Virus Research 324 (2023) 199026

Contents lists available at ScienceDirect

Virus Research

journal homepage: www.elsevier.com/locate/virusres

A novel virus in the amily Marnaviridae as a potential pathogen o Penaeus

vannamei glass post-larvae disease
Ailan Xu b, 1, Shan Xu a, 1, Qihang Tu a, 1, Huanao Qiao a, 1, Wei Lin a, Jing Li a, Yugan He a,
Tie Xie a, Lingting Pan c, Qiang Pan d, Yunwei Zhao b, *, Xin Su a, *, Yigang Tong a, *
a
College o Lie Science and Technology, Beijing University o Chemical Technology, No. 15 Beisanhuan East Road, Chaoyang, Beijing 100089, China
b
The First Aliated Hospital o Jiamusi University, 348 Dexiang Street, Jiamusi, Heilongjiang 154003, China
c
Ningbo University, Ningbo 315211, China
d
Qingdao Nuoanbaite Biotechnology Co., China

A R T I C L E I N F O A B S T R A C T

Keywords: As an aquatic animal o great commercial relevance, Penaeus vannamei is currently the dominant species o
Marnaviridae cultured shrimp in China and many other countries worldwide. In recent years, the outbreak o glass post-larvae
P. vannamei disease (GPD), which accounts or more than 90% o the mortality o shrimp seedlings in serious cases, in many
Baishivirus
regions o China has caused signicant losses and threatened the sustainability o the aquaculture industry and
Genome analysis
Phylogenetic analysis
the economy. It is extremely urgent to determine the inectious agent o GPD in P. vannamei. In this work, we
perormed metagenomic sequencing o glass post-larvae collected rom diseased prawns in Tangshan Hebei,
where GPD broke out recently. An evolutionary tree was constructed by MEGA 7 to understand the evolutionary
history and relationship o the pathogen genome. A novel virus in the amily Marnaviridae was rst identied in
P. vannamei suering rom GPD, and we tentatively named this virus Baishivirus (GenBank: ON550424). The
identied pathogen was validated according to Koch’s rule with a pathogenic challenge assay and reverse
transcription-polymerase chain reaction. There was only 8% query coverage with 64.96% identity in the
Baishivirus genome when compared with its most closely related genome sequence o Wenzhou picorna-like virus
21 reported in 2016. Baishivirus genomic RNA is 9.895 kb in length and encodes three potential open reading
rames (ORFs). The identication o Baishivirus in P. vannamei enriches the amily Marnaviridae and potentially
provides a new candidate to study and prevent GPD in the aquaculture industry.

1. Introduction
P. vannamei arming is an important part o aquaculture, which
greatly contributes to the development o the global economy. The
major producers include China, India, Ecuador, Indonesia and Vietnam
(Fig. 1A) (https://www.ao.org/ishery/zh/culturedspecies/litopena
eus_vannamei/en). In 2020, global P. vannamei production was esti-
mated at 5.82 million tons, and the annual growth rate declined by
2.15%. Disease in P. vannamei is one o the main reasons or the decline
o production, which are mainly induced by viral and bacterial in-
ections. Strategies such as the application o antibacterial agents can be
used to resist bacterial inection (Ninawe and Selvin, 2009). Viral in-
ections usually cause immense losses to shrimp arming, which is
drawing increasing attention rom researchers (Karunasagar and Aba-
bouch, 2012).Many DNA viruses have serious eects on shrimp, such as
white spot syndrome virus (WSSV), monodon-type baculovirus (MBV),
inectious hypodermal and hematopoietic necrosis virus (IHHNV),
hepatopancreatic parvovirus (HPV), shrimp hemocyte iridescent virus

Abbreviations: GPD, glass post-larvae disease; WSSV, white spot syndrome virus; MBV, Monodon-type baculovirus; IHHNV, inectious hypodermal and he-
matopoietic necrosis virus; HPV, hepatopancreatic parvovirus; SHIV, shrimp hemocyte iridescent virus; WSSV-AU, Australian WSSV; IMNV, inectious myonecrosis
virus; PvNV, Penaeus vannamei nodavirus; MrNV, Macrobrachium rosenbergii nodavirus; CMNV, covert mortality nodavirus; LSNV, Laem-Singh virus; TSV, Taura
syndrome virus; mNGS, metagenomic next-generation sequencing; AHPND, acute hepatopancreatic necrosis disease; EHP, Enterocytozoon hepatopenaei; VP, viral
protein; UTRs, untranslated regions.
* Corresponding authors.
E-mail addresses: 1054237726@qq.com (Y. Zhao), xinsu@mail.buct.edu.cn (X. Su), tongyigang@mail.buct.edu.cn (Y. Tong).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.virusres.2022.199026
Received 4 August 2022; Received in revised orm 13 December 2022; Accepted 14 December 2022
Available online 15 December 2022
0168-1702/© 2022 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
A. Xu et al. Virus Research 324 (2023) 199026

(SHIV), Taura syndrome virus, Spawner-isolated mortality virus (SMV),
lymphoid parvo-like virus (LPV), Baculovirus penaei (BP) and baculovi-
rus midgut gland necrosis virus (BMNV) (Santos et al., 2020; Zhu et al.,
2019; Weerachatyanukul et al., 2021; Yan et al., 2016; Dhar et al., 2004;
Phuthaworn et al., 2016; Qiu et al., 2017; Dhar et al., 2004; Owens et al.,
2003; Owens, 1991; Overstreet et al., 2010; Momoyama, 2009).
RNA viruses in shrimp aquaculture mainly include inectious myo-
necrosis virus (IMNV), Penaeus vannamei nodavirus (PvNV), Macro-
brachium rosenbergii nodavirus (MrNV), covert mortality nodavirus
(CMNV), Laem-Singh virus (LSNV), yellow head virus (YHV), gill asso-
ciated virus (GAV), and Taura syndrome virus (TSV) (Lightner, 2011;
Naim et al., 2014; Ninawe and Selvin, 2009; Senapin et al., 2013;
Wertheim et al., 2009). Both IMNV and PvNV can inect P. vannamei and
cause muscle necrosis (Flegel, 2012). CMNV, identied by Zhang’s
team, is associated with a recessive atal disease in prawns and has
caused severe losses in China and some South Asian countries (Zhang
et al., 2014). TSV was rst discovered in P. vannamei in 1992 and is
responsible or shrimp Taura syndrome and has impacted shrimp
aquaculture or decades (Cruz-Flores et al., 2021). The identication
and characterization o pathogens in the shrimp culture industry is
critical or reducing economic losses by preventing and controlling
shrimp disease.
Glass post-larvae disease (GPD) is highly inectious and pathogenic.
Once individual shrimp seedlings have GPD symptoms, almost all the
other shrimp seedlings in the same pond may develop GPD in approxi-
mately 24 h (Zou et al., 2020). Recently, GPD has inected numerous
P. vannamei in Hebei Province, northern China, resulting in mass mor-
tality o shrimp and large economic losses. Zou et al. successully iso-
lated a strain o Vibrio parahaemolyticus, which was shown to be highly
pathogenic and associated with GPD (Zou et al., 2020). However, the
V. parahaemolyticus identied in our work was not the cause o GPD.
Herein, we identied a novel virus in the amily Marnaviridae as a po-
tential pathogen o GPD, and we named it Baishivirus. This work not only
uncovers a novel member o the Marnaviridae amily but also provides
new insight into GPD research in the P. vannamei arming industry.
2. Materials and methods
2.1. Sample collection and processing
The shrimp seedlings (P7-P8 stages) used in the experiment were
collected rom breeding arms (Fig. 1B) in Tangshan city, Hebei Prov-
ince, where 80% o the shrimp seedlings showed GPD symptoms. Ater
the samples were transported to the laboratory on dry ice, they were
thawed and washed three times in 70% ethanol and then washed with
sterile deionized water to remove environmental contaminants.

Fig. 1. Distribution o major countries producing P. vannamei in the world and the sample-gathering locations in this study. (A) Major countries producing
P. vannamei in the world. The total global production o P. vannamei in 2020 was approximately 5.82 million tons. (The major producers o P. vannamei in 2020 rom
high to low are China, India, Ecuador, Indonesia and Vietnam). (B) Location where the P. vannamei samples were collected. (Guangdong and Hainan provinces are
marked in yellow, Hebei province is marked in purple, and Tangshan city is marked in red.)

2
A. Xu et al.
Approximately 1 g o shrimp larvae was ground in a rozen grinder at 70
Hz or 60 s. The homogenate was centriuged at 12,000 × g or 10 min at
4◦ C. The supernatant o each sample was ltered with a 0.45 μm Pellicon
II lter (Millipore, Billerica, MA, USA). The ltrate was stored at -80◦ C
beore nucleic acid extraction and challenge testing.
2.2. Nucleic acid extraction and library preparation
Highly puried viral nucleic acids were extracted rom the ltered
supernatant by using a High Pure Viral Nucleic Acid Kit (Roche,
Switzerland) according to the instructions provided by the manuac-
turer. Ater quantication with a Qubit RNA Assay Kit (Thermo Fisher
Scientic, Inc.), extracted RNA was reverse transcribed into cDNA using
Hiair® II 1st Strand cDNA Synthesis SuperMix or qPCR (gDNA digester
plus) (Shanghai Yisheng Biotechnology Co., LTD.). A Qubit dsDNA HS
Assay Kit (Thermo Fisher Scientic, Inc.) was used to determine the
cDNA content on a Qubit 4.0 fuorescence photometer (Thermo Fisher
Scientic, Inc.). Libraries were prepared using the NEBNext® Ultra II
Directional RNA Library Prep Kit or Illumina® (NEB # E7760S / L), and
the quality o the libraries was analyzed on an Agilent 2100 Bioanalyzer
(Agilent, Santa Clara, CA, USA) and LabChip Touch. The library was
subjected to metagenomic next-generation sequencing (mNGS) on the
Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) platorm (150
bp paired-end).
2.3. Bioinormatics analysis
The low-quality reads were removed to obtain clean data. Clean data
were compared to the nonredundant protein database (nr) and nonre-
dundant nucleotide database (nt) using the NCBI blastn and blastx
programs. Clean data were de novo assembled using SPAdes v3.13.0 to
obtain whole genome sequences. The viral sequence was annotated
using the online RAST server (https://rast.nmpdr.org/rast.cgi), and the
possible open reading rames (ORFs) were urther conrmed using
blastx (http://www.ncbi.nlm.nih.gov/BLAST/). The MOTIF Search tool
(https://www.genome.jp/tools/moti/) was used to analyze the protein
motis o the virus. To obtain genomic abundance, a map method was
used in CLC Genomics Workbench 12.0.1 (Qiagen, Germany). The
protein-based amino acid evolutionary tree were constructed using the
MEGA 7 program (Kumar et al., 2016). Tree topology was assessed by
bootstrap analysis using the neighbor-joining method with the deault
parameters o 1,000 replicates.
2.4. Challenge test
Healthy P. vannamei seedlings were purchased rom a shrimp arm in
Cangzhou, Hebei Province, and were cultured or 2 days beore being
used in the challenge test. Sixty P. vannamei were divided into two
experimental groups and one control group, each with 20 prawns.
Prawns in the experimental groups were immersed in a mixture o 3 mL
ltered supernatant (20738 copies/μL Baishivirus in S1’and 46663
copies/μL Baishivirus in S2’) (S1′ , S2′ : primary GPD samples) and 27 mL
o PBS or 10 min. In the control group, 20 prawns were bathed in 30 mL
PBS or 10 min. The soaked prawns and PBS were transerred into 1 L o
oxygenated water and ed normally or 5 days. Prawn mortality and
morphological changes were recorded. Ater the dead prawns were
removed, they were individually sealed into bags marked with the group
name and time and stored at 2~8◦ C beore preparing samples or RT‒
PCR. To conrm the genome sequence o pathogens assembled by
metagenomic sequencing, primers were designed by SnapGene, and the
ragment size o the targeted ORF2 gene was 131 bp. The upstream
primer F: TGTGGAAGTCCAGCCATAAC, downstream primer R:
AGCTGGGTTTCTCCTTCTTG, and probe: TGGGAGTGGCAAACGCCAT-
TACTT were used. The ragment was amplied using the One Step TB
Green™ PrimeScript™ RT‒PCR Kit (TAKARA, Code No. RR066A). The
reaction conditions were as ollows: one cycle o 42◦ C or 5 min, 95◦ C or
3
Virus Research 324 (2023) 199026
10 sec and 40 cycles o 95◦ C or 5 sec, 60◦ C or 34 sec. Pathogens were
urther veried using a highly specic and sensitive kit designed by our
laboratory, which notably combines nucleic acid extraction and visual
LAMP (loop-mediated isothermal amplication) (Tong, et al., 2021).
3. Results
3.1. Clinical symptoms
In April 2021, GPD broke out suddenly in P. vannamei arms in
Tangshan, Hebei Province. The early clinical signs o GPD include not
eating, poor motivation, sluggish action, slow response to external
stimulation, pale-yellow shrimp gills, and color change o liver pancre-
atic tissue rom ull brown to light brown. Approximately 24 h-48 h
later, shrimp developed more symptoms, such as empty jejunum and
stomach, swollen and loose gill laments, a necrotic and pale hepato-
pancreas outline, and a thin and turbid area rom the thymus to the
abdomen. The body o dying shrimp becomes white and transparent,
with muscle atrophy, gill tissue brittleness and erosion, hepatopancreas
necrosis and paleness, glassy degeneration o the jejunum and an empty
stomach (Fig. 2).
3.2. Discovery o Baishivirus
Ater the shrimp with GPD were ground, the supernatant was
collected or metagenomic sequencing to identiy potential pathogens.
According to Blastx, 111 contigs related to Wenzhou Picorna-like virus
21, which was the most abundant category, were obtained. Ater denovo
assembly, a novel picorna-like virus genomic sequence o 9859 bp was
obtained, which was validated by high coverage o the whole genome
sequence (Fig. S1). There was only 64.96% identity over 8% query cover
compared to its closest Wenzhou picorna-like virus 21 (GenBank:
KX884351.1) reported in 2016 (Shi et al., 2016), and we named the
newly identied pathogen Baishivirus. Three open reading rames
(ORFs) were predicted in Baishivirus: ORF1, ORF2, and ORF3, encoding
proteins with lengths o 76 aa, 1995 aa, and 877 aa, respectively. In
addition to Baishivirus, three other pathogens were discovered by met-
agenomic sequencing: pico1 (Wenzhou shrimp virus 8), VP (Vibrio par-
ahaemolyticus) and VC (Vibrio campbellii). We separated primary GPD
samples into the supernatant (virus in theory) and precipitate (bacte-
rium in theory) and detected these pathogens by RT‒PCR. Pico1 existed
in both the experimental group (diseased shrimp) and the control group
(healthy shrimp), indicating that pico1 was not the cause o the disease
(Fig. 3).
Challenge experiments were perormed to satisy Koch’s postulates.
Ater we challenged healthy shrimp with the supernatant, prawns in the
experimental group showed symptoms o GPD at 24-48 h, and all prawns
died on the ourth day o the challenge experiment, while prawns in the
control group were normal. The Ct values o Baishivirus in the two
original GPD samples S1’ and S2’ were 25.66 and 24.49, respectively,
and the Ct value o Baishivirus in the control sample was undetectable
(Fig. 3). Ater challenge with the GPD sample, the Ct values o Baishivirus
in inected samples S1 and S2 (S1, S2: shrimp inected with the primary
supernatant) were 31.565 and 33.701, respectively, and the Ct value in
the control group was undetectable. In contrast, neither VC nor VP were
detected in the inected shrimp sample by RT‒PCR with the challenge o
the precipitate, ruling out their roles in GPD (S3 and S4 in Fig. 3) (S3, S4:
shrimp inected with the primary precipitate). The results indicated that
Baishivirus exists in GPD samples and is likely to inect normal
P. vannamei with GPD.
3.3. Phylogenetic analysis
Construction o RNA libraries or S1’ and S2’ GPD samples generated
a total o 4.7G and 8G data, respectively. Denovo assembly was per-
ormed through SPAdes v3.13.0 to obtain the complete Baishivirus
A. Xu et al. Virus Research 324 (2023) 199026

Fig. 2. Clinical symptoms o P. vannamei inected with glass post-larvae disease (GPD) compared with normal prawns. As shown in the lower let corner o the
picture, the black arrow indicates normal prawns, and the red arrow indicates diseased prawns.

Fig. 3. Ct values o RT‒PCR in the challenge experiment. S0: control sample, S1′ , S2′ : primary GPD samples, S1, S2: shrimp inected with the primary supernatant,
S3, S4: shrimp inected with the primary precipitate. Pico1: Wenzhou shrimp virus 8, pico2: Baishivirus, VP: Vibrio parahaemolyticus, VC: Vibrio campbellii. UD:
undetectable.

genome sequence. Protein motis o Baishivirus ORFs were analyzed by
the MOTIF Search tool, and multiple protein motis were predicted as
indicated (Fig. 4A and 4B). The amino acid sequence phylogenetic tree
o Baishivirus was rst constructed based on capsids (Fig. 4C). Members
o eight amilies within the order Picornavirales, namely, Caliciviridae,
Dicistroviridae, Ifaviridae, Marnaviridae, Picornaviridae, Polycipiviridae,
Secoviridae, and Solinviviridae, were selected to construct the evolu-
tionary tree. In the evolutionary tree, Baishivirus is closest to Wenzhou
picorna-like virus 21 (GenBank KX884351.1) identied in 2016 (upda-
ted in 2018). Both Baishivirus and Wenzhou picorna-like virus 21
(KX884351.1) were closest to members o the Marnaviridae amily,
indicating they probably belong to the Marnaviridae amily.
The Marnaviridae amily can be dierentiated rom other amilies
within the Picornavirales order by the RdRP sequence (Lang et al., 2021).
Thereore, a phylogenetic tree was constructed based on the Baishivirus
RdRP sequence to urther investigate the evolutionary relationships o

4
A. Xu et al.
Fig. 4. Phylogenetic tree o Baishivirus based on amino acids encoded by the capsid. (A) Schematic diagram o the Baishivirus genome structure. (B) Protein motis o
Baishivirus ORF2 and ORF3 analyzed by MOTIF Search. (C) Homology analysis o the amino acid sequence encoded by the capsid (the red dot and ont represent
Baishivirus).
Baishivirus (Fig. 5). As shown in the phylogenetic tree, Baishivirus was
closest to members o the Marnaviridae and Dicistroviridae amilies.
Consequently, a phylogenetic tree based on the RdRP sequence was
urther constructed by including all members o Marnaviridae and
Dicistroviridae (Fig. S2). We selected members o Secoviridae as out-
groups o the tree to better understand the evolutionary relationships.
Baishivirus and Wenzhou picorna-like virus 21 (KX884351.1) constituted
a new branch o Marnaviridae. The evolutionary tree based on RdRP also
conrms that Baishivirus is a novel virus in the amily Marnaviridae
within the order Picornavirales. In addition, Baishivirus and Wenzhou
virus 21 probably orm a novel genus o the Marnaviridae amily, which
we tentatively named Baishivirus.
4. Discussion
As an important export product, P. vannamei is very popular
5
Virus Research 324 (2023) 199026
worldwide, as it not only enhances the economic development o
China’s aquaculture industry but also promotes the globalization o the
aquaculture industry. In recent years, viral diseases and bacterial dis-
eases have continuously emerged in aquaculture, which may involve
multiple drivers, such as regional geographic actors, viral inection,
bacterial inection, and anthropogenic actors (Kibenge, 2019). The
epidemic in P. vannamei aquaculture has brought about continuous
shrimp seedling death and a huge crisis to the shrimp arming industry.
Determination o the critical pathogen in shrimp aquaculture is bene-
cial or the individualized treatment o shrimp disease. For instance, to
prevent white spot syndrome caused by WSSV, 30 ppm chlorine is rec-
ommended to kill inected shrimp and carriers, and water exchange
should be minimized to prevent virus carriers rom entering the pond.
The epidemic o Enterocytozoon hepatopenaei (EHP) appeared in several
countries and is caused by ungal microsporidians. In this situation,
accumulated organic matter in the pond bottoms is suggested to be
A. Xu et al.
Fig. 5. Phylogenetic tree o Baishivirus based on amino acids encoded by RdRP (the red dot and ont represent Baishivirus).
removed physically, and biosecurity should be ensured in the hatchery.
For acute hepatopancreatic necrosis disease (AHPND) caused by Vibrio
parahaemolyticus, the eeding rate is strictly controlled, and an appro-
priate stocking density is proposed to prevent symptoms. Although the
gross clinical signs o GPD are similar to those o AHPND syndrome to
some degree, GPD is a novel disease with dierent inectious agents
(Kumar et al., 2021). The novel Baishivirus in the amily Marnaviridae
reported in this work provides new insight into studying GPD in the
P. vannamei aquaculture industry. Histopathology and electron micro-
scopy should be perormed in urther studies to prove the dominant role
o Baishivirus in GPD occurrence.
Positive-strand RNA viruses o eukaryotes can be divided into three
superamilies: the picorna-like, alpha-like and favi-like amilies (Koo-
nin et al., 2008). Members belonging to the picorna-like superamily are
characterized by RdRP, a chymotrypsin-like protease, a superamily 3
helicase (S3H) and viral proteins (VPs). In general, these viruses have
icosahedral virions composed o capsid proteins. As members o the
picorna-like superamily, the virus taxonomy o Marnaviridae was sub-
mitted to ICTV in 2021 (Lang et al., 2021). Marnaviridae is a non-
enveloped, 22-35 nm virion with our structural proteins (VP1-4) on the
surace. The nonstructural proteins are encoded at the 5’ terminal ends,
6
Virus Research 324 (2023) 199026
and the structural proteins are encoded at the 3’ terminal ends. Because
the gene character in this amily is similar to some Picornaviridae
members, phylogenetic analysis o Marnaviridae RdRP amino acid se-
quences is suggested to distinguish it rom other amilies. Currently, a
total o 7 genera belong to Marnaviridae: Bacillarnavirus, Kusarnavirus,
Labyrnavirus, Locarnavirus, Marnavirus, Salisharnavirus and Sogarnavirus.
The viral gene is replicated in the cytosol, and the latent periods range
rom 8 to 48 h. Isolation o puried virus particles will urther clariy the
characteristics o the Baishivirus structure and replication mechanism.
GPD-inected P. vannamei samples were analyzed by metagenomic
sequencing to reveal a new pathogen in GPD, named Baishivirus. A
comparison o the protein sequences o dierent picorna-like viral su-
peramily members revealed that Baishivirus is most likely to be a
member o Marnaviridae. Because o the relatively low similarity with
the known members o Marnaviridae, we suggest that Baishivirus is a
novel virus within Marnaviridae. Baishivirus and Wenzhou picorna-like
21 possibly represent a new genus in the Marnaviridae amily, which
we tentatively named Baishivirus. However, we cannot completely rule
out the possibility that both Baishivirus and Wenzhou picorna-like 21
virus are unclassied in the Picornavirales order, which may constitute a
new amily. Overall, the discovery o Baishivirus enriches the marine
A. Xu et al.
Marnaviridae amily and promotes urther evolutionary and migration
studies.
5. Conclusions
P. vannamei arming has high economic value and promotes the
globalization o trade in the aquaculture industry. A variety o patho-
gens are emerging in dierent natural or cultured aquatic animal species
in dierent regions, which is worthy o attention. This study identied a
novel Baishivirus o Marnaviridae in P. vannamei that is likely to play a
dominant role in the outbreak o GPD. These results increase our
awareness o viral diversity, providing guidance or the breeding o
P. vannamei as well as signicance in the prevention o emerging in-
ectious diseases in aquaculture. The emergence o COVID-19 has
brought mankind into the postepidemic era. Similarly, GPD will become
the "epidemic" or the shrimp culture industry in which long-term eorts
are needed to study the relevant prevention and control measures. The
pathogen, host, and environment should all be considered in urther
studies. Biosaety is supposed to be guaranteed or global aquaculture
arms and aquaculture processing plants, and simultaneously, the
technology o diagnosis and monitoring o pathogens should be
improved to ultimately achieve the goal o disease control and
prevention.
Declaration of Competing Interest
The authors declare no competing nancial interests.
Data availability
Data will be made available on request.
Acknowledgments
This work is supported by the State Key Research Development
Program o China (No. 2019YFC1200500, No. 2019YFC1200502, No.
ZK20200015), 2021 Capital Health Development Research Special
Research Project (No. 2021-1G-4301) and Fundamental Research Funds
or the Central Universities (buctrc202230). Furthermore, we are
grateul or the samples o diseased shrimp rom arms in Tangshan City,
Hebei Province.
Supplementary materials
Supplementary material associated with this article can be ound, in
the online version, at doi:10.1016/j.virusres.2022.199026.
References
Cruz-Flores, R., Mai, H.N., Dhar, A.K., 2021. Complete genome reconstruction and
genetic analysis o Taura syndrome virus o shrimp rom archival Davidson’s-xed
paran embedded tissue. Virology 553, 117–121. https://doi.org/10.1016/j.
virol.2020.11.009.
Dhar, A.K., Cowley, J.A., Hasson, K.W., Walker, P.J., 2004. Genomic organization,
biology, and diagnosis o Taura syndrome virus and yellowhead virus o penaeid
shrimp. Adv. Virus Res. 63, 353–421. https://doi.org/10.1016/S0065-3527(04)
63006-5.
Flegel, T.W., 2012. Historic emergence, impact and current status o shrimp pathogens in
Asia. J. Invertebr. Pathol. 110 (2), 166–173. https://doi.org/10.1016/j.
jip.2012.03.004.
Karunasagar, I., Ababouch, L., 2012. Shrimp viral diseases, import risk assessment and
international trade. Indian J. Virol. O. Organ Indian Virol. Soc. 23 (2), 141–148.
https://doi.org/10.1007/s13337-012-0081-4.
Kibenge, F.S., 2019. Emerging viruses in aquaculture. Curr. Opin. Virol. 34, 97–103.
https://doi.org/10.1016/j.coviro.2018.12.008.
Virus Research 324 (2023) 199026
Koonin, E.V., Wol, Y.I., Nagasaki, K., Dolja, V.V., 2008. The Big Bang o picorna-like
virus evolution antedates the radiation o eukaryotic supergroups. Nat. Rev.
Microbiol. 6 (12), 925–939. https://doi.org/10.1016/S0277-3791(00)00124-4.
Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics
analysis version 7.0 or bigger datasets. Mol. Biol. Evol. 33 (7), 1870–1874. https://
doi.org/10.1093/molbev/msw054.
Kumar, V., Roy, S., Behera, B.K., Bossier, P., Das, B.K., 2021. Acute hepatopancreatic
necrosis disease (AHPND): virulence, pathogenesis and mitigation strategies in
shrimp aquaculture. Toxins 13 (8). https://doi.org/10.3390/toxins13080524.
Lang, A.S., Vlok, M., Culley, A.I., Suttle, C.A., Takao, Y., Tomaru, Y., ICTV Report
Consortium, 2021. ICTV virus taxonomy prole: Marnaviridae 2021. J. Gen. Virol.
102 (8) https://doi.org/10.1099/jgv.0.001633.
Lightner, D.V., 2011. Virus diseases o armed shrimp in the Western Hemisphere (the
Americas): a review. J. Invertebr. Pathol. 106 (1), 110–130. https://doi.org/
10.1016/j.jip.2010.09.012.
Momoyama, K., 2009. Survival o Baculoviral Mid-gut Gland Necrosis Virus (BMNV) in
inected tissues and in sea water. Fish Pathol. 24 https://doi.org/10.3147/
jsp.24.179.
Naim, S., Brown, J.K., Nibert, M.L., 2014. Genetic diversication o penaeid shrimp
inectious myonecrosis virus between Indonesia and Brazil. Virus Res. 189, 97–105.
https://doi.org/10.1016/j.virusres.2014.05.013.
Ninawe, A.S., Selvin, J., 2009. Probiotics in shrimp aquaculture: avenues and challenges.
Crit. Rev. Microbiol. 35 (1), 43–66. https://doi.org/10.1080/10408410802667202.
Overstreet, R.M., Stuck, K.C., Krol, R.A., Hawkins, W.E., 2010. Experimental Inections
with Baculovirus penaei in the White Shrimp Penaeus vannamei (Crustacea:
Decapoda) as a Bioassay. J. World Aquac. Soc. 19 https://doi.org/10.1111/j.1749-
7345.1988.tb00778.x.
Owens, L., 1991. Lymphoidal parvo-like virus rom Australian penaeid prawns. Dis.
Aquat. Org. 11, 32–46.
Owens, L., McElnea, C., Snape, N., Harris, L., Smith, M., 2003. Prevalence and eect o
spawner-isolated mortality virus on the hatchery phases o Penaeus monodon and
P. merguiensis in Australia. Dis. Aquat. Org. 53 (2), 101–106. https://doi.org/
10.3354/dao053101.
Phuthaworn, C., Nguyen, N.H., Quinn, J., Knibb, W., 2016. Moderate heritability o
hepatopancreatic parvovirus titre suggests a new option or selection against viral
diseases in banana shrimp (Fenneropenaeus merguiensis) and other aquaculture
species. Génét. Sél. Évol. 48 (1), 64. https://doi.org/10.1186/s12711-016-0243-8.
Qiu, L., Chen, M.M., Wan, X.Y., Li, C., Zhang, Q.L., Wang, R.Y., Cheng, D.Y., Dong, X.,
Yang, B., Wang, X.H., 2017. Characterization o a new member o Iridoviridae,
Shrimp hemocyte iridescent virus (SHIV), ound in white leg shrimp (Litopenaeus
vannamei). Sci. Rep. 7 (1), 11834. https://doi.org/10.1038/s41598-017-10738-8.
Santos, C.A., Andrade, S., Fernandes, J., Freitas, P.D., 2020. Shedding the light on
Litopenaeus vannamei dierential muscle and hepatopancreas immune responses in
white Spot Syndrome Virus (WSSV) exposure. Genes 11 (7). https://doi.org/
10.3390/genes11070805.
Senapin, S., Phiwsaiya, K., Gangnonngiw, W., Briggs, M., Sithigorngul, P., Flegel, T.W.,
2013. Dual inections o IMNV and MrNV in cultivated Penaeus vannamei rom
Indonesia. Aquaculture 372-375, 70–73. https://doi.org/10.1016/j.
aquaculture.2012.10.027.
Shi, M., Lin, X.D., Tian, J.H., Chen, L.J., Chen, X., Li, C.X., Qin, X.C., Li, J., Cao, J.P.,
Eden, J.S., Buchmann, J., Wang, W., Xu, J., Holmes, E.C., Zhang, Y.Z., 2016.
Redening the invertebrate RNA virosphere. Nature 540 (7634), 539–543. https://
doi.org/10.1038/nature20167.
Tong, Y., He, Y., Tu, Q., Xie, T., 2021. A visual method or virus detection combining
nucleic acidextraction and LAMP amplication (in Chinese). Patent, Beijing
University o Chemical Technology.
Weerachatyanukul, W., Pooljun, C., Hirono, I., Kondo, H., Chotwiwatthanakun, C.,
Jariyapong, P., 2021. Inectious hypodermal and hematopoietic necrosis virus-like
particle (IHHNV-VLP) induces peroxiredoxin expression and activity in
Fenneropenaeus merguiensis. Fish Shellsh Immunol. 121, 53–61. https://doi.org/
10.1016/j.si.2021.12.015.
Wertheim, J.O., Tang, K.F., Navarro, S.A., Lightner, D.V., 2009. A quick use and the
emergence o Taura syndrome virus. Virology 390 (2), 324–329. https://doi.org/
10.1016/j.virol.2009.05.010.
Yan, D.C., Huang, J., Yang, B., Sun, H.S., Wang, Y.Y., Liu, X., 2016. Competition o
inectious hypodermal and haematopoietic necrosis virus (IHHNV) with white spot
syndrome virus (WSSV) or binding to shrimp cellular membrane. J. Fish Dis. 39
(10), 1225–1229. https://doi.org/10.1111/jd.12489.
Zhang, Q., Liu, Q., Liu, S., Yang, H., Liu, S., Zhu, L., Yang, B., Jin, J., Ding, L., Wang, X.,
Liang, Y., Wang, Q., Huang, J., 2014. A new nodavirus is associated with covert
mortality disease o shrimp. The J. Gen. Virol. 95 (Pt 12), 2700–2709. https://doi.
org/10.1099/vir.0.070078-0.
Zhu, F., Twan, W.H., Tseng, L.C., Peng, S.H., Hwang, J.S., 2019. First detection o white
spot syndrome virus (WSSV) in the mud shrimp Austinogebia edulis in Taiwan. Sci.
Rep. 9 (1), 18572. https://doi.org/10.1038/s41598-019-54837-0.
Zou, Y., Xie, G., Jia, T., Xu, T., Wang, C., Wan, X., Li, Y., Luo, K., Bian, X., Wang, X.,
Kong, J., Zhang, Q., 2020. Determination o the inectious agent o Translucent Post-
Larva Disease (TPD) in Penaeus vannamei. Pathogens 9 (9). https://doi.org/10.3390/
pathogens9090741.