Nutrient Removal 2009

Decoupling and Optimization of Both P and N removal in an Advanced IFAS-EBPR-MBR

System

Nehreen Majed1, Annalisa Onnis-Hayden1, Thomas Welander2 and April Z. Gu1*

1
Dept. of Civil & Environmental Engineering, Northeastern University, Boston, MA 02115
2
Veolia Water Solutions and Technologies, Providence, RI, 02903
*
Corresponding author: April Z. Gu, april@coe.neu.edu

ABSTRACT

An advanced continuous-flow IFAS-EBPR-MBR system has been established with the aim to
decouple the nitrogen (N) removing and phosphorus (P) removing microbial populations and to
achieve simultaneous optimization of N and P removal for obtaining high quality effluent.
Effluent phosphorus as low as 0.03 mg-P/L and effluent total nitrogen of less than 2 mg-N/L
have been reached with stable performance at steady state at both 15-days and 8-day SRTs. To
understand the population distribution in the reactor, both P uptake and release and
polyphosphate accumulating organisms (PAOs) population abundance studies were conducted
with mixed liquor (ML), with carrier media only or with combination of ML and media. The
results indicated that most of the PAO activity was in the ML and the PAO activity in the biofilm
was insignificant. Population study showed that about 50% of total cells in ML were PAOs and
more than 70% of these PAOs were Accumulibacter type. Fixed film contained less than 2-5% of
total PAOs, which contained more than 50% of Accumulibacter type and, nearly all of the PAOs
resided in the loosely attached portion of the biofilm on the media. Membrane/nitrate recycle
brings both biomass and nitrate from the membrane chamber back to the anoxic zone and change
in recycle ratio affected the biomass (MLSS) distribution in different zones of the reactor as
observed for recycle ratio of 1Q, 1.5Q and 2.5Q, respectively. Nitrate recycle also impacted the
COD, nitrogen species and phosphorus profiles in different reactor zones along the process.
Lowest effluent nitrate was found at recycle ratio of 2.5 (<2 mg-N/L) and effluent average P
concentrations were 0.03 mg-P/L at recycle ratio of 2.5 and 0.25 mg-P/L at recycle ratio of 1.5.
The optimal recycle ratio that yields satisfactory effluent N and P was 2.5 for the system.
Incorporation of the membrane system seems to be feasible in the IFAS system, which retains
the particulate nutrients and solids and provides a high quality effluent.

KEYWORDS: IFAS, EBPR, MBR, PAO, Phosphorus removal, BNR

INTRODUCTION AND OBJECTIVES

Recently, there has been an increasing demand and challenge to achieve very low effluent total
phosphorus and total nitrogen due to more stringent discharge limits imposed on wastewater
treatment plants in US. Biological nutrient removal (BNR) process is still the most commonly
applied technology for removing nitrogen and phosphorus from municipal wastewater. Further
optimization and improvement of BNR processes and incorporation of membrane filtration into
the BNR process are among the promising approaches for taking these challenges.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

43
 Nutrient Removal 2009

It has been recognized that in order to achieve both very low effluent nitrogen and phosphorus,
the aspects that seem to be beneficial for both efficient N and P removal in a biological nutrient
removal (BNR) system include sufficient influent bCOD strength, optimal operation condition
favorable for the functional microorganisms, recycle stream management and treatment and
efficient solids-liquid separation processes. However, there are also some conflicting
requirements regarding solids retention time (SRT) for the two processes. Longer SRT (>8-20
days) is often required by the slow-growing nitrifiers to accomplish complete nitrification,
however, shorter SRT (<3-5 days) is desired for high denitrification rate and, short SRT is also
shown to be favorable for poly-P accumulating organism (PAOs) and for more stable phosphorus
removal (Rodrigo et al. 1999; Whang and Park 2006). Investigation of treatment processes
/approaches that can enhance the beneficial factors and can solve above conflicts is in demand.

Fixed film systems such as Integrated Fixed-Film Activated Sludge (IFAS) or moving bed
biofilm reactors (MBBR) have been shown to be successful for the enhancement of nitrification
and denitrification in BNR system upgrade (Azimi et al. 2007; Christensson and Welander 2004;
Odegaard 2006; Onnis-Hayden 2007) and have been proved particularly suitable for retrofit
solution in regions where winter temperature usually will limit nitrification (Andreottola et al.
2000; Odegaard 2006). IFAS also provides an increased solids inventory as biomass builds up on
the media. Less waste activated sludge is produced due to longer retention in the media as well
(Johnson 2006). Polyethylene biofilm careers used in IFAS have been tested and found to be
resistant to nitrifier-washout offering an operational robust system (Maas 2007). However, all
these studies with IFAS have focused mainly on nitrification capacity and enhanced P removal in
these IFAS systems have not been extensively investigated.

Despite the advantages of fixed film processes for Nitrogen removal, its application will be
limited without the integration with efficient P removal process since most effluent permits
regulate both N and P. Enhanced P removal in fixed film systems have been explored in recent
years although not extensively. Sequencing batch biofilm reactors (SBBR) have been shown to
be successful for stable and efficient nitrogen removal with small footprint (Arnz et al. 2001;
Gieseke et al. 2002; Helness and Odegaard 1999; Kumar and Chaudhari 2003; Pastorelli et al.
1999). But simultaneous P removal with biofilm reactors were found to be limited by the mass
transfer and diffusion limitations in biofilm systems and need for the removal of phosphorus rich
biomass (Falkentoft et al. 2001; Morgenroth and Wilderer 1999).Moreover, in the case where
there is presence of organic carbon in the aerobic phase, nitrifiers are easily outcompeted by the
heterotrophs for oxygen and possible competition for organic carbon between denitrifying and
phosphorus removing organisms in the biofilm. These make the simultaneous N and P removal
in fixed film system more challenging and requiring biofilm processes to be separated in both
space and time (Gieseke et al. 2002; Gieseke et al. 2001; Helness and Odegaard 1999; Pastorelli
et al. 1999). However, some studies with full scale plants have demonstrated that IFAS has the
potential to reach low effluent P-level requiring proper reactor configuration and operational
conditions (Onnis-Hayden 2008; Rogalla et al. 2006). But detailed kinetic analysis for varying
conditions and configurations is not yet available.

This study proposed a new process namely IFAS-EBPR-MBR with aims to eliminate the
conflicting SRT requirements by decoupling the nitrifying population and P removing population
and to obtain high quality effluent with membrane filtration. The process decouples the slow-

Copyright ©2009 Water Environment Federation. All Rights Reserved.

44
 Nutrient Removal 2009

growing nitrifying populations and the other heterotrophs including PAOs and denitrifiers by
allowing the former to attach to media (fixed film carrier) and the latter to be in the suspended
mixed liquor (ML). Decoupling allows for separate controls of the SRTs of different populations
,which would lead to the optimization of the biological processes and therefore improve the
overall stability. The reactor configuration, nitrate recycle ratio, amount of DO return to the
anoxic zone, loading, SRT etc. can affect the overall process performance of IFAS. Location of
media and substrate concentrations determine the fixed film biomass and thus has overall effect
on the system (Sriwiriyarat and Randall 2005a).

The new IFAS-EBPR-MBR process is established with the following hypotheses: 1) Most of the
nitrifiers will be maintained on the fixed film media and carry out most of the nitrification
activity. This will allow for more efficient and stable nitrification to occur at much shorter mixed
liquor SRT (less volume) and it is also less susceptible to disturbances; 2) Most of the
denitrifiers will reside in the mixed liquor. The shorter SRT (higher growth rate) of denitrifiers
lead to higher denitrification rates ; 3) Most of the phosphorus removing organisms (poly
phosphorus accumulating organisms-PAO) will reside in the mixed liquor and the shorter SRT is
more favorable for PAOs (e.g more competitive over GAOs) and yield more stable P removal ;
4) Efficient solids/liquid separation by submerged membrane filtration further reduces the
particular N and P and leads to lower TP and TN in the effluent. The objectives of this study are:
1) Evaluate the performance of the new IFAS-EBPR-MBR process for advanced N and P
removal; 2) Investigate the distribution of PAO populations and PAO activities among different
forms of biomass in the system; 4) Investigate the feasibility and impact of the incorporation of
membrane unit in the IFAS and 5) Identifying the potential operational issues and their effects on
N and P removal performance.

Further studies will be continued with the following objectives: 1) Evaluating the process
performance and stability under various loading conditions; 2) Correlating the microbial
population dynamics with the performance of the system 3) Quantifying the distribution of key
microbial populations on the media and in the mixed liquor and incorporate the information into
model development for IFAS-EBPR process; 5) Assessing the membrane fouling elements in the
IFAS system.

METHODOLOGY

Reactor Set up
A continuous flow reactor was set up that includes an anaerobic zone, an anoxic zone and
followed by two-stage aerobic zones. Plastic media K3 (Anox Kaldnes) has been employed in
the two aerobic chambers at 40% fill. The media elements have a surface area of 500 m2/m3 and
there are approximately 115,000 pieces of media elements per cubic meter. A flat-sheet
membrane unit (KUBOTA Type 510 from Enviroquip Inc.) has been placed at the end of the
second aerobic chamber. The configuration allows for both A2O and UCT mode of
operation. Anaerobic and anoxic chambers were continuously mixed with paddle mixers and fine
bubble aeration was used in the aerobic chambers to supply oxygen as well as to keep the media
suspended.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

45
 Nutrient Removal 2009

Figure 1 gives the layout of the reactor setup which is followed by table 1 to provide with the
operating conditions along the reactor chambers. Table 2 has the loading characteristics.

The membrane unit (Kuboto, Enviroquip) has four flat plate cartridges in a single deck. The
membrane material is chlorinated polythelene. Nominal pore size and surface area of each
cartridge in the unit is 0.4 micron and 0.8 m2, respectively. The flow flux through the membrane
is around 0.77 gal/ft2.d. The unit is backwashed every day for around 30 minutes with the
effluent and the membrane is cleaned weakly with sodium hypochlorite solution (350 mgCl/L).

Anoxic recycle
Staged IFAS with
membrane unit

Aerobic Aerobic Effluent

Influent
Anaerobic Anoxic
Membrane unit
Media

Membrane/Nitrate Recycle

Figure 1: Configuration of IFAS-EBPR-MBR process

Table 1: Operating conditions along the different zones of the reactor:

Anaerobic zone Anoxic zone Aerobic zone 1 Aerobic zone 2

pH 7.2-7.8 7.2-7.8 7.5-8.0 7.5-8.0
DO, mg/L 0 0 5.0-7.5 6.0-8.5
Temperature, ºC 19-22 19-22 19-22 19-22
HRT, hr 3.46 2.53 6.5 6.5
Recycle flow 0.88Qin 1 Qin -2.5 Qin
- -
received From Anoxic From Aerobic 2

Table 2: Influent loading characteristics:

Influent flow, L/d 100.8

mg-COD/mg-P 43
mg-COD/mg-N 17
F/M ratio, mg COD/mgVSS.d 0.23
Volumetric loading rate, kg COD/m3.d 0.31

Copyright ©2009 Water Environment Federation. All Rights Reserved.

46
 Nutrient Removal 2009

The reactor was seeded with returned activated sludge from Scituate Wastewater Treatment plant
at Scituate, Massachusetts. The synthetic feeding solution that is prepared to feed the reactor
consisted of 142 mg/L potassium Chloride (KCl), 266 mg/L magnesium chloride
(MgCl2.6H2O), 76.4 mg /L ammonium chloride (NH4Cl) (20mg-N/L), 17 mg/L magnesium
sulfate (MgSO4.7H2O), 56 mg/L calcium chloride (CaCl2), 9.7 mg/L yeast extract, 0.074 mg/L
boric acid (H3BO3), 0.36 mg/L zinc sulfate (ZnSO4.7H2O), 0.018 mg/L potassium iodide (KI),
0.074 mg/L cupric sulfate (CuSO4.5H2O), 0.091 mg/L cobalt nitrate (Co[NO3]2.6H2O), 0.038
mg/L sodium molybdate (Na2MoO4.2H2O), 0.41 mg/L manganous sulfate (MnSO4.H2O), 0.36
mg/L ferrous sulfate (FeSO4.7H2O) and 35.6 mg/L sodium phosphate monobasic
(NaH2PO4.H2O) (8 mg-P/L) as the inorganic nutrient feeding. The organic portion of the feeding
consisted of 744 mg/L sodium acetate (CH3COONa.3H2O) (350 mg –COD/L) and 18 mg/L of
casamino acids.

Monitoring and analysis

The reactor was maintained at steady state on the basis of monitoring of the suspended solids
concentration at each zone and the effluent N and P concentrations. Nitrogen and phosphorus
species were analyzed in both effluent and in each reactor zone for profiles along the reactor.
The performance of the reactor was evaluated with SRT ranged from 8 to 15 days. System
performances at shorter SRT (<3, 5 days) are being evaluated currently.

Performance at three different Membrane/nitrate recycle ratios, 1Qin , 1.5Qin and 2.5Qin were
investigated to observe the impact of different recycle ratios on the overall performance of the N
and P removal of the system, on the PAO activity, DPAO abundance and to observe the effect on
the internal shift in biomass in different reactor zones. Impact of recycle ratio on MLSS level of
the upstream zones follows the theoretical trend, which is obtained according to the following
expression:

MLSS at upstream end = MLSS of downstream end * R/(1+ R), Where, R = recycle ratio

Here, R/(1+R) is designated as the concentration factor. The MLSS in the second aerobic zone
was stabilized at the level of around 1500 mg TSS/L. Depending on this fixed MLSS, MLSS for
the anaerobic and the anoxic zone was calculated theoretically according to the respective
recycle ratios. In order to assess the membrane fouling phenomenon, observation of membrane
flux was carried out for 2 weeks with only backwashing the membrane without chemical
cleaning. During this time, fixed level of pressure was maintained across the membrane to
observe the decline in flux.

Samples from each zone were filtered through 0.45 micron filter papers before analyzing for the
anions (NO3-, NO2- and PO43-) and COD. Measurements for pH and DO are made every weekday
for each of the zones of the reactor. Total Suspended Solids (TSS) and Volatile Suspended Solids
(VSS) were measured according to standard method (APHA 1998) . Measurements of NO3-,
NO2- and PO43- anions are made with DX-120 ion chromatograph. NH3-N is measured with
ammonia probe according to standard method. Total phosphorous and Total Nitrogen are
analyzed according to standard methods (APHA 1998).

Copyright ©2009 Water Environment Federation. All Rights Reserved.

47
 Nutrient Removal 2009

Kinetic study for P removal

To evaluate the phosphorus removal rates and distribution of PAO activity among the mixed
liquor and different sections of the biofilm on fixed-film media, P uptake and release tests were
conducted with the biomass sources from mixed liquor only, ML and media and media only for
both of the two sequential aerobic stages

Each of the batch testing was carried out with 2 liter of mixed liquor or mixed liquor and media
(at 40% fill) withdrawn from aerobic zones. The sludge was left to settle for 2 hours and then 1
liter of supernatant was replaced with synthetic washing buffer consisting of all the inorganic
nutrients in the reactor feeding except for NH4-N and PO43—P source. Batch testing with media
was carried out with the media in the washing buffer at 40% fill. The sludge sample was
continuously mixed in the 2L batch reactor and kept at a controlled temperature room at 20ºC.

The sludge in the batch reactor was subjected to a 45 minute anaerobic period followed by a 3
hour 45 minute aerobic period. Acetate was added as the carbon source in the beginning of the
anaerobic phase. Nitrogen gas was bubbled inside the batch testing reactor to maintain the
anaerobic condition. pH was maintained around 7.5-8 through the testing period using 1N HCl or
1N NaOH. Dissolved oxygen was provided with aquarium aerators during the aerobic phase.
Samples were collected every 15 minutes until the first 1.5 hours and every 30 minutes
afterwards. Each sample was 10 ml which were filtered through 0.45 micron filter papers.
Analyses were done immediately for COD, PO43, NO3- and NO2- .

PAO Population Analysis

Samples from anaerobic and aerobic zones were stained with Neisser stain periodically in order
to visualize the polyphosphate granules which would eventually let us evaluate the presence and
abundance of PAOs in the system. Since Accumulibacter is often found to be the dominant PAO
in lab scale aceate –fed reactor (He et al. 2006; Hesselmann et al. 1999; McMahon et al. 2002;
Oehmen et al. 2004) we used FISH probes to target specifically for Accumulibacter types to
observe its distribution and abundance in various part of the biomass in the ML or on the media.

Fluorescence In-Situ Hybridization was carried out with samples from the reactor sludge and
also with the samples from the outer (loosely attached biofilm) and inner sides (tightly-attached
biofilm) of the plastic media in each of the aerobic zones in order to find out the presence and
abundance of known candidate PAOs and GAOs in different portion of the biomass . Fixation
was carried out with 2 ml of sludge samples that were fixed in a 4% paraformaldehyde –
phosphate buffer saline (PBS; 130 mM sodium chloride, 10 mM sodium phosphate buffer [pH
7.2]) solution (3:1, vol/vol). The fixed samples were washed in PBS, resuspended in a PBS-96%
ethanol solution (1:1, vol/vol), and stored at -20ºC prior to hybridization. Prior to hybridization,
the fixed cells were disrupted with 26 gauge syringe for 10-15 minutes in order to ensure
uniform distribution of the cells on the slide. Then, fixed cells were immobilized on gelatin
coated slides and dehydrated in 50, 80 and 96% ethanol solutions (3 min each).

The oligonucleotide probes that were used are listed in table 3 and were obtained from MWG-
Biotech. The PAO probes (PAO mix) were labeled with CY3, GAO probes (GAO mix) were
labeled with CY5 and the EUB probe was labeled with FAM. The in-situ hybridization of the
fixed and dehydrated samples on the slide was carried out using a buffer containing 0.9 M NaCl,

Copyright ©2009 Water Environment Federation. All Rights Reserved.

48
 Nutrient Removal 2009

20 mM Tris-HCl (pH 7.4), 0.01% sodium dodecyl sulfate, 50 ng of each oligonucleotide probe
and amount of formamide corresponding to the % formamide of the PAO probes. The slide
containing the probes and hybridization buffer was incubated in the hybridizer for 2 hours at 46
ºC. The slide was then rinsed with washing buffer and immediately immersed in the washing
buffer tube which was then kept in the water bath at 48 ºC for 15 min. The washing buffer
consisted of 20 mM Tris-HCl (pH 7.4), 0.01% sodium dodecyl sulfate, between 1.75-5 mM
0.5M EDTA and between 3.5-900 mM 5M NaCl . Afterwards, the slide was rinsed with
deionized water and air dried in the dark. The dried slide was mounted with Vectra Shield
Mounting Medium (Vector Laboratories) anti-bleaching reagent. The slide was viewed and the
images are then obtained with a Carl Zeiss Axio Imager. M1, Epifluorescence Microscope.

For the quantification of the relative proportion of the target types of cells, around 20
micrographs were collected with random fields of view from the same slide/sample and then
average proportion of the target cells was calculated.

Table 3: Probes for FISH

rRNA target
Probe Sequence Specifity % Formamide Reference
site
EUB338 GCTGCCTCCCGTAGGAGT 16S, 338-355 Bacteria 20
(Zilles et al.
PAO462 CCGTCATCTACWCAGGGTATTAAC 16S, 462-485 Most Accumulibacter 35
2002)
(Crocetti et
PAO651 CCCTCTGCCAAACTCCAG 16S, 651-668 Most Accumulibacter 35
al. 2000)
(Zilles et al.
PAO846 GTTAGCTACGGCACTAAAAGG 16S, 846-866 Most Accumulibacter 35
2002)
(Crocetti et
GAOQ431 TCCCCGCCTAAAGGGCTT 16S, 431-448 Most Accumulibacter 35
al. 2002)
(Crocetti et
GAOQ989 TTCCCCGGATGTCAAGGC 16S, 989-1006 Most Competibacter 35
al. 2002)

RESULTS AND DISCUSSION

Phosphorus removal in the reactor

The new IFAS-EBPR-MBR process is capable of removing phosphorous at above 90%
efficiency as shown in figure 2 for both 15 days and 8 days of SRT. The effluent profile shows
the gradual decrease in the P level from the start up phase. Through the start up phase,
fluctuation in the effluent P level has occurred due to the time taken for biomass to build up in
the media and also to reach the steady state condition. The effluent P level as low as 0.03 mg-P/L
has been reached with the system as the reactor has stabilized at a COD/TP ratio of 43. Effluent
average P concentrations were 0.03 mg-P/L at recycle ratio of 2.5 and 0.25 mg-P/L at recycle
ratio of 1.5. Effluent P level did not change noticeably at the range of recycle ratios that were
studied, but the profiles of P along the zones had significant changes. At a same COD/P ratio,
(Hesselmann et al. 1999) obtained effluent P level below 0.5 mg-P/L with a lab-scale SBR-
EBPR system. The first full-scale IFAS operation with biofilm career (K1) in Broomfield which
studied mainly the nitrification capacity of the system has shown to produce effluent with a
stable P level at 0.5 mg-P/L and total P of 1.25 mg-P/L with a COD/TP ratio ranging from 15-30

Copyright ©2009 Water Environment Federation. All Rights Reserved.

49
 Nutrient Removal 2009

(Rogalla et al. 2006; Rutt K. 2006). (Sriwiriyarat and Randall 2005b) has shown in the
evaluation of a pilot-scale IFAS system with accuweb media that it was capable of producing
effluent with P level at 10.2±3 mg-P/L corresponding to 70% removal efficiency at a COD/TP of
20 and the efficiency was reduced to 50% at a COD/TP of 52 and these efficiencies were not
significantly higher than their control without IFAS, mainly hypothesized due to higher release
of P in the anoxic zone without subsequent uptake in following aerobic zone. With a COD/TP of
around 16, 70% P removal efficiency but a stable effluent P level at around 4 mg-P/L was
obtained by (Azimi et al. 2007) who used a polystyrene media with surface area of 650 m2/m3
and placed in all of the anaerobic, aerobic and anoxic zones at a full-scale plant in Tehran. The
results from our study indicated that stable and low effluent P can be achieved in an IFAS-EBPR
process for both higher and a lower SRT and further investigation is needed to better understand
how influent COD/P and other process configurations/conditions might affect the P removal
performance in such a system.

Figure 2: Profile of Ortho-P with time for SRT = 15 days and SRT = 8 days

Zone profiles of ortho-P along the reactor shown in later section show that as high as 50% of the
P released in the anaerobic zone was taken up in the anoxic zone and the rest taken up in the two
aerobic zones. Anoxic P-uptake in the EBPR systems has been previously shown to be due to the
presence of Accumulibacter type PAOs which are capable of using both oxygen and
nitrate/nitrite as electron acceptor (Carvalho et al. 2007; Kong et al. 2004; Oehmen et al. 2007;
Zeng et al. 2003). Our FISH results confirmed that Accumulibacter- type PAO is predominant in
the reactor, which is expected since Accumulibacter has been found to be the dominant PAO in
acetate-fed reactors and also in many full-scale plants (Gu 2005; He et al. 2006; He 2005;
Saunders et al. 2003; Zilles et al. 2002).

Phosphorus removal rates and kinetics

The P-uptake release profiles are shown in figure 3 and figure 4 as obtained from the batch
testing with different forms of biomass. P- release up to 40 mg-P/L were obtained within the end

Copyright ©2009 Water Environment Federation. All Rights Reserved.

50
 Nutrient Removal 2009

of the anaerobic phase with mixed liquor from both of the aerobic zones, indicating high PAO
activities in the mixed liquor. The P-uptake was complete within 3 hours of the aerobic phase for
batch testing with mixed liquor only as well as with mixed liquor with media from both of the
aerobic zone sludge. Anaerobic P-release rate as high as 59 mg-P/gVSS/h and P-uptake rate of
34.91 mg-P/gVSS/h were evidenced with the mixed liquor sludge. Both of these rates are
substantially higher than the values reported by (Monti et al. 2007) (30 mg-P/gVSS/h for P-
release and 6 mg-P/gVSS/h for P-uptake rate) where a pilot plant was studied for EBPR with
membrane assistance. (Gu 2005) studied the operation and performance of six full-scale EBPR
plants and the highest rates that were obtained were 31.9 mg-P/gVSS/h for P-release and 9.7 mg-
P/gVSS/h for P-uptake. (Chuang et al. 1996) studied the kinetics of P removal with an acetate
fed anaerobic-anoxic-aerobic lab-scale configuration and obtained the highest P-release rate of
18.6 mg-P/gTSS/h. Our lab-scale system has substantially higher rates than these and also agrees
well with the P-release rates reported by (Liu et al. 1997) ranging from 42-155 mg-P/gVSS/h for
lab scale SBR set up. This suggests that we have a very robust biomass rich in PAO types of
organisms.

Very small P release and no P-uptake were observed with media (biofilm) only suggesting that
the PAO activity in the biofilm is negligible. The amount of P released with ML+media is
slightly less than with ML only for both aerobic stages. This is because, by keeping the same
reaction volume, adding media reduced the mixed liquor volume where most PAOs reside and
therefore reduce the PAO biomass per unit reactor volume. The overall P release was around
50% lower in stage 1 than in stage 2 for both ML and ML + media which could be attributed to
the overall biomass content in the two zones. Due to the retention of solids by the membrane in
aerobic stage 2, an overall biomass in stage 2 is higher than stage 1. And also during batch
testing, the VSS was around 50% higher in stage 2 than stage 1 and thus the overall release of P
was higher for stage 2 as well. This difference becomes smaller when the release and uptake
rates are normalized to the overall biomass as discussed below.

Figure 3: P-uptake and release profiles for aerobic stage 1

Copyright ©2009 Water Environment Federation. All Rights Reserved.

51
 Nutrient Removal 2009

Figure 4: P-uptake and release profiles for aerobic stage 2

P-uptake and release rates for both of the aerobic stages are compared in figure 5 and 6. When
the rates were normalized against mixed liquor VSS concentration, slightly higher rates for both
release and uptake were observed with ML only than with ML+media (eg. for P release, 11%
higher for stage 1 and 20% higher for stage 2 whereas the difference is more pronounced for P
uptake rates). Although it suggests that the contribution of PAO activity from the biofilm is not
so significant, nonetheless, presence of heterotrophic organisms and nitrifiers on the media
could hinder the PAOs activities due to carbon uptake competition during the anaerobic
condition of the batch testing and/or oxygen uptake competition during the aerobic condition of
the batch testing. Comparing the results between aerobic stage 1 and stage2, both ML and media
showed slight higher rates for stage 2 than stage 1(except for P uptake rate for ML + media),
although whether the difference is statistically significant need further confirmation. The
possible presence of other heterotrophic organisms in higher proportion in the upstream aerobic
stage could possibly lead to correspondingly higher PAO biomass in stage 2 than those in stage
1. These differences in rates do indicate that microbial community compositions vary for
different stages.

Figure 5: Rates of P release for batch testing Figure 6: Rates of P uptake for batch testing
with sample from aerobic stage1 and stage 2 with sample from aerobic stage1 and stage 2

Copyright ©2009 Water Environment Federation. All Rights Reserved.

52
 Nutrient Removal 2009

For batch testing with media only, very little P-release occurred in anaerobic phase and the
release continued very slowly through the aerobic phase without any P-uptake as shown in the
figure 3 and 4. During the aerobic stage, the heterotrophs and nitrifiers in the biofilm will
compete for oxygen due to high COD available; they may inhibit the PAO activity, which is very
low to begin with due to the low abundance of PAOs in the biofilm. Assuming the PAOs in the
biofilm is the same as those in mixed liquor, it is estimated that about < 2-5% of the TSS on the
media is PAOs.

Distribution of PAO population and correlation with P metabolism

Table 4 summarizes the P uptake and release kinetics both for in-situ measurements and also for
batch testing results with sludge at SRT of 8 days. Biomass distribution in the mixed liquor and
media are also provided in the table. In-situ rates of P release and P-uptake are less than those
determined in batch tests since substrates are normally limiting in continuous flow reactors,
while substrate was in excess in batch tests.

Relatively higher biofilm biomass was found in stage 1 than that in stage 2, as evidenced by
thicker biofilm on the media in stage 1 than stage 2. This is likely due to higher carbon and
ammonia availability in the upstream aerobic zone (Kim 2007; Sriwiriyarat and Randall 2005a).
(Onnis-Hayden 2007) obtained 7.93 and 4.97 g/m2 of unit biomass at aerobic stage 1 and stage 2
respectively using K1 type media at Broomfield pilot plant IFAS. Loosely attached biomass to
the media in our system was also measured to be around 0.11 g/m2 for the first aerobic zone
media and 0.2 g/m2 for the second aerobic zone media. Higher percentage of loosely attached
biomass on the media might be the result of more vigorous hydraulic mixing condition in stage 2
where the membrane resides. The overall yield of the system was 0.39 gVSS/gCOD which is
comparable to typical conventional anoxic/oxic biological systems of 0.4 gVSS/gCOD (Metcalf
and Eddy 2003).

Neisser staining confirmed that 50% of the total cells in the mixed liquor were stained as
polyphosphate accumulating organisms (figure 7a) and around 20-30% of total cells in stage 1
media and 15-20% in stage 2 media contained poly-P. Figure 7 shows FISH micrographs for the
mixed liquor and the fixed film media as well.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

53
 Nutrient Removal 2009

Table 4: Overall summary of P-uptake, release kinetics and biomass distribution in the
mixed liquor and media

AEROBIC AEROBIC
ANAEROBIC ANOXIC STAGE 1 STAGE 2
Amount Preleased and
Premoved , 4.46 (release) 3.42 (removed) 1.61 (removed) 0.04 (removed)
g/d
In-situ Rate of Prelease and
Puptake, 16.13(release) 6.12(uptake) 2.72(uptake) 0.05 (uptake)
mg-P/gTSS.h

ML 41.47 (release) 22.56 (uptake) 27.45 (uptake)

Batch testing only
rate of Prelease ML +
36.08 (release) - 17.84 (uptake) 12.38 (uptake)
and Puptake, media
mgP/gTSS.h
Media
3.44 (release) 0 0
only
Biomass (ML),
mg TSS/L 400±100 700±100 900±100 (67%) 1200±100 (86%)
(% of ML+ media
biomass)
Biomass in media,
mg TSS/L - - 438(33%) 190(14%)
(% of ML + media
biomass)
Loosely attached biomass
in media,
- - 23(5%) 41(21%)
mg TSS/L(% of media
biomass)

The FISH micrographs show that Accumulibacter type PAOs are present in both mixed liquor
and in media. 35-40% of the total population (>70% of total PAOs) in both of the aerobic zones
in the mixed liquor is Accumulibacter type; this is comparable to the ranges of Accumulibacter
abundance reported in studies with lab scale acetate fed EBPR systems (Jobbagy et al. 2006;
Oehmen et al. 2006; Saito et al. 2004). Only the loosely attached portion of biomass in the
media contained Accumulibacter type PAOs (10-15% of total cells and 50% of total PAOs) as
shown in the figure. But the samples scraped out from the inner portion of the fixed media from
both of the aerobic stages showed little or no presence of PAOs as shown in the FISH
micrograph. No Competibacter type GAOs were detected from FISH study.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

54
 Nutrient Removal 2009

(a) (b)

(c) (d)
Figure 7: Micrographs of samples from (a) Neisser stained granules shown by arrows, (b) FISH – mixed
liquor samples, (c) FISH-Loosely attached biomass in the media, (d) FISH-inner portion of biomass in the
media; cells in yellow/orange pointed with white arrows are Accumulibacter type PAOs and green cells are
all other types of bacteria

The FISH results imply that the fixed media may retain PAOs, mainly in the outer portion or in
the portion of the media biomass that is loosely attached to it. The amount of PAOs on the fixed
film varies depending on the substrate concentrations and conditions in the reactor. It is
estimated from the biomass measurement and FISH data that the fixed media contains only
around 0.8 % and 3% of total media biomass as Accumulibacter PAOs in stage 1 media and in
stage 2 media respectively. Comprising such a small proportion of total biomass in the media,
PAOs do not contribute significantly to the P-uptake and release mechanism as have been shown
in the batch testing results with mixed liquor and media.

Nitrogen Removal in the reactor

Profiles for influent and effluent total nitrogen are shown as a function of time in figure 8 for
both 15 days and 8 days of SRT. Complete nitrification is seen to have achieved as no ammonia
is detected in the effluent, while denitrification efficiency varied as the nitrate recycle ratio was
adjusted during the start up phase. The lowest total nitrogen in the effluent that has been
measured is <2 mg-N/L at a recycle ratio of 2.5. Both zone profiles and the effluent levels for

Copyright ©2009 Water Environment Federation. All Rights Reserved.

55
 Nutrient Removal 2009

nitrogen species had significant changes in the range of the nitrate recycle ratios that were
studied. Both denitrification and nitrogen removal are occurring at 87% efficiency at a recycle
ratio above 1.5. N removal performance is largely affected by carbon to nitrogen ratio, nitrate
recycle and nitrate uptake in the anoxic zone all of which seem to be conducive in our system.

Fixed film system seems to be very efficient and robust for nitrogen removal as has been shown
beforehand (Onnis-Hayden 2007) and also higher nitrification benefits are supposed to be gained
with IFAS by placing media at downstream aerobic zones (Kim 2007) and that is confirmed in
our system by a very consistent level of effluent total nitrogen.

Figure 8: Profiles of influent and effluent total Nitrogen with time for SRT = 15 days and SRT = 8 days

Performance in different membrane/nitrate recycle ratio

Recycle flow from the aerobic zone to the anoxic zone brings back solids and nitrate. Dissolved
oxygen (6-8 mg/L) is also brought back to the anoxic zone with the recycle. The recycle ratio has
multiple effects on the process including denitrification efficiency, P removal and biomass
distribution along the process as shown in the following discussion.

Effects of recycle ratio on MLSS concentration in different zones: The obtained levels of MLSS
in the anaerobic and anoxic zones for three different recycle ratios seem to follow the theoretical
trend as shown in figure 9. We have a shift in mixed liquor solids concentration in the upstream
zones due to the different amount of recycle flow being received.

Impact of nitrate recycle ratio on the consumption of COD: Membrane/nitrate recycle ratio
impacts COD because it changes the biomass distribution and the amount of DO and nitrate
return to the anoxic zone. Although the recycle ratio change from 1.5 to 2.5 or 1.0 has negligible
effects on the final effluent COD concentration, it did however, affect the COD concentrations
profiles along the reactor. The COD concentrations in different reactor zones directly affect the
in situ reaction rates, following the Monod-type kinetics. COD level in the anaerobic and anoxic

Copyright ©2009 Water Environment Federation. All Rights Reserved.

56
 Nutrient Removal 2009

zones also impact P removal. Effect of recycle on COD consumption can be viewed in figure 10
where the DO level of the second aerobic zone has been considered to be 7 mg/L. According to
the COD profile shown in figure 11, recycle ratio of 2.5 brings back more DO to the anoxic zone
which consumes an additional 3000 mg-COD/d than that in recycle ratio of 1.5 whereas recycle
ratio of 1.0 brings back less DO resulting in a 3000 mg of lesser COD consumption per day in
the anoxic zone.
Theoretical Anoxic MLSS Theoretical Anaerobic MLSS
Aerobic MLSS Anoxic MLSS
Anaerobic MLSS 5000
1700
4500
1500
4000

COD Consumed, mg/d

1300 3500
MLSS, mg-TSS/L

1100 3000

2500
900
2000
700
1500
500 Aerobic DO = 7mg/L
1000 Influent COD = 0.066 lb/d
300 500

100 0
0 0.5 1 1.5 2 2.5 3 3.5 0 0.5 1 1.5 2 2.5 3 3.5
Recycle Ratio Recycle Ratio

Figure 9: Impact of recycle ratio on MLSS Figure 10: COD consumption with recycle ratio

Profile for Recycle - 1.0 Qin Profile for Recycle - 1.5Qin

Profile for Recycle - 2.5Qin
500

400
COD, mg/L

300

200

100

0
INF AN AX AE1 AE2 EFF

Figure 11: Impact of recycle ratio on COD

Membrane fouling

Membrane fouling is the most serious problem with membrane separation processes which is
manifested by a significant decline in permeate flux or increase in transmembrane pressure.
Figure 12 shows the change of membrane flux during a period of 2 weeks with backwash but
without any chemical cleaning. Increased MLSS being one of the major fouling causes, the
MLSS of our IFAS system is 1500 mg/L as TSS which is far less than 20 g/L as required for the
permeate flux to decline abruptly as have been reported by (Chang et al. 2002).

Another study by (Fleischer et al. 2005) showed that at an MLSS level of 7000 mg/L in the
membrane zone, the flux decreased from 34 L/m2.h to 15 L/m2.h within a day which is

Copyright ©2009 Water Environment Federation. All Rights Reserved.

57
 Nutrient Removal 2009

equivalent to a flux drop of 56%. In our case, the highest drop of flux that was observed within a
day was 23% before backwashing. This is obviously due to the lower MLSS level in our
membrane zone and also due to the fact that the membrane fiber in (Fleischer et al. 2005) study
had a nominal pore size of 0.04 micron which is ten times smaller than the pore size that our
membrane has. The smaller the pore size, the larger the filtering capacity but also the more it
makes the fiber vulnerable to be clogged by the finer particles in the mixed liquor. There is a
specific flux below which there is no decline in flux which is termed the critical flux. During the
observation of decline in membrane flux (figure 12), it was seen that the critical flux that our
membrane system can sustain could be as low as 22 L/m2.h whereas with the zenon polymer
submerged membrane (pore size 0.1 micron), (Bouhabila et al. 1998) reported the critical flux to
be 30 L/m2.h and also concluded that air flow rate has a significant effect on the filtration
condition and fouling resistance. Effect of air flow rate on our submerged membrane unit is yet
to get outlined. So far, our membrane system has been efficient in producing high quality
effluent with no solids or particulate nutrients and the performance of this system is being
maintained through continuous maintenance.

40

35
Permeate Flux, L/m2.hr

30

25

20
0 50 100 150 200 250
Tim e , hr

Figure 12: Profile of permeate flux through membrane unit

(red arrows show the backwash points)

CONCLUSIONS

A continuous flow lab-scale IFAS-EBPR-MBR process has been developed with the aim to
decouple and allow for separate SRT control of the nitrifying and P-removing populations and,
therefore to achieve more efficient and stable P and N removal. Effluent total nitrogen level as
low as <2 mg-N/L and effluent phosphorus level of 0.03 mg-P/L has been reached. Phosphorus
removal kinetic studies and population analyses revealed that most of the PAO activity is taking
place in the suspended mixed liquor as we hypothesized and the contribution to P removal by the
PAO activity in the biofilm seems rather small. 50% of the total population in the ML are PAOs
and among which about 70% are Accumulibacter type, whereas the amount of PAOs on the fixed
film varied (<2-5%) depending on the substrate concentrations, location of the media and
conditions in the reactor. Thus process design and model development should take all these
factors into account. Kinetic data indicates that SRT in ML controls the PAOs mostly and thus,

Copyright ©2009 Water Environment Federation. All Rights Reserved.

58
 Nutrient Removal 2009

mixed liquor could be maintained at a shorter SRT for achieving better and more stable P
removal.

The combined membrane/nitrate recycle ratio is an important operating parameter since it affects
MLSS distribution in the reactor zones, the actual HRT and the amount of nitrate and DO
returning from the membrane zone back to the anoxic and anaerobic zones. Changes in recycle
ratio led to distinct changes in the profiles of COD, N and P in different zones along the reactor,
although the effluent COD and effluent P levels did not seem to be noticeably affected by the
recycle ratios in the range of our study. Optimal recycle ratio for achieving satisfactory P and N
removal is desired.

Incorporation of membrane in an IFAS-EBPR system seems to be feasible with efficient

solids/liquid separation and low level of effluent N and P. The sufficient retention of biomass
inventory by the IFAS fixed –film media implies that less volume is required for the same
loading compared to conventional suspended activated sludge system.

With such a promising performance of the new IFAS-EBPR-MBR system, there is substantial
scope of future research to be carried out on the process performance under different loading and
operating conditions. Understanding the population dynamics and distribution on the fixed film
media and in the mixed liquor will be helpful in the development of model for IFAS-
EBPR process.

ACKNOWLEDGEMENTS

We acknowledge the financial support from AnoxKaldnes and Veolia Water Solutions and
Technologies for this study.

REFERENCES

Andreottola, G., Foladori, P., Ragazzi, M., and Tatano, F. (2000). "Experimental comparison
between MBBR and activated sludge system for the treatment of municipal wastewater."
Water Sci Technol, 41(4-5), 375-382.
APHA. (1998). Standard Methods for the Examination of water and wastewater, 20th Ed.,
American Public Health Association, Washington D.C.
Arnz, P., Arnold, E., and Wilderer, P. A. (2001). "Enhanced biological phosphorus removal in a
semi full-scale SBBR." Water Sci Technol, 43(3), 167-174.
Azimi, A. A., Hooshyari, B., Mehrdadi, N., and Bidhendi, G. N. (2007). "Enhanced COD and
nutrient removal efficiency in a hybrid integrated fixed film-activated sludge process."
Iranian Journal of Science and Technology Transaction B-Engineering, 31(B5), 523-533.
Bouhabila, E. H., Ben Aim, R., and Buisson, H. (1998). "Microfiltration of activated sludge
using submerged membrane with air bubbling (application to wastewater treatment)."
Desalination, 118(1-3), 315-322.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

59
 Nutrient Removal 2009

Carvalho, G., Lemos, P. C., Oehmen, A., and Reis, M. A. M. (2007). "Denitrifying phosphorus
removal: Linking the process performance with the microbial community structure."
Water Res, 41(19), 4383-4396.
Chang, I. S., Le Clech, P., Jefferson, B., and Judd, S. (2002). "Membrane fouling in membrane
bioreactors for wastewater treatment." J Environ Eng-Asce, 128(11), 1018-1029.
Christensson, M., and Welander, T. (2004). "Treatment of municipal wastewater in a hybrid
process using a new suspended carrier with large surface area." Water Sci Technol,
49(11-12), 207-214.
Chuang, S. H., Ouyang, C. F., and Wang, Y. B. (1996). "Kinetic competition between
phosphorus release and denitrification on sludge under anoxic condition." Water Res,
30(12), 2961-2968.
Crocetti, G. R., Banfield, J. F., Keller, J., Bond, P. L., and Blackall, L. L. (2002). "Glycogen-
accumulating organisms in laboratory-scale and full-scale wastewater treatment
processes." Microbiol-Uk, 148, 3353-3364.
Crocetti, G. R., Hugenholtz, P., Bond, P. L., Schuler, A., Keller, J., Jenkins, D., and Blackall, L.
L. (2000). "Identification of polyphosphate-accumulating organisms and design of 16S
rRNA-directed probes for their detection and quantitation." Appl Environ Microb, 66(3),
1175-1182.
Falkentoft, C., Harremoes, P., Mosbaek, H., and Wilderer, P. (2001). "Stability of a lab-scale
biofilm for simultaneous removal of phosphorus and nitrate." Water Sci Technol, 43(1),
335-342.
Fleischer, E. J., Broderick, T. A., Daigger, G. T., Fonseca, A. D., Holbrook, R. D., and Murthy,
S. N. (2005). "Evaluation of membrane bioreactor process capabilities to meet stringent
effluent nutrient discharge requirements." Water Environ Res, 77(2), 162-178.
Gieseke, A., Arnz, P., Amann, R., and Schramm, A. (2002). "Simultaneous P and N removal in a
sequencing batch biofilm reactor: insights from reactor- and microscale investigations."
Water Res, 36(2), 501-509.
Gieseke, A., Purkhold, U., Wagner, M., Amann, R., and Schramm, A. (2001). "Community
structure and activity dynamics of nitrifying bacteria in a phosphate-removing biofilm."
Appl Environ Microb, 67(3), 1351-1362.
Gu, A. Z., Saunders, A.M., Neethling, J.B., Stensel, H.D., Blackall, L. (2005). "Investigation of
PAOs and GAOs and their effects on EBPR performance at full-scale wastewater
treatment plants in US." Proceedings, WEFTEC 05, Washington, DC.
He, S., Gu, A. Z., and McMahon, K. D. (2006). "Fine-scale differences between
Accumulibacter-like bacteria in enhanced biological phosphorus removal activated
sludge." Water Sci Technol, 54(1), 111-117.
He, S., Gu, A.Z., McMahon, K.D. (2005). "The role of Rhodocyclus-like organisms in biological
phosphorus removal: factors influencing population structure and activity." Proceedings,
WEFTEC 05, Washington, DC.
Helness, H., and Odegaard, H. (1999). "Biological phosphorus removal in a sequencing batch
moving bed biofilm reactor." Water Sci Technol, 40(4-5), 161-168.
Hesselmann, R. P. X., Werlen, C., Hahn, D., van der Meer, J. R., and Zehnder, A. J. B. (1999).
"Enrichment, phylogenetic analysis and detection of a bacterium that performs enhanced
biological phosphate removal in activated sludge." Syst Appl Microbiol, 22(3), 454-465.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

60
 Nutrient Removal 2009

Jobbagy, A., Literathy, B., Wong, M. T., Tardy, G., and Liu, W. T. (2006). "Proliferation of
glycogen accumulating organisms induced by Fe(III) dosing in a domestic wastewater
treatment plant." Water Sci Technol, 54(1), 101-109.
Johnson, T., Steichen, M., Shaw, A., McQuarrie, J. and Hunter, G. . (2006). "When is IFAS The
Right Choice ?", Proceedings, WEFTEC 06, Dallas, TX.
Kim, H., Hubbell, S., Boltz, J.P., Flournoy, W., Gellner, J., Pitt, P., Dodson, R. and Schuler, A.J.
. (2007). "Questions and Answers About Integrated Fixed-Film/Activated Sludge (IFAS)
in a BNR Pilot Plant." Proceedings, WEFTEC 07, Sandiego, CA.
Kong, Y. H., Nielsen, J. L., and Nielsen, P. H. (2004). "Microautoradiographic study of
Rhodocyclus-related polyphosphate accumulating bacteria in full-scale enhanced
biological phosphorus removal plants." Appl Environ Microb, 70(9), 5383-5390.
Kumar, B. M., and Chaudhari, S. (2003). "Evaluation of sequencing batch reactor (SBR) and
sequencing batch biofilm reactor (SBBR) for biological nutrient removal from simulated
wastewater containing glucose as carbon source." Water Sci Technol, 48(3), 73-79.
Liu, W. T., Nakamura, K., Matsuo, T., and Mino, T. (1997). "Internal energy-based competition
between polyphosphate- and glycogen-accumulating bacteria in biological phosphorus
removal reactors - Effect of P/C feeding ratio." Water Res, 31(6), 1430-1438.
Maas, C. L. A. (2007). "Detachment of Solids and Nitrifiers in IFAS Systems, Proceedings."
Proceedings, WEFTEC 07, Sandiego, CA.
McMahon, K. D., Jenkins, D., and Keasling, J. D. (2002). "Polyphosphate kinase genes from
activated sludge carrying out enhanced biological phosphorus removal." Water Sci
Technol, 46(1-2), 155-162.
Metcalf, and Eddy. (2003). Wastewater Engineering: Treatment and reuse, 4th Edition revised
by Tchobanoglous G., Burton F.L., and Stensel H. D. McGraw-Hill Science Engineering.
Ed.
Monti, A., Hall, E. R., Koch, F. A., Dawson, R. N., Husain, H., and Kelly, H. G. (2007).
"Toward a high-rate enhanced biological phosphorus removal process in a membrane-
assisted bioreactor." Water Environ Res, 79(6), 675-686.
Morgenroth, E., and Wilderer, P. A. (1999). "Controlled biomass removal - The key parameter to
achieve enhanced biological phosphorus removal in biofilm systems." Water Sci Technol,
39(7), 33-40.
Odegaard, H. (2006). "Innovations in wastewater treatment: the moving bed biofilm process."
Water Sci Technol, 53(9), 17-33.
Oehmen, A., Lemos, P. C., Carvalho, G., Yuan, Z. G., Keller, J., Blackall, L. L., and Reis, M. A.
M. (2007). "Advances in enhanced biological phosphorus removal: From micro to macro
scale." Water Res, 41(11), 2271-2300.
Oehmen, A., Saunders, A. M., Vives, M. T., Yuan, Z. G., and Keller, H. (2006). "Competition
between polyphosphate and glycogen accumulating organisms in enhanced biological
phosphorus removal systems with acetate and propionate as carbon sources." Journal of
Biotechnology, 123(1), 22-32.
Oehmen, A., Yuan, Z., Blackall, L. L., and Keller, J. (2004). "Short-term effects of carbon
source on the competition of polyphosphate accumulating organisms and glycogen
accumulating organisms." Water Sci Technol, 50(10), 139-144.
Onnis-Hayden, A., Dair, D., Johnson, C, Schramm, A. and Gu, A.Z. (2007). "Kinetics and
nitrifying populations in nitrogen removal processes at a full-scale integrated fixed-film
activated sludge (IFAS) plant." Proceedings, WEFTEC 07, Sandiego, CA.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

61
 Nutrient Removal 2009

Onnis-Hayden, A., Majed, N., Mcmahon, K.D. and Gu, A.Z. (Year). "Phosphorus Removal and
PAOs Populations at a Full-Scale Integrated Fixed-Film Activated Sludge (IFAS) Plant."
Proceedings, WEFTEC08, Chicago, IL.
Pastorelli, G., Canziani, R., Pedrazzi, L., and Rozzi, A. (1999). "Phosphorus and nitrogen
removal in moving-bed sequencing batch biofilm reactors." Water Sci Technol, 40(4-5),
169-176.
Rodrigo, M. A., Seco, A., Ferrer, J., and Penya-Roja, J. M. (1999). "The effect of sludge age on
the deterioration of the enhanced biological phosphorus removal process." Environ
Technol, 20(10), 1055-1063.
Rogalla, F., Johnson, T. L., and McQuarrie, J. (2006). "Fixed film phosphorus removal - flexible
enough?" Water Sci Technol, 53(12), 75-81.
Rutt K., S. J. a. C. H. J. (2006). "Two year case study of integrated fixed film activated sludge at
Broomfield, CO WWTP.", Proceedings, WEFTEC 06. Dallas, TX.
Saito, T., Brdjanovic, D., and van Loosdrecht, M. C. M. (2004). "Effect of nitrite on phosphate
uptake by phosphate accumulating organisms." Water Res, 38(17), 3760-3768.
Saunders, A. M., Oehmen, A., Blackall, L. L., Yuan, Z., and Keller, J. (2003). "The effect of
GAOs (glycogen accumulating organisms) on anaerobic carbon requirements in full-scale
Australian EBPR (enhanced biological phosphorus removal) plants." Water Sci Technol,
47(11), 37-43.
Sriwiriyarat, T., and Randall, C. W. (2005a). "Evaluation of integrated fixed film activated
sludge wastewater treatment processes at high mean cells residence time and low
temperatures." Journal of Environmental Engineering-Asce, 131(11), 1550-1556.
Sriwiriyarat, T., and Randall, C. W. (2005b). "Performance of IFAS wastewater treatment
processes for biological phosphorus removal." Water Research, 39(16), 3873-3884.
Whang, L. M., and Park, J. K. (2006). "Competition between polyphosphate- and glycogen-
accumulating organisms in enhanced-biological-phosphorus-removal systems: Effect of
temperature and sludge age." Water Environ Res, 78(1), 4-11.
Zeng, R. J., Saunders, A. M., Yuan, Z. G., Blackall, L. L., and Keller, J. (2003). "Identification
and comparison of aerobic and denitrifying polyphosphate-accumulating organisms."
Biotechnol Bioeng, 83(2), 140-148.
Zilles, J. L., Peccia, J., Kim, M. W., Hung, C. H., and Noguera, D. R. (2002). "Involvement of
Rhodocyclus-related organisms in phosphorus removal in full-scale wastewater treatment
plants." Appl Environ Microb, 68(6), 2763-2769.

Copyright ©2009 Water Environment Federation. All Rights Reserved.

62