
Normal
In Fig. 1.21a, a mating between the unrelated carriers
VI-1 and VI-2 produced a child with cystic fibrosis. How
likely is such a marriage between unrelated carriers for a
recessive genetic condition? The answer depends on the
gene in question and the particular population into which
a person is born. As Table 1.1 shows, the incidence of
genetic diseases (and thus the frequency of their carriers)
varies markedly among populations. Such variation re-
flects the distinct genetic histories of different groups.
The area of genetics that analyzes differences among
groups of individuals is called population genetics, a sub-
ject we cover in Chapter 24. Notice that in Fig. 1.21a,
several unrelated, unaffected people, such as II-1 and II-4,
married into the family under consideration. Although it
is highly probable that these individuals are homozygotes
for the normal allele of the gene (CF+CF+), a small chance
(whose magnitude depends on the frequency of the dis-
ease allele in the population) exists that any one of them
could be a carrier of a CF disease allele.
Genetic researchers identified the cystic fibrosis gene
in 1989, soon after the Huntington disease gene was iden-
tified. The normal, dominant CF+ allele makes a protein
called cystic fibrosis transmembrane conductance regula-
tor (CFTR). CFTR protein forms a channel in the cell
membranes that controls the flow of chloride ions through
lung cells. Recessive CF disease alleles either produce no
CFTR or produce nonfunctional or less functional ver-
sions of the protein (Fig. 1.22). Because of osmosis, water
CF CF
Outside of the cell
Mucus
Inside of the cell
Cystic fibrosis

flows into lung cells without CFTR, while a thick, dehy-
drated mucus builds up outside the cells. Thus, CF CF
homozygotes have no (or not enough) functional CFTR
and exhibit cystic fibrosis. Physicians have tried to
ameliorate the disease’s debilitating symptoms with gene
therapy (insertion of a normal CF+ gene into lung cells of
patients), but so far without success.
Despite the failure to date of gene therapy, identifi-
cation of the gene responsible for cystic fibrosis has
essen tial concept s 1.3
• In a vertical pattern of transmission, a trait that appears in
an affected individual also appears in at least one parent,
one of the affected parent’s parents, and so on. If a trait is
rare, a pedigree with a vertical pattern usually indicates
that the disease-causing allele is dominant.
• In a horizontal pattern of transmission, a trait that appears
in an affected individual may not appear in any ancestors,
but it may appear in some of the person’s siblings. A
pedigree with a horizontal pattern usually indicates a rare
recessive disease-causing allele. Affected individuals are
often products of consanguineous mating.
S O LV E D P R O B L E M S
Solving Genetics Problems
The best way to evaluate and increase your understanding
of the material in the chapter is to apply your knowledge in
solving genetics problems. Genetics word problems are like
puzzles. Take them in slowly—don’t be overwhelmed by
the whole problem. Identify useful facts given in the prob-
lem, and use the facts to deduce additional information. Use
genetic principles and logic to work toward the solutions.
The more problems you do, the easier they become.
Solving genetics problems requires much more than
simply plugging numbers into formulas. Each problem is
unique and requires thoughtful evaluation of the informa-
tion given and the question being asked. The following are
general guidelines you can follow in approaching these
word problems:
a. Read through the problem once to get some sense of
the concepts involved.
b. Go back through the problem, noting all the geno-
types and phenotypes supplied to you or otherwise
implied. Represent the known information in a sym-
bolic format—assign symbols for alleles; use these
symbols to indicate genotypes; make a diagram of the
crosses. Be sure you do not assign different letters of
the alphabet to two alleles of the same gene, as this
can cause confusion. Also, be careful to discriminate
Solved Problems 19
recently led to effective treatments for the disease in pa-
tients with particular mutant alleles. For example, in
2015 the U.S. Food and Drug Administration approved a
drug cocktail called Orkambi® that helps the particular
defective form of CFTR specified by one of these alleles
to function properly. Varied approaches to the treatment
of cystic fibrosis and other inherited diseases will be dis-
cussed later in the book.
• Various kinds of biochemical events may explain
why some disease alleles are dominant. In the case
of Huntington disease, the disease-causing HD allele
specifies an abnormal, deleterious version of the
protein produced by the normal, recessive allele.
• Recessive disease alleles, like the CF alleles that
cause cystic fibrosis, usually specify either no protein
or less-functional versions of the protein that the
normal, dominant allele produces.
clearly between the upper- and lowercases of letters,
such as C(c) or S(s).
c. Now, reassess the question and work toward the solu-
tion using the information given. Make sure you
answer the question being asked!
d. When you finish the problem, check to see that the
answer makes sense. You can often check solutions
by working backward; that is, see if you can recon-
struct the data from your answer.
e. After you have completed a question and checked your
answer, spend a minute to think about which major
concepts were involved in the solution. This step is
crucial for improving your understanding of genetics.
For each chapter, the logic involved in solving one or more
problems is described in detail.
Solved Problem I
In cats, white patches are caused by the dominant allele P,
while pp individuals are solid-colored. Short hair is caused by
a dominant allele S, while ss cats have long hair. A long-haired
cat with patches whose mother was solid-colored and short-
haired mates with a short-haired, solid-colored cat whose
mother was long-haired and solid-colored. What kinds of
kittens can arise from this mating, and in what proportions?
20 Chapter 1   Mendel’s Principles of Heredity
Answer
The solution to this problem requires an understanding of
dominance/recessiveness, gamete formation, and the inde-
pendent assortment of alleles of two genes in a cross.
First make a representation of the known information:
Mothers: solid, short-haired solid, long-haired
Cross: Cat 1 Cat 2
patches, long-haired × solid, short-haired
What genotypes can you assign? Any cat showing a reces-
sive phenotype must be homozygous for the recessive
allele. Therefore, the long-haired cats are ss; solid cats
are pp. Cat 1 is long-haired, so it must be homozygous for
the recessive allele (ss). This cat has the dominant pheno-
type of patches and could be either PP or Pp, but because
the mother was pp and could only contribute a p allele in
her gametes, Cat 1 must be Pp. Cat 1’s full genotype is Pp ss.
Similarly, Cat 2 is solid-colored, so it must be homozygous
for the recessive allele (pp). Because this cat is short-
haired, it could have either the SS or Ss genotype. Its mother
was long-haired (ss) and could only contribute an s allele in
her gamete, so Cat 2 must be heterozygous Ss. The full
genotype is pp Ss.
The cross is therefore between Pp ss (Cat 1) and pp Ss
(Cat 2). To determine the types of kittens, first establish the
types of gametes that can be produced by each cat and then
set up a Punnett square to determine the genotypes of the
offspring. Cat 1 (Pp ss) produces Ps and ps gametes in
equal proportions. Cat 2 (pp Ss) produces pS and ps gam-
etes in equal proportions. Four types of kittens can result
from this mating with equal probability: Pp Ss (patches,
short-haired), Pp ss (patches, long-haired), pp Ss (solid,
short-haired), and pp ss (solid, long-haired).
Cat 1
Ps ps
pS Pp Ss pp Ss
Cat 2
ps Pp ss pp ss
The following table demonstrates that you could also work
through this problem using the product rule of probability
instead of a Punnett square. The principles are the same:
Gametes produced in equal amounts by either parent are
combined at random.
Cat 1 Cat 2
gamete gamete Progeny
1/2 P s × 1/2 p S 1/4 Pp Ss patches, short-haired
1/2 P s × 1/2 p s 1/4 Pp ss patches, long-haired
1/2 p s × 1/2 p S 1/4 pp Ss solid-colored, short-haired
1/2 p s × 1/2 p s 1/4 pp ss solid-colored, long-haired
Solved Problem II
In tomatoes, red fruit is dominant to yellow fruit,
and purple stems are dominant to green stems. The progeny
from one mating consisted of 305 red fruit, purple stem
plants; 328 red fruit, green stem plants; 110 yellow fruit,
purple stem plants; and 97 yellow fruit, green stem plants.
What were the genotypes of the parents in this cross?
Answer
This problem requires an understanding of independent as-
sortment in a dihybrid cross, as well as the ratios predicted
from monohybrid crosses.
Designate the alleles:
R = red, r = yellow
P = purple stems, p = green stems
In genetics problems, the ratios of offspring can indicate
the genotype of parents. You will usually need to total the
number of progeny and approximate the ratio of offspring
in each of the different classes. For this problem, in which
the inheritance of two traits is given, consider each trait
independently. For red fruit, there are 305 + 328 = 633
red-fruited plants out of a total of 840 plants. This value
(633/840) is close to 3/4. About 1/4 of the plants have yel-
low fruit (110 + 97 = 207/840). From Mendel’s work,
you know that a 3:1 phenotypic ratio results from crosses
between plants that are heterozygous for one gene. There-
fore, the genotype for fruit color of each parent must have
been Rr.
For stem color, 305 + 110 or 415/840 plants had pur-
ple stems. About half had purple stems, and the other half
(328 + 97) had green stems. A 1:1 phenotypic ratio occurs
when a heterozygote is mated to a homozygous recessive
(as in a testcross). The parents’ genotypes must have been
Pp and pp for stem color.
The complete genotype of the parent plants in this
cross was Rr Pp × Rr pp.
Solved Problem III
Tay–Sachs is a recessive lethal disease in which neurologi-
cal deterioration occurs early in life. This disease is rare in
the population overall but is found at relatively high fre-
quency in Ashkenazi Jews from Eastern Europe. A woman
whose maternal uncle had the disease is trying to deter-
mine the probability that she and her husband could have
an affected child. Her father does not come from a high-
risk population. Her husband’s sister died of the disease at
an early age.
a. Draw the pedigree of the individuals described.
­Include the genotypes where possible.
b. Determine the probability that the couple’s first child
will be affected.
 Problems 21

Answer gotes. Finally, because individual II-3 is not from a

This problem requires an understanding of dominance/­ high-risk population, the most likely assumption is that
recessiveness and probability. First, diagram the pedigree, he is TT.
and then assign as many genotypes as possible using the You next need to determine the chance that a child of
following allele designations: III-1 and III-2 (that is, individual IV-1) would have Tay–
Sachs (tt). For that to be possible, both III-1 and III-2 must
T = normal allele; t = Tay–Sachs allele be Tt, given that neither is tt. For III-1 to be Tt, II-2 must be
Tt. Calculating the chance that II-2 is Tt is a bit tricky. At
Tt Tt first, it appears that the chance is 1/2 that the daughter of
I
1 2 two heterozygous (Tt) parents would be Tt: the expected
TT Tt Tt progeny ratio is 1 TT : 2 Tt : 1 tt. However, in this case you
II tt have additional information to consider: II-2 is unaffected
1 2 3 4 5
Affected and thus the genotype tt is ruled out. That leaves 1 TT : 2 Tt,
uncle or a 2/3 chance that II-2 is Tt. If so, the chance that II-2
III tt would transmit the t allele to III-1 is 1/2. Thus, the proba-
1 2 3 bility that III-1 is Tt is 2/3 × 1/2 = 1/3.
Affected
?
sister What is the chance that III-2 is Tt? Both of his parents
are heterozygous, and he is unaffected. Thus, using similar
The genotypes of the two affected individuals, the wom- logic, the likelihood that III-2 is Tt is 2/3.
an’s uncle (II-1) and the husband’s sister (III-3), are tt. The probability that both III-1 and III-2 are Tt is
Because the uncle was affected, both of his parents 1/3 × 2/3 = 2/9. The chance that the child of two Tt parents
(I-1 and I-2) must have been heterozygous. would be tt is 1/4. Thus, the overall likelihood that IV-1,
Similarly, as the husband’s sister (III-3) is affected, the child of III-1 and III-2, would have Tay–Sachs is
both of her parents (II-4 and II-5) must be heterozy- 2/9 × 1/4 = 1/18.

PROBLEMS

Vocabulary l. recessive 12. the alleles an individual has

m. dihybrid cross 13. the separation of the two alleles of a
1. For each of the terms in the left column, choose the gene into different gametes
best matching phrase in the right column. n. homozygote 14. offspring of the P generation
a. phenotype 1. having two identical alleles of a given gene
b. alleles 2. the allele expressed in the phenotype of
the heterozygote
Section 1.1
c. independent 3. alternate forms of a gene 2. During the millennia in which selective breeding was
assortment practiced, why did breeders fail to uncover the princi-
d. gametes 4. observable characteristic ple that traits are governed by discrete units of inheri-
e. gene 5. a cross between individuals both tance (that is, by genes)?
heterozygous for two genes
3. Describe the characteristics of the garden pea that
f. segregation 6. alleles of one gene separate into gametes
made it a good organism for Mendel’s analysis of the
randomly with respect to alleles of other
genes basic principles of inheritance. Evaluate how easy or
g. heterozygote 7. reproductive cells containing only one difficult it would be to make a similar study of inheri-
copy of each gene tance in humans by considering the same attributes
h. dominant 8. the allele that does not contribute to the you described for the pea.
phenotype of the heterozygote
i. F1 9. the cross of an individual of ambiguous Section 1.2
genotype with a homozygous recessive
individual 4. An albino corn snake is crossed with a normal-colored
j. testcross 10. an individual with two different alleles corn snake. The offspring are all normal-colored.
of a gene When these first-generation progeny snakes are
k. genotype 11. the heritable entity that determines a crossed among themselves, they produce 32 normal-
characteristic colored snakes and 10 albino snakes.
22 Chapter 1   Mendel’s Principles of Heredity

a. How do you know that only a single gene is respon- c. A man with a chin dimple and a nondimpled woman
sible for the color differences between these snakes? produce eight children, all having the chin dimple.
b. Which of these colors is controlled by a dominant Can you be certain of the man’s genotype? Why or
allele? why not? What genotype is most likely, and why?
c. A normal-colored female snake is involved in a 11. Some inbred strains of the weedy plant Arabidopsis
testcross. This cross produces 10 normal-colored thaliana flower early in the growing season, but other
and 11 albino offspring. What are the genotypes of strains flower at later times. Four different Arabdiposis
the parents and the offspring? plants (1–4) were crossed, and the resulting progeny
were tabulated as follows:
5. Two short-haired cats mate and produce six short-
haired and two long-haired kittens. What does this in- Mating Progeny
formation suggest about how hair length is inherited? 1×2 77 late : 81 early
6. Some humans exhibit piebald spotting: patches of skin 1×3 134 late
that lack pigmentation. The condition results from the 1×4 93 late : 32 early
inability of p­ igment-producing cells to migrate prop- 2×3 111 late
erly during development. Two adults with piebald spot- 2×4 65 late : 61 early
ting have one child who has this characteristic and a 3×4 126 late
second child with normal skin pigmentation.
a. Explain the genetic basis for the difference in flow-
a. Is piebald spotting dominant or recessive? What
ering time. How do you know that among this
information led you to this answer?
group of plants, the flowering time trait is influ-
b. What are the genotypes of the parents? enced by the action of a single gene? Which allele
7. Flies with short wings are homozygous for a recessive is dominant and which recessive?
allele of the wing-length gene. You have a fly that has b. Ascribe genotypes to the four plants.
normal wings (dominant phenotype). You need to c. What kinds of progeny would you expect if you al-
know if this fly with normal wings is pure-breeding lowed plants 1–4 to self-fertilize, and in what ratios?
or heterozygous for the wing-length trait. What cross
would you do to ­determine the genotype, and what re- 12. Among Native Americans, two types of earwax (ceru-
sults would you expect for each possible genotype? men) are seen: dry and sticky. A geneticist studied the
inheritance of this trait by observing the types of off-
8. A mutant cucumber plant has flowers that fail to open spring produced by different kinds of matings. He ob-
when mature. Crosses can be done with this plant by served the following numbers:
manually opening and pollinating the flowers with
pollen from another plant. When closed × open Offspring
crosses were done, all the F1 progeny were open. The Parents Number of mating pairs Sticky Dry
F2 plants were 145 open and 59 closed. A cross of Sticky × sticky 10 32 6
closed × F1 gave 81 open and 77 closed. How is the Sticky × dry 8 21 9
closed characteristic inherited? What evidence led Dry × dry 12 0 42
you to your conclusion?
9. In a particular population of mice, certain individuals dis- a. How is earwax type inherited?
play a phenotype called short tail, which is inherited as a b. Why are no 3:1 or 1:1 ratios present in the data
dominant characteristic. Some individuals display a reces- shown?
sive characteristic called dilute, which affects coat color.
Which of these phenotypes would be easier to eliminate 13. Imagine you have purchased a black stallion of un-
from the population by selective breeding? Why? known genotype. You mate him to a red mare, and
she delivers twin foals, one red and one black. Can
10. In humans, a dimple in the chin is a dominant charac- you tell from these results how color is inherited, as-
teristic controlled by a single gene. suming that alternative alleles of a single gene are in-
a. A man who does not have a chin dimple has volved? What crosses could you do to determine how
children with a woman with a chin dimple whose color is inherited?
mother lacked the dimple. What proportion of their 14. If you roll a die (singular of dice), what is the prob-
children would be expected to have a chin dimple? ability you will roll: (a) a 6? (b) an even number?
b. A man with a chin dimple and a woman who lacks (c) a number divisible by 3? (d) If you roll a pair of
the dimple produce a child who lacks a dimple. dice, what is the probability that you will roll two
What is the man’s genotype? 6s? (e) an even number on one and an odd number

on the other? (f) matching numbers? (g) two num-
bers both over 4?
15. In a standard deck of playing cards, four suits exist
(red suits = hearts and diamonds, black suits =
spades and clubs). Each suit has 13 cards: Ace (A),
2, 3, 4, 5, 6, 7, 8, 9, 10, and the face cards Jack (J),
Queen (Q), and King (K).
a. In a single draw, what is the probability that you
will draw a face card? A red card? A red face card?
b. Now you draw 4 cards, one at a time. After each
draw, you return the card to the deck. What is the
chance that all four cards you pick are face cards?
c. Suppose instead you draw 4 cards without return-
ing any to the deck between draws. What is the
chance that they are all face cards?
16. How many genetically different eggs could be formed
by women with the following genotypes?
a. Aa bb CC DD
b. AA Bb Cc dd
c. Aa Bb cc Dd
d. Aa Bb Cc Dd
17. What is the probability of producing a child that will
phenotypically resemble either one of the two parents
in the following four crosses? How many phenotypi-
cally different kinds of progeny could potentially
result from each of the four crosses?
a. Aa Bb Cc Dd × aa bb cc dd
b. aa bb cc dd × AA BB CC DD
c. Aa Bb Cc Dd × Aa Bb Cc Dd
d. aa bb cc dd × aa bb cc dd
18. A mouse sperm of genotype a B C D E fertilizes an
egg of genotype a b c D e. What are all the possibili-
ties for the genotypes of (a) the zygote and (b) a
sperm or egg produced by the mouse that develops
from this fertilization?
19. Your friend is pregnant with triplets. She thinks it
is equally likely she will be the mother of 3 sons,
3 daughters, 2 sons and 1 daughter, or 1 son and
2 daughters. Is she correct? Explain. (Assume that
each of the triplets is from a separate fertilization, and
that boys and girls are equally likely.)
20. Galactosemia is a recessive human disease that is
treatable by restricting lactose and glucose in the diet.
Susan Smithers and her husband are both heterozy-
gous for the galactosemia gene.
a. Susan is pregnant with twins. If she has
fraternal (nonidentical) twins, what is the
probability both of the twins will be girls who
have galactosemia?
Problems 23
b. If the twins are identical, what is the probability
that both will be girls and have galactosemia?
       For parts (c–g), assume that no twins exist among the
children.
c. If Susan and her husband have four children, what
is the probability that none of the four will have
galactosemia?
d. If the couple has four children, what is the probabil-
ity that at least one child will have galactosemia?
e. If the couple has four children, what is the proba-
bility that the first two will have galactosemia and
the second two will not?
f. If the couple has three children, what is the proba-
bility that two of the children will have galactose-
mia and one will not, regardless of order?
g. If the couple has four children with galactosemia,
what is the probability that their next child will
have galactosemia?
21. Albinism is a condition in which pigmentation is
lacking. In humans, the result is white hair, nonpig-
mented skin, and pink eyes. The trait in humans is
caused by recessive alleles. Two normal parents
have an albino child. What are the parents’ genotypes?
What is the probability that the next child will be
albino?
22. A cross between two pea plants, both of which grew
from yellow round seeds, gave the following numbers
of seeds: 156 yellow round and 54 yellow wrinkled.
What are the genotypes of the parent plants? (Yellow
and round are dominant traits.)
23. A third-grader decided to breed guinea pigs for her
school science project. She went to a pet store and
bought a male with smooth black fur and a female
with rough white fur. She wanted to study the inheri-
tance of those features and was sorry to see that the
first litter of eight contained only rough black animals.
To her disappointment, the second litter from those
same parents contained seven rough black animals.
Soon the first litter had begun to produce F2 offspring,
and they showed a variety of coat types. Before long,
the child had 125 F2 guinea pigs. Eight of them had
smooth white coats, 25 had smooth black coats, 23
were rough and white, and 69 were rough and black.
a. How are the coat color and texture characteristics
inherited? What evidence supports your
conclusions?
b. What phenotypes and proportions of offspring
should the girl expect if she mates one of the
smooth white F2 females to an F1 male?
24. The self-fertilization of an F1 pea plant produced from
a parent plant homozygous for yellow and wrinkled
24 Chapter 1   Mendel’s Principles of Heredity
seeds and a parent homozygous for green and round
seeds resulted in a pod containing seven F2 peas.
(Yellow and round are dominant.) What is the probabil-
ity that all seven peas in the pod are yellow and round?
25. The achoo syndrome (sneezing in response to bright
light) and trembling chin (triggered by anxiety) are
both dominant traits in humans.
a. What is the probability that the first child of parents
who are heterozygous for both the achoo gene and
the trembling chin gene will have achoo syndrome
but lack a trembling chin?
b. What is the probability that the first child will have
neither achoo syndrome nor trembling chin?
26. A pea plant from a pure-breeding strain that is tall,
has green pods, and has purple flowers that are termi-
nal is crossed to a plant from a pure-breeding strain
that is dwarf, has yellow pods, and has white flowers
that are axial. The F1 plants are all tall and have pur-
ple axial flowers as well as green pods.
a. What phenotypes do you expect to see in the F2?
b. What phenotypes and ratios would you predict in
the progeny from crossing an F1 plant to the dwarf
parent?
27. The following table shows the results of different
­matings between jimsonweed plants that had either
purple or white flowers and spiny or smooth pods.
Determine the dominant allele for each of the two
traits and indicate the genotypes of the parents for
each of the crosses.
Parents Offspring
Purple White Purple White
spiny spiny smooth smooth
a. purple spiny × purple spiny 94 32 28 11
b. purple spiny × purple smooth 40 0 38 0 gene normally provides. Of the two alleles Y and y,
c. purple spiny × white spiny 34 30 0 0
d. purple spiny × white spiny 89 92 31 27
e. purple smooth × purple smooth 0 0 36 11
f. white spiny × white spiny 0 45 0 16
28. A pea plant heterozygous for plant height, pod
shape, and flower color was selfed. The progeny
consisted of 272 tall, inflated pods, purple flowers;
92 tall, inflated, white flowers; 88 tall, flat pods,
purple; 93 dwarf, inflated, purple; 35 tall, flat, white;
31 dwarf, inflated, white; 29 dwarf, flat, purple;
11 dwarf, flat, white. Which alleles are dominant
in this cross?
29. In the fruit fly Drosophila melanogaster, the follow-
ing genes and alleles are known:
Wing size: recessive allele for tiny wings t; dominant
allele for normal wings T.
Eye shape: recessive allele for narrow eyes n;
dominant allele for normal (oval) eyes N.
For each of the four following crosses, give the
genotypes of each of the parents.
Male Female
Wings Eyes Wings Eyes Offspring
1 tiny oval × tiny oval 78 tiny wings, oval eyes
24 tiny wings, narrow eyes
2 normal narrow × tiny oval 45 normal wings, oval eyes
40 normal wings, narrow eyes
38 tiny wings, oval eyes
44 tiny wings, narrow eyes
3 normal narrow × normal oval 35 normal wings, oval eyes
29 normal wings, narrow eyes
10 tiny wings, oval eyes
11 tiny wings, narrow eyes
4 normal narrow × normal oval 62 normal wings, oval eyes
19 tiny wings, oval eyes
30. Based on the information you discovered in the previ-
ous problem, answer the following:
a. A female fruit fly with genotype Tt nn is mated to
a male of genotype Tt Nn. What is the probability
that any one of their offspring will have normal
characteristics for both traits?
b. What phenotypes would you expect among the off-
spring of this cross? If you obtained 200 progeny, how
many of each phenotypic class would you expect?
31. Considering the yellow and green pea color pheno-
types studied by Gregor Mendel:
a. What is the biochemical function of the protein
that is specified by the gene responsible for the
pea color phenotype?
b. A null allele of a gene is an allele that does not
specify any of the biochemical function that the
which is more likely to be a null allele?
c. In terms of the underlying biochemistry, why is the
Y allele dominant to the y allele?
d. Why are peas that are yy homozygotes green?
e. The amount of the protein specified by a gene is
roughly proportional to the number of functional
copies of the gene carried by a cell or individual.
What do the phenotypes of YY homozygotes, Yy
heterozygotes, and yy homozygotes tell us about
the amount of the Sgr enzyme (the product of
the pea color gene) needed to produce a yellow
color?
f. The Sgr enzyme is not needed for the survival of a
pea plant, but the genomes of organisms contain
many so-called essential genes needed for an indi-
vidual’s survival. For such genes, heterozygotes for
the normal allele and the null allele survive, but
Another random document with
no related content on Scribd:
The Project Gutenberg eBook of Les Peterkins
This ebook is for the use of anyone anywhere in the United States
and most other parts of the world at no cost and with almost no
restrictions whatsoever. You may copy it, give it away or re-use it
under the terms of the Project Gutenberg License included with this
ebook or online at www.gutenberg.org. If you are not located in the
United States, you will have to check the laws of the country where
you are located before using this eBook.

Title: Les Peterkins

Author: Mark Twain

Translator: François de Gaïl

Release date: December 23, 2023 [eBook #72486]

Language: French

Original publication: Paris: Mercure de France, 1910

Credits: Véronique Le Bris, Laurent Vogel and the Online Distributed

Proofreading Team at https://www.pgdp.net (This file was
produced from images generously made available by the
Bibliothèque nationale de France (BnF/Gallica))

*** START OF THE PROJECT GUTENBERG EBOOK LES

PETERKINS ***
 LES PETERKINS
DU MÊME AUTEUR
Contes choisis, traduits par Gabriel de Lautrec et précédés d’une
étude sur l’humour 1 vol.
Exploits de Tom Sawyer détective, et autres nouvelles,
traduits par François de Gail 1 vol.
Un Pari de Milliardaires, et autres nouvelles, traduits par
François de Gail 1 vol.
Le Prétendant américain, roman traduit par François de Gail 1 vol.
Plus fort que Sherlock Holmès, traduit par François de Gail 1 vol.
Le Capitaine Tempête, et autres contes, traduit par Gabriel de
Lautrec 1 vol.

MARK TWAIN

Les Peterkins
ET AUTRES CONTES

TRADUITS PAR

FRANÇOIS DE GAIL

PARIS
MERCVRE DE FRANCE
XXVI, RVE DE CONDÉ, XXVI
 MCMX

JUSTIFICATION DU TIRAGE:

Droits de traduction et de reproduction réservés pour tous pays.

TABLE
 LES PETERKINS

(D’APRÈS PEABODY HALE)

C’était bien le moment de se livrer à l’étude des langues. Les Peterkins
venaient d’entrer dans leur nouvelle maison, beaucoup plus confortable que
la précédente; ils devaient avoir la place pour toute chose et toute chose à sa
place.
Elisabeth-Elisa n’oubliait pas combien leur ancienne installation était
peu pratique; pendant longtemps, en effet, pour jouer du piano, elle avait été
obligée de s’asseoir dans la galerie de l’autre côté de la fenêtre. Mᵐᵉ
Peterkins se souvenait des difficultés qu’elle éprouvait au sujet des nappes
de table.
La nappe supérieure se trouvait dans une malle rangée contre la porte
d’une grande armoire située sous l’escalier; la nappe du dessous était
renfermée dans un tiroir de la grande armoire; de sorte que, lorsqu’il
s’agissait de changer les nappes, il fallait retirer et mettre de côté la malle
pour pouvoir ouvrir l’armoire, car on devait d’abord se servir de la nappe
du dessous; après cela, il fallait remettre en place la malle pour l’ouvrir et
en extraire la nappe supérieure.
Après tous ces déplacements, il était encore nécessaire de déplacer la
malle pour dégager la porte de l’armoire qui contenait la boîte à couteaux.
Ces déménagements successifs occasionnaient naturellement une grande
perte de temps.
Maintenant que la nouvelle maison des Peterkins était suffisamment
grande, ils trouveraient le moyen de tout loger. Agamemnon se réjouissait
surtout de l’installation de la nouvelle bibliothèque. Dans leur ancienne
maison, il n’y avait pas de pièce spéciale pour les livres: les dictionnaires
étaient au premier étage, chose fort incommode, et les volumes de
l’encyclopédie répartis en plusieurs endroits. Ainsi, les volumes de A
jusqu’à P se trouvaient au rez-de-chaussée, tandis que tous ceux de Q
jusqu’à Z étaient classés dans différentes chambres du premier étage.
Malheureusement on ne pouvait jamais se rappeler si la section de A à P
comprenait la lettre P.
—Je montais toujours au premier étage pour chercher P, disait
Agamemnon, et je m’apercevais que le volume se trouvait en bas; à chaque
instant c’était une nouvelle confusion.
Naturellement, maintenant, la nouvelle maison des Peterkins se prêtait
mieux à la vie studieuse. En ayant tous les livres dans la même pièce, on
évitait une grande perte de temps pour les chercher.
M. Peterkins suggéra à chacun des siens d’apprendre une langue
différente. S’ils voyageaient un jour à l’étranger ce serait on ne peut plus
commode: Elisabeth-Elisa pourrait parler français avec les Parisiens,
Agamemnon allemand avec les Allemands, Salomon-John italien avec les
Italiens; Mᵐᵉ Peterkins parlerait espagnol en Espagne; quant à lui, il
aborderait à la fois toutes les langues orientales en commençant par le russe.
Mᵐᵉ Peterkins n’était pas très décidée à apprendre l’espagnol; car toute
sa famille avait juré qu’elle n’irait jamais en Espagne à cause de son horreur
pour l’Inquisition. Mᵐᵉ Peterkins d’ailleurs partageait cette horreur avec ses
enfants.
Les voyages à l’étranger lui souriaient peu et elle avait toujours déclaré
qu’elle ne quitterait pas le sol natal avant qu’un pont fût jeté sur
l’Atlantique! (Or il n’en était pas encore question.) Agamemnon déclarait
qu’il ne fallait jurer de rien, que chaque jour on faisait de nouvelles
découvertes et qu’un pont ne serait assurément pas plus difficile à inventer
qu’un téléphone; dans les temps anciens on se servait déjà de ponts. La
question des professeurs vint alors sur le tapis. On pourrait certainement en
trouver à Boston. S’ils venaient tous le même jour il serait facile de
transporter trois d’entre eux dans le petit break. Agamemnon irait au-devant
d’eux, puis les reconduirait; de cette façon il s’habituerait à leur
conversation à l’aller comme au retour.
Monsieur Peterkins se documenta sur les langues orientales: on lui apprit
que le sanscrit était la base de toutes ces langues; aussi proposa-t-il à toute
sa famille de commencer par le sanscrit; ils n’auraient ainsi besoin au début
que d’un seul professeur et pourraient ensuite bifurquer sur les autres
langues.
Mais sa famille préféra apprendre des langues différentes. Elisabeth-
Elisa savait déjà un peu de français; elle avait essayé, sans grand succès,
d’en placer quelques mots à l’exposition du centenaire, mais elle s’était
aperçue qu’elle venait de lier conversation avec un Maure qui ne
comprenait pas le français.
M. Peterkins objecta qu’il leur faudrait plusieurs pièces pour leurs études
si tous les professeurs venaient à la même heure; mais Agamemnon lui fit
remarquer qu’ils se serviraient de dictionnaires différents. M. Peterkins était
d’avis qu’il vaudrait mieux avoir tous les professeurs en même temps, car
chaque élève pourrait, en plus de la langue qu’il étudierait, attraper des
bribes des autres langues; d’après lui le meilleur moyen d’apprendre à
parler une langue étrangère était d’entendre parler les autres autour de soi.
Mᵐᵉ Peterkins objecta que sa maison ressemblerait à une tour de Babel;
elle en prit cependant son parti.
Agamemnon signala une autre difficulté: naturellement il leur fallait des
professeurs étrangers qui parleraient chacun leur langue maternelle; mais,
dans ce cas, comment faire pour les inviter à venir à la maison, leur
expliquer la combinaison de la voiture, et arranger la répartition des heures
de leçon? Agamemnon se demandait comment on pouvait se tirer d’affaire
avec un étranger lorsqu’on était incapable de lui exposer ce qu’on désirait.
Elisabeth-Elisa répondit qu’en pareil cas les signes et la pantomime
devaient rendre de grands services. Salomon-John et les jeunes garçons se
mirent aussitôt à mimer. Elisabeth-Elisa expliqua que le mot «langue»
signifiait à la fois «langage et organe de la parole»; ils pouvaient donc
montrer leur langue pour se faire comprendre.
Comme exercice pratique, les jeunes garçons figurèrent les professeurs
étrangers parlant chacun leur langue maternelle; Agamemnon et Salomon-
John firent semblant de les inviter à venir instruire la famille au moyen
d’une série de signes.
M. Peterkins déclara que leur succès était admirable, et qu’ils pourraient
presque aller à l’étranger sans étudier les langues; il encouragea ses enfants
à se faire comprendre par signes. Pourtant, comme le pont n’était pas
encore construit, il vaudrait peut-être mieux attendre et cultiver les langues.
Mᵐᵉ Peterkins craignait que les professeurs étrangers ne se considérassent
comme invités au lunch: Salomon-John, en effet, n’avait cessé de montrer
sa bouche en l’ouvrant, la fermant et en sortant sa langue; il semblait plus
par là vouloir les inviter à manger que leur demander des leçons de langues.
Agamemnon suggéra qu’ils pourraient emporter avec eux les divers
dictionnaires lorsqu’ils iraient trouver les professeurs; cela exprimerait
qu’ils désiraient des leçons et les professeurs n’y verraient pas une
invitation au lunch.
Mᵐᵉ Peterkins trouvait plus prudent de préparer un lunch pour les
professeurs au cas où ils prendraient la visite pour une invitation, seulement
elle ignorait ce qu’ils mangeaient d’habitude. M. Peterkins pensa qu’il
serait très bon d’apprendre ce détail en fréquentant des étrangers, car, avant
de quitter leur pays natal, ils auraient ainsi l’occasion de s’habituer aux
plats étrangers. Les petits garçons se réjouissaient beaucoup à l’idée de
manger de nouveaux mets. Agamemnon avait entendu dire que la soupe à la
bière était le régal favori des Allemands et il se proposait, dès sa première
leçon, de s’en faire expliquer la préparation.
Salomon-John savait que tous les étrangers aiment beaucoup l’ail, aussi
pensa-t-il que les professeurs seraient enchantés de sentir une odeur d’ail
dans la maison dès leur première leçon, et qu’ils apprécieraient beaucoup
cette délicate attention.
Elisabeth-Elisa voulait faire à une de ses parentes habitant Philadelphie
la surprise de lui parler français. Aussi désirait-elle commencer ses leçons
avant la visite annuelle de sa famille de Philadelphie. Il y eut un léger retard
dans l’exécution de ces projets: M. Peterkins préférait trouver des
professeurs établis depuis peu dans la région, car il ne voulait pas subir la
tentation de parler anglais avec eux; il désirait des professeurs récemment
débarqués en Amérique, et il revint un soir chez lui avec une liste complète
des étrangers nouvellement arrivés. La famille Peterkins décida qu’elle
emprunterait aux Bromwicks leur break pour le premier jour, et M.
Peterkins et Agamemnon partirent en voiture à la ville pour ramener tous
les professeurs. L’un était un Russe, qui voyageait pour son plaisir et n’avait
nullement l’intention de donner des leçons; peut-être y consentirait-il, mais
dans tous les cas il ne savait pas un mot d’anglais.
M. Peterkins avait dans son porte-cartes les cartes des messieurs qui lui
avaient recommandé les différents professeurs; accompagné
d’Agamemnon, il alla d’hôtel en hôtel pour les convoquer. Il les trouva tous
très polis, tous prêts à venir après les explications données au moyen des
signaux convenus. Ils avaient oublié les dictionnaires, mais Agamemnon
possédait un guide qui pouvait les remplacer et qui sembla très approprié
aux étrangers.
 M. Peterkins dut se contenter d’un professeur russe, car il ne trouva
aucun maître de sanscrit nouvellement débarqué dans le pays.
Mais voici qu’une difficulté inattendue surgit lorsqu’ils mirent dans la
même voiture le professeur russe et le professeur d’arabe; ce dernier était
Turc et portait un fez sur sa tête; il s’assit au fond de la voiture! Ils se
regardèrent de travers et s’invectivèrent chacun dans leur langue sans que
M. Peterkins pût comprendre un traître mot. Etait-ce du russe, était-ce de
l’arabe? En tout cas il sautait aux yeux (ou plutôt aux oreilles) que les
individus ne voulaient à aucun prix se trouver dans la même voiture. M.
Peterkins était au désespoir; il avait oublié la guerre turco-russe! Quelle
gaffe énorme il venait de commettre en invitant le Turc!
Une foule de curieux s’était groupée devant l’hôtel. Le professeur
français pria très poliment le Russe de monter avec lui dans la première
voiture; mais une autre difficulté se présentait: le professeur allemand se
carrait tranquillement dans le fond de cette voiture!!!
Le professeur français avait à peine mis le pied sur le marche-pied qu’il
invectiva violemment le professeur allemand; ce dernier, furieux, sauta de
la voiture par la porte opposée, fit le tour en courant et le saisit au collet. A
n’en pas douter, l’Allemand et le Français ne pouvaient pas habiter
ensemble la même voiture! Pendant ce temps-là la foule des curieux
augmentait toujours.
Agamemnon, fort heureusement, savait dire en allemand le mot
«monsieur»; s’adressant au professeur allemand, il l’invita par signes à
prendre place dans l’autre voiture.
L’Allemand consentit à s’asseoir aux côtés du Turc. Enfin les voitures se
mirent en marche: M. Peterkins avait l’Italien à ses côtés, le professeur
français et le Russe étaient assis derrière et se parlaient sur un ton aigre qui
laissait supposer à M. Peterkins qu’ils n’étaient pas complètement d’accord.
Le voyage d’Agamemnon s’effectua dans un profond silence: l’Espagnol
assis à côté de lui semblait d’humeur maussade, tandis que le Turc et
l’Allemand n’échangèrent pas un traître mot.
En arrivant à la maison, ils furent reçus par Mᵐᵉ Peterkins et Elisabeth-
Elisa; par une délicate attention pour le professeur espagnol, Mᵐᵉ Peterkins
avait jeté sur ses épaules une mantille de dentelle. M. Peterkins introduisit
les professeurs dans la bibliothèque, mais il eut soin de les installer chacun
à une respectable distance l’un de l’autre. Salomon-John chercha le
dictionnaire italien et s’assit à côté du professeur italien. Agamemnon, avec
un dictionnaire allemand, se rapprocha du professeur allemand. Les jeunes
garçons montrèrent au Turc leur livre de «contes arabes». M. Peterkins
essaya d’expliquer au professeur russe qu’il ne possédait pas de dictionnaire
russe et qu’il avait espéré apprendre le sanscrit avec lui; de son côté Mᵐᵉ
Peterkins essaya de faire entendre à son professeur qu’elle n’avait pas de
livres espagnols. Elle oublia momentanément sa terreur de l’Inquisition et
essaya de lui glisser quelques mots en se servant de termes anglais
prononcés très lentement et en altérant son accent le mieux qu’elle pouvait.
L’Espagnol s’inclina, parut prendre grand intérêt à sa conversation, et se
montra très poli.
Pendant ce temps, Elisabeth-Elisa sortait au Parisien les quelques
phrases qu’elle connaissait. Elle parlait plus facilement français qu’elle ne
comprenait son professeur; lui, saisissait parfaitement ce qu’elle disait. Elle
récita son vocabulaire et ânonna l’exercice suivant: J’ai le livre.—As-tu le
pain?—L’enfant a une poire.—L’enfant sait-il sa leçon?
Le professeur écouta avec grande attention et répondit très distinctement
à chaque question. Soudain, après avoir récité une de ses phrases, elle se
leva, courut vers sa mère, et lui chuchota à l’oreille:—Ils ont, je crois,
commis l’erreur que vous redoutiez; ils se croient invités au lunch! il vient
de me remercier de notre aimable invitation à déjeuner.
—Ils n’ont pas pris leur déjeuner! s’exclama Mᵐᵉ Peterkins en regardant
l’Espagnol: il semble affamé! Qu’allons-nous faire?
Elisabeth-Elisa courut consulter son père. Qu’allaient-ils faire?
Comment leur faire comprendre qu’ils étaient invités à donner une leçon et
non au lunch? Elisabeth-Elisa pria Agamemnon de chercher le mot
«apprendre» dans le dictionnaire (apprendre devant signifier enseigner).
Hélas! ils s’aperçurent que ce mot voulait à la fois dire apprendre et
enseigner! Qu’allaient-ils faire?
Les étrangers se tenaient maintenant assis silencieux dans leur coin
respectif. L’Espagnol paraissait de plus en plus blême. Allait-il donc
s’évanouir? Le Français tortillait et effilait ses moustaches en regardant
l’Allemand. Que faire si le Russe venait à attaquer le Turc et si l’air
narquois du Parisien finissait par exaspérer l’Allemand?
—Il faut leur donner quelque chose à manger, dit M. Peterkins à voix
basse; cela les calmera.
 —Si seulement je savais ce qu’ils ont l’habitude de manger! continua
Mᵐᵉ Peterkins.
Salomon-John suggéra qu’aucun des professeurs ne savait ce que son
voisin avait l’habitude de manger: on pouvait donc leur offrir n’importe
quoi.
Mᵐᵉ Peterkins se montra plus hospitalière que son fils, et déclara
qu’Amanda pourrait préparer du bon café. M. Peterkins proposa un plat
américain. Salomon-John envoya un des jeunes garçons chercher des olives.
Bientôt on servit le café et un plat de fèves bouillies; peu après arrivèrent
les olives, le pain, des œufs à la coque et quelques bouteilles de bière.
L’effet fut prodigieux! Chaque individu se mit à parler sa propre langue
avec volubilité; Mᵐᵉ Peterkins versa du café à l’Espagnol qui s’inclina avec
grâce. Tous aimaient la bière, tous aussi les olives.
Le Français s’étendit longuement sur «les mœurs américaines».
Elisabeth-Elisa supposa qu’il faisait allusion à l’absence de nappe sur la
table. Le Turc souriait, le Russe parlait avec animation. Au milieu du
brouhaha produit par ces différentes langues, M. Peterkins répétait d’un air
navré:
—Comment leur ferons-nous donc comprendre qu’ils doivent nous
donner des leçons?
Au même instant la porte s’ouvrit et donna passage à la parente de
Philadelphie qui, arrivée le jour même, venait faire sa première visite.
En entendant le bruit tumultueux de ces différentes conversations, elle
recula d’effroi. La famille se précipita au-devant d’elle avec joie. Tous en
même temps lui demandèrent de leur servir d’interprète auprès des
professeurs. Pouvait-elle leur venir en aide? Pouvait-elle expliquer aux
étrangers qu’on attendait d’eux des leçons? Des leçons! A peine avaient-ils
prononcé ce mot que leurs hôtes se dressèrent tous comme un seul homme,
la face rayonnante de joie. C’était le seul mot anglais que tous
connaissaient. Ils étaient venus à Boston pour «donner des leçons». Le
voyageur russe espérait ainsi apprendre l’anglais. Cette idée de leçon
semblait leur plaire plus que le déjeuner. Assurément, ils donneraient bien
volontiers des leçons. Le Turc sourit à cette perspective. La glace était
rompue: les professeurs savaient maintenant qu’on attendait d’eux des
leçons.
 PERCE, MON AMI, PERCE!
I
Je prie le lecteur de vouloir bien jeter les yeux sur les vers suivants et de
me dire s’il leur trouve vraiment un caractère pernicieux:

Conducteur, quand tu reçois l’argent,

Perce, en présence du voyageur,
Un ticket bleu de dix cents,
Un ticket brun de huit cents,
Un ticket rose de quatre cents,
Perce en présence du voyageur!
(En chœur:)
Perce, mon ami, perce avec soin,
Perce, en présence du voyageur!

Je trouvai ces vers dans un journal, il y a quelque temps, et les relus deux
ou trois fois. A partir de cet instant, ils prirent possession de mon cerveau.
Pendant tout le temps du déjeuner, leur cadence se répercuta dans ma tête, si
bien qu’à la fin du repas, lorsque je roulai ma serviette, je fus incapable de
savoir si j’avais mangé ou non. La veille, je m’étais tracé mon programme
de travail pour le jour suivant: un drame poignant dans la nouvelle que
j’écris en ce moment.
Je me retirai chez moi pour composer ma tragédie; je pris ma plume,
mais mon esprit obsédé répéta comme un refrain: «Perce en présence du
voyageur.» Je luttai de toutes mes forces pendant une heure, mais ce fut
peine perdue. «Un ticket bleu de dix cents, un ticket brun de huit cents»,
etc.;—ces vers bourdonnèrent à mes oreilles sans trêve ni relâche.
C’était pour moi une journée perdue, je ne le comprenais que trop
maintenant. Je renonçai à mon travail et pris le parti de faire un tour en
ville; mais à peine sur le trottoir, je m’aperçus que mes pieds marquaient la
cadence de ces maudits vers. N’y tenant plus, je ralentis le pas; mais rien
n’y fit: le rythme de ces vers s’accommoda de ma nouvelle allure et
continua à me poursuivre.
 Je rentrai chez moi et souffris de cette obsession pendant tout le reste de
la journée; je me mis à table machinalement, et mangeai sans m’en rendre
compte; un mal de tête violent me prit, je criai d’agacement et me promenai
de long en large. Je me couchai, mais dans mon lit je ne fis que me tourner
et me retourner, poursuivi par les mêmes rimes. A minuit, devenu presque
enragé, je me levai et essayai de lire, mais à chaque ligne il me sembla que
je lisais: «Perce en présence du voyageur.» Au lever du soleil, je ne me
possédais plus, et chacun se demanda avec stupéfaction pourquoi je répétais
ce refrain idiot: «Perce, oh! perce en présence du voyageur.»

II
Deux jours plus tard, un samedi matin, je me levai plus mort que vif et
sortis pour retrouver un ami très apprécié de moi, le Révérend M., auquel
j’avais donné rendez-vous pour visiter la tour de Talcott, distante de plus de
dix milles. Mon ami me regarda sans me poser la moindre question. Nous
partîmes; suivant son habitude, M. parla comme un moulin à vent. Je ne lui
répondais pas, car je n’entendais rien. Au bout d’un mille, M. me demanda:
—«Mark, êtes-vous souffrant? Vous me paraissez aujourd’hui
terriblement abattu, hagard et distrait. Voyons, qu’avez-vous?»
D’un air lugubre, sans enthousiasme, je lui répondis: «Perce, mon ami,
perce avec soin, perce en présence du voyageur.»
Mon ami me regarda froidement, parut très perplexe et ajouta:
—Je ne saisis pas ce que vous voulez dire, Mark. Votre réponse ne
contient rien qui me paraisse particulièrement triste et pourtant la façon
dont vous venez de prononcer ces paroles, le son pathétique de votre voix
me frappent péniblement. Qu’avez-vous donc?»
Je n’entendis même pas ses paroles, absorbé par mon refrain: «Un ticket
bleu de dix cents, un ticket brun de huit cents, un ticket rose de quatre cents,
perce en présence du voyageur.» J’ignore ce qui se passa pendant les neuf
autres milles. Cependant, tout à coup, M. posa la main sur mon épaule et
s’écria:
—Oh! réveillez-vous, réveillez-vous, je vous en prie; ne dormez pas
toute la journée. Nous voici arrivés à la tour, mon cher. J’ai parlé comme
une pie-borgne pendant toute cette promenade sans obtenir de vous une
réponse; regardez donc ce magnifique paysage d’automne! Vous qui avez
voyagé, vous devez pouvoir faire des comparaisons. Voyons, donnez-moi
votre opinion, que pensez-vous de ce point de vue?
Je soupirai tristement et murmurai: «Un ticket brun de huit cents, un
ticket rose de quatre cents. perce en présence du voyageur!»
Le Révérend M. s’arrêta net et d’un air très grave me contempla des
pieds à la tête, puis ajouta:
—Mark, ceci me dépasse: les paroles que vous venez de prononcer sont
les mêmes que tout à l’heure; je ne leur trouve aucune signification spéciale
et pourtant, quand vous les prononcez, j’éprouve un pénible serrement de
cœur. «Perce, perce en...» Comment est donc la suite?
Je repris le vers depuis le commencement et lui récitai la tirade
complète. Le visage de mon ami s’illumina:
—Quelle charmante et étrange consonnance! me répondit-il, on dirait de
la musique; quel agréable rythme! Je crois avoir attrapé la cadence; voulez-
vous me répéter ces vers encore une fois et je les saurai complètement par
cœur.
Je lui redis mes vers; M. les répéta en commettant une légère erreur que
je rectifiai; après la troisième audition, il les dit parfaitement bien. A ce
moment il me sembla qu’un lourd fardeau venait de dégringoler de mes
épaules; mon cerveau se sentit débarrassé de ce torturant refrain et
j’éprouvai une profonde sensation de repos et de bien-être. Mon cœur était
si léger que je me pris à chanter pendant une demi-heure, tandis que nous
rentrions doucement chez nous. Ma langue déliée se mit à parler sans
discontinuer pendant une grande heure; les paroles coulaient de ma bouche
comme l’eau d’une fontaine. Au moment de prendre congé de mon ami, je
lui serrai la main et lui dis:
—Quelle royale promenade nous venons de faire! Mais je constate que
depuis deux heures vous ne n’avez pas adressé la parole. Voyons, parlez, à
votre tour, racontez-moi quelque chose.
Le Révérend M. jeta sur moi un regard lugubre, poussa un profond
soupir et articula machinalement: «Perce, mon ami, perce avec soin, perce
en présence du voyageur!»
J’éprouvai une cruelle angoisse et pensai en moi-même: «Mon pauvre
ami, cette fois, il le sait, ton refrain.»—Je ne vis plus le Révérend M.
pendant deux ou trois jours. Mardi soir, il apparut de nouveau devant moi et
se laissa tomber comme une masse dans un fauteuil; il était pâle, abattu,
horriblement déprimé. Levant sur moi ses yeux éteints il me dit:
—Ah! Mark, quelle horrible découverte j’ai faite en apprenant vos vers!
Ils me poursuivent comme un cauchemar nuit et jour, heure par heure, sans
la moindre trêve. Depuis que je vous ai vu, j’ai souffert mort et passion.
Appelé samedi soir, par télégramme, je pris le train de nuit pour Boston: un
de mes meilleurs amis venait de mourir et sa famille me priait de prononcer
son éloge funèbre. Je m’assis dans mon compartiment et essayai d’élaborer
le plan de mon discours. Il me fut impossible d’aller plus loin que la
première phrase, car, à peine le train venait-il de s’ébranler en faisant
entendre le monotone «clac, clac, clac» des roues, que vos vers odieux
martelèrent mes oreilles avec ce bruit de roues pour accompagnement.
Pendant une heure, je restai assis dans mon coin et prononçai une syllabe de
ces vers à chaque claquement distinct des roues.
Un violent mal de tête étreignit mon crâne; j’eus l’impression que je
deviendrais fou si je restais plus longtemps assis à ma place. Je me
déshabillai donc et gagnai ma couchette. Je m’y étendis. Vous devinez ce
qui se passa:
Clac, clac, clac, un ticket bleu—clac, clac, clac, de dix cents—clac, clac,
clac, un ticket brun—clac, clac, clac, de huit cents—etc... perce en présence
du voyageur!

III
Impossible de fermer l’œil. En arrivant à Boston j’étais fou à lier. Ne me
demandez pas comment se passèrent les funérailles. Je fis de mon mieux,
mais chacune de mes périodes graves et solennelles commença et finit
invariablement par: «perce, mon ami, perce avec soin, perce en présence du
voyageur.» Pour comble de malheur, j’adoptai dans mon éloge funèbre la
cadence ondulée de ces vers néfastes et je vis, à ma grande stupeur, les
auditeurs distraits, complètement absorbés, battre la mesure en dodelinant
de leurs stupides têtes. Vous me croirez si vous voulez, Mark, mais avant la
fin de mon discours, l’assemblée tout entière, y compris les parents du
défunt, ses amis et les indifférents, hochaient placidement la tête à l’unisson
de mes paroles.
 Lorsque j’eus fini, je m’enfuis dans la sacristie, exaspéré au plus haut
point; là je rencontrai une vieille demoiselle très âgée, tante du défunt, qui
était arrivée de Springfield trop tard pour pénétrer dans l’église. Elle me dit
en sanglotant:
—Oh! il est parti, c’est fini! Et je n’ai pas pu le voir avant sa mort.
—Oui, fis-je, il est parti, il est parti, il est parti!...
—Oh! vous l’aimiez bien, vous! Vous l’aimiez tant!
—J’aimais qui?
—Mais mon pauvre Georges, mon pauvre neveu!
—Lui! Oh! oui, certainement... certainement. «Perce, mon ami,
perce.»—Quelle misère!
—Merci, monsieur, merci pour ces bonnes paroles; sa mort me fait
tellement souffrir. Avez-vous assisté à ses derniers moments?
—Oui, je...—derniers moments de qui?
—De notre cher défunt.
—Oh! oui—oui—oui. Je le suppose.—Je le crois bien! oh! oui,
certainement j’étais là, j’étais là.
—Quelle douce consolation! Rapportez-moi ses dernières paroles. Qu’a-
t-il dit?
—Il disait, il disait (oh! ma tête, ma tête, ma pauvre tête!) il n’a cessé de
répéter: Perce, perce, perce en présence du voyageur! Oh! laissez-moi,
Madame! Au nom de ce qu’il y a de plus sacré, laissez-moi à ma folie, à ma
misère, à mon désespoir! «Un ticket brun de huit cents—un ticket rose de
quatre cents.»—Vraiment je n’y puis plus tenir!... «Perce en présence du
voyageur!»
Mon ami me regarda alors avec des yeux désespérés et me dit avec une
expression touchante:
—Mark, vous ne dites rien; vous ne me donnez pas le moindre espoir; ne
pouvez-vous donc pas m’apporter une parole de consolation? Hélas! le
temps n’est plus à l’espérance! Quelque chose me fait pressentir que ma
langue est condamnée pour toujours à répéter ce refrain macabre. Tenez, le
voici encore qui revient: «Un ticket bleu de dix cents—un ticket brun de...»
Ce murmure s’éteignit peu à peu; mon ami tomba dans une douce extase
qui apporta à ses souffrances un répit bienfaisant.
 Pour le préserver d’une entrée imminente à l’asile des aliénés, je le
conduisis à l’Université la plus proche, et là, il put décharger le pénible
fardeau de ses rimes obsédantes dans les oreilles des pauvres étudiants.
Qu’est-il arrivé à ces étudiants? Je préfère me taire et ne pas faire connaître
le triste résultat de cette transmission.
Pourquoi ai-je écrit cet article? C’est dans un but élevé et très louable;
c’est pour vous avertir, lecteurs, que si quelque jour vos yeux rencontrent
ces rimes impitoyables, vous devez les fuir plus que la peste.
 POURQUOI J’ÉTRANGLAI MA
CONSCIENCE
Je me sentais de bonne humeur, presque joyeux. J’approchai une
allumette de mon cigare et juste à ce moment on m’apporta le courrier du
matin. Sur la première enveloppe qui me tomba sous les yeux, je reconnus
une écriture qui me donna un frisson de plaisir. C’était une lettre de ma
tante Marie; cette chère tante, je l’aimais et la vénérais plus que n’importe
qui au monde. Elle avait été l’idole de mon enfance. La maturité,
d’ordinaire si fatale à certains enthousiasmes, n’avait pas été capable de
déloger ma tante de son piédestal. Pour vous donner une idée de la grande
influence qu’elle exerçait sur moi, je vous avouerai que tandis que tous les
autres s’évertuaient inutilement à me supplier de moins fumer, tante Marie
savait seule émouvoir ma conscience engourdie lorsqu’elle abordait ce sujet
délicat. Mais tout a une limite ici-bas. Un jour heureux vint enfin, où même
les admonestations de tante Marie ne surent plus m’émouvoir.
Ma tante vint passer un hiver auprès de nous et sa visite me causa un
grand plaisir. Naturellement elle me conjura d’un air très sérieux
d’abandonner ma pernicieuse habitude, mais dès qu’elle aborda ce sujet je
devins d’un calme, d’une indifférence absolus. Les dernières semaines qui
marquèrent la fin de cette mémorable visite s’écoulèrent comme un rêve
charmant et me procurèrent une paisible satisfaction. Assurément je
n’aurais pas savouré davantage mon vice favori si mon aimable bourreau
avait été lui-même un fumeur ou un zélé défenseur de cette habitude.
Eh bien! l’écriture de ma tante me rappela que j’étais très désireux de la
revoir. Je devinais facilement ce que pouvait contenir sa lettre. Je l’ouvris.
Comme je m’y attendais elle annonçait sa venue pour le jour même, par le
train du matin.
Je pensai en moi-même: «Je me sens en ce moment parfaitement
heureux et bien disposé; si mon plus implacable ennemi pouvait maintenant
se dresser devant moi, je réparerais bien volontiers les torts que j’aurais pu
avoir envers lui.»