PUBLIC AND ENVIRONMENTAL

HEALTH MICROBIOLOGY

Outer Membrane Vesicles Derived from Salmonella enterica

Serotype Typhimurium Can Deliver Shigella flexneri 2a
O-Polysaccharide Antigen To Prevent Shigella flexneri 2a
Infection in Mice
Huizhen Tian,a Biaoxian Li,a Tian Xu,a Haolin Yu,b Jingxuan Chen,b Haiyan Yu,a Shan Li,a Lingbing Zeng,c Xiaotian Huang,a
Qiong Liua,d

a Department of Medical Microbiology, School of Medicine, Nanchang University, Nanchang, China

b School of Ophthalmology and Optometry, Nanchang University, Nanchang, China
c The First Affiliated Hospital of Nanchang University, Nanchang, China
d Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Chengdu, China

ABSTRACT Shigellosis has become a serious threat to health in many developing

countries due to the severe diarrhea it causes. Shigella flexneri 2a is the principal species
responsible for this endemic disease. Despite multiple attempts to design a vaccine
against shigellosis, no effective vaccine has been developed yet. Lipopolysaccharide
(LPS) is both an essential virulence factor and an antigen protective against Shigella,
due to its outer domain, termed O-polysaccharide antigen. In the present study, S. flex-
neri 2a O-polysaccharide antigen was innovatively biosynthesized in Salmonella and
attached to core-lipid A via the ligase WaaL, with purified outer membrane vesicles
(OMVs) utilized as vaccine vectors. Here, we identified the expression of the heterol-
ogous O-antigen and have described the isolation, characterization, and immune protec-
tion efficiency of the OMV vaccine. Furthermore, the results of animal experiments indi-
cated that immunization of mice with the OMV vaccine induced significant specific
anti-Shigella LPS antibodies in the serum, with similar trends in IgA levels from vaginal
secretions and fluid from bronchopulmonary lavage, both intranasally and intraperitone-
ally. The OMV vaccine derived from both routes of administration provided significant
protection against virulent S. flexneri 2a infection, as judged by a serum bactericidal
assay, opsonization assay, and challenge test. This vaccination strategy represents a
novel and improved approach to control shigellosis by the combination of Salmonella
glycosyl carrier lipid bioconjugation with OMVs. Citation Tian H, Li B, Xu T, Yu H, Chen J, Yu H, Li
IMPORTANCE Shigella, the cause of shigellosis or bacillary dysentery, is a major public S, Zeng L, Huang X, Liu Q. 2021. Outer
membrane vesicles derived from Salmonella
health concern, especially for children in developing countries. An effective vaccine enterica serotype Typhimurium can deliver
would control the spread of the disease to some extent. However, no licensed vac- Shigella flexneri 2a O-polysaccharide antigen to
prevent Shigella flexneri 2a infection in mice.
cine against Shigella infection in humans has so far been developed. The Shigella O-
Appl Environ Microbiol 87:e00968-21. https://
antigen polysaccharide is effective in stimulating the production of protective anti- doi.org/10.1128/AEM.00968-21.
bodies and so could represent a vaccine antigen candidate. In addition, bacterial Editor Charles M. Dozois, INRS–Institut
outer membrane vesicles (OMVs) have been used as antigen delivery platforms due Armand-Frappier
Copyright © 2021 American Society for
to their nanoscale properties and ease of antigen delivery to trigger an immune
Microbiology. All Rights Reserved.
response. Therefore, the present study provides a new strategy for vaccine design, Address correspondence to Qiong Liu,
combining a glycoconjugated vaccine with OMVs. The design concept of this strat- p19890528@126.com.
egy is the expression of Shigella O-antigen via the LPS synthesis pathway in recombi- Received 21 May 2021
Accepted 19 July 2021
nant Salmonella, from which the OMV vaccine is then isolated. Based on these find-
Accepted manuscript posted online
ings, we believe that the novel vaccine design strategy in which polysaccharide 28 July 2021
antigens are delivered via bacterial OMVs will be effective for the development and Published 10 September 2021
clinical application of an effective Shigella vaccine.

October 2021 Volume 87 Issue 19 e00968-21 Applied and Environmental Microbiology aem.asm.org 1
Tian et al. Applied and Environmental Microbiology

KEYWORDS O-polysaccharide antigen, outer membrane vesicle, Salmonella

Typhimurium, Shigella flexneri 2a

S higellosis continues to be a leading cause of severe inflammatory diarrhea in many

developing countries and is thought to cause approximately 165 million cases each
year, predominantly in children under 5 years of age (1). Among all serotypes, Shigella
flexneri is the major cause of bloody diarrheal disease in humans and is also an impor-
tant pathogen in higher primates in a number of settings (2). As occurs with other en-
teric Gram-negative bacteria, Shigella can invade intestinal cells, the infection of which
results in a proinflammatory response (3). O-antigen (O-Ag) chains, a component of li-
popolysaccharide (LPS) molecules, contribute to Shigella virulence and infection (4).
O-antigen chains are formed by oligosaccharide repeating units (RUs) that bear a linear
tetrasaccharide backbone consisting of three L-rhamnose residues and an N-acetyl-D-
glucosamine residue which are encoded by O-antigen gene clusters approximately
16,000 bp in length and located between the galF and gnd genes (5) (Fig. 1A).
Vaccination is a pivotal aspect of the strategy to control shigellosis (6). The humoral
immune response, both systemic and mucosal, is a major component of protective immu-
nity against Shigella infection, and available data suggest that the presence of serum anti-
bodies recognizing the O-antigen of Shigella LPS is associated with protection against
shigellosis (7, 8). However, serum antibodies alone are not sufficient to predict whether an
individual has protection against shigellosis (9). Mucosal immunity plays a critical role in
the mechanism of protection against Shigella infection, as established in previous studies
(9, 10). The levels of antibody-secreting cells (ASCs), especially those that secrete immuno-
globulin A (IgA) antibodies, should be consistent with the degree of protection provided
by a potential vaccine (11). A mouse model has recently been established in studies that
have evaluated the safety and efficacy of Shigella vaccines (12). Minimal reactogenicity and
significant protection efficacy against shigellosis were observed in mice vaccinated with a
live vaccine prepared from streptomycin-dependent S. flexneri 2a, which was found to be
safe and able to protect volunteers and primates (13).
Outer membrane vesicles (OMVs) produced by Gram-negative bacteria contain bio-
logically active components such as proteins and LPS, which perform diverse biological
functions, including participation in the secretory pathway, bacterial infection, physiol-
ogy, and virulence (14). Parenteral vaccines are often ineffective in stimulating a
mucosal immune response which are instead most effectively elicited by antigens at
mucosal surfaces (15). It has been established that OMVs acting as nanoparticle vac-
cines induce mucosal immunity and protection against intestinal bacteria, including
Shigella (16, 17). There is a substantial body of evidence indicating that antibodies gen-
erated against Shigella O-antigen play a crucial role in providing protection against the
disease (7, 8). Therefore, we hypothesized that the fusion of OMVs and Shigella O-anti-
gen could represent the basis for a highly effective vaccine. Furthermore, compared to
wild-type Shigella OMVs, those derived from mature engineered bacteria or an attenu-
ated delivery vector, such as Escherichia coli or S. Typhimurium, would be more condu-
cive to genetic engineering and so able to deliver molecules that would elicit an
immune response and better control virulence, ensuring enhanced safety (8, 18).
Compared to E. coli, S. Typhimurium, as a pathogen of multihost infection, has broader
application potential as a delivery platform (19). Increasing evidence has confirmed
that OMVs from S. Typhimurium could represent a platform for the delivery of heterol-
ogous immunogenic protein antigens (20). In addition, previous studies have
confirmed that heterologous polysaccharides acting as important protective antigens
could be incorporated into S. Typhimurium, thereby inducing immune activation, with
glycoengineered S. Typhimurium having demonstrated considerable potential as
a Shigella vaccine candidate due to the excellent efficacy and safety of the S.
Typhimurium OMV platform (8).
In the present study, the feasibility of delivering a vector based on OMVs from S.
Typhimurium carrying the S. flexneri 2a O-polysaccharide antigen was explored and a

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 2

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

FIG 1 (A) Construction of plasmid expressing S. flexneri 2a O-antigen polysaccharide. The origin for replication was pSC101 as the
replicon. The complete O-antigen cluster was cloned in this plasmid and then expressed. (B) Schematic molecular model of the
structure of S. flexneri 2a O-antigen and the principle of expression in S. Typhimurium. (C) Immunization and challenge protocols for
mouse experiments.

potential vaccine against Shigella infection evaluated (Fig. 1A and B). Efficient delivery
vehicles were fabricated with the balance of immune response between homologous
and heterologous antigens consistent with that previously judged appropriate (18).
Therefore, nonessential antigens which displayed a strong immune response to the
host but disrupting the recognition of delivery antigens by antigen-presenting cells
(APCs) were omitted, such as flagellin proteins FliC and FljB and major porins, including
OmpA, OmpC, and OmpD (21, 22). To ensure the display of heterologous O-antigens,
the rfbP gene was knocked out which enabled the expression of S. flexneri O-antigen
on core-lipid A (23). The immune response and protection afforded by this Shigella gly-
coconjugate-OMV vaccine were evaluated in a mouse model, establishing a novel and
improved approach for the prevention of shigellosis.

RESULTS
Construction of Salmonella OMV vaccine delivering Shigella O-polysaccharide
antigen. To construct a plasmid expressing the complete S. flexneri 2a LPS O-antigen,
the S. flexneri 2a O-antigen gene cluster, located between the galF and gnd genes and
approximately 16,000 bp in size (Fig. 1A), was cloned by PCR. Low-copy vector plasmid
pYA3337, with a pSC101 origin of replication, was selected. In the present study,
pQK018 expressing the S. flexneri 2a O-antigen was constructed using a Gibson assem-
bly kit (New England Biolabs, Beverly, MA) (Fig. 1B). The identity of the expression plas-
mid was found in the TOP10 E. coli strain (Invitrogen, Carlsbad, CA) due to its rough
LPS phenotype. S. flexneri 2a O-antigen expression in the TOP10 strain was confirmed,
since it was visible in SDS-PAGE gels using silver staining (see Fig. S1 in the supplemen-
tal material).

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 3

Tian et al. Applied and Environmental Microbiology

Purified Salmonella-derived OMVs delivering the S. flexneri 2a O-antigen were

obtained by density gradient centrifugation and observed by cryo-electron microscopy
(cryo-EM). Spherical OMVs with a bilayer membrane were observed. Flagellin was not
detected due to the deletion of the FliC and FljB proteins (Fig. 2A). There was no appa-
rent difference in the OMV conformation due to the deletion of the OmpA, OmpC, and
OmpD proteins, the major porins in Salmonella, compared to wild-type Salmonella
OMVs, while the presence of the Salmonella OMVs was not affected by the expression
of the S. flexneri 2a O-antigen (Fig. 2A). Similar levels of LPS were present in the OMV
vaccine and OMV vector samples, roughly 15 m g of LPS/50 m g of protein (see Fig. S2A).
Furthermore, the nanoparticle tracking analysis (NTA) data indicated that the quantity
of OMV released by Salmonella expressing S. flexneri 2a O antigen was consistent with
that of the Salmonella vector, while the OMV particle size produced by these two
bacteria both had a diameter of 70 to 90 nm, indicating that delivery of the S. flexneri
2a O antigen did not affect the morphological characteristics of the OMVs (see
Fig. S2B to D).
The safety of the OMV vaccine was also determined in vitro using a macrophage via-
bility assay. RAW 264.7 cells were treated with OMVs for 24 h and their cytotoxicity
examined using a MultiTox-Fluor multiplex cytotoxicity assay. The data demonstrated
that neither the OMV vaccine nor the OMV vector elicited any apparent cytotoxicity.
However, high concentrations of OMVs caused slight cell lysis (;75% cell viability)
(Fig. 2B), indicating that, in spite of expressing the heterologous polysaccharide anti-
gen, this OMV vaccine was sufficiently safe in vitro for subsequent evaluation in in vivo
experiments.
The biosynthesis of the S. flexneri 2a O-antigen in OMVs was determined by silver
staining (Fig. 2C) and by Western blotting using anti-S. flexneri 2a serogroup serum
(Fig. 2D). The S. flexneri 2a O-antigen expressed by plasmid pQK018 was added and
attached to the core polysaccharide using O-antigen ligase encoded by the waaL gene
(Fig. 2C and 1B). Deletion of the rfbP gene resulted in the blockade of O-antigen syn-
thesis and a change in LPS from smooth to rough phenotype in S. Typhimurium, while
the expression of the Salmonella O-antigen was not detected in the OMV vaccine in
which the S. flexneri 2a O-antigen was delivered, nor was it detected in the OMV vector
(Fig. 2C and E).
To further define the LPS bands from the S. flexneri 2a O-antigen, Western blot anal-
ysis was performed. LPS samples from wild-type S. flexneri 2a and wild-type S.
Typhimurium represented the positive and negative controls, respectively (Fig. 2D).
The LPS bands demonstrated a response to the anti-Shigella LPS serum, while LPS from
Salmonella displayed no bands on the nitrocellulose membranes (Fig. 2D). The results
indicate that the O-antigen from S. flexneri 2a could be synthesized in OMVs derived by
S. Typhimurium.
Antibody response of Salmonella-derived OMVs delivering Shigella O-antigen.
To evaluate the efficiency of the Shigella O-antigen-induced immune response after
their delivery in Salmonella OMVs, the mice were immunized with the recombinant
OMV vaccine, Salmonella OMV vector, or phosphate-buffered saline (PBS) control by
intranasal or intraperitoneal administration. The concentration of antibodies, including
IgG, vaginal IgA, lung-wash IgA, IgG1, and IgG2a against S. flexneri 2a or S.
Typhimurium LPS, was measured by quantitative enzyme-linked immunosorbent assay
(ELISA). As shown in Fig. 3A and B, immunization with OMV vaccine resulted in a signif-
icantly higher anti-Shigella LPS IgG level than in the OMV vector group by both intra-
nasal and intraperitoneal immunization (P , 0.05), whereas the IgG levels in both
groups were distinctly higher than that in the PBS control group (P , 0.01).
Furthermore, mucosal immunity, as the first line of host defense, plays a critical role in
the prevention of pathogenic infection. Secretory IgAs (S-IgAs), including vaginal IgA
and lung-wash IgA, are the most important factors in mucosal immunity against
Shigella infection (6). Therefore, the concentrations of vaginal IgA and lung-wash IgA in
immunized mice were measured. The OMV vaccine delivering S. flexneri 2a O-

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 4

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

FIG 2 (A) OMVs derived from S. Typhimurium mutants delivering O-antigen were visualized by Cryo-EM. The red arrow indicates a
visible OMV. (B) Cytotoxic effect of OMVs derived from S. Typhimurium delivering S. flexneri 2a O-antigen polysaccharide and the
parental mutant in RAW 264.7 macrophages. Cells were incubated with the corresponding OMVs at the dose indicated. Cell viability
was measured from the supernatant using a Multitox-Fluor multiplex cytotoxicity assay. Supernatants from cells without OMV
treatment and cell lysates acted as negative and positive controls, respectively. (C) Identification of OMVs derived from S.
Typhimurium delivering S. flexneri 2a O-polysaccharide antigen by their LPS profile and silver staining. (D) Identification of OMVs
derived from S. Typhimurium delivering S. flexneri 2a O-polysaccharide antigen by Western blotting. The primary antibody used for
detection was a rabbit polyclonal antibody specific for S. flexneri 2a O-antigen. (E) Detection of OMV vaccine and OMV vector against
the serum of S. Typhimurium LPS by Western blotting. The primary antibody used was rabbit polyclonal antibody specific for S.
Typhimurium O-antigen. *, P , 0.05; ***, P , 0.001.

polysaccharide antigen induced a significant mucosal antibody response against

Shigella LPS (P , 0.05) (Fig. 3C and D). However, no significant mucosal antibody
against LPS was detected in mice 8 weeks after intraperitoneal immunization with
OMVs (Fig. 3C and D). Furthermore, the levels of IgG1 and IgG2a in the serum of immu-
nized mice were determined, the data revealing that IgG2a was the predominant sub-
type of Shigella LPS-specific IgG elicited by the OMV vaccine through both intranasal
and intraperitoneal administration (Fig. 3E and F). In addition, the concentrations of S.
Typhimurium LPS-specific IgG induced by the OMV vaccine or OMV vector remained
low level in both routes, indicating that the OMV vector in which the O antigen was
deleted did not stimulate an excessive nonspecific immune response that could inter-
fere with the production of a Shigella LPS-specific immune response (Fig. 3G).

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 5

Tian et al. Applied and Environmental Microbiology

FIG 3 Humoral and mucosal antibody response in immunized and control mice after intranasal or intraperitoneal administration. S. flexneri
2a LPS or S. Typhimurium LPS represented the coated immunogen. Serum IgG of mice immunized intranasally (A), serum IgG of mice
immunized by intraperitoneal administration (B), total vaginal IgA of mice immunized intranasally (C), lung wash-IgA from mice immunized
intranasally (D), serum IgG1 and IgG2a of mice immunized intranasally (E), serum IgG1 and IgG2a of mice immunized intraperitoneally (F), and
S. Typhimurium LPS-specific IgG (G) were quantified by ELISA. Each group represented 5 or 10 mice. The data represent exact concentrations
of IgG, IgG1, IgG2a, or IgA antibodies quantified by a corresponding standard curve in individual sera from mice immunized intranasally or
intraperitoneally using an OMV vaccine, OMV vector or PBS. Mice received a booster after 4 weeks, and samples were collected 4 and
8 weeks after the first immunization. PBS-vaccinated mice represented the control group. Error bars represent variations among mice in each
group. *, P , 0.05; **, P , 0.01; ***, P , 0.001.

OMVs delivering Shigella O-antigen stimulated Shigella LPS-specific splenic

lymphocyte proliferation. The priming of a cell-mediated immune response plays an
important role in the induction of protective immunity against S. flexneri infection. The
proliferation of splenic cells in response to stimulation by S. flexneri 2a LPS, with S.
Typhimurium LPS and PHA cultures used as negative and positive controls, respec-
tively, was measured 7 days after primary immunization. The results indicated that
splenic cells extracted from mice in which the OMV vaccine had been administered
intranasally and incubated with S. flexneri 2a LPS displayed significant lymphocyte pro-
liferation similar to that of the phytohemagglutinin (PHA)-positive control group. In
addition, no apparent proliferation of splenic lymphocytes incubated with S.
Typhimurium LPS was observed (Fig. 4A). Moreover, immunization with both the OMV
vaccine and OMV vector via intraperitoneal administration stimulated significantly
higher Shigella LPS or S. Typhimurium LPS-specific splenic proliferation compared to
the PBS control group (P , 0.05) (Fig. 4B). However, the level of splenic lymphocyte

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 6

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

FIG 4 Splenic lymphocytes were isolated from immunized mice after 7 days after intranasal (A) or
intraperitoneal administration (B). Each group consisted of three mice. Splenic lymphocytes were
incubated with S. flexneri 2a LPS or S. Typhimurium LPS, while PHA was incubated as a positive
control, to determine cell proliferation. The data represent the proliferation of splenic lymphocytes in
mice immunized intranasally or intraperitoneally with the OMV vaccine, OMV vector or PBS. Error bars
represent variations between mice in each group. *, P , 0.05; **, P , 0.01; ***, P , 0.001.

proliferation induced by either OMV vaccine or OMV vector with intraperitoneal admin-
istration was lower than that for intranasal administration (Fig. 4).
Th1/Th2 polarization response to OMVs delivering Shigella O-antigen. Th1 and
Th2 cells secrete a variety of cytokines that mediate an immune reaction. Therefore,
the levels of gamma interferon (IFN-g), interleukin-12 (IL-12) (p40), IL-4, IL-13, IL-6, and
tumor necrosis factor alpha (TNF-a) were measured to evaluate Th1/Th2 polarization.
Splenocytes treated with LPS from S. flexneri 2a were used to enhance immunity in
order to detect cytokine levels. We found that IFN-g, IL-12 (p40), IL-4, and IL-13 levels in
spleen cells from both intranasal and intraperitoneal groups increased compared to
the PBS control group (Fig. 5A to D). In addition, the levels of IFN-g, IL-12 (p40), and IL-
4 in cells treated with the OMV vaccine via both intranasal and intraperitoneal adminis-
tration were higher than those in the OMV vector group (P , 0.01), as were IL-13 levels.
Interestingly, the levels of IFN-g and IL-12 in mice immunized with the OMV vaccine via
the intranasal route were significantly higher than those in mice immunized with the
OMV vector (P , 0.01), indicating that the OMV vaccine induced a Th1-polarized
immune response (because IFN-g is secreted by Th1 cells), while IL-12 facilitates
CD41 cells to become Th1 cells (24). Furthermore, as shown in Fig. 5E, IL-6 levels did
not change significantly after a variety of treatments. In particular, mouse splenocytes
immunized with the intraperitoneal OMV vaccine displayed higher TNF-a levels than
those receiving it intranasally (Fig. 5F), indicating that intraperitoneal immunization
with OMV vaccine may induce a mild inflammatory response, compared to intranasal
immunization.
OMVs delivering Shigella O-antigen induced effective bactericidal activity and
displayed the capacity to opsonize bacteria. To evaluate the specific bactericidal
potential, sera from mice immunized with the recombinant OMV vaccine and
Salmonella OMV vector were tested using a serum bactericidal assay (SBA). As pre-
sented in Fig. 6A, the intranasal OMV vaccine induced the secretion of antibodies with
significantly higher SBA activity and .50% growth inhibition using a serum dilution of
approximately 1:3,200 (P , 0.05). However, significantly greater SBA activity was
observed in mice immunized via the intraperitoneal route with OMV vaccine, but only
when the dilution was less than or equal to 1:400 compared to those immunized with

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 7

Tian et al. Applied and Environmental Microbiology

FIG 5 Splenocytes were isolated from 9 mice immunized intranasally or by intraperitoneal administration. Levels of
cytokines were measured to evaluate the Th1/Th2 polarization effect. These data display the levels of cytokines in the
splenocytes of mice immunized by intranasal or intraperitoneal administration with an OMV vaccine, OMV vector, or
PBS. After stimulation of the splenocytes with 6 m g/ml LPS isolated from S. flexneri for 24 h, levels of IFN-g (A), IL-12
(p40) (B), IL-4 (C), IL-13 (D), IL-6 (E), and TNF-a (F) in the supernatants were measured by quantitative ELISA. Error bars
represent variations between mice in each group. *, P , 0.05; **, P , 0.01; ***, P , 0.001.

the OMV vector (P , 0.05) (Fig. 6B). All data indicated that Salmonella-derived OMVs
delivering Shigella O-antigen polysaccharide elicited effective bactericidal activity.
Furthermore, the ability of sera from mice immunized with the OMV vaccine to
opsonize bacteria and enhance phagocytosis was determined using an isolated macro-
phage model. Bacterial uptake was observed in both the intranasal and intraperitoneal
groups (Fig. 6C and D), indicating that the sera of mice immunized with OMV vaccine
displayed greatly enhanced phagocytosis of Shigella by macrophages. Salmonella-
derived OMVs that delivered Shigella O-antigen polysaccharide modulated the
immune system of mice and participated in the clearing of pathogens (Fig. 6C and D).
Protection against S. flexneri 2a challenge. Mouse models have been typically used
to evaluate specific protection against challenge with virulent Shigella infection (6). At 5
weeks after booster immunization, the mice were challenged with S. flexneri 2a at a lethal
dose either intranasally (;106 CFU) or by intraperitoneal administration (;5  107 CFU).
This stringent challenge resulted in 100% mortality in PBS-immunized mice. However,
mice immunized with intranasal OMV vaccine were 100% protected after virulent Shigella
challenge. In addition, the OMV vaccine provided by intraperitoneal administration also
provided significant protection to the mice (P , 0.05) (Fig. 7A and B). In particular, one or
two mice immunized with the OMV vector by both intranasal and intraperitoneal adminis-
tration survived after the Shigella challenge, indicating that Salmonella OMV vector

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 8

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

FIG 6 Bactericidal properties and opsonization of sera from mice immunized with Salmonella-derived OMVs delivering S. flexneri 2a
O-polysaccharide antigen in vitro. SBAs were performed using sera (8 weeks after first immunization) of mice in the OMV vaccine and
OMV vector immunization groups, with bacterial growth activity expressed in terms of serum dilutions. (A and B) Mice immunized
with OMVs by intranasal (A) or intraperitoneal (B) administration. The data represent the percentage of CFU of S. flexneri 2a with
active/inactive complement in each serum dilution compared to the CFU of the same serum dilutions with no complement. Error bars
represent standard deviations. The opsonization assay was performed with mouse sera 8 weeks after the first immunization using the
OMV vaccine and OMV vector. (C and D) Mice immunized with OMVs by intranasal (C) or intraperitoneal (D) administration. The data
represent the CFU of S. flexneri 2a in each well with diverse-treated serum. Error bars represent standard deviations. **, P , 0.01; ***,
P , 0.001.

induced heightened protective efficacy against Shigella infection in those mice (Fig. 7A
and B), consistent with our previous study (8, 22). Histological and pathological scores of
mouse lung tissue after S. flexneri 2a challenge displayed normal lung morphology in the
lungs of mice immunized with the OMV vaccine (Fig. 7C). In comparison, mice immunized
with the OMV vector displayed lung architecture with mild infiltration of neutrophils and
mononuclear cells (Fig. 7D). However, mice immunized with PBS demonstrated significant
perivascular and peribronchial inflammation, clearly characteristic of severe pneumonia
(Fig. 7E). Statistical analysis of the pathological scores demonstrated consistency with his-
tological analysis (Fig. 7F).
Moreover, the mouse model of shigellosis by intraperitoneal infection with S. flexneri
2a was used to further confirm the protection conferred by the OMV vaccine.
Significantly higher survival was observed in the group of mice immunized with the
OMV vaccine via both intranasal and intraperitoneal routes compared with the OMV vec-
tor or PBS control groups (P , 0.01) (Fig. 7G and H). Taken together, the data indicate

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 9

Tian et al. Applied and Environmental Microbiology

FIG 7 Protection of Salmonella-derived OMVs delivering S. flexneri 2a O-polysaccharide antigen in pulmonary and shigellosis mouse
models. (A and B) BALB/c mice protected by intranasal (A) or intraperitoneal (B) immunization with Salmonella-derived OMVs
delivering S. flexneri 2a O-polysaccharide antigen, against challenge with wild-type S. flexneri 2a by intranasal infection. Ten mice per
group were immunized twice at 4-week intervals with the OMV indicated. Mice were challenged with 1.4  106 CFU of S. flexneri 2a
after 5 weeks, after booster immunization. Hematoxylin-eosin-stained light micrographs (magnification, 20) and pathology scores of
histological sections from mice lungs are shown. (C) Lungs from intranasally immunized mice with OMVs delivering S. flexneri 2a O-
polysaccharide antigen, 24 h after intranasal challenge with a lethal dose of S. flexneri 2a displaying normal airspaces, interstitium,
and bronchioles. (D and E) Lung tissues from intranasally immunized mice with OMV vector (D) and from PBS-immunized mice (E)
presenting severe pneumonia with vascular congestion, peribronchial, and perivascular accumulation of inflammatory cells, including
polymorphonuclear neutrophils and mononuclear cells. (F) Pathology scores of histological sections from mouse lungs. A score of 0
indicates no noticeable inflammation or lesions; a score of 1 indicates few or scattered foci affecting ,10% of the tissue, typically
with a few mild perivascular and/or peribronchial lymphoid aggregates; a score of 2 indicates frequent mild perivascular and/or
peribronchial lymphoid aggregates, with or without occasional small foci of pneumonia, with overall inflammation affecting no more
than 10 to 20% of the tissue; a score of 3 indicates moderate lesions, typically with abundant perivascular and peribronchial
lymphoid infiltrates and multiple mild to moderate foci of pneumonia, with inflammation affecting approximately 20 to 30% of the
tissue; a score of 4 indicates extensive pneumonia and marked inflammation affecting more than 30% of the tissue; and a score of 5
indicates extensive lesions with 50% of the tissue affected. (G and H) Intranasal (G) or intraperitoneal (H) immunization with
Salmonella-derived OMVs delivering S. flexneri 2a O-polysaccharide antigen protected BALB/c mice against challenge with 5  107 CFU
wild-type S. flexneri 2a by intraperitoneal administration at 5 weeks and after booster immunization. Ten mice per group were
immunized twice at 4-week intervals with the OMV indicated. Mortality was monitored for 3 weeks after challenge. The numbers in
parentheses refer to the numbers of surviving mice and the total number of mice per group. *, P , 0.05; **, P , 0.01.

that the Salmonella-derived OMV vaccine provides significant protection against virulent
S. flexneri 2a infection in a mouse model of lung pneumonia and shigellosis.

DISCUSSION
Shigellosis is an important cause of morbidity and mortality among both children
and adults, with S. flexneri the most frequently isolated species worldwide, and

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 10

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

accounting for the majority of cases in developing countries (1). Vaccination appears
to be a rational prophylactic approach to its control (25). In a recent study, vaccine
design strategies focused on serotype-specific Shigella LPS-associated O-antigen
induced a strong antibody response against Shigella compared with other conserved
invasion plasmid antigens (Ipas) due to their ability to cross-protect against diverse
serotypes, and the O-polysaccharide antigen (26). Although monophosphoryl lipid A
(MPLA), a low-toxicity derivative of LPS can be used as a commercial adjuvant in vac-
cine development, it functions with a bias toward interferon-s (TRIF) by activating of
Toll-like receptor 4 (TLR4) (27). However, as an antigenic component of a vaccine,
Shigella LPS is not appropriate because of its poorly immunogenic. Therefore, O-anti-
gen in LPS is commonly coupled with protein carriers or functionally assembled on
bacterial glycosyl carrier lipids to induce a stronger and longer-lasting immune
response (7). An innovation of the present study was to combine the biosynthetic sys-
tem of Salmonella glycoconjugates and OMVs, representing an efficient vaccine deliv-
ery system, representing an ideal as a vaccination against Shigella. We report the
enzymatic conjugation of S. flexneri 2a O-polysaccharide antigen to residues of the core-
lipid structure using the oligosaccharyltransferase WaaL (RfaL) from S. Typhimurium
(Fig. 1B). Glycoconjugates of the O-antigen were present in purified Salmonella OMVs, as
confirmed by silver staining and Western blot analysis (Fig. 2C and D).
Rather than simply developing an effective vaccine for the prevention and control of
shigellosis, the ultimate goal of the present study was to develop a vaccine design strat-
egy based on OMVs able to provide cross-protection for a variety of intestinal pathogens.
Therefore, we explored novel strategies to improve the efficiency of cross-protection by
genetic engineering in multihost infected S. Typhimurium. OMVs were derived from the
bacterial outer membrane, which contains a large number of outer membrane proteins
(OMPs) and the conserved lipid A core moiety (28). Through remodeling of the outer
membrane structure, some conservative antigenic components were exposed effectively
to improve the cross-protection to OMVs. Using this strategy in a previous study, the O
antigen chain of LPS was truncated, allowing us to confirm that deletion of the rfbP
gene was effective in improving the cross-protection of Salmonella OMVs against heter-
ologous Salmonella serotypes (23). Furthermore, deletion of Salmonella complete O anti-
gen not only allowed the expression of heterologous S. flexneri O antigen on the
Salmonella LPS core, it also avoided foreign O-antigen becoming recognized by the host
immune system via the LPS carrier (29). The data in the present study confirmed that the
rfbP mutation did not affect the capacity of the S. flexneri 2a O-antigen to conjugate with
the lipid A core (Fig. 2C and D). In addition, during the process of exploring strategies to
enhance cross-protection by Salmonella OMVs, we also knocked out a number of nones-
sential proteins, including FliC, FljB, OmpA, OmpC, and OmpD, which may have affected
the expression of conserved antigens or stimulation of immunity. The results also con-
firmed that deletion of those proteins was able to effectively improve the protection by
OMVs against heterologous serotypes of Salmonella, including Choleraesuis and
Enteritidis, and avian pathogenic Escherichia coli and Shigella flexneri 2a (21, 22). Based
on the results presented above, considering that there are numerous conserved lipid A
core moieties in Salmonella OMVs, we designed an S. flexneri O antigen polysaccharide
chimeric vaccine using a Salmonella OMV vector, effectively providing cross-protection
against multiple serotypes of intestinal pathogens. This glycoconjugated OMV vaccine
not only provided protection against Shigella infection, but also protected against infec-
tion from Salmonella serotypes. This is the most important advantage of this vaccine
beyond the use of wild-type Shigella OMVs and other engineered bacterial applications,
such as the E. coli polysaccharide chimeric OMV vaccine (7). The animal data also con-
firmed our hypothesis that Salmonella OMVs delivering S. flexneri 2a O antigen would
induce a protective efficacy against Shigella infection (Fig. 7).
Safety is a primary consideration for vaccine design, and recent strategies focus on
targeting purified or recombinant subunit vaccines because thus far they represent the
safest route for the development of a vaccine. However, safety is usually accompanied

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 11

Tian et al. Applied and Environmental Microbiology

by low inherent immunogenicity. Therefore, OMVs may represent an ideal approach

that will balance safety with immunogenicity. The proposed approach involves OMVs
naturally released from S. Typhimurium, and the present study established that these
naturally occurring OMVs display no inherent cytotoxicity except at very high concen-
trations (Fig. 2B). However, such a high dose of OMV is not possible when vaccinating.
Over the whole immunization program in which two doses were given, no deaths of
mice were observed, and there was no case of mental disorder or ruffled fur in mice af-
ter immunization, initially confirming that the OMV vaccine was safe in vivo. The levels
of TNF-a in the immunized mice also confirmed this (Fig. 5F). Furthermore, it has been
established that bacterial OMVs can enhance the immunogenicity of antigens that are
naturally poorly immunogenic without the addition of adjuvants (30–32). The success-
ful licensed meningococcal B vaccine (4CMenB) based on OMVs derived from a
Neisseria meningitidis serogroup B (MenB) outbreak strain (B:4:P1.7-2.4) further indi-
cates that as long as the OMVs produced by pathogenic bacteria are safe, there are no
safety or legal concerns (33). Taken together, it is clear that the use of OMVs as delivery
carriers is of incomparable benefit.
In the present study, we demonstrated that both intranasal and intraperitoneal
administration of a Shigella O-antigen vaccine based on OMVs resulted in a robust LPS-
specific antibody response in both the systemic and mucosal compartments (Fig. 3A and
B). It is worth noting that we also detected a certain level of immune response against S.
flexneri 2a LPS in the serum of mice immunized with the OMV vector (Fig. 3A and B). We
speculate that this may be due to the fact that we did not completely remove the OMPs
during the process of S. flexneri 2a purification. According to a previous study, we found
that the OMV vector (DfliC DfljB DrfbP DompA DompC DompD) induced an effective
immune response against OMPs isolated from S. flexneri 2a in mice (22). Furthermore, no
immune response against S. Typhimurium LPS was detected in mice immunized with
the OMV vaccine or OMV vector, because the purity of the commercial Salmonella LPS
was guaranteed. Nevertheless, these data do not affect our judgment that the OMV vac-
cine delivering S. flexneri 2a O-antigen was able to induce an effective immune response
against S. flexneri 2a LPS compared to the OMV vector.
The results of the quantitative ELISA and challenge experiments presented here
indicate that the Salmonella OMV-based vaccine designed to protect against Shigella
challenge would be effective by both intranasal and intraperitoneal administration. In
particular, the benefit of intranasal immunization appears to be greater than that of in-
traperitoneal immunization in providing protection against Shigella infection. This may
be because the intranasal route avoids intragastric and intestinal degradation (21).
However, a major part of the explanation may be that intranasal immunization by the
OMV vaccine induces an immune response more conducive to the elimination of
Shigella infection. Our data confirm that intranasal immunization induced greater levels
of specific IgA in vaginal secretions and murine lungs (Fig. 3C and D), which play an im-
portant role in clearing Shigella infection on the mucosal surface as the first line of
defense against pathogens invading a host (11). Moreover, intranasal immunization
with the OMV vaccine induced a highly indicative Th1 dominant response (high IFN-
g/IL-12), suggesting that vaccinated animals elicit a strong cellular response essential
to combatting Shigella infection (34). Therefore, these factors may be responsible for
intranasal immunization providing more effective protection against Shigella infection,
suggesting that intranasal immunization may be preferable for OMV vaccination to
protect against S. flexneri 2a infection.
An effective glycoconjugate vaccine candidate against virulent pathogens should
be highly immunogenic and able to elicit bactericidal antibodies, enhancing the phag-
ocytosis of pathogens by macrophages (35). The results indicate that the O-antigen
polysaccharide delivered by Salmonella OMVs displays good immunological character-
istics, with bactericidal potential, and providing opsonization (Fig. 3, 5, and 6). We also
found that the use of Salmonella OMVs as a vector is an ideal strategy for the develop-
ment of a glycoconjugate vaccine.

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 12

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

Shigella preferentially invades the colon, eliciting a severe inflammatory response in

humans, and a major obstacle to the development of a Shigella vaccine is the lack of a
clinically relevant nonprimate animal model that strictly mimics human infection with
Shigella (12). Multiple studies have attempted to develop low-cost Shigella infection
models in mice that have good ease of handling and wide availability of immunologi-
cal research tools. Although studies have reported that oral administration of Shigella
does not induce diarrheal disease, other studies have described the pathological histo-
logical features of lung tissue following Shigella infection in mice, localized infection
manifesting as inflammation of the mucosal epithelium closely resembling intestinal
shigellosis (36). Therefore, in the present study, a pulmonary mouse model was used to
evaluate the efficacy of protection against Shigella infection using a Shigella O-polysac-
charide antigen vaccine based on Salmonella OMVs. It was established that intranasal
challenge with a lethal S. flexneri 2a infection caused clear symptoms of severe pneu-
monia in mice immunized with PBS (Fig. 7), while OMV vaccine-immunized mice
received significant protection using the same challenge model, indicating that the
pulmonary model was suitable for the evaluation of the Shigella vaccine. Despite these
advantages, the lack of clinical relevance of the pulmonary model remains a serious
concern. Yang et al. successfully established a mouse model of shigellosis via the intra-
peritoneal injection of Shigella which produces the clinical manifestations of human
shigellosis (37). This model has been used to determine the protection of vaccine can-
didates targeting S. flexneri 2a and 3a infection (38, 39). Therefore, we also used the in-
traperitoneal model to confirm protection by the OMV vaccine. We acknowledge that
the intraperitoneal infection model does not entirely reflect natural human infection,
and additional exploration of higher-level animal models is required, such as an intra-
gastric primate model, to comprehensively evaluate the potential of the OMV vaccine.
Future studies will determine the quantity of the S. flexneri 2a polysaccharide antigen
in Salmonella-derived OMVs by quantification of LPS based on the Kdo method to demon-
strate the efficacy of the coconjugate by Salmonella biosynthesis. These results demon-
strate the advantage of this strategy compared to traditional proteosome-LPS vaccines.
Further studies will be required to establish whether an immune response against Shigella
LPS could be enhanced by increasing the dose of OMV used in immunization and the
number of doses required for the OMV vaccine delivering O-polysaccharide antigen to
provide sufficient immune protection against virulent S. flexneri 2a infection.
In summary, the present study presented a novel strategy of delivering or coconju-
gating a polysaccharide antigen using a biosynthetic Salmonella carrier and OMVs,
demonstrating immunogenicity and protective efficacy of the vaccine against virulent
S. flexneri 2a infection in a murine pulmonary model that verified the potential of the
vaccine using a Shigella O-antigen based on Salmonella OMVs. In addition, the results
highlighted that the most suitable route of administration of this vaccine for the con-
trol of shigellosis was via intranasal administration. Finally, the study will assist in the
development of polysaccharide coconjugated vaccines and aid the development of a
multiple-serotype vaccine platform using a vaccine design strategy based on OMV-
based biosynthetic glycoconjugates.

MATERIALS AND METHODS

Construction of plasmids and mutants. All strains and plasmids utilized in the present study are
listed in Table 1. S. Typhimurium, Escherichia coli, and S. flexneri 2a were cultured in Luria-Bertani (LB)
broth or agar (Difco, Detroit, MI) at 37°C. The primers used in the present study are listed in Table 2.
Transformation of E. coli and S. Typhimurium was performed by electroporation. Transformants were
selected on LB agar plates containing appropriate antibiotics.
For construction of the expression plasmid pQK018, S. flexneri 2a O-antigen gene clusters were di-
vided in two, then amplified by two pairs of primers, 2a-1F/2a-1R and 2a-2F/2a-2R, using the S. flexneri
2a genome as a template. An approximately 6,000-bp fragment of the plasmid vector was amplified by
the primers for the 2a-F-vector/2a-R-vector. Those fragments overlapped and were assembled using a
Gibson assembly kit (New England Biolabs, Beverly, MA) in accordance with the manufacturer’s protocol
(40), resulting in the expression of pQK018 (Fig. 1A and B). Furthermore, the S. flexneri 2a O-antigen
expression plasmid pQK018 was transferred into the previously constructed mutation K016, to

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 13

Tian et al. Applied and Environmental Microbiology

TABLE 1 Bacterial strains and plasmids used in the study

Strain or plasmid Description Source or reference
Strains
S. Typhimurium
x 3761 S. Typhimurium UK-1 48
K016 S. Typhimurium x 3761 DfliC DfljB DompA DompC DompD DrfbP 22
K017 K016 containing pQK018 This study
Shigella
S. flexneri 2a Wild-type virulent strain Lab stock

Plasmids
pQK018 For expression of Shigella flexneri 2a O antigen This study
pYA3337 Asd expression vector Ptrc promoter pSC101ori 49

successfully construct a mutant strain capable of expressing S. flexneri 2a O-antigen (K017) for subse-
quent purification of the OMV vaccine.
OMV purification and measurement of their concentration. OMVs were isolated from Salmonella
essentially as described in a previously published protocol (22). The total protein concentration in the
OMVs was measured using a bicinchoninic acid protein assay (Thermo Pierce, Rockford, IL), in accord-
ance with the manufacturer’s protocol. The LPS content in the same quantity of each OMV sample
(50 m g) was quantified via Kdo (3-deoxy-D-manno-octulosonic acid) analysis with commercial S.
Typhimurium LPS purchased from Sigma-Aldrich (St. Louis, MO) used as a standard (41).
Cryo-electron microscopy, lipopolysaccharide assays, and Western blot analysis. Cryo-EM was
performed as described previously (42). Lipopolysaccharide profiles of the OMVs or strains were pre-
pared and visualized using the method of Hitchcock and Brown (43). After separation of the LPS within
the samples by SDS-PAGE, the different bands were blotted to nitrocellulose membranes, which were
then incubated with blocking solution (5% skimmed milk in Tris-buffered saline) for 2 h, and then incu-
bated with rabbit polyclonal antibodies specific for S. flexneri 2a O-antigen or S. Typhimurium O-antigen
(BD, Franklin Lakes, NJ) at room temperature. An alkaline phosphatase-conjugated goat anti-rabbit im-
munoglobulin G secondary antibody (Sigma-Aldrich) at 1:10,000 dilution was added, followed by incu-
bation at room temperature for 1 h. Immunoreactive bands were detected by the addition of BCIP (5-
bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium solution (Sigma-Aldrich). The reaction was
stopped after 2 min by washing the blots with large volumes of deionized water.
Nanoparticle tracking analysis. The particle size distribution of OMVs was determined by nanopar-
ticle tracking analysis (NanoSight NS300; Malvern Instruments, United Kingdom) using a method
described in our previous study (22). Purified OMV samples were diluted to a concentration acceptable
for analysis within the recommended range of 100 to 120 visible particles per frame. Triplicate, high-sen-
sitivity videos of each sample were recorded within 532-nm green laser light, at a camera level of 14,
using NanoSight 3.0 or 3.1 software, with a threshold value of between 3 and 5. Data for each sample
were derived from the mean of triplicate video statistics. Furthermore, the number of OMVs per milliliter
was normalized to the number of CFU/ml of each strain to calculate the number of OMVs per CFU.
Cytotoxicity of OMVs toward macrophages. RAW 264.7 murine macrophages were obtained from
the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cells were maintained at 37°C
in Dulbecco modified Eagle medium (Gibco BRL, Gaithersburg, MD) supplemented with 10% fetal bo-
vine serum (FBS; HyClone, Logan, UT) in an atmosphere containing 5% CO2. The specific cytotoxicity of
the OMV vaccine or OMV vector in macrophages was determined by seeding RAW 264.7 cells in 24-well
plates (5  105 cells/well) prior to exposing them to different concentrations of OMVs, ranging from
3.075 to 100 m g/ml. The plates were incubated at 37°C in 5% CO2 for 24 h. The supernatants of each well
were collected and then assessed using a Multitox-Fluor Multiplex cytotoxicity assay (Promega, Madison,
WI) in accordance with the manufacturer’s instructions. Supernatants of cells cultured without OMVs or
treated with cell lysis solution (BioVision, Milpitas, CA) were used as negative and positive controls,
respectively. The value for each experiment was determined from the mean value of wells measured in
triplicate. In addition, three independent experiments were performed.
OMV immunization protocol in mice. The research in animals was conducted in compliance with

TABLE 2 Primers used in the study for construction of plasmid expressing S. flexneri 2a O
antigen
Primer Sequence (59–39)
2a-F-vector CGCCTGCATATAGCCCATTTCAGAATGGCCGGCCGCAGTC
2a-R-vector GAAAGTCGTGGTTATACCGCTCATGAGACAATAACCCTG
2a-1F CCGCCATTCTGAAATGGGCTATATGCAGGCGTTTGTGAA
2a-1R AATGCATTTCTTACTCGATAATAAC
2a-2F CTGTGGGATTAACATACCAATTCAC
2a-2R ATTGTCTCATGAGCGGTATAACCACGACTTTCGATGTTG

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 14

Delivery of O Antigen against Shigella Infection via OMVs Applied and Environmental Microbiology

the Animal Welfare Act and regulations related to experiments involving animals (Nanchang, China; ap-
proval 2011-028) and followed the principles stated in the Guide for the Care and Use of Laboratory
Animals (50). All experimental protocols were approved by Nanchang University. All efforts were made
to minimize any suffering of the animals during experimentation.
Six-week-old female BALB/c mice (16 to 22 g) were purchased from Dashuo Biotechnology Co., Ltd.
(Chengdu, China), and used in immunization trials, in which two immunization methods were used.
Suitable groups of 10 mice each were immunized on days 0 and 30 with 20 m g of OMVs in 10 m l of PBS
per mouse by intranasal administration or 5 m g of OMVs in 100 m l of PBS per mouse by intraperitoneal
injection. Nasal administration of 10 m l of PBS or intraperitoneal injection of 100 m l of PBS served as neg-
ative controls for the two methods of immunization, respectively. Blood samples were collected by or-
bital sinus puncture and vaginal secretions collected by repeated flushing and aspiration of a total of
0.15 ml of the same buffer 4 and 8 weeks after the initial immunization. Lung lavage samples were col-
lected 4 weeks after immunization with boosters in the groups receiving intranasal administration. After
centrifugation, serum was obtained, and all samples were preserved at 280°C.
Challenge experiment. A pulmonary pneumonia mouse model and a shigellosis mouse model were
used to evaluate the protective efficacy of the OMV vaccine against virulent Shigella. To construct the pul-
monary pneumonia model, the mice were challenged with 20 m l of S. flexneri 2a suspension (1.4  106
CFU, 100-fold greater than the 50% lethal dose (LD50; LD50 of intranasal administration = 1.2  104 CFU) via
drops administered to the external nares of each mouse using a 1-ml Hamilton syringe 5 weeks after im-
munization with the booster. In addition, the mice in each immunized group of the shigellosis model were
challenged with 100 m l of BSG containing S. flexneri 2a (5  107 CFU, 100-fold greater than LD50, LD50 of in-
traperitoneal administration = 4.5  105 CFU) via the intraperitoneal route. Challenged mice were moni-
tored daily for 30 days, and their survival or death recorded daily. During this period, infected mice were
closely monitored twice per day for a change in their clinical appearance. The clinical appearance was
scored as follows: weight loss greater than 10% = 2; ruffled fur = 2; hunched posture = 2; decrease in
appetite = 2; weakness/inability to obtain feed or drink water = 2; lethargy or morbidity = 2. When the total
clinical appearance score was .8, the mice were immediately euthanized using CO2 in a custom flow
metered chamber. At the conclusion of the animal experiments, all remaining mice were euthanized with
CO2. Animal care was consistent with previous procedures. This animal experiment was performed twice,
and data combined prior to analysis (Fig. 1C).
Splenic lymphocyte proliferation. Mice were euthanized 7 days after primary immunization (three
mice per group), and their spleens were aseptically removed. Spleen cell suspensions were obtained
then passed through a 70-m m sterile cell strainer (Fisher Brand, Houston, TX; one spleen/strainer).
Erythrocytes were lysed with RBC lysis buffer (eBioscience, San Diego, CA). Splenocytes were resus-
pended in RPMI 1640 culture medium supplemented with 5% FBS. The suspended cells were seeded in
96-well culture plates (3  105 cells/well) and then incubated in a 5% CO2 incubator at 37°C. For the ex-
perimental test groups, cells were cultured with S. flexneri 2a LPS or S. Typhimurium LPS (30 ng/well). As
a positive control, cells were cultured with PHA (10 m g/ml), with sterile culture medium as a negative
control. After 72 h of incubation, 20 m l of MTT (5 mg/ml in PBS) was added to each well. After 4 h of incu-
bation at 37°C in a 5% CO2 incubator, supernatants were collected after centrifugation at 200  g for
5 min. Formazan crystals were dissolved by the addition of 100 m l DMSO per well and agitated at 37°C
for 10 min. The optical density at 490 nm was measured using a microplate reader. Cell proliferation was
calculated as a stimulation index (SI), defined as the ratio of the mean absorbance of triplicate wells of
cells stimulated with PHA or LPS to that of the negative control.
Measurement of cytokine production by stomach tissue and mouse splenocytes. Mouse spleno-
cytes were isolated for evaluation of the Th1/Th2 polarizing effects of immunization through measure-
ment of the levels of IFN-g, IL-12 (p40), IL-4, IL-13, IL-6, and TNF-a. The splenocytes of nine mice 4 weeks
after booster immunization with the corresponding antigens were obtained and stimulated for 24 h
with 6 m g/ml LPS isolated from S. flexneri, as previously reported (30). Supernatants from stimulated cells
were collected and cytokines produced by the stimulated cells measured by ELISA. The detailed ELISA
protocol is described below. Briefly, 96-well plates were coated with monoclonal anti-IFN-g, anti-IL-12
(p40), anti-IL-4, anti-IL-13, anti-IL-6, or anti-TNF-a antibodies (BD Biosciences, Mountain View, CA). After
blocking with 1% bovine serum albumin (BSA) in PBS, the samples were added to duplicate wells and
incubated overnight at 4°C. The wells were washed and incubated with biotinylated monoclonal anti-
IFN-g, anti-IL-12 (p40), anti-IL-4, anti-IL-13, anti-IL-6, or anti-TNF-a antibodies (BD Biosciences, Billerica,
MA). Horseradish peroxidase-labeled anti-biotin antibody (Vector Laboratories, Burlingame, CA) was
then added to each well. The reaction was developed by the addition of 3,39,5,59-tetramethyl-benzidine
(Moss, Inc., Pasadena, CA) and terminated with 0.5 N HCl. Standard curves were generated using mouse
recombinant (r) IFN-g, IL-12 (p40), IL-4, IL-13, IL-6, and TNF-a.
Opsonization assay. An opsonization assay was performed using a method described in a previous
study (44). Briefly, mouse peritoneal macrophages were harvested by flushing the peritoneal cavity of
BALB/c mice with precooled PBS. Macrophages collected in the fluid were centrifuged and resuspended
in prewarmed RPMI (Gibco BRL) supplemented with 10% FBS. Approximately 5  105 cells were added
to the wells of 12-well plates and cultivated at 37°C in an atmosphere containing 5% CO2 for 2 h.
Nonadherent cells were then removed during replacement of the culture medium, and then the cells
were incubated at 37°C overnight. Prior to inoculation, a log-phase culture of 106 S. flexneri 2a in PBS
was incubated with immunized or nonimmunized sera (negative control) from mice at 8 weeks after pri-
mary immunization for 1.5 h at 37°C. Macrophages were infected with 5  106 opsonized bacteria (MOI
of 10 bacteria per macrophage) and incubated for 30 min. The macrophages were washed with PBS and
then incubated with gentamicin (50 m g/ml) in RPMI for a further 30 min. The macrophages were washed

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 15

Tian et al. Applied and Environmental Microbiology

and then incubated with RPMI for 0 or 60 min; next, they were lysed with 0.1% Triton X-100. The number
of S. flexneri were determined by CFU count on LB plates.
Serum bactericidal assay. A serum bactericidal assay (SBA) was performed using the protocol
described previously, with some modifications (45). Briefly, S. flexneri 2a were cultured in LB medium to
log phase (OD = 0.2), diluted 1:10,000 in SBA buffer (PBS 1 0.5% BSA) to ;103 CFU/ml, and then distrib-
uted into sterile polystyrene U-bottomed 96-well plates. In each well, a total volume of 50 m l, containing
12.5 m l of the bacterial cells, 25 m l of 2-fold increasing concentrations of mouse serum (starting at a
1:100 dilution), and 12.5 m l of baby rabbit complement (Sigma-Aldrich), was added. The sera were
heated to 56°C for 30 min to inactivate any endogenous complement. To evaluate the possible nonspe-
cific inhibitory effects of rabbit complement or mouse serum, the bacteria were also incubated with ei-
ther the same tested sera plus heat-inactivated complement or SBA buffer and activated complement.
The plates were incubated at 37°C for 90 min, and 10 m l of the sample from each well was spotted onto
LB agar plates. The resultant CFU were enumerated the following day. The bactericidal activity was cal-
culated from the proportion of CFU counted in each dilution of serum with active or inactive comple-
ment compared to CFU from the same serum dilution with no complement. Each sample and control
were tested in triplicate.
Quantitative ELISA. LPS was purified from S. flexneri 2a as described in a previous study, with some
modifications (46). S. flexneri 2a was grown for 12 h at 37°C in 500-ml LB broth cultures. Wet cell pellets
were resuspended in 5 ml of tap water then extracted with 50% (vol/vol) aqueous phenol for 15 min at
70°C. After the addition of 2 volumes of water, the mixture was centrifuged (5,000  g) for 30 min at 4°C
to remove particulate matter. Both the aqueous and the phenol layers were removed and dialyzed sepa-
rately against running tap water for 2 days until all traces of phenol were removed. The samples (aque-
ous and phenol) were pooled and lyophilized. The lyophilized dialysate was dissolved in 200 m l of deion-
ized distilled water and treated sequentially with 2 g of DNase and 500 mg of RNase for 1 h at 37°C, after
which 2 g of proteinase K was added, and the samples were incubated for a further 3 h at 37°C. Each
enzyme-treated sample was subjected to ultracentrifugation at 100,000  g for 16 h at 4°C to yield LPS
as a viscous gel pellet. This pellet was subsequently resuspended in 500 m l of deionized distilled water
and then lyophilized for subsequent experiments.
The antibody response was analyzed by quantitative ELISA. First, 1 m g of LPS suspended in 100 m l of
sodium bicarbonate coating buffer (pH 9.6) was used to coat 96-well plates, followed by incubation
overnight at 4°C. Standard curves of each isotype were created. The concentration of antibody was
quantified in plates coated in triplicate with 2-fold dilutions of an appropriate purified mouse Ig isotype
standard (IgG, IgA, IgG1, and IgG2a; BD Biosciences), starting at 0.5 m g/m l. Each plate was washed three
times with PBS containing 0.1% Tween 20 (PBST) and then blocked with 2% BSA solution for 2 h at room
temperature. A 100-m l volume of suitably diluted sample (serum, 1:100; vaginal wash or lung wash, 1:10)
was added to individual wells in triplicate, followed by incubation for 1 h at room temperature. After a
washing step with PBST, biotinylated goat anti-mouse IgG and IgA (Southern Biotechnology, Inc.,
Birmingham, AL) were added to each well. The wells were developed with a streptavidin-alkaline phos-
phatase conjugate (Southern Biotechnology, Inc.), and then the concentration was measured after the
addition of a p-nitrophenylphosphate substrate (Sigma-Aldrich) in diethanolamine buffer (pH 9.8). The
depth of color (absorbance) was measured at 405 nm using an automated ELISA plate reader (model
EL311SX; BioTek, Winooski, VT). The OD values were plotted against representative concentrations of
the diluted unconjugated antibody solutions to create standard curves using linear regression in
Microsoft Excel (R2=0.98). The final Ig isotype concentration in the antibody sample was calculated from
the corresponding standard curve.
Histology and pathological scores. Twenty-four hours after bacterial infection, animals were eutha-
nized by inhalation of CO2. The lungs were removed, perfused with 10% buffered formalin phosphate
(Fisher, Pittsburgh, PA), dehydrated, and embedded in paraffin. Sections were cut to a thickness of 3 m m
and then stained with hematoxylin-eosin or Giemsa.
Lung injury scores were recorded by a pathologist blinded to the grouping on a 0- to 4-point scale,
based on the following parameters: infiltration of inflammatory cells, epithelial shedding, loss of barrier
integrity, and goblet cell hyperplasia (47).
Statistical analysis. All experiments were conducted in triplicate. A one-way analysis of variance
was performed to determine the statistical significance of differences between mean values of various
experimental and control groups. Data were expressed as means 6 the standard deviations. Means
were compared using a least significant difference test. P , 0.05 was considered significantly different.
All data were analyzed with GraphPad Prism version 5.01.

SUPPLEMENTAL MATERIAL
Supplemental material is available online only.
SUPPLEMENTAL FILE 1, PDF file, 1.2 MB.

ACKNOWLEDGMENTS
This study was supported by the National Natural Science Foundation of China
(grants 32060040 and 31760261), the Natural Science Foundation of Jiangxi Province
(20202BAB206062), the Science and Technology Research Project of Jiangxi Provincial

October 2021 Volume 87 Issue 19 e00968-21 aem.asm.org 16

Delivery of O Antigen against Shigella Infection via OMVs
Education Department (60224), and key research and development projects of the
Jiangxi Natural Science Foundation (20192BBG70067).
Qiong Liu conceived and designed the experiments. Huizhen Tian, Biaoxian Li, Tian
Xu, Haolin Yu, Jingxuan Chen, Haiyan Yu, Shan Li, and Lingbing Zeng performed the
experiments. Huizhen Tian, Lingbing Zeng, Qiong Liu, and Xiaotian Huang analyzed the
data, Huizhen Tian and Qiong Liu wrote the manuscript.
We declare there are no conflicts of interest.
REFERENCES
1. Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam
S, Wu Y, Sow SO, Sur D, Breiman RF, Faruque AS, Zaidi AK, Saha D, Alonso
PL, Tamboura B, Sanogo D, Onwuchekwa U, Manna B, Ramamurthy T,
Kanungo S, Ochieng JB, Omore R, Oundo JO, Hossain A, Das SK, Ahmed S,
Qureshi S, Quadri F, Adegbola RA, Antonio M, Hossain MJ, Akinsola A,
Mandomando I, Nhampossa T, Acácio S, Biswas K, O’Reilly CE, Mintz ED,
Berkeley LY, Muhsen K, Sommerfelt H, Robins-Browne RM, Levine MM.
2013. Burden and aetiology of diarrhoeal disease in infants and young
children in developing countries (the Global Enteric Multicenter Study,
GEMS): a prospective, case-control study. Lancet 382:209–222. https://doi
.org/10.1016/S0140-6736(13)60844-2.
2. Kotloff KL, Riddle MS, Platts-Mills JA, Pavlinac P, Zaidi AKM. 2018. Shigello-
sis. Lancet 391:801–812. https://doi.org/10.1016/S0140-6736(17)33296-8.
3. Sansonetti PJ. 2001. III. Shigellosis: from symptoms to molecular pathoge-
nesis. Am J Physiol Gastrointest Liver Physiol 280:G319–G323. https://doi
.org/10.1152/ajpgi.2001.280.3.G319.
4. Van Den Bosch L, Manning PA, Morona R. 1997. Regulation of O-antigen
chain length is required for Shigella flexneri virulence. Mol Microbiol
23:765–775. https://doi.org/10.1046/j.1365-2958.1997.2541625.x.
5. Morona R, Daniels C, Van Den Bosch L. 2003. Genetic modulation of Shi-
gella flexneri 2a lipopolysaccharide O antigen modal chain length reveals
that it has been optimized for virulence. Microbiology (Reading)
149:925–939. https://doi.org/10.1099/mic.0.26141-0.
6. Levine MM, Kotloff KL, Barry EM, Pasetti MF, Sztein MB. 2007. Clinical trials
of Shigella vaccines: two steps forward and one step back on a long, hard
road. Nat Rev Microbiol 5:540–553. https://doi.org/10.1038/nrmicro1662.
7. Ravenscroft N, Braun M, Schneider J, Dreyer AM, Wetter M, Haeuptle MA,
Kemmler S, Steffen M, Sirena D, Herwig S, Carranza P, Jones C, Pollard AJ,
Wacker M, Kowarik M. 2019. Characterization and immunogenicity of a
Shigella flexneri 2a O-antigen bioconjugate vaccine candidate. Glycobiol-
ogy 29:669–680. https://doi.org/10.1093/glycob/cwz044.
8. Su H, Liu Q, Wang S, Curtiss R, III, Kong Q. 2019. Regulated delayed Shi-
gella flexneri 2a O-antigen synthesis in live recombinant Salmonella enter-
ica serovar Typhimurium induces comparable levels of protective
immune responses with constitutive antigen synthesis system. Theranos-
tics 9:3565–3579. https://doi.org/10.7150/thno.33046.
9. Cohen D, Green M, Block C, Slepon R, Ofek I. 1991. Prospective study of
the association between serum antibodies to lipopolysaccharide O anti-
gen and the attack rate of shigellosis. J Clin Microbiol 29:386–389. https://
doi.org/10.1128/jcm.29.2.386-389.1991.
10. Riddle MS, Kaminski RW, Williams C, Porter C, Baqar S, Kordis A, Gilliland
T, Lapa J, Coughlin M, Soltis C, Jones E, Saunders J, Keiser PB, Ranallo RT,
Gormley R, Nelson M, Turbyfill KR, Tribble D, Oaks EV. 2011. Safety and im-
munogenicity of an intranasal Shigella flexneri 2a Invaplex 50 vaccine.
Vaccine 29:7009–7019. https://doi.org/10.1016/j.vaccine.2011.07.033.
11. Boyaka PN. 2017. Inducing mucosal IgA: a challenge for vaccine adjuvants
and delivery systems. J Immunol 199:9–16. https://doi.org/10.4049/
jimmunol.1601775.
12. Kim YJ, Yeo SG, Park JH, Ko HJ. 2013. Shigella vaccine development: pro-
spective animal models and current status. Curr Pharm Biotechnol
14:903–912. https://doi.org/10.2174/1389201014666131226123900.
13. Tacket CO, Binion SB, Bostwick E, Losonsky G, Roy MJ, Edelman R. 1992.
Efficacy of bovine milk immunoglobulin concentrate in preventing illness
after Shigella flexneri challenge. Am J Trop Med Hyg 47:276–283. https://
doi.org/10.4269/ajtmh.1992.47.276.
14. Kotloff KL, Losonsky GA, Nataro JP, Wasserman SS, Hale TL, Taylor DN,
Newland JW, Sadoff JC, Formal SB, Levine MM. 1995. Evaluation of the
safety, immunogenicity, and efficacy in healthy adults of four doses of
live oral hybrid Escherichia coli-Shigella flexneri 2a vaccine strain EcSf2a-2.
Vaccine 13:495–502. https://doi.org/10.1016/0264-410x(94)00011-b.
October 2021 Volume 87 Issue 19 e00968-21
Applied and Environmental Microbiology
15. Lycke N. 2012. Recent progress in mucosal vaccine development: poten-
tial and limitations. Nat Rev Immunol 12:592–605. https://doi.org/10
.1038/nri3251.
16. Camacho A, de Souza J, Sanchez-Gomez S, Pardo-Ros M, Irache JM,
Gamazo C. 2011. Mucosal immunization with Shigella flexneri outer mem-
brane vesicles induced protection in mice. Vaccine 29:8222–8229. https://
doi.org/10.1016/j.vaccine.2011.08.121.
17. Camacho AI, Irache JM, de Souza J, Sánchez-Gómez S, Gamazo C. 2013.
Nanoparticle-based vaccine for mucosal protection against Shigella flex-
neri in mice. Vaccine 31:3288–3294. https://doi.org/10.1016/j.vaccine
.2013.05.020.
18. Li R, Liu Q. 2020. Engineered bacterial outer membrane vesicles as multi-
functional delivery platforms. Front Mater 7. https://doi.org/10.3389/
fmats.2020.00202.
19. Zhang S, Walters N, Cao L, Robison A, Yang X. 2013. Recombinant Salmo-
nella vaccination technology and its application to human bacterial
pathogens. Curr Pharm Biotechnol 14:209–219.
20. Schetters STT, Jong WSP, Horrevorts SK, Kruijssen LJW, Engels S, Stolk D,
Daleke-Schermerhorn MH, Garcia-Vallejo J, Houben D, Unger WWJ, den
Haan JMM, Luirink J, van Kooyk Y. 2019. Outer membrane vesicles engi-
neered to express membrane-bound antigen program dendritic cells for
cross-presentation to CD81 T cells. Acta Biomater 91:248–257. https://doi
.org/10.1016/j.actbio.2019.04.033.
21. Liu Q, Liu Q, Yi J, Liang K, Hu B, Zhang X, Curtiss R, III, Kong Q. 2016. Outer
membrane vesicles from flagellin-deficient Salmonella enterica serovar
Typhimurium induce cross-reactive immunity and provide cross-protec-
tion against heterologous Salmonella challenge Sci Rep 6:34776. https://
doi.org/10.1038/srep34776.
22. Chen Y, Jie K, Li B, Yu H, Ruan H, Wu J, Huang X, Liu Q. 2020. Immunization
with outer membrane vesicles derived from major outer membrane pro-
tein-deficient Salmonella Typhimurium mutants for cross protection
against Salmonella enteritidis and avian pathogenic Escherichia coli O78
infection in chickens. Front Microbiol 11:588952. https://doi.org/10.3389/
fmicb.2020.588952.
23. Liu Q, Liu Q, Yi J, Liang K, Liu T, Roland KL, Jiang Y, Kong Q. 2016. Outer
membrane vesicles derived from Salmonella Typhimurium mutants with
truncated LPS induce cross-protective immune responses against infec-
tion of Salmonella enterica serovars in the mouse model. Int J Med Micro-
biol 306:697–706. https://doi.org/10.1016/j.ijmm.2016.08.004.
24. Comoy EE, Capron A, Thyphronitis G. 1997. In vivo induction of type 1 and
2 immune responses against protein antigens. Int Immunol 9:523–531.
https://doi.org/10.1093/intimm/9.4.523.
25. Shim DH, Chang SY, Park SM, Jang H, Carbis R, Czerkinsky C, Uematsu S,
Akira S, Kweon MN. 2007. Immunogenicity and protective efficacy offered
by a ribosomal-based vaccine from Shigella flexneri 2a. Vaccine
25:4828–4836. https://doi.org/10.1016/j.vaccine.2007.03.050.
26. Dharmasena MN, Hanisch BW, Wai TT, Kopecko DJ. 2013. Stable expres-
sion of Shigella sonnei form I O-polysaccharide genes recombineered into
the chromosome of live Salmonella oral vaccine vector Ty21a. Int J Med
Microbiol 303:105–113. https://doi.org/10.1016/j.ijmm.2013.01.001.
27. Mata-Haro V, Cekic C, Martin M, Chilton PM, Casella CR, Mitchell TC. 2007.
The vaccine adjuvant monophosphoryl lipid A as a TRIF-biased agonist of
TLR4. Science 316:1628–1632. https://doi.org/10.1126/science.1138963.
28. Kaparakis-Liaskos M, Ferrero RL. 2015. Immune modulation by bacterial
outer membrane vesicles. Nat Rev Immunol 15:375–387. https://doi.org/
10.1038/nri3837.
29. Ravenscroft N, Haeuptle MA, Kowarik M, Fernandez FS, Carranza P,
Brunner A, Steffen M, Wetter M, Keller S, Ruch C, Wacker M. 2016. Purifica-
tion and characterization of a Shigella conjugate vaccine, produced by
aem.asm.org 17
Tian et al.
glycoengineering Escherichia coli. Glycobiology 26:51–62. https://doi.org/
10.1093/glycob/cwv077.
30. Song Z, Li B, Zhang Y, Li R, Ruan H, Wu J, Liu Q. 2020. Outer membrane
vesicles of Helicobacter pylori 7.13 as adjuvants promote protective effi-
cacy against Helicobacter pylori infection. Front Microbiol 11:1340.
https://doi.org/10.3389/fmicb.2020.01340.
31. Tan K, Li R, Huang X, Liu Q. 2018. Outer membrane vesicles: current status
and future direction of these novel vaccine adjuvants. Front Microbiol
9:783. https://doi.org/10.3389/fmicb.2018.00783.
32. Liu Q, Tan K, Yuan J, Song K, Li R, Huang X, Liu Q. 2018. Flagellin-deficient
outer membrane vesicles as adjuvant induce cross-protection of Salmo-
nella Typhimurium outer membrane proteins against infection by heter-
ologous Salmonella serotypes. Int J Med Microbiol 308:796–802. https://
doi.org/10.1016/j.ijmm.2018.06.001.
33. Rappuoli R, Pizza M, Masignani V, Vadivelu K. 2018. Meningococcal B vaccine
(4CMenB): the journey from research to real world experience. Expert Rev
Vaccines 17:1111–1121. https://doi.org/10.1080/14760584.2018.1547637.
34. Yagnik B, Sharma D, Padh H, Desai P. 2019. Oral immunization with Lac-
Vax OmpA induces protective immune response against Shigella flexneri
2a ATCC 12022 in a murine model. Vaccine 37:3097–3105. https://doi
.org/10.1016/j.vaccine.2019.04.053.
35. Shimanovich AA, Buskirk AD, Heine SJ, Blackwelder WC, Wahid R, Kotloff
KL, Pasetti MF. 2017. Functional and antigen-specific serum antibody lev-
els as correlates of protection against shigellosis in a controlled human
challenge study. Clin Vaccine Immunol 24:e00412-16. https://doi.org/10
.1128/CVI.00412-16.
36. Wierzba TF. 2021. The search for an efficacious shigella vaccine. Lancet
Infect Dis 21:446–447. https://doi.org/10.1016/S1473-3099(20)30588-0.
37. Yang JY, Lee SN, Chang SY, Ko HJ, Ryu S, Kweon MN. 2014. A mouse
model of shigellosis by intraperitoneal infection. J Infect Dis 209:203–215.
https://doi.org/10.1093/infdis/jit399.
38. Medeiros PQ, Ledwaba SE, Bolick DT, Giallourou N, Yum LK, Costa DVS,
Oriá RB, Barry EM, Swann JR, Lima AM, Agaisse H, Guerrant RL. 2019. A
murine model of diarrhea, growth impairment and metabolic disturban-
ces with Shigella flexneri infection and the role of zinc deficiency. Gut
Microbes 10:615–630. https://doi.org/10.1080/19490976.2018.1564430.
39. Hajialibeigi A, Amani J, Gargari SLM. 2021. Identification and evaluation
of novel vaccine candidates against Shigella flexneri through reverse vac-
cinology approach. Appl Microbiol Biotechnol 105:1159–1173. https://doi
.org/10.1007/s00253-020-11054-4.
October 2021 Volume 87 Issue 19 e00968-21
Applied and Environmental Microbiology
40. Silayeva O, Barnes AC. 2018. Gibson Assembly facilitates bacterial allelic
exchange mutagenesis. J Microbiol Methods 144:157–163. https://doi
.org/10.1016/j.mimet.2017.11.023.
41. Osborn MJ. 1963. Studies on the Gram-negative cell wall. I. Evidence for
the role of 2-keto- 3-deoxyoctonate in the lipopolysaccharide of Salmo-
nella Typhimurium. Proc Natl Acad Sci U S A 50:499–506. https://doi.org/
10.1073/pnas.50.3.499.
42. Hu B, Morado DR, Margolin W, Rohde JR, Arizmendi O, Picking WL,
Picking WD, Liu J. 2015. Visualization of the type III secretion sorting plat-
form of Shigella flexneri. Proc Natl Acad Sci U S A 112:1047–1052. https://
doi.org/10.1073/pnas.1411610112.
43. Hitchcock PJ, Brown TM. 1983. Morphological heterogeneity among Salmo-
nella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J
Bacteriol 154:269–277. https://doi.org/10.1128/jb.154.1.269-277.1983.
44. Meyer Næss L, Aarvak T, Aase A, Oftung F, Høiby EA, Sandin R, Michaelsen
TE. 1999. Human IgG subclass responses in relation to serum bactericidal
and opsonic activities after immunization with three doses of the Norwe-
gian serogroup B meningococcal outer membrane vesicle vaccine. Vac-
cine 17:754–764. https://doi.org/10.1016/S0264-410X(98)00259-X.
45. McIntosh ED, Bröker M, Wassil J, Welsch JA, Borrow R. 2015. Serum bacteri-
cidal antibody assays: the role of complement in infection and immunity.
Vaccine 33:4414–4421. https://doi.org/10.1016/j.vaccine.2015.07.019.
46. McKay GA, Woods DE, MacDonald KL, Poole K. 2003. Role of phosphoglu-
comutase of Stenotrophomonas maltophilia in lipopolysaccharide biosyn-
thesis, virulence, and antibiotic resistance. Infect Immun 71:3068–3075.
https://doi.org/10.1128/IAI.71.6.3068-3075.2003.
47. Mitra S, Chakrabarti MK, Koley H. 2013. Multi-serotype outer membrane
vesicles of Shigellae confer passive protection to the neonatal mice against
shigellosis. Vaccine 31:3163–3173. https://doi.org/10.1016/j.vaccine.2013
.05.001.
48. Luo Y, Kong Q, Yang J, Mitra A, Golden G, Wanda SY, Roland KL, Jensen
RV, Ernst PB, Curtiss R, III. 2012. Comparative genome analysis of the high
pathogenicity Salmonella Typhimurium strain UK-1. PLoS One 7:e40645.
https://doi.org/10.1371/journal.pone.0040645.
49. Maddux JT, Stromberg ZR, Curtiss R, III, Mellata M. 2017. Evaluation of
recombinant attenuated salmonella vaccine strains for broad protection
against extraintestinal pathogenic Escherichia coli. Front Immunol 8:1280.
https://doi.org/10.3389/fimmu.2017.01280.
50. National Research Council (US) Committee for the Update of the Guide
for the Care and Use of Laboratory Animals. 2011. Guide for the care and
use of laboratory animals, 8th ed. National Academies Press, Washington,
DC.
aem.asm.org 18