Fish and Shellfish Immunology Reports 3 (2022) 100066

Contents lists available at ScienceDirect

Fish and Shellfish Immunology Reports

journal homepage: www.sciencedirect.com/journal/fish-and-shellfish-immunology-reports

A blend of Guava, Bitter, and Neem Leaf extracts improves haematology

and resistance to co-infection of Streptococcus agalactiae and Aeromonas
jandaie but not Liver health in Nile tilapia
E.D. Abarike *, S.O. Dandi, A. Ampofo-Yeboah
Department of Fisheries and Aquatic Resources Management, University for Development Studies, Tamale, Ghana

A R T I C L E I N F O A B S T R A C T

Keywords: Given the intense interest in the use of herbal extracts to improve fish growth, fish health, and disease resistance
Guava in fish in culture systems, in this study, we examined the effects of a blend of Guava, Bitter and Neem leaf extracts
Bitter leaf (GBNL) (i.e., 1:1:1 for GL, BL, and NL respectively) at different inclusion (i.e. 0 GBNL gkg− 1, 1 GBNL gkg− 1, 3
Neem
GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL gkg− 1 and 10 GBNL gkg− 1) levels on growth, haematology, immunity, liver
Tilapia
Aquaculture
toxicity and resistance to bacterial co-infections in Nile tilapia. After 8 weeks of feeding, Nile tilapia fed 3 GBNL
Herbs gkg− 1 diets showed significant effects in improving weight gain compared to those fed the control diet. GBNL fed
fish showed improved health of fish by stimulating significant increases in levels of White blood cells, Red blood
cells, Haemoglobin, and Haematocrit in relation to those fed the control diet. Also, the applications of deferent
GBNL levels in Nile tilapia diets showed the potential to upregulate the expression of the immune-related genes
heat shock protein 70, chicken type lysozymes, and Beta-defensin, with significant effects shown in fish fed
5GBNL gkg− 1 diets in comparison to the control. The results also indicate that GBNL supplementation can
decrease mortalities to co-infection of Streptococcus agalactiae and Aeromonas jandaie in Nile tilapia with the
lowest mortalities of 13.65% and relative per cent survival of 82.57 % in fish fed 5GBNL gkg− 1. Despite the
potential of GBNL applications in Nile tilapia, findings of this study indicate fish fed the different concentrations
of GBNL, particularly with 7 GBNL gkg− 1 can promote the leaching of the liver enzymes: alanine transaminase,
aspartate aminotransferase, and alkaline phosphate into the bloodstream which is suggestive of potential liver
damage in Nile tilapia. Histological examinations of a cross-section of the liver tissues of fish fed GBNL showed
various injuries including hydropic changes, pyknosis nuclei, erythrocytes congestion and vacuolation with the
severest seen in those fed 7 GBNL gkg− 1. Taking all of the above into consideration, 5GBNL gkg− 1 application
could improve the health and disease resistance of Nile tilapia; however, prolong use thus after 8 weeks of
administration could be injurious to fish liver health.

Introduction matters have been worsened by the occurrence of co-infections partic­

Nile tilapia, Oreochromis niloticus also known as Tilapia is an
important commercial aquaculture fish cultured in many parts of the
world. Tilapia production has gained prominence because it is highly
acceptable in the market and is easy to culture [1]. As of 2018, Tilapia
production reached about 6.532 million tons and is envisaged to reach
7.3 million tons by 2030 [2]. Despite the huge increase in production
potential, Tilapia production has been hampered by a surge in the
occurrence and proliferation of pathogenic infections [3]. Bacteria seem
the topmost among the pathogens that plague Tilapia production and
ularly, Streptococcal and Aeromonas infections [4,2].
Over the years the aquaculture industry has battled pathogenic in­
fections through many prominent strategies, for instance, the use of
antibiotics, probiotics, prebiotics, and chemotherapeutics. In recent
times, there has been the need to shift to other treatment regimens that
may be more environmentally friendly, readily available, cost-effective,
and may have other additional benefits [5]. The addition of herbal ad­
ditives in fish feeds has been purported to be biodegradable, improve
feed palatability, enhance growth, boost immunity and increase stress
and disease resistance in animals [6]. In fish, there have been reports of

* Corresponding author.
E-mail address: eabarike@uds.edu.gh (E.D. Abarike).

https://doi.org/10.1016/j.fsirep.2022.100066
Received 6 July 2022; Received in revised form 3 August 2022; Accepted 16 August 2022
Available online 18 August 2022
2667-0119/© 2022 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
E.D. Abarike et al.
positive effects of herbal supplements on growth, immune response, and
disease resistance [7,8]. This has been attributed to their antibacterial,
antifungal, antioxidant, antiviral, antiparasitic and immunosuppressive
properties [9]. Herbs such as Guava (Psidium guajava) leaves have lots of
veterinary applications, particularly in the management of diarrhoea in
livestock [10]. Bitter (Vernonia amygdalina) leaf is used in the treatment
of amoebic dysentery and gastrointestinal disorders in humans [11]. The
leaves of Neem (Azadirachta indica) have been used in treating microbial
and parasitic infections in livestock [12]. Despite the good qualities of
Guava leaves (GL), Bitter leaves (BL), and Neem leaves (NL), to the best
of our knowledge, research on many herbal supplements are based on
the use of individual species [13]. However, greater benefits could be
derived from them by combining compatible species to explore the
possibility of their synergistic effects [14]. Concerning disease resistance
tests, research on how herbal supplemented fed fish respond to
co-infections is still rudimentary.
Given the increasing interest in the use of herbal feed additives to
improve the growth and survival of fish in culture systems, in this study,
we examined the effects of a blend of GL, BL, and NL (GBNL) (i.e. 1:1:1
for GL, BL, and NL respectively) at different inclusion (i.e. 0 GBNL
gkg− 1, 1 GBNL gkg− 1, 3 GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL gkg− 1, and
10 GBNL gkg− 1) levels on growth, haematology, gene expression, liver
toxicity, and resistance to Streptococcus agalactiae and Aeromonas jandaie
co-infections in Tilapia. It is hoped that the findings of this study will
offer avenues to enable stakeholders such as fish farmers and aquacul­
ture drug and feed manufacturers to utilize these herbal extracts in
achieving the production of more resilient fish in a healthier environ­
ment and increasing food production to contribute to food security.
Materials and methods
Preparation of fish feed
Succulent GL, BL, and NL samples were collected from the environs
of the UDS-Nyankpala campus and leaf extracts were obtained using
procedures with slight modification as have been described in previous
reports [15,16,17]. Briefly, an electronic scale (Shinko Denshi scale
model: RJ-620) was used to weigh 0.5 kg of either GL or BL or NL into a
blender containing 1 litre of absolute ethanol (99%). The leaves and
ethanol were blended, and stored overnight and the solution was sieved
out using 93, 65, and 23-micron mesh to separate liquid from the fibrous
leaf materials. The filtrate (i.e. sieved leaf extracts) was heated in a
water bath at 100◦ C for 30 min to evaporate the ethanol and water and
to concentrate the crude extract which was then put into zip lock bags
and stored at 4◦ C in the refrigerator until use. To prepare the feed, ex­
tracts of GL, BL and NL were mixed in the ratio 1:1:1 respectively (i.e.
designated as GBNL) out of which 1 g, 3 g, 5 g, 7 g, and 10 g were
weighed and each added to a kilogram of powdered commercial feed (i.e
Koudijs Tilapia of composition: Crude protein (30 %), Crude fat (6 %).
crude fibre (5 %), Moisture (10 %), Ash (10 %), phosphorus (1 %),
calcium (1 %)). The feed were designated 1 GBNL gkg− 1, 3 GBNL gkg− 1,
5 GBNL gkg− 1, 7 GBNL gkg− 1, and 10 GBNL gkg− 1. 200 ml of distilled
water was added to the mixture and moulded using a manual animal
feed pelletizing machine into 2 mm pellets. The feed was designated 1
GBNL gkg− 1, 3 GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL gkg− 1, and 10 GBNL
gkg− 1 . Also, to a kilogram of commercial feed, 200 ml of distilled water
was added and similarly, moulded into pellets for use as a control diet
designated as 0 GBNL gkg− 1. Mounded pellets were dried under shade,
bagged, stored in a cool room and used until the experiment was
terminated.
Experimental set-up
Tilapia without externally observed abnormalities of an average
weight of 66.66 ± 1.3 g, were obtained from a commercial fish farm in
Tamale Metropolis, Northern Region, Ghana. The fish were distributed
2
Fish and Shellfish Immunology Reports 3 (2022) 100066
into eighteen (18) circular concrete tanks (30 fish per tank) of dimension
dimensions 90 cm in diameter and 60 cm in depth containing 3800 litres
of water and allowed to stabilize within two weeks. At the start of the
experiment, the fish were assigned at random in triplicates into six (6)
groups each for the experimental diets prepared. The experiment lasted
eight (8) weeks for the feeding trial and another two (2) weeks for a
bacterial challenge experiment. Fish were fed at a rate of 2% of body
weight daily in two equal rations with only the commercial administered
during the stabilization period and the prepared feed (test diets) given
during the experimental period. Feed rations were adjusted biweekly
after 24 h starvation and bulk weighing of the biomass per treatment
replicate. Water was constantly aerated (BOYU air compressor) and the
quality was monitored using a multiparameter water meter (Bante 900).
80% of the cultured water was renewed once every 4 weeks.
Sample measurement/collection
Growth measurement
Parameters that were assessed as indices for growth included the:
initial and final weight, weight gain, feed conversion ratio (FCR), hep­
atosomatic index (HSI), viscerosomatic index (VSI) and condition factor
(K) as have been previously described [18].
Blood and tissue sample collection
After 8 weeks of experimental feeding, blood samples from test fish
were collected as previously described [18]. Whole blood was taken
using a 2 mL disposable syringe and discharged into two different tubes
(i.e., one for haematological analysis and the other for liver toxicity test)
each containing EDTA to prevent clotting. The blood was then sent to a
Laboratory at the Tamale Teaching Hospital for determination of hae­
matological parameters including white blood cells (WBC), red blood
cells (RBC), haemoglobin (HGB), and haematocrits (HCT) and plasma
constituents (i.e., Total Protein (TP), Albumin (ALB), gamma-glutamyl
transferase (y-GT), Total bilirubin (T-BIL) and Direct bilirubin (D-BIL)
using a haematological analyzer (Urit 5250). A part of the extracted
blood was analyzed using a Roche Automated Chemical Analyzer to
determine the levels of aspartate aminotransferase (AST), alanine
transaminase (ALT), and alkaline phosphate (ALP). Liver tissues from
the same fish were collected in two portions. One portion was put into
1.5 ml Eppendorf tubes containing 1 ml of RNA later and stored at 4◦ C
for use in detecting the expression of growth hormone (GH) and
insulin-like growth factor (IGF-1) as growth-related genes and the im­
mune genes: beta-defensin (β-defensin), C-type lysozyme and heat shock
proteins (HSP) 70. Beta-actin (β-actin), a housekeeping gene was used as
an internal control gene. Primers of genes used in this study are listed in
Table 1
Primers of genes used.
Gene name Primer sequence (5′ -3′ ) Source
β-actin (housekeeping F- GenBank:
gene) AACAACCACACACCACACATTTC EF206801.1
R-TGTCTCCTTCATCGTTCCAGTTT
HSP70 F-ACCCAGACCTTCACCACCTA [19]
R- GTCCTTGGTCATGGCTCTCT
F-ATGTAGAAAGGTTTGCCTCCCA GenBank:
β-defensin
R- KJ577575.1
ACAGCCCAGAGGTCCAAAGAAC
C-type lysozyme F- [20]
AAGGGAAGCAGCAGCAGTTGTG
R-CGTCCATGCCGTTAGCCTTGAG
GH F- AGCAACGTCAGCTCAACAAA [21]
R- CGATCGGGCTGATGATGTA
IGF-1 F- GGGAAGGAACAAATGGACAA [21]
R- TTACAGTGAACCATTCCACAGG
Where: Growth hormone = GH, Insulin-like growth factor = IGF-1, Beta-actin=
β-actin, Beta-defensin = β-defensin, Chicken type lysozyme = C-type lysozyme
and Heat shock proteins 70 = HSP70
E.D. Abarike et al. Fish and Shellfish Immunology Reports 3 (2022) 100066

Table 1. The other portion of the liver was fixed in buffered formalin for i Cumulative mortality (%) = Total mortality in each treatment after
histological studies of the effects of treatments on liver integrity. challenge / Total number of fish challenged for same treatment ×
100 [21]
ii Relative per cent survival (RPS) = 1- (% of mortality in the treated
Gene expression study group) / (% of mortality in the control group) × 100 [21]

RNA isolation Statistical analysis

Total RNA derived from Tilapia liver tissues were extracted using
TRIzol0020 reagent (Transgen, China) according to the manufacturer’s
protocol. The quality of total RNA was measured spectrophotometrically
(NanoDrop 2000, Thermo Scientific) and by electrophoresis on 1%
agarose gel. First-strand cDNA from RNA of the best quality (absorbance
260/280 > 1.8 and 260/230 > 1.8) was synthesised using One-Step
gDNA removal and cDNA Synthesis SuperMix kit (Transgen, China).
RT-qPCR
The qRT-PCR assay was carried out using the AriaMx real-time PCR
System (Agilent Technologies). The amplification was carried out in a 20
μl reaction volume containing 10 μl tip-mix (Transgen, China), 0.4 μl
sense and 0.4 μl anti-sense primers, 1 μl undiluted cDNA, and 8.2 μl
double distilled water. The thermal profile for qPCR was 94◦ C for 5 min
followed by 45 cycles of 94◦ C for 30 s, 60◦ C for 30 s, and 72◦ C for 30 s.
Polymerase Chain Reaction (PCR) efficiency was determined according
to Livak and Schmittgen [19] and the relative expression of the target
genes was analyzed using the 2-△△CT method [20]. The specific
primers used for qRT-PCR are listed in Table 2.
Histological examination
Fixed liver samples of fish in buffered formalin were grossed by
resecting to measure about 2.2 cm and embedded in a cassette. Grossed
tissues were then processed using Leica TP1020 automated processor.
Tissues were put in increasing concentrations of ethanol (i.e., 70%, 80%,
90% and 100%) and clearing was done using 2 changes of xylene fol­
lowed by impregnation with molten paraffin wax (melting point 55-57
◦
C) and embedding done using SLEEMPS/P1 to form tissue blocks.
Sections of the tissue block were cut to about 4 μm using SLEE micro­
tome and thin sections transferred onto frosted slides, stained with he­
matoxylin and eosin, dried and mounted using DPX mounter. Prepared
slides were then viewed under a Leica LAS EZ microscope and photo­
graphed using an ICC50 HD camera.
Challenge test
After 8 weeks of the feeding trial, Tilapia from the respective treat­
ments were infected with Aeromonas jandaie and Streptococcus agalactiae
suspension. Bacteria were cultured, purified and resuspended in physi­
ologically buffered saline (PBS) to make concentrations of 1.0 × 105
CFUml− 1 (Manuscript in production; DOI: 10.1002/aah.10165) and 1.0
× 109 CFUml− 1 [18] for Aeromonas jandaie and Streptococcus agalactiae
respectively and then mixed to make one bacterial suspension. All test
groups were injected intraperitoneally with 0.2 ml of the mixed bacterial
suspension and observed for mortalities for 14 days. Dead fish were
examined for clinical signs and bacteria re-isolated to confirm the cause
of death. Cumulative mortality and survival were computed using the
formula:
Using SPSS (IBM SPSS STATISTICS, 16.0 package, IBM Corporation,
New York, USA) for Windows version 10 (SPSS, Chicago, USA), between
the experimental and control groups, growth parameters, haemato­
logical indices, liver toxicity parameters, and expression of growth and
immune-related genes were analyzed using one-way analysis of variance
(ANOVA). Differences in means were further analyzed using Tukey HSD
and presented as means ± standard error (SE).
Results
Growth parameters
Fish fed GBNL supplemented diets were found to have higher weight
gains, lower hepatosomatic and viscerosomatic indexes, improved
(lower) feed conversion ratio, and condition factor in comparison to
those fed the control diet. Except for fish fed 3 GBNL gkg− 1 all other
GBNL fed fish did not show significant improvement in the growth and
feed utilization variables compared to those fed the control diet (P >
0.05, Table 2).
Expression of growth-related genes
Illustrated in Fig. 1 is the effect of control and GBNL fed diets on the
expression of Insulin Growth Factor (IGF-1) and Growth Hormone (GH).
Fish fed 1, 3, and 5 GBNL gkg− 1 diets significantly upregulated the
expression of the IGF-1 gene (Fig. 1A) in comparison to those fed the
control. However, a significant difference was found only in fish fed 3
GBNL gkg− 1 compared to the other fish groups in the expression of the
GH gene (Fig. 1 B) (P < 0.05).
Haematological profiles of Tilapia
As shown in Fig. 2, it was found that the levels of White Blood Cells
[WBC] (Fig. 2A), Red Blood Cells [RBC] (Fig. 2B), Haemoglobin [HB]
(Fig. 2C), and percentage Haematocrit [HCT] (Fig. 2D) were signifi­
cantly increased in the blood of fish fed different supplemental levels of
GBNL in comparison to those fed the control diet. No significant dif­
ferences in haematological variables were observed among the GBNL fed
fish (P > 0.05).
Expression of immune-related genes
Inclusion of GBNL in diets of Nile tilapia was found to upregulate the
expression of the immune-regulated genes; heat shock protein [HSP70]
(Fig. 3A), C-type lysozymes (Fig. 3B) and Beta-defensin (Fig. 3C) relative
to the fish fed the control diet. Generally, the results indicate that the

Table 2
Growth performance and feed utilization of Nile Tilapia fed test diets.
Diets Initial weight (g) Final weight (g) Weight gain (g) VSI HSI FCR K SR(%)

0 GBNL gkg− 1 68.36 ± 2.02a 84.65 ± 3.17a 16.28 ± 1.16b 11.79 ± 0.17a 4.52 ± 0.38a 4.26 ± 0.68a 1.85 ± 0.04a 90a
1 GBNL gkg− 1 69.47 ± 1.79a 98.95 ± 4.91a 29.48 ± 3.12ab 9.92 ± 0.30a 4.32 ± 0.34a 3.49 ± 1.87a 2.24 ± 0.08a 92a
3 GBNL gkg− 1 62.14 ± 2.29a 99.22 ± 4.53a 37.07 ± 2.24a 9.31± 0.43a 4.07 ± 0.38a 1.79 ± 0.51a 2.33 ± 0.10a 90a
5 GBNL gkg− 1 67.18 ± 2.45a 97.20 ± 5.65a 30.02 ± 3.20ab 7.97 ± 0.59a 3.27 ± 0.50a 2.37 ± 0.57a 2.14 ± 0.03a 90a
7 GBNL gkg− 1 66.10 ± 1.85a 91.56 ± 3.51a 25.46 ± 1.66ab 9.29 ± 0.71a 3.88 ± 0.24a 2.66 ± 0.58a 2.12 ± 0.06a 94a
10 GBNL gkg− 1 65.14 ± 2.45 88.31 ± 4.25a 23.17 ± 1.81ab 8.72 ± 0.42a 3.35 ± 0.29a 2.86 ± 0.69a 2.15 ± 0.06a 92a

Where, VSI = viscerosomatic index; HSI = hepatosomatic index; FCR = feed conversion ratio; K = condition factor.SR= survival rate Means ± SE (Turkeys’ HSD test, n
= 3) with different superscript letters in the same column denote

3
E.D. Abarike et al. Fish and Shellfish Immunology Reports 3 (2022) 100066

Fig. 1. Comparison (mean ± SE, Turkeys’ HSD test, n = 3) of the expression of Insulin growth factor IGF-1 (graph A), and growth hormone [GH] (graph B) genes in
the head kidney of Nile Tilapia fed with control (0GBNL gkg− 1) and GBNL supplemented diets (1 GBNL gkg− 1, 3GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL gkg− 1 and 10
GBNL gkg− 1).

Fig. 2. Comparison (mean ± SE, Turkeys’ HSD test, n == 3) of White blood cells [WBC] (graph A), Red blood cells [RBC] (graph B), and Hemoglobin [HB] (graph C)
and Hemotocit [HCT] (graph D) of Nile Tilapia fed with control (0GBNL gkg− 1) and GBNL supplemented diets (1 GBNL gkg− 1, 3GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL
gkg− 1 and 10 GBNL gkg− 1).

significant upregulation of expression of these genes was noticeable in
the 5 GBNL gkg− 1 fed fish group in comparison to the other groups. It
was realized that 1, 3, 7, and 10 GBNL gkg− 1 fed fish stimulated the
upregulation of the immune genes studied in comparison to the control,
however, the pattern was not consistent.
increasing levels of GBNL in diets of fish in comparison to those fed the
control diet (Table 3). Among the GBNL fed fish, TP, ALB, and T-bill
were consistently highest in fish fed 5 GBNL gkg− 1 and those fed 7 GBNL
gkg− 1 were lowest.

Plasma components
Measured values of the total protein (TP), albumin (ALB), globulin
(GLO), and total-bilirubin (T-bill) showed an increasing trend with
Challenge test
The cumulative mortality (%) of GBNL and control fed Nile tilapia
following co-infections with the bacteria, Aeromonas jandaie and Strep­
tococcus agalactiae after 14 days of observation is shown in Fig. 4. Among

4
E.D. Abarike et al. Fish and Shellfish Immunology Reports 3 (2022) 100066

Fig. 3. : Comparison (mean ± SE, Turkeys’ HSD test, n == 3) of the expression of immune related genes; Heat shock protein (graph A), c-type lysozymes (graph B),
and Beta-defensin (graph C) in the headkidney of Nile Tilapia fed with control (0GBNL gkg− 1) and GBNL supplemented diets (1 GBNL gkg− 1, 3GBNL gkg− 1, 5 GBNL
gkg− 1, 7 GBNL gkg− 1 and 10 GBNL gkg− 1).

1
can be archived when fed with 5 GBNL gkg− compared to the other
Table 3 GBNL treatments and the control.
Effects of GBNL and control fed Nile Tilapia on plasma components.
Treatments TP ALB GLO T-bill
Liver health test
1
0 GBNL gkg− 47.00 ± 14 ± 0.38d 32.5 ± 1.06c 1.85 ± 0.04c
1.01c
1 GBNL gkg− 1
53.10 ± 23.3 ± 1.85b 33.63 ± 6.97 ± 0.98c
The ALT, AST, ALP, and y-GT are shown in Fig. 5. It was observed
4.97bc 3.34c that fish fed different levels of GBNL diets had increased the levels of
3 GBNL gkg− 1
54.30 ±3.20 24.33 ± 56.46 ± 8.62 ± 1.03b ALT, AST, ALP, and y-GT compared to the fish fed the control diet. In­
bc
0.61b 1.64a crements were most significant in the levels of these enzymes which
1
5 GBNL gkg− 78.33 ± 28.8 ± 2.43a 58.67 ± 13.42 ±
seem to have risen from 1 GBNL gkg− 1 reached a peak at 7 GBNL gkg− 1
4.03a 0.98ab 1.07ab
7 GBNL gkg − 1
52.56 ± 16.27 ± 32.97 ± 5.19 ± 0.91c and began to decrease at 10 GBNL gkg− 1.
3.55bc 0.03d 1.78c
10 GBNL 65.5 ± 4.05b 19.87 ± 49.03 ± 11.05 ±
gkg− 1 1.01c 3.03b 0.49b Histology of liver

TP = Total protein, ALB = Albumin, GLO = Globulin, T-bill = Total Bilirubin

Photomicrography of GNBL and the control fed fish of liver tissues
Means ± SE with different superscript letters in the same column denote sta­
are shown in Fig. 6. Typically, histological changes observed in the livers
tistically difference (Turkey HSD test, P < 0.05).
of test fish included: hydropic changes, erythrocytes infiltration into the
sinusoids, and pyknotic nuclei. These malformations, particularly with
the treated fish, those fed 5 GBNL gkg− 1 (13.65%) recorded the lowest
erythrocyte infiltration into the sinusoids, seem to increase in severity
cumulative mortality whilst that fed 1 GBNL gkg− 1 (31.06%) was found
with increasing GBNL levels reaching their peak in 7 GNBL gkg− 1 and
to have the highest mortality. That notwithstanding, there were no
seem to have declined slightly in 10 GNBL gkg− 1 compared to the
significant differences in cumulative mortalities among GBNL fed groups
control.
(P > 0.05). In contrast, it was observed that fish fed GBNL diets showed
significantly lower cumulative mortality compared to those fed the
Discussions
control (P < 0.05) diet. Relative present survival computed showed the
order 0.00 %, 60.35%, 68.08 %, 70.99 %, 75.63 %, and 82.57 % for
Studies on the application of a blend of medicinal herbs and their
0 GBNL gkg− 1, 1 GBNL gkg− 1, 3 GBNL gkg− 1, 7 GBNL gkg− 1, 10 GBNL
extracts in sustainable aquaculture have been shown to markedly
gkg− 1, and 5 GBNL gkg− 1 respectively. These results suggest that
improve growth performance in cultured fish due to synergistic effects
significantly higher survival against bacterial infection in Nile tilapia
and improve feed utilization [22]. The present investigation revealed

5
E.D. Abarike et al. Fish and Shellfish Immunology Reports 3 (2022) 100066

Fig. 4. Cumulative mortality (%) of Nile Tilapia, Oreochromis niloticus fed different doses of with control (0GBNL gkg− 1) and GBNL supplemented diets (1 GBNL
gkg− 1, 3GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL gkg− 1, and 10 GBNL gkg− 1) after 14 days post-challenge with Aeromonas jandaie and Streptococcus agalactiae. Each line
graph represents the mean ± SE of three biological replicates (n == 3).

Fig. 5. Comparison (mean ± SE, Turkeys’ HSD test, n == 3) of the enzymes levels of Alanine transaminase (graph A), Aspartate transaminase (graph B), Alkaline
phosphatase (graph C) and Gamma-glutamyltransferase (graph D) in whole blood of Nile Tilapia fed with control (0GBNL gkg− 1) and GBNL supplemented diets (1
GBNL gkg− 1, 3GBNL gkg− 1, 5 GBNL gkg− 1, 7 GBNL gkg− 1 and 10 GBNL gkg− 1).

that GBNL supplementation in the diets of Nile tilapia could contribute upregulation of the growth hormone (GH) and insulin-like growth fac­
to increased weight gain and condition factor and lower feed conversion tor, I (IGF-I) genes which play key roles in regulating fish growth [5].
ratio in Nile tilapia. The observed significant increase in weight gain in Reasons, why the other GBNL treatments did not significantly improve
fish fed 3 GBNL gkg− 1 diets can be attributed to the significant growth, might be attributed to insufficient upregulation in the

6
E.D. Abarike et al.
Fig. 6. Black arrows (erythrocyte infiltration/congesstion of sinusoids), Red arrows (pyknosis of nuclei), Yellow arrow (hydropic change), Purple (Vacuolation). (For
interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
expression of growth-related genes such as IGF-1 and GH genes and
slightly higher FCRs [23]. Improvements in growth performance and
feed utilization have been reported in Nile tilapia [24,25,26], European
eel [27] and Common Carp [28], fed a mixture of herbal extracts and in
Nile tilapia [18] fed a mixture of herbal extracts with probiotic, bacillus.
In addition, it was found that the GBNL application did not present any
adverse effects on fish survival compared to those in the control group.
Similar results have been reported in Nile tilapia fed Basella alba leaf
ethanol extract, Tribulus terrestris seed ethanol extract, Mucuna pruriens
seed methanol extract, and Asparagus racemosus root methanol extract
[29].
Fish health is now increasingly monitored using haematological
variables such as red blood cells (RBC), white blood cells(WBC), hae­
moglobin (Hb), and haematocrit (Hct) [30]. WBC in blood help with
immune responses in an organism; Hb plays a critical role in meta­
bolism; RBC determines the status of oxygen delivery to tissues in the
organism; and haematocrit (Ht) determines the volume of RBC [31]. In
this experiment, we observed that fish fed the control diet showed
normality of haematological variables reported in cultured Nile tilapia
[32]. This suggests the experimental conditions did not impart adversely
on the normal physiology of Nile tilapia. Our results indicate that fish
fed GBNL can improve the health of fish by stimulating significant in­
creases in levels of WBC, RBC, Hb, and Hct in relation to those fed the
control diet. It is believed that the presence of metabolites such as fla­
vonoids, tannins, polyphenols and other bioactive compounds in GBNL
[33,34,35] accounts for the triggered immunostimulation [36]. It was
noticed that increased levels of haematological variables in Nile tilapia
by the application of GBNL did not differ in a dose range between 1 and
10 gkg− 1. The dynamics of different application levels of GBNL are far
from being understood and may merit further investigation.
In the present investigation, it has been found that fish fed GBNL has
significant improvement in TP, ALB, GLO, and T-bill compared to the
control implying an improvement in the immune response in fish [37]
7
Fish and Shellfish Immunology Reports 3 (2022) 100066
explaining the low cumulative mortalities observed in GBNL fed fish
after challenge with pathogens. Generally, our findings suggest that for
optimal performance, the 5 GBNL gkg− 1 application would be the best
choice because it showed better performance compared to the others
and the control. Similarly, the Common carp [28], and the African
catfish [38] fed a blend of herbal extracts were reported to have showed
significant improvement in the above-mentioned biochemical indices.
Knowledge of the expression of immune gene-related in fish is a vital
tool to clarify information on the mode of action of the application of
herbal supplements in aquaculture [5]. Upregulation in the expression
of HSP70 [39], Chicken type-lysozymes (c-type lysozymes) [40] and
Beta-defensins [41] improves the antioxidant ability of cells, innate
immune systems and modulation of immune activities following
administration of immunostimulants. Our findings suggest that the
application of GBNL has the potential to upregulate the expression of
HSP70, c-type lysozymes and Beta-defensin in Nile tilapia, with signif­
icant effects with the dose application of 5gkg− 1 in which the expression
of immune-regulated genes seem to have reached their peak and
declined afterwards. Significant upregulation of these immune-related
genes perhaps supported GBNL fed fish to have improved resistance to
pathogens used in the challenge test hence could explain the low cu­
mulative mortalities recorded. In line with other results, significant in­
creases in the expression of lysozymes following exposure to Azadirachta
indica, and Zingiber officinale among others on Catfish, Pangasianodon
hypophthalmus leukocytes have been reported [42]. Also, a mixture of A.
membranaceus, A. sinensis, and C. hupehensis was found to induce the
expression of HSP 70 in Nile tilapia [43] and the application of Acan­
thopanax senticosus have been reported to modulate the expression of
lysozyme and Beta-defensin in mice [44] and ultimately low commu­
nicative mortalities after pathogen challenge tests.
The efficiency of herbs fed to fish to increase their resistance to mi­
crobial infection could be evaluated in an artificial infection test with a
target pathogen [45]. The results indicate that GBNL supplementation
E.D. Abarike et al.
can decrease mortalities and increase the RPS up to 82.57 % (i.e. with 5
GBNL gkg− 1 feed supplementation) to co-infection of Streptococcus
agalactiae and Aeromonas jandaie in Nile tilapia. This could be a
consequence of the increased synthesis of haematological variables and
expression of immune-related genes in fish exposed to GBNL feed as
have been explained earlier [46]. Also, synergies of bioactive com­
pounds in a blend of herbal extracts can promote the stimulation of the
secretion of immunological substances which can inhibit the growth of
harmful pathogens and promote health benefits to the host [26]. In other
reports, herbal extracts used singly or in combinations have been re­
ported to decrease mortality in fish against many pathogens [24,7,47].
AST, ALT, ALP, and Gamma-glutamyltransferase (GGT) enzymes are
haematological variables clinically measured as biomarkers for liver
health [48]. AST helps metabolize amino acids; ALT helps convert
proteins into energy for the liver cells; ALP is important for breaking
down proteins; GGT breaks down and changes moving proteins. The
findings of the study indicate fish fed the different concentrations of
GBNL can promote the leaching of these liver enzymes into the blood­
stream suggestive of potential liver damage in Nile tilapia. The levels of
these liver enzymes increase with increasing concentrations reaching a
peak at 7 g GBNL gkg-1 and then begins to decline. Higher levels of these
enzymes in the blood examined were further supported by the histo­
pathological results in the study where generally more pathological
conditions were observed in a cross-section of the liver tissues examined.
The rise in the levels of these liver enzymes might be due to increased
metabolism to mitigate the induced stress or insufficient detoxification
of GBNL by the fish liver. Despite the potential damage due to the
elevation of liver enzymes in the bloodstream of Nile tilapia, mortality
was null in all GBNL treatments. A possible explanation could be drawn
from [49] who explained that the toxic effects of herbs on fish become
lesser after a certain period of exposure when the fish gains tolerance to
the concentrations administered. Nonetheless, GBNL use in fish culture
should be done with caution, mindful of the fact that prolonged use thus
after 8 weeks of administration could be injurious to fish health. Few
investigations have reported elevated levels of liver enzymes, for
instance, ALT, AST, and ALP spiked up in Indian Major Carp, Cirrhinus
mrigala when fed with herbals leave extract [50].
Conclusion
These research findings have shown that the application of GBNL
extracts in Nile tilapia culture can improve weight gain significantly
with the inclusion of 3 gkg− 1. Application of 1, 3, 5, 7, and 10 gkg− 1
GBNL can significantly increase haematological variables and
biochemical indices and resistance to diseases such as co-infections of
Streptococcus agalactiae and Aeromonas jandaie in Nile tilapia but with
the best results obtainable with the application of 5 gkg− 1 of GBNL. It
has been found that the application of GBNL can be injurious to the liver
in Nile tilapia after 8 weeks of administration through increase the
leaking of liver enzymes. Therefore, the level of these liver enzymes
could be used as biomarkers of GBNL leaf extracts application to
determine its toxicity to Nile tilapia in the field of environmental
biomonitoring.
Authors’ contributions
E.D. Abarike conceived the idea and designed the experiment,
collected and analyzed data and drafted the manuscript. A. Ampofo-
Yeboah, edited and proofread the manuscript. S.O. Dandi assisted in
laboratory and field experiments.
Animal rights
All fish were handled in accordance with the U.K animal act, 1986
and associated guidelines, EU Directive 2010/63/EU for animal exper­
iments. Hormonal sex reversed Nile tilapia were used in the experiment.
8
Fish and Shellfish Immunology Reports 3 (2022) 100066
Compliance with ethical standards Submission declaration and
verification
This article to be considered for publication has not been published
previously and is not under consideration for release elsewhere.
Funding
The study was supported by the International Foundation for Science
of grant number I2-A-6542-1
Data availability statement
Data will be available on request from the corresponding author
Declaration of Competing Interest
The authors declare there is no conflict of interest.
Acknowledgments
The authors wish to thank International Foundation for Science for
supporting us with funds to carry out this study. We appreciate the effort
of the Dean, Faculty of Biosciences, UDS Prof Elliot H. Alhassan and the
Head, Department of Fisheries and Aquatic Resources Management,
UDS Dr. Daniel N. Akongyuure for facilitating the release of funds for
project execution. We are also indebted to Dr. Abass Abdul-Karim, the
Head, Public Health Laboratory, Tamale Teaching Hospital for
providing us with laboratory space for gene expression analysis. Also,
we are grateful to Associate Professor, Edmund Muonir Der, the Head,
Department of Pathology, UDS for assisting in histological analysis of
tissues.
References
[1] E.D. Abarike, E.A. Obodai, F.Y.K. Attipoe, Growth and economic performance of
fingerlings of Oreochromis niloticus fed on different non-conventional feeds in out-
door hapas at Akosombo in Ghana, Afr. J. Agric. 8 (2013) 3384–3391, https://doi.
org/10.5897/AJAR12.593.
[2] M.S. Monir, S.B.M. Yusoff, Z.B.M. Zulperi, H.B.A. Hassim, A. Mohamad, M.S.B.M.
H. Ngoo, M.Y. Ina-Salwany, Haemato-immunological responses and effectiveness
of feed-based bivalent vaccine against Streptococcus iniae and Aeromonas hydrophila
infections in hybrid red tilapia (Oreochromis mossambicus × Oreochromis niloticus),
BMC Vet. Res. 16 (2020) 1–14, https://doi.org/10.1186/s12917-020-02443-y.
[3] M. Dioguardi, F.A. Guardiola, M. Vazzana, A. Cuesta, M.A. Esteban, M. Cammarata,
Vitamin D3 affects the innate immune status of European sea bass (Dicentrarchus
labrax L.), Fish Physiol. Biochem. 43 (2017) 1161–1174, https://doi.org/10.1007/
s10695-017-0362-3.
[4] L. Basri, M.R. Nor, A. Salleh, I.M.S. Yasin, M.Z. Saad, N.Y.A. Rahaman, T. Barkham,
Mohammad Noor, A. Amal, Co-infections of Tilapia Lake Virus, Aeromonas
hydrophila and Streptococcus agalactiae in farmed Red Hybrid Tilapia, Animals 10
(2020), https://doi.org/10.3390/ani10112141.
[5] E. Ahmadifar, H.P. Fallah, M. Yousefi, A.O.Dawood Mahmoud, H.A. Seyed Hossein
Hoseinifar, S. Yilmaz, M. Paolucci, H. Doan Van, The gene regulatory roles of
herbal extracts on the growth,immune system, and reproduction of fish, Animal 11
(2021) 1–24, https://doi.org/10.3390/ani11082167.
[6] H.Van Doan, S.H. Hoseinifar, S. Jaturasitha, M.A.O. Dawood, R. Harikrishnan, The
effects of berberine powder supplementation on growth performance, skin mucus
immune response, serum immunity, and disease resistance of Nile tilapia
(Oreochromis niloticus) fingerlings, Aquaculture 520 (2020), 734927, https://doi.
org/10.1016/j.aquaculture.2020.734927.
[7] N.N. Gabriel, Review on the progress in the role of herbal extracts in Tilapia
culture, Cogent Food Agric 5 (2019), https://doi.org/10.1080/
23311932.2019.1619651.
[8] N. Van Hai, The use of medicinal plants as immunostimulants in aquaculture: a
review, Aquaculture (2015), https://doi.org/10.1016/j.aquaculture.2015.03.014.
[9] E. Yilmaz, O. Taşbozan, C. Erbaş, Potential of medicinal herbal products to be used
in aquaculture, Int. J. Sci. Eng. Res. 9 (2018) 16–23.
[10] P.G. Daswani, M.S. Gholkar, T.J. Birdi, Psidium guajava : a single plant for multiple
health problems of the rural Indian population, Pharmacogn. Rev. 11 (2017)
167–174, https://doi.org/10.4103/phrev.phrev.
[11] E.O. Farombi, O. Owoeye, Antioxidative and chemopreventive properties of
Vernonia amygdalina and Garcinia biflavonoid, Int. J. Environ. Res. Public Health 8
(2011) 2533–2555, https://doi.org/10.3390/ijerph8062533.
E.D. Abarike et al.
[12] A. Tibebu, G. Haile, A. Kebede, Review on medicinal value and other application of
Neem tree: senior seminar on animal health, Biomed. Nurs. 4 (2018) 62–69,
https://doi.org/10.7537/marsbnj040118.10.
[13] F.K.A. Kuebutornye, E.D. Abarike, The contribution of medicinal plants to tilapia
aquaculture: a review, Aquac. Int. 28 (2020), https://doi.org/10.1007/s10499-
020-00506-3.
[14] R. Cerezuela, F.A. Guardiola, P. González, J. Meseguer, M.Á. Esteban, Effects of
dietary Bacillus subtilis, Tetraselmis chuii, and Phaeodactylum tricornutum, singularly
or in combination, on the immune response and disease resistance of sea bream
(Sparus aurata L.), Fish Shellfish Immunol. 33 (2012) 342–349, https://doi.org/
10.1016/j.fsi.2012.05.004.
[15] S. Banerjee, M.L. Kim, M. Shariff, H. Khatoon, M.F. Yusoff, Antibacterial Activity of
Neen (Azadirachta indica) leaves on Vibro spp. isolated from cultured Shrimps,
Assiian J. Anim. Vet. Adv. 8 (2013) 355–361, https://doi.org/10.3923/
ajava.2013.355.361.
[16] B. Biswas, K. Rogers, F. McLaughlin, D. Daniels, A. Yadav, Antimicrobial activities
of leaf extracts of Guava (Psidium guajava L.) on two gram-negative and gram-
positive bacteria, Int. J. Microbiol. 2013 (2013), https://doi.org/10.1155/2013/
746165.
[17] T. Olowolafe, O. Mo, Toxicity of aqueous extracts of bitter leaf (Vernonia
amygdalina) on haematological profile of African catfish (Clarias gariepinus)
juveniles, Int. J. Fish. Aquat. Stud. 6 (2018) 596–600.
[18] E.D. Abarike, J. Jian, J. Tang, J. Cai, H. Yu, C. Lihua, L. Jun, Influence of traditional
Chinese medicine and Bacillus species (TCMBS) on growth, immune response and
disease resistance in Nile tilapia, Oreochromis niloticus, Aquac. Res. 49 (2018)
2366–2375, https://doi.org/10.1111/are.13691.
[19] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2-ÄÄCT method, Methods 25 (2001) 402–408,
https://doi.org/10.1006/meth.2001.1262.
[20] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C T
method, Nat. Protoc. 3 (2008) 1101–1108, https://doi.org/10.1038/
nprot.2008.73.
[21] M. Saiyad Musthafa, S.M. Asgari, A. Kurian, P. Elumalai, A.R. Jawahar Ali, B.
A. Paray, M.K. Al-Sadoon, Protective efficacy of Mucuna pruriens (L.) seed meal
enriched diet on growth performance, innate immunity, and disease resistance in
Oreochromis mossambicus against Aeromonas hydrophila, Fish Shellfish Immunol. 75
(2018) 374–380, https://doi.org/10.1016/j.fsi.2018.02.031.
[22] F.I. Magouz, M.T. Shehab El-Din, A.A. Amer, M.S. Gewaily, W.A. El-Dahdoh, M.A.
O. Dawood, A blend of herbal essential oils enhanced the growth performance,
blood bio-immunology traits, and intestinal health of Nile tilapia (Oreochromis
niloticus), Ann. Anim. Sci. 22 (2022) 751–761, https://doi.org/10.2478/aoas-
2021-0066.
[23] M. Aanyu, M.B. Betancor, O. Monroig, Effects of dietary limonene and thymol on
the growth and nutritional physiology of Nile tilapia (Oreochromis niloticus),
Aquaculture 488 (2018) 217–226, https://doi.org/10.1016/j.
aquaculture.2018.01.036.
[24] E.D. Abarike, J. Jian, J. Tang, J. Cai, H. Yu, L. Chen, Traditional Chinese Medicine
enhances growth, immune response, and resistance to Streptococcus agalactiae in
Nile tilapia, J. Aquat. Anim. Health 31 (2019) 46–55, https://doi.org/10.1002/
aah.10049.
[25] A.A.M. Hassan, M.H. Yacout, M.S. Khalel, S.H.A. Hafsa, M.A.R. Ibrahim, D.
N. Mocuta, A. Turek Rahoveanu, L. Dediu, Effects of some herbal plant
supplements on growth performance and the immune response in Nile tilapia
(Oreochromis niloticus). “Agriculture Life, Life Agric, Conf. Proc. 1 (2018) 134–141,
https://doi.org/10.2478/alife-2018-0020.
[26] L. Poolsawat, Y. Yu, X. Li, X. Zhen, W. Yao, P. Wang, C. Luo, X. Leng, Efficacy of
phytogenic extracts on growth performance and health of tilapia (Oreochromis
niloticus × Oreochromis aureus), Aquac. Fish. 7 (2022) 411–419, https://doi.org/
10.1016/j.aaf.2020.08.009.
[27] Z. Huang, J. Lu, Y. Ye, A. Xu, Z. Li, Effects of dietary Chinese herbal medicines
mixture on growth performance, digestive enzyme activity and serum biochemical
parameters of European eel, Anguilla anguilla, Aquac. Rep. 18 (2020), 100510,
https://doi.org/10.1016/j.aqrep.2020.100510.
[28] M. Raissy, H. Ghafarifarsani, S.H. Hoseinifar, E.R. El-Haroun, S. Shahbazi
Naserabad, H. Van Doan, The effect of dietary combined herbs extracts (oak acorn,
coriander, and common mallow) on growth, digestive enzymes, antioxidant and
immune response, and resistance against Aeromonas hydrophila infection in
common carp, Cyprinus carpio, Aquaculture 546 (2022), 737287, https://doi.org/
10.1016/j.aquaculture.2021.737287.
[29] I. Ghosal, D. Mukherjee, S.B. Chakraborty, The effects of four plant extract on
growth, sex reversal, immunological and haemato-biochemical parameters in Nile
tilapia, Oreochromis niloticus (Linnaeus, 1758), Aquac. Res. 52 (2021) 559–576,
https://doi.org/10.1111/are.14914.
[30] M. Maftuch, Haematological Analysis of Nile tilapia (Oreochromis niloticus) and
Striped Catfish (Pangasius hypophthalmus) using hematology analyzer tool software
at Fish Breeding Center Jojogan, Tuban, East Java, Res. J. Life Sci. 5 (2018)
107–115, https://doi.org/10.21776/ub.rjls.2018.005.02.4.
[31] M. Esmaeili, Blood performance: a new formula for fish growth and health, Biology
10 (2021) 1–17, https://doi.org/10.3390/biology10121236.
Fish and Shellfish Immunology Reports 3 (2022) 100066
[32] T.C. Hrubec, J.L. Cardinale, S.A. Smith, Haematology and plasma chemistry
reference intervals for cultured Tilapia (Oreochromis Hybrid), Vet. Clin. Pathol. 29
(2000) 7–12, https://doi.org/10.1111/j.1939-165X.2000.tb00389.x.
[33] M.S. Nagano, C. Batalini, Phytochemical screening, antioxidant activity and
potential toxicity of Azadirachta indica A. Juss (neem) leave, Rev. Colomb. Ciencias
Quim. 50 (2021) 29–47, https://doi.org/10.15446/rcciquifa.v50n1.95447.
[34] S. Naseer, S. Hussain, N. Naeem, M. Pervaiz, M. Rahman, The phytochemistry and
medicinal value of Psidium guajava (Guava), Clin. Phytosci. 4 (2018) 1–8.
[35] E.A. Ugbogu, O. Emmanuel, E.D. Dike, G.O. Agi, O.C. Ugbogu, C. Ibe, E.J. Iweala,
The phytochemistry, ethnobotanical, and pharmacological potentials of the
medicinal plant Vernonia amygdalina L. (bitter Leaf), Clin. Complement. Med.
Pharmacol. 1 (2021), 100006, https://doi.org/10.1016/j.ccmp.2021.100006.
[36] H. Syawal, R. Kurniawan, I. Effendi, B. Austin, Fermented medicinal herbs improve
the haematological and physiological profile of Striped catfish (Pangasianodon
hypophthalmus), F1000Research 466 (2021), https://doi.org/10.12688/
f1000research.52640.2.
[37] U. Oniovosa, O. Aina, S. Alarape, O. Babalola, O. Adeyemo, Effects of neem leaves
aqueous extract on organ histology, haematological parameters and biochemical
indices in catfish, Alex. J. Vet. Sci. 54 (2017) 17, https://doi.org/10.5455/
ajvs.256015.
[38] F.J. Fawole, R.O. Yisa, O.O. Jayeoba, I. Adeshina, A.O. Ahmed, B.O. Emikpe, Effect
of Dietary polyherbal mixture on growth performance, haemato-immunological
indices, antioxidant responses, and intestinal morphometry of African Catfish,
Clarias gariepinus, Aquac. Nutr. 2022 (2022) 1–11, https://doi.org/10.1155/2022/
5502796.
[39] S. Daneghian, R. Amani, S.A. Hosseini, P. Ghandil, A. Jafari, A.S. Malehi, Effect of
herbal antioxidant‑rich formula on the improvement of the antioxidant defence
system and heat shock protein‑70 expression in recreational female athletes: a
randomized controlled trial, J. Res. Med. Sci. 24 (2019), https://doi.org/10.4103/
jrms.JRMS.
[40] C. Zhou, H. Lin, Z. Huang, J. Wang, Y. Wang, W. Yu, Molecular characterization of
G-type lysozyme from juvenile golden pompano Trachinotus ovatus and the
regulation of its activity and expression by dietary sodium butyrate levels, Aquac.
Rep. 14 (2019), 100198, https://doi.org/10.1016/j.aqrep.2019.100198.
[41] C. Barroso, P. Carvalho, J.F.M. Gonçalves, P.N.S. Rodrigues, J.V. Neves,
Antimicrobial peptides: Identification of two beta-defensins in a teleost fish, the
European sea bass (Dicentrarchus labrax), Pharmaceuticals 14 (2021) 1–16, https://
doi.org/10.3390/ph14060566.
[42] T.Q. Nhu, B.T. Bich Hang, A. Vinikas, L.T. Bach, B.T. Buu Hue, D.T. Thanh Huong,
J. Quetin-Leclercq, M.L. Scippo, N.T. Phuong, P. Kestemont, Screening of immuno-
modulatory potential of different herbal plant extracts using striped catfish
(Pangasianodon hypophthalmus) leukocyte-based in vitro tests, Fish Shellfish
Immunol. 93 (2019) 296–307, https://doi.org/10.1016/j.fsi.2019.07.064.
[43] E.D. Abarike, J. Jian, J. Tang, J. Cai, E.M. Sakyi, F.K.A. Kuebutornye, A mixture of
Chinese herbs and a commercial probiotic Bacillus species improves hemato-
immunological, stress, and antioxidant parameters, and expression of HSP70 and
HIF-1α mRNA to hypoxia, cold, and heat stress in Nile tilapia, Oreochromis niloticus,
Aquac. Rep. 18 (2020), 100438, https://doi.org/10.1016/j.aqrep.2020.100438.
[44] Y.Q. Zhang, Y.L. Zhang, Z.K. Liu, Effects of Acanthopanax senticosus
supplementation on innate immunity and changes of related immune factors in
healthy mice, Innate Immun. 27 (2021) 461–469, https://doi.org/10.1177/
1753425920955200.
[45] E. Awad, D. Austin, A. Lyndon, A. Awaad, The possible effect of hala extract
(Pandanus tectorius) on immune status, anti-tumour and resistance to Yersinia
ruckeri infection in rainbow trout (Oncorhynchus mykiss), Fish Shellfish Immunol.
87 (2019) 620–626, https://doi.org/10.1016/j.fsi.2019.02.012.
[46] A.M. Tiamiyu, I.O. Olatoye, O.A. Olayemi, T.C. Ekundayo, O.B. Adedeji, R.
C. Okocha, Medicinal plant feed additives enhanced survivability and growth
performance of Clarias gariepinus (African Catfish) against bacterial infection,
Microbiol. Res. 12 (2021) 744–752, https://doi.org/10.3390/
microbiolres12040054.
[47] D. Stratev, G. Zhelyazkov, X.S. Noundou, R.W.M. Krause, Beneficial effects of
medicinal plants in fish diseases, Aquac. Int. 26 (2018) 289–308, https://doi.org/
10.1007/s10499-017-0219-x.
[48] A. Rastiannasab, S. Afsharmanesh, R. Rahimi, I. Sharifian, Alternations in the liver
enzymatic activity of Common carp, Cyprinus carpio in response to parasites,
Dactylogyrus spp. and Gyrodactylus spp, J. Parasit. Dis. 40 (2016) 1146–1149,
https://doi.org/10.1007/s12639-014-0638-9.
[49] J.S. Doctolero, E.S. Estrella, E.M. Vera Cruz, Influence of Water Immersion using
Guava (Psidium guajava), Lemon-Grass (Cymbopogon citratus) and Horse Radish
(Moringa oleifera) aqueous leaves extracts on the nursing of Nile tilapia
(Oreochromis niloticus), Int. J. Zool. Anim. Biol. 4 (2021) 1–8, https://doi.org/
10.23880/izab-16000279.
[50] M. Saravanan, M. Ramesh, A. Malarvizhi, R. Petkam, Toxicity of neem leaf extracts
(Azadirachta indica A. Juss) on some haematological, ionoregulatory, biochemical
and enzymological parameters of Indian Major carp, Cirrhinus mrigala, J. Trop. For.
Environ. 1 (2011), https://doi.org/10.31357/jtfe.v1i1.80.