Available online at www.sciencedirect.

com

Diagnostic Microbiology and Infectious Disease 60 (2008) 25 – 32

www.elsevier.com/locate/diagmicrobio
Parasitology

Characterization of Trypanosoma cruzi isolated from humans, vectors,

and animal reservoirs following an outbreak of acute human
Chagas disease in Santa Catarina State, Brazil
Mário Steindela , Letícia Kramer Pachecoa , Daniele Scholla , Marcos Soaresa ,
Milene Hoehr de Moraesa , Iriane Egera,b , Cecília Kosmanna , Thais Cristine Marques Sinceroa ,
Patrícia Hermes Stocoa , Silvane Maria Fonseca Murtac ,
Carlos José de Carvalho-Pintoa , Edmundo Carlos Grisarda,⁎
a
Departamento de Microbiologia e Parasitologia, Universidade Federal de Santa Catarina, Florianópolis, 88040-900, SC, Brazil
b
Universidade do Vale do Itajaí, Itajaí, 88302-202, SC, Brazil
c
Centro de Pesquisas René Rachou/FIOCRUZ, Belo Horizonte, 30190-002, MG, Brazil
Received 27 April 2007; accepted 21 July 2007

Abstract

During March 2005, 24 cases of acute human Chagas disease were detected in Santa Catarina State, southern Brazil, all of them related to
the ingestion of Trypanosoma cruzi-contaminated sugar cane juice. Following field studies allowed the isolation of 13 T. cruzi strains from
humans, opossums (Didelphis aurita and Didelphis albiventris), and vectors (Triatoma tibiamaculata). The isolated strains were
characterized by multilocus enzyme electrophoresis (MLEE) and analysis of the spliced-leader and 24Sα rRNA genes. The assays revealed
that all strains isolated from humans belong to the TcII group but revealed a TcII variant pattern for the phosphoglucomutase enzyme. Strains
isolated from opossums also showed a TcI profile in all analysis, but strains isolated from triatomines revealed a mixed TcI/TcII profile by
MLEE. No indication of the presence of Trypanosoma rangeli was observed in any assay. Considering that mixed strains (TcI/TcII) were
isolated from triatomines in an area without active vectorial transmission to humans and that all strains isolated from humans belong to the
TcII group, our results show that T. cruzi TcI and TcII groups are circulating among reservoirs and vectors in southern Brazil and indicate that
selection toward TcII group in humans may occur after ingestion of a mixed (TcI/TcII) T. cruzi population.
© 2008 Elsevier Inc. All rights reserved.

Keywords: Human Chagas disease; Trypanosoma cruzi; Oral infection; MLEE; Strain characterization; PCR

1. Introduction by the parasite, and 70 to 80 million individuals are living in

Trypanosoma cruzi, the etiologic agent of Chagas disease,
is a protozoan parasite that infects a broad range of
triatomines and mammalian species, including man, causing
the most important parasitic infection in Latin America due
to its impact in terms of public health and economy (Dias
et al., 2002). Around 14 million people are currently infected
⁎ Corresponding author. Department of Microbiology, Immunology and
Parasitology, UFSC, Florianópolis 88040-900, SC, Brazil. Tel.: +55-48-
37215164; fax: +55-48-37219258.
E-mail address: grisard@ccb.ufsc.br (E.C. Grisard).
0732-8893/$ – see front matter © 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.diagmicrobio.2007.07.016
areas with high risk of transmission (World Health
Organization [WHO], 2002).
Primarily, T. cruzi is transmitted to man by deposition of
contaminated feces of triatomine vectors in mucous mem-
branes, but outbreaks of oral transmission of the parasite by
ingestion of contaminated food with infected triatomines or
their dejection have been reported in Brazil, Colombia, and
Mexico (Silva et al., 1968; Shikanai-Yasuda et al., 1991;
Valente et al., 1999; Coura et al., 2002; WHO, 2002).
After infection by T. cruzi, the acute phase in humans
lasts for 4 to 8 weeks and can be associated by clinical
manifestations such as signs of the parasite entry and a
general malaise (WHO, 2002). Depending on the geographic
26 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32

region, around 60% to 70% of the infected patients remain
asymptomatic, characterizing the indeterminate form of the
disease (Moncayo, 2003). However, 20% to 35% of the
infected individuals may develop irreversible lesions of
the autonomous nervous system in the heart, esophagus, and
colon in the chronic phase of the infection (Prata, 2001;
Moncayo, 2003). Furthermore, severe electrocardiographic
abnormalities revealing the chagasic cardiomyopathy may
be observed in almost 30% of the chronically infected
individuals (WHO, 2002).
Based on several markers used for characterization of
T. cruzi strains, the taxon was divided into 2 distinct major
phylogenetic lineages or groups named TcI and TcII (Anon,
1999). TcII group is further divided into 5 subgroups
named TcIIa to TcIIe (Yeo et al., 2005; Westenberger et al.,
2006). Despite a few exceptions, in the south of the
Amazon basin and throughout Brazil, TcI and TcII groups
basically correspond to parasites related to the sylvatic and
domestic transmission cycles, respectively (Anon, 1999).
However, in areas north of the Amazon basin like
Venezuela and Mexico, human infection is most commonly
due to parasites from the TcI group (Miles et al., 1981;
Bosseno et al., 2002).
It is well established that the isolation method, in vitro or
in vivo maintenance, differential susceptibility of triatomine
vectors, host and/or parasite genetic characteristics, or even
host immune system may act as selective mechanisms for
natural parasite populations, having a major impact on the
parasite characterization (Macedo and Pena, 1998; Macedo
et al., 2004; Pinho et al., 2000). Furthermore, the overlapping
of the sylvatic and domestic cycles (Pinho et al., 2000;
Diosque et al., 2003; Macedo et al., 2004), the observation of
natural and stable infection of free-living nonhuman
primates (Leontopithecus rosalia) by T. cruzi II parasites
(TcII) (Lisboa et al., 2004), the occurrence of mixed TcI/TcII
strain infection in sylvatic triatomines (Bosseno et al., 1996),
as well as the known intra- and interstrains heterozygosity
(Ruiz-Garcia et al., 2000; Sturm et al., 2003; El-Sayed et al.,
2005) must be considered as complicating factors for parasite
characterization. This work aims to present the characteriza-
tion of T. cruzi strains isolated from humans, reservoirs and
vectors during the outbreak of acute human Chagas disease
in southern Brazil.
viduals ingested sugar cane juice in the afternoon of
February 13, 2005, in a single food court located at the
municipality of Navegantes, approximately 100 km north
of Florianópolis (Fig. 1). A detailed search for triatomines
and possible T. cruzi reservoirs was carried out in the
identified food court surroundings, including a forested
area located 100 m behind the building, as well as in other
food courts along the same highway, involving the
Universidade Federal de Santa Catarina (UFSC) Staff and
regional health authorities.
2.2. Parasites
The origin of all parasites and strains included in this
study are shown in Table 1. In this study, T. cruzi strains from
humans, reservoirs, and triatomine vectors, captured by the
Santa Catarina State Health Authority staff (Diretoria de
Vigilância Epidemiológica/State of Santa Catarina Health
Staff), were isolated by hemoculture and/or xenoculture in a
liver infusion tryptose (LIT) medium. All the collected
samples were also examined for the presence of T. cruzi by
both wet and Giemsa-stained smears. T. cruzi SC28 and
Colombiana (TcI group), Y (TcII group) strains, and Try-
panosoma rangeli SC58 strain were used as controls for
spliced-leader (SL) and 24Sα rDNA polymerase chain
reaction (PCR) assays. Standard T. cruzi strains representing
zymodemes Z1 (Barra Seca), Z2 (Y), and ZB (CL) were used
as controls in the isoenzymatic assays. In this study, we will
refer to T. cruzi strains of zymodemes Z1 and Z2 as TcI and
TcII strains, respectively.
2.3. Multilocus enzyme electrophoresis
Isoenzymatic characterization of the strains was carried
out as described by Steindel et al. (1995). Briefly, the
parasites were harvested from the LIT medium and washed
twice in cold Krebs–Ringer–Tris buffer, pH 7.4, at 2000 × g

2. Material and methods

2.1. Geographic and temporal description of the outbreak

In March 2005, several cases of an unknown febrile

hemorrhagic disease with 3 fatal cases were reported by the
health authorities of the State of Santa Catarina (SC),
southern Brazil, being associated with the ingestion of sugar
cane juice in a roadside food court. Based on epidemiologic
data collected from the patients with confirmed Chagas
disease diagnosis and considering their clinical symptoms, Fig. 1. Map showing the SC State (shaded) in Brazil and the location of the
which will be the object of another publication, all indi- outbreak location (star) at the Navegantes Municipality in the SC State.
 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32 27

Table 1
Parasite species and strains used in the study
Parasite Strains Hosts Group Reference
T. rangeli SC58 E. dasythrix – Steindel et al. (1991)
T. cruzi SC28 D. aurita TcI Steindel et al. (1995)
Colombiana Human (chronic phase) TcI Murta et al. (1998)
Y Human (acute phase) TcII Pereira da Silva and Nussenzweig (1953)
CL T. infestans TcII Brener and Chiari (1963)
Barra Seca T. infestans TcI Filardi and Brener (1987)
SC90 D. aurita TcI/TcII This study
SC91 D. albiventris TcI/TcII This study
SC92–SC93 T. tibiamaculata TcI/TcII This study
SC94–SC102 Human (acute phase) TcII This study

and submitted to an osmotic lysis with an enzymatic
stabilizer (2 mmol/L dithiotreitol, 2 mmol/L ε-amino-caproic
acid, 2 mmol/L Na2EDTA, pH 7.4). Centrifugation was done
at 15 000 × g for 1 h at 4 °C and the resulting enzymatic
extract stored as 15-μL beads in liquid nitrogen. A total of
6 enzymes were analyzed: glucose phosphate isomerase
(GPI—E.C. 5.3.1.9.), malic enzyme (ME—E.C. 1.1.1.40.),
glucose-6-phosphate dehydrogenase (E.C. 1.1.1.49.), phos-
phoglucomutase (PGM—E.C. 2.7.5.1.), aspartate amino-
transferase (E.C. 2.6.1.1.), and alanine aminotransferase
(2.6.1.2.). The total enzymatic extract electrophoresis and
the specific enzyme detection were carried out as for-
merly described by Carneiro et al. (1990) and the results
digitally recorded.
2.4. DNA extraction and PCR assays
DNA from all strains was extracted by standard phenol–
chloroform protocols from logarithmic growth phase
cultures. After extraction, the concentration and purity of
the extracted DNA were assessed by spectrophotometry and
the samples stored at −20 °C. The identity of the isolated
strains was performed by specific amplification of the kDNA
minicircle using primers S-35 and S-36 (Sturm et al., 1989).
Characterization of the SL (Fernandes et al., 2001) and 24Sα
rDNA (Souto et al., 1996) genes was performed by PCR
amplification using primers TC1/TC2/TC3/TR/ME and D-
71/D-72, respectively (Table 2). These assays allow the
confirmation of the parasite identity and typing of the
isolated strains according to the T. cruzi major phylogenetic
lineages (TcI or TcII). The expected bands for the multiplex
SL amplification are of approximately 200 bp (TcI), 250 bp
(TcII), and 150 bp (TcIII or Z3) for T. cruzi, and
approximately 100 bp for T. rangeli. For the 24Sα rDNA,
the expected amplification product is of approximately 110
and 125 bp for TcI and TcII strains, respectively.
DNA amplification was carried out in a Mastercycler
Gradient thermocycler (Eppendorf, Hamburg, Germany) as
described by each author. All pre- and post-PCR amplifica-
tion procedures were performed in distinct areas not sharing
reagents or equipment to avoid carry-on contamination. Fifty
to 100 ng of DNA from standard T. cruzi strains belonging
to the TcI (SC28 and Colombiana) and TcII (Y) groups and
T. rangeli strain (SC58) were used as positive controls in all
assays. Tubes without DNA (negative control) were included
in each reaction set. The resulting PCR products were
resolved in 10% polyacrylamide gels stained with ethidium
bromide and digitally recorded.
3. Results

Table 2 During the outbreak herein described, 24 patients were

Sequence and reference of each primer used for T. cruzi and/or T. rangeli
detection and characterization
Primer Sequence (5′–3′)
S-35 AAATAATGTACGGGTGGAGATGCATGA Sturm et al. (1989)
S-36 GGGTTCGATTGGGGTTGGTGT
TC1 ACACTTTCTGTGGCGCTGATCG
TC2 TTGCTCGCACACTCGGCTGCAT
TC3 CCGCGWACAACCCCTMATAAAAATG
TR CCTATTGTGATCCCCATCTTCG
ME TACCAATATAGTACAGAAACTG
D-71 AAGGTGCGTCGACAGTGTGG
D-72 TTTTCAGAATGGCCGAACAGT
infected by ingestion of sugar cane juice resulting in 3
deaths. A total of 9 T. cruzi strains were isolated from these
Reference
individuals by hemoculture of venous blood in the LIT
medium, and after a maximum of 60 days' maintenance in
Sturm et al. (1989)
culture, DNA was extracted for characterization assays.
Fernandes et al.
(2001) Despite the combined capture effort, only 6 adult marsupials
Fernandes et al. were captured (2 Didelphis albiventris, 3 Didelphis aurita,
(2001) and 1 Marmosa cinerea), of which natural T. cruzi infection
Fernandes et al. was detected in 1 D. albiventris and 1 D. aurita, from which
(2001)
parasites were isolated by hemoculture. From a total of 38
Fernandes et al.
(2001) Triatoma tibiamaculata trapped in the forested area behind
Fernandes et al. the food court, 12 tested positive for T. cruzi, from which it
(2001) was possible to isolate strains by xenoculture from 2
Souto et al. (1996) individual triatomine bugs (Table 1). Only a single adult
Souto et al. (1996)
triatomine was captured inside a nearby peridomestic area,
28 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32

Fig. 2. An ethidium bromide stained 10% polyacrylamide gel showing the amplification products obtained for the SL gene for each strain. MW = molecular
weight marker (100-bp ladder); Tr = T. rangeli SC58 strain; TcII = T. cruzi Y strain; SC28 (TcI) = T. cruzi SC28 TcI strain; COL (TcI) = T. cruzi Colombiana TcI
strain; NC = negative control (no DNA added); Tt = T. tibiamaculata; Da = D. aurita; Dal = D. albiventris; H = human.

being the 1st report of this species inside human-made
constructions in the SC State. Due to the interest on this
species biology, the remaining triatomines were used to
establish a colony at UFSC for further studies. Strains
isolated from opossums and triatomines were cultivated for a
maximum of 60 days (4 passages) before characterization
assays. The identity of the parasite strains isolated from
humans, opossums, and triatomines were confirmed by
morphology and by specific PCR amplification of the
conserved region of the kDNA minicircle as described by
Vallejo et al. (1999) to be T. cruzi.
All patients with confirmed T. cruzi infection were treated
with 5 mg/kg of body weight/day using Benznidazol®
(Roche, Basel, Switzerland) for 60 to 90 days. Posttreatment
follow-ups have been done every 6 months using clinical
(electrocardiogram and chest radiography), parasitologic
(hemoculture), immunologic (indirect immunofluorescence
assay [IFA] and enzyme-linked immunosorbent assay
[ELISA]), and molecular (PCR) methods. Thus far, no
parasites have been detected, and complete recovery is
assumed. The diagnostic clinical follow-up after treatment
and epidemiologic aspects of these cases are the object of
another publication.
Analysis of the SL (Fig. 2) and 24Sα rRNA (Fig. 3) genes
revealed that all strains isolated from humans (SC94 to
SC102) belong to the TcII group, respectively, revealing the
expected 250- and 125-bp bands as also observed for the
control TcII (Y) strain. Isolates from triatomine bugs (SC92
and SC93) showed a clear mixed profile (TcI/TcII) on the
phenotypic multilocus enzyme electrophoresis (MLEE)
analysis (Fig. 4A and B). This observation was not clear
on the SL PCR assay (Fig. 2), where isolates SC90–SC93
revealed the same diagnostic band as obtained for the SC28
strain (TcI) isolated in the SC State but differing in pattern
and size from the Colombiana (TcI) strain. Strains SC90–
SC93 presented bands slightly smaller than the originally
described diagnostic bands of approximately 200 bp (TcI)
and approximately 250 bp (TcII) as observed in the T. cruzi
TcI standard strain (Colombiana) (Fig. 2). Also, we have
observed the amplification of additional bands of approxi-
mately 125, 150, and 270 bp for the Colombiana strain not
described in the original article by Fernandes et al. (2001).
Strain SC28 revealed the same bands as observed for the
Colombiana strain and an additional approximately 120-bp
band as also observed for strains SC90–SC93 isolated in the
SC State (Fig. 2).
The TcII control strain (Y) showed the amplification
of 4 additional bands of approximately 125, 140, 290,
and 300 bp, which were also observed for the TcII
strains (SC94–SC102) but not previously described.

Fig. 3. An ethidium bromide stained 10% polyacrylamide gel showing the amplification products obtained for the 24Sα rDNA for each strain. MW = molecular
weight marker (100-bp ladder); Tr = T. rangeli SC58 strain; TcII = T. cruzi Y strain; SC28 (TcI) = T. cruzi SC28 TcI strain; COL (TcI) = T. cruzi Colombiana TcI
strain; NC = negative control (no DNA added); Tt = T. tibiamaculata; Da = D. aurita; Dal = D. albiventris; H = human.
 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32
Fig. 4. Zymograms obtained for the GPI (A) and PGM (B) enzymes for the
T. cruzi strains isolated from humans, opossums, and triatomine bugs during
the outbreak of Chagas disease in the State of SC by MLEE analysis. TcI and
TcII groups and ZB zymodeme are represented by T. cruzi Barra Seca, Y,
and CL standard strains, respectively. Tt = T. tibiamaculata; Da = D. aurita;
Dal = D. albiventris; H = human.
Considering that the original description of this SL assay
by Fernandes et al. (2001) used low-resolution ethidium
bromide-stained agarose gels, the herein presented results
may indicate a differential amplification pattern for strains
from distinct groups (TcI or TcII) and/or geographic
origins, but further studies addressing such variability must
be performed.
Isoenzymatic analysis agreed with both the SL and 24Sα
rRNA PCR data showing a TcII profile for all strains isolated
from humans (SC94–SC102). Interestingly, these samples
revealed a TcII variant pattern for the PGM enzyme (Fig.
4B). Because no subtyping of TcII strains were performed,
we cannot infer that this variation is a TcII group subtype
(TcIIa–TcIIe) or even a new distinct genotype. A typical TcI
pattern was observed for strains SC90 and 91 isolated from
opossums (Fig. 4A and B) as confirmed by both PCR assays
(Figs. 2 and 3). Strains SC92 and SC93 isolated from
T. tibiamaculata clearly revealed a mixed TcI/TcII isoenzy-
matic profile (Figs. 4A and B), which was not confirmed by
both PCR assays (Fig. 2).
Strains isolated from humans (SC94–SC102) showed the
typical 125-bp band (Fig. 3) as also observed for the TcII
control strain (Y) on the 24Sα rDNA assay as described by
Souto et al. (1996). In this assay, strains SC90 and SC91
isolated from opossums clearly demonstrated the same
amplification pattern as observed for the TcI control strain
29
(SC28) but differing from the Colombiana strain. The SC28
strain, isolated in the SC State and characterized as TcI
(Steindel et al., 1995), revealed an intermediate band of
approximately 120 bp (Fig. 3).
Strains SC92 and SC93 isolated from T. tibiamaculata
showed on the 24Sα rDNA assay a distinct amplification
pattern than all control and SC strains (Fig. 3), not sharing
the 110- or 125-bp bands and, thus, not allowing a clear
definition of the strain classification. Considering the clear
TcI/TcII mixture on strains SC92 and SC93 as revealed by
MLEE analysis (Fig. 4), the 24Sα rDNA assay was not able
to clearly detect both T. cruzi populations in triatomines,
and the SL gene assay only clearly detected the existence
of a TcI population (Fig. 2). Moreover, the band pat-
tern obtained for SC92 and SC93 strains isolated from
T. tibiamaculata neither match the band pattern obtained for
human strains (SC94–SC102) nor match with the strains
isolated from Didelphis spp. (SC90 and SC91) (Fig. 3).
On the 24Sα rDNA assay, the Colombiana strain revealed
a more distinct amplification pattern than the TcI strains
isolated in the SC State, including the SC28 (TcI) control
strain (Fig. 3), as also observed on the SL gene analysis
(Fig. 2). Thus, the variability observed for the SC93 and
SC94 strains must be further addressed and can be due to
the lack of sensitivity of this assay to detect TcI/TcII mixed
infections. No T. rangeli infections were recorded among the
isolates in any assay, and all employees of the food court
tested negative for T. cruzi infection in serologic assays (IFA
and ELISA).
4. Discussion
The 1st report of acute Chagas disease acquired by oral
route in Brazil occurred in 1965 in the State of Rio Grande
do Sul, when 17 patients were simultaneously infected,
resulting in 6 fatal cases (Silva et al., 1968). From 1968 to
2000, outbreaks of acute Chagas disease by oral transmission
were reported in Brazil (Shikanai-Yasuda et al., 1991; Coura
et al., 2002). Epidemiologic studies of some of these
outbreaks that occurred in the northern region of the country
pointed out that ingestion of contaminated palm fruit juice
(açaí) was strongly associated with these infections (Valente
et al., 1999).
Despite having borders with 2 endemic states (Rio
Grande do Sul and Paraná) and Argentina, and the presence
of naturally infected reservoirs and vectors, the State of SC is
considered as a nonendemic area for human Chagas disease.
Epidemiologic and biologic studies carried out for the last 25
years at the coastal area of the State covered by the Atlantic
rain forest revealed natural infection by T. cruzi among
marsupials (D. aurita and D. albiventris), rodents (Echimys
dasythrix and Akodon sp.), and sylvatic triatomines (Pan-
and Rhodnius domesticus) (Steindel et al., 1995), as well as
the occurrence of T. rangeli in single or mixed infections
with T. cruzi (Steindel et al., 1991; Grisard et al., 1999).
30 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32
Characterization of 68 T. cruzi strains isolated from sylvatic
reservoirs and vectors in this state showed that 91.5% (54) of
the strains belong to the T. cruzi TcI group and 3 (5.1%) to
the TcII group, and 2 (3.4%) presented a mixture of TcI/TcII
strains (Steindel et al., 1995).
In the present study, a total of 13 T. cruzi strains were
isolated from infected humans as well as from triatomine
vectors and opossums captured in the outbreak area.
Characterization of the isolated strains by MLEE and PCR
analysis of the SL and 24Sα rRNA genes showed that all the
strains isolated from humans undoubtedly belonged to the
TcII group. Strains isolated from T. tibiamaculata (SC92 and
SC93) had mixed TcI/TcII profiles as confirmed by MLEE
(Fig. 4). The 24Sα rDNA assay (Fig. 3) was not sensitive
enough to detect this mixed profile and indicated the
existence of a size variability of this gene among strains
SC28 and Colombiana, both belonging to the same TcI
group. Strains SC90 and SC91 isolated from sylvatic
mammals (D. aurita and D. albiventris) showed a clear TcI
profile by PCR assays (Figs. 2 and 3) and by MLEE (Fig. 4).
Thus, considering the observed variation on the character-
ization assays and the limitations of some used techniques in
detecting mixed infections, we strongly encourage the
combined use of specific phenotypic and genotypic markers
for T. cruzi characterization.
Interestingly, primers D71/D72 directed to the 24Sα
rRNA gene generated a distinct amplification pattern for
strains isolated during the outbreak from opossums (SC90
and SC91) and triatomines (SC92 and SC93), as well as for
the SC28 and Colombiana strains used as TcI standard
(Figs. 2 and 3). These observations point out a disagreement
with the results reported by Souto et al. (1996), demonstrat-
ing that it is not possible to group the parasites based on the
PCR product size alone. Based on this size variation,
preliminary assays carried out with 5 TcI T. cruzi strains
from SC and Rio Grande do Sul States, southern Brazil,
confirmed our findings (data not shown), but further studies
must be performed to address such variation.
In the SC State, mixed TcI/TcII infection in adults
P. megistus was previously reported (Steindel et al., 1995).
These findings reinforced the occurrence of hybrid T. cruzi
populations under natural conditions, also named as T. cruzi
group III or TcIII (Macedo et al., 2004). However,
considering the absence of active transmission of T. cruzi
to humans in the state and the existing records of circulation
of TcII strains in wild animals such as the golden lion
tamarins (L. rosalia) (Lisboa et al., 2004) and TcI/TcII in
opossums (D. aurita) (Bosseno et al., 1996), our results
reinforce the natural mixing and transmission of TcI/TcII
strains among reservoirs and hosts, pointing out for the
1st time the transmission of such mixed strains by
T. tibiamaculata in the State of SC, Brazil.
Studies in the Paraguayan Chaco have associated T. cruzi
TcI and TcII strains with arboreal and terrestrial mammalian,
respectively (Yeo et al., 2005). On the other hand, findings of
T. cruzi infection in mammals with or without mixed
arboreal/terrestrial behavior harboring a mix of TcI/TcII
strains have been reported for D. aurita (Pinho et al., 2000)
and L. rosalia (Lisboa et al., 2004).
Studies carried out in Bolivia revealed mixed T. cruzi TcI/
TcII infections in Triatoma infestans (Bosseno et al., 1996)
and in humans (Breniere et al., 1998). Based on these
observations, these authors proposed a “synanthropic
mammals–vector cycle” model suggesting that a restricted
cycle of transmission involving humans and vectors supports
a selection toward TcII strains in humans. However, in some
areas like Mexico, a clear predominance of TcI group
parasites infecting humans, hosts, and triatomines can be
observed (Bosseno et al., 2002).
In Brazil, as well as in the south of the Amazon basin area,
the majority of strains from chronic chagasic patients present
a TcII pattern, whereas both TcI and TcII strains were found
in acute infection in humans (Luquetti et al., 1986; Di Noia
et al., 2002). Thus, the detection of single TcII in acutely
infected humans in our study can be explained by i) a
predominant infection by a TcII group clones, ii) a selection
of the TcII group by humans, or iii) the lack of sensitivity of
the available methods in detecting cryptic presence of TcI
clones because parasites of this group are capable of
sustainable infections in humans (Miles et al., 1981; Bosseno
et al., 2002).
The biologic diversity of the T. cruzi taxon could be
attributed to the genetic potential of each vertebrate host in
selecting parasite clones (Dvorak, 1984; Veloso et al., 2005)
but not having a clear relationship of distinct clones with the
distinct Chagas disease pathologies (Buscaglia and Di Noia,
2003) and epidemiology (Miles et al., 2003).
Considering that one of the possibilities of contamination
of humans in this outbreak was by crushing infected
triatomines during the juice preparation, the survival of T.
cruzi on sugar cane juice as reported by Pinto et al. (1990),
and the finding of mixed T. cruzi TcI/TcII in T. tibiamaculata
in the present study, our results may indicate, despite the
small data set available, the intraspecific variability and the
sensitivity of the methods that selection toward TcII group in
humans may occur as formerly reported (Bosseno et al.,
1996; Breniere et al., 1998). However, considering that a
small number of samples were examined and that natural
circulation in the past in triatomines and marsupials were
represented by TcII or TcI/II mixture strains in the SC
State (Steindel et al., 1995), another hypothesis is that
patients could be infected only by T. cruzi TcII strains.
Furthermore, our results confirm the maintenance of both
TcI and TcII clones circulating in the sylvatic environment
in the SC State.
This is the 1st report of T. tibiamaculata inside a
peridomestic area in the SC State, a vector species not
previously studied in this state but with an increasing
importance on the Chagas disease epidemiology (Dias-
Lima and Sherlock, 2000). These conclusions are rein-
forced by the fact that, in this State, the most prevalent
triatomine species entering human domiciles is P. megistus
 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32
(Steindel et al., 1995), which was not found in the roadside
food court surroundings.
Breniere et al. (1998) emphasize that the clone distribution
must be comparatively studied using clones obtained from
vectors and from recently infected patients, suggesting that
the clonal selection must occur in later stage of the infection,
probably by selective pressure of the human immune system
in response to the infection. Several studies have proposed
that strains isolated from patients in the acute phase of
Chagas disease had a more complex genetic composition
than those obtained during the chronic phase (Macedo and
Pena, 1998; Devera et al., 2003). The SC outbreak provided a
unique chance to address such points because the possibility
of previous or multiple infections was discarded due to the
nonendemicity for human Chagas disease (Steindel et al.,
1995). Also, the exploration of this rare possibility by
obtaining samples from patients in acute phase following oral
infection as well as to obtain samples from reservoirs and
vectors captured in the outbreak area is unique.
Acknowledgments
The authors thank Dr. Michael Miles for his valuable
suggestions on the manuscript, the Diretoria de Vigilância
Epidemiológica, the Laboratório Central, and the State of
Santa Catarina Health Staff, Brazil, for the field works and
for laboratory support, respectively. L.K.P., D.S., M.H.M.,
C.K., T.C.M.S., and P.H.S. were recipients of CNPq or
CAPES scholarships.
References
Anon (1999) Recommendations from a satellite meeting. Mem Inst Oswaldo
Cruz 94(Suppl I):429–432.
Bosseno MF, Telleria J, Vargas F, Yaksic N, Noireau F, Morin A,
Breniere SF (1996) Trypanosoma cruzi: study of the distribution of
two widespread clonal genotypes in Bolivian Triatoma infestans
vectors shows a high frequency of mixed infections. Exp Parasitol 83
275–282.
Bosseno MF, Barnabé C, Magallón Gastélum E, Lozano Kasten F, Ramsey
J, Espinoza B, Brenière SF (2002) Predominance of Trypanosoma cruzi
lineage I in Mexico. J Clin Microbiol 40:627–632.
Brener Z, Chiari E (1963) Variações morfológicas observadas em diferentes
amostras de Trypanosoma cruzi. Rev Inst Med Trop São Paulo
5:220–224.
Breniere SF, Bosseno MF, Telleria J, Bastrenta B, Yacsik N, Noireau F,
Alcazar JL, Barnabe C, Wincker P, Tibayrenc M (1998) Different
behavior of two Trypanosoma cruzi major clones: transmission and
circulation in young Bolivian patients. Exp Parasitol 89:285–295.
Buscaglia CA, Di Noia JM (2003) Trypanosoma cruzi clonal diversity and
the epidemiology of Chagas disease. Microbes Infect 5:419–427.
Carneiro M, Chiari E, Goncalves AM, da Silva Pereira AA, Morel CM,
Romanha AJ (1990) Changes in the isoenzyme and kinetoplast DNA
patterns of Trypanosoma cruzi strains induced by maintenance in mice.
Acta Trop 47:35–45.
Coura JR, Junqueira AC, Fernandes O, Valente SA, Miles MA (2002)
Emerging Chagas disease in Amazonian Brazil. Trends Parasitol
8:171–176.
Devera R, Fernandes O, Coura JR (2003) Should Trypanosoma cruzi be
called “cruzi” complex? A review of the parasite diversity and the
31
potential of selecting population after in vitro culturing and mice
infection. Mem Inst Oswaldo Cruz 98:1–12.
Dias JC, Silveira AC, Schofield CJ (2002) The impact of Chagas disease
control in Latin America: a review. Mem Inst Oswaldo Cruz 97:
603–612.
Dias-Lima AG, Sherlock IA (2000) Sylvatic vectors invading houses
and the risk of emergence of cases of Chagas Disease in Sal-
vador, State of Bahia, northeast Brazil. Mem Inst Oswaldo Cruz 95:
611–613.
Di Noia JM, Buscaglia CA, Marchi CR, Almeida IC, Frasch AC (2002) A
Trypanosoma cruzi small surface molecule provides the first immuno-
logical evidence that Chagas' disease is due to a single parasite lineage.
J Exp Med 195:401–413.
Diosque P, Barnabe C, Padilla AM, Marco JD, Cardozo RM, Cimino RO,
Nasser JR, Tibayrenc M, Basombrio MA (2003) Multilocus enzyme
electrophoresis analysis of Trypanosoma cruzi isolates from a
geographically restricted endemic area for Chagas' disease in Argentina.
Int J Parasitol 33:997–1003.
Dvorak JA (1984) The natural heterogeneity of Trypanosoma cruzi:
biological and medical implications. J Cell Biochem 24:357–371.
El-Sayed NM, Myler PJ, Bartholomeu DC, Nilsson D, Aggarwal G, Tran
AN, Ghedin E, Worthey EA, Delcher AL, Blandin G, Westenberger SJ,
Caler E, Cerqueira GC, Branche C, Haas B, Anupama A, Arner E,
Aslund L, Attipoe P, Bontempi E, Bringaud F, Burton P, Cadag E,
Campbell DA, Carrington M, Crabtree J, Darban H, da Silveira JF, de
Jong P, Edwards K, Englund PT, Fazelina G, Feldblyum T, Ferella M,
Frasch AC, Gull K, Horn D, Hou L, Huang Y, Kindlund E, Klingbeil M,
Kluge S, Koo H, Lacerda D, Levin MJ, Lorenzi H, Louie T, Machado
CR, McCulloch R, McKenna A, Mizuno Y, Mottram JC, Nelson S,
Ochaya S, Osoegawa K, Pai G, Parsons M, Pentony M, Pettersson U,
Pop M, Ramirez JL, Rinta J, Robertson L, Salzberg SL, Sanchez DO,
Seyler A, Sharma R, Shetty J, Simpson AJ, Sisk E, Tammi MT, Tarleton
R, Teixeira S, Van Aken S, Vogt C, Ward PN, Wickstead B, Wortman J,
White O, Fraser CM, Stuart KD, Andersson0 B (2005) The genome
sequence of Trypanosoma cruzi, etiologic agent of Chagas disease.
Science 309:409–415.
Fernandes O, Santos SS, Cupolillo E, Mendonca B, Derre R, Junqueira
AC, Santos LC, Sturm NR, Naiff RD, Barrett TV, Campbell DA,
Coura JR (2001) A mini-exon multiplex polymerase chain reaction
to distinguish the major groups of Trypanosoma cruzi and
T. rangeli in the Brazilian Amazon. Trans R Soc Trop Med Hyg
95: 97–99.
Filardi LS, Brener Z (1987) Susceptibility and natural resistance of Trypa-
nosoma cruzi strains to drugs used clinically in Chagas disease. Trans R
Soc Trop Med Hyg 81:755–759.
Grisard EC, Steindel M, Guarneri AA, Eger-Mangrich I, Campbell DA,
Romanha AJ (1999) Characterization of Trypanosoma rangeli strains
isolated in Central and South America: an overview. Mem Inst Oswaldo
Cruz 94:203–209.
Lisboa CV, Mangia RH, de Lima NR, Martins A, Dietz J, Baker AJ, Ramon-
Miranda CR, Ferreira LF, Fernandes O, Jansen AM (2004) Distinct
patterns of Trypanosoma cruzi infection in Leontopithecus rosalia in
distinct Atlantic coastal rainforest fragments in Rio de Janeiro—Brazil.
Parasitology 129:703–711.
Luquetti AO, Miles MA, Rassi A, Resende JM, Souza AA, Póvoa MM,
Rodrigues I (1986) Trypanosoma cruzi: zymodemes associated with
acute and chronic Chagas' disease in central Brazil. Trans R Soc Trop
Med Hyg 80:462–470.
Macedo AM, Pena SDJ (1998) Genetic variability of Trypanosoma cruzi:
implications for the pathogenesis of Chagas disease. Parasitol Today
14:119–123.
Macedo AM, Machado CR, Oliveira RP, Pena SD (2004) Trypanosoma
cruzi: genetic structure of populations and relevance of genetic
variability to the pathogenesis of Chagas disease. Mem Inst Oswaldo
Cruz 99:1–12.
Miles MA, Cedillos RA, Povoa MM, de Souza AA, Prata A, Macedo V
(1981) Do radically dissimilar Trypanosoma cruzi strains (zymodemes)
32 M. Steindel et al. / Diagnostic Microbiology and Infectious Disease 60 (2008) 25–32
cause Venezuelan and Brazilian forms of Chagas' disease? Lancet
1:1338–1340.
Miles MA, Feliciangeli MD, Rojas De Arias A (2003) American
trypanosomiasis (Chagas disease) and the role of molecular epidemiol-
ogy in guiding control strategies. BMJ 28:1444–1448.
Moncayo A (2003) Chagas disease: current epidemiological trends after the
interruption of vectorial and transfusional transmission in the southern
cone countries. Mem Inst Oswaldo Cruz 95:577–591.
Murta SMF, Gazzinelli RT, Brener Z, Romanha AJ (1998) Molecular
characterization of susceptible and naturally resistant strains of Trypa-
nosoma cruzi to benznidazole and nifurtimox. Mol Biochem Parasitol
93:203–214.
Pereira da Silva LH, Nussenzweig V (1953) Sobre uma cepa de Trypano-
soma cruzi altamente virulenta para o camundongo branco. Folia Clin
Biol 20:191–208.
Pinho AP, Cupolillo E, Mangia RH, Fernandes O, Jansen AM (2000) Try-
panosoma cruzi in the sylvatic environment: distinct transmission cycles
involving two sympatric marsupials. Trans R Soc Trop Med Hyg 94:
509–514.
Pinto PL, Amato Neto V, do Nascimento SA, de Souza HB, Miyamoto A,
Moreira AA, Braz LM (1990) Viability of Trypanosoma cruzi in sugar
cane juice. Rev Inst Med Trop São Paulo 32:325–327.
Prata A (2001) Clinical and epidemiological aspects of Chagas disease.
Lancet Infect Dis 1:92–100.
Ruiz-Garcia M, Montilla M, Nicholls SO, Angarita L, Alvarez D
(2000) Genetic relationships and spatial genetic structure among
clonal stocks of Trypanosoma cruzi in Colombia. Heredity 85:
318–327.
Shikanai-Yasuda MA, Marcondes CB, Guedes LA, Siqueira GS, Barone
AA, Dias JC, Amato Neto V, Tolezano JE, Peres BA, Arruda Junior ER,
Lopes MH, Shiroma M, Chapadeiro E (1991) Possible oral transmission
of acute Chagas disease in Brazil. Rev Inst Med Trop São Paulo
33:351–357.
Silva NN, Clausell DT, Nolibos H, de Mello AL, Ossanai J, Rapone T,
Snell T (1968) Surto epidêmico de doença de Chagas com provável
contaminação oral. Rev Inst Med Trop São Paulo 10:265–276.
Souto RP, Fernandes O, Macedo AM, Campbell DA, Zingales B (1996)
DNA markers define two major phylogenetic lineages of Trypanosoma
cruzi. Mol Biochem Parasitol 3:141–152.
Steindel M, Pinto JC, Toma HK, Mangia RH, Ribeiro-Rodrigues R,
Romanha AJ (1991) Trypanosoma rangeli (Tejera, 1920) isolated from a
sylvatic rodent (Echimys dasythrix) in Santa Catarina Island, Santa
Catarina State: first report of this trypanosome in southern Brazil. Mem
Inst Oswaldo Cruz 86:73–79.
Steindel M, Toma HK, Ishida MM, Murta SM, de Carvalho Pinto CJ,
Grisard EC, Schlemper Jr BR, Ribeiro-Rodrigues R, Romanha AJ
(1995) Biological and isoenzymatic characterization of Trypanosoma
cruzi strains isolated from sylvatic reservoirs and vectors from the State
of Santa Catarina, Southern Brazil. Acta Trop 60:167–177.
Sturm NR, Degrave W, Morel C, Simpson L (1989) Sensitive detection and
schizodeme classification of Trypanosoma cruzi cells by amplification
of kinetoplast minicircle DNA sequences: use in diagnosis of Chagas'
disease. Mol Biochem Parasitol 33:205–214.
Sturm NR, Vargas NS, Westenberger SJ, Zingales B, Campbell DA (2003)
Evidence for multiple hybrid groups in Trypanosoma cruzi. Int J
Parasitol 33:269–279.
Valente SAS, Valente VC, Frahia Neto H (1999) Considerations on the
epidemiology and transmission of Chagas disease in the Brazilian
Amazon. Mem Inst Oswaldo Cruz 94:395–398.
Vallejo GA, Guhl F, Chiari E, Macedo AM (1999) Species-specific detection
of Trypanosoma cruzi and Trypanosoma rangeli in vector and
mammalian hosts by polymerase chain reaction amplification of
kinetoplast mini-circle DNA. Acta Trop 72:203–212.
Veloso VM, Romanha AJ, Lana M, Murta SM, Carneiro CM, Alves CF,
Borges EC, Tafuri WL, Machado-Coelho GL, Chiari E, Bahia MT
(2005) Influence of the long-term Trypanosoma cruzi infection in
vertebrate host on the genetic and biological diversity of the parasite.
Parasitol Res 96:382–389.
Westenberger SJ, Sturm NR, Campbell DA (2006) Trypanosoma cruzi 5S
rRNA arrays define five groups and indicate the geographic origins of an
ancestor of the heterozygous hybrids. Int J Parasitol 36:337–346.
World Health Organization (2002) Control of Chagas Disease. 2nd ed.
WHO: Geneva; 2002 (Technical Reports Series 905).
Yeo M, Acosta N, Llewellyn M, Sanchez H, Adamson S, Miles GA, Lopez
E, Gonzalez N, Patterson JS, Gaunt MW, de Arias AR, Miles MA (2005)
Origins of Chagas Disease: Didelphis species are natural hosts of Try-
panosoma cruzi I and armadillos hosts of Trypanosoma cruzi II,
including hybrids. Int J Parasitol 35:225–233.