Available online at www.sciencedirect.

com

Scientia Horticulturae 116 (2008) 65–72

www.elsevier.com/locate/scihorti

Chitosan effects on floral production, gene expression,

and anatomical changes in the Dendrobium orchid
Patchra Limpanavech a,c,*, Subhalai Chaiyasuta a,c, Ranitha Vongpromek a,c,
Rath Pichyangkura b,c, Chumpol Khunwasi a, Supachitra Chadchawan a,c,
Pongtharin Lotrakul a,c, Reungwit Bunjongrat a,
Anchalee Chaidee a, Thapana Bangyeekhun a
a
Environment and Plant Physiology Research Unit, Department of Botany, Faculty of Science,
Chulalongkorn University, Bangkok 10330, Thailand
b
Department of Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
c
Center of Chitin-Chitosan Biomaterial, Chulalongkorn University, Bangkok 10330, Thailand
Received 14 March 2007; received in revised form 18 September 2007; accepted 22 October 2007

Abstract
Six types of chitosan molecules, P-70, O-70, P-80, O-80, P-90, and O-90, were used to determine the effects on Dendrobium ‘Eiskul’ floral
production. According to analysis of variance (ANOVA) followed by Duncan’s multiple range test (DMRT), chitosan O-80 at all concentrations
tested, 1, 10, 50, and 100 ppm could induce early flowering and increase the accumulative inflorescence number during the 68 weeks of the
experimental period, when compared to the non-chitosan-treated controls. Therefore, chitosan O-80 was selected for further investigation of
chitosan effects on the Dendrobium orchid. With the foliar anatomical study, chloroplasts in the young leaves of the plants treated with chitosan O-
80 at 10 and 50 ppm were found to be significantly larger than those of the non-chitosan-treated ones. Enlarged chloroplasts were also detected in
the old leaves treated with 50 ppm chitosan O-80. Differential display showed that the ycf2 gene (accession no. DQ268736) in chloroplasts was
affected after 24 h of chitosan O-80 treatment. The reduction of ycf2 gene expression was detected in the young leaves after 12–48 h of chitosan O-
80 application using the reverse transcription-polymerase chain reaction (RT-PCR) method. This indicated that chloroplast was one of the target
sites for chitosan action in Dendrobium. Moreover, chitosan O-80 also significantly increased the number of vascular bundles containing silica cells
in both old and young leaves, suggesting chitosan effects on silica metabolism and/or silica uptake in orchids.
# 2007 Elsevier B.V. All rights reserved.

Keywords: Chitosan; Flowering; Orchid; Dendrobium; Chloroplast; Vascular bundle; Silica

1. Introduction non-toxic biodegradable natural polymer, chitosan, which is

Thailand is the top tropical orchid exporter. Two point six
billions baht’s worth of orchids is exported each year
(Department of Agriculture Extension, 2003), and the
Dendrobium ‘Eiskul’ is one of the important commercial cut
flowers. In order to produce the high-yield and good quality
crop, a tremendous amount of fertilizer and chemical stimulants
have to be applied, most of which are imported. This results in
higher production cost for growers. Our research goal is to
introduce an alternative method for orchid growers, using the
* Corresponding author. Tel.: +66 2 218 5485 6; fax: +66 2 252 8979.
E-mail address: patchra.L@chula.ac.th (P. Limpanavech).
0304-4238/$ – see front matter # 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.scienta.2007.10.034
produced domestically, to promote orchid production.
Chitosan is a biopolymer with many appealing character-
istics. It has been reported in various industrial, medicinal,
pharmaceutical, and agricultural applications (Babel and
Kurniawan, 2003; Obara et al., 2003; Wang et al., 2003;
Worrell et al., 2002; Ohta et al., 1999).
Chitosan was first characterized as an elicitor in plants. It has
been shown to activate plant defense genes through the
octadecanoid pathway (Doares et al., 1995), to increase the
activity of a wounding responsive protein in tomatoes
(Stratmann and Ryan, 1997) and has acted as an elicitor in
slash pine (Pinus elliotti) (Mason and Davis, 1997) and oats
(Tada et al., 2001). According to the defense gene induction
activity, chitosan has been proven to induce disease resistance
66 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72
in several plants, with pathogen and plant cultivar specificity
(Eikemo et al., 2003; Bell et al., 1998). The role of chitosan in
plant protection may also result from its antifungal activity.
Fifty parts per million chitosan almost completely inhibited
Botrytis cinerea conidia germination in vitro, and it was shown
to be able to control gray mould, caused by B. cinerea, in
cucumber plants (Ben-Shalom et al., 2003).
Chitosan’s effects on plant growth has also been shown in
Eustoma grandiflorum (Raf.) Shinn (Ohta et al., 1999).
Chitosan application to the soil mix at sowing time remarkably
enhanced plant growth and the treated plants flowered 15 days
earlier than the controls. Moreover, a greater number and
weight of flowers was produced by chitosan-treated plants.
Chitosan application in soil mixture also promoted seedling
growth of Torenia fournieri Linden ex E. Fourn., Exacum
affine Balf., Begonia hiemalis Fotsch, Sinningia speciosa
(Lodd.), Lobelia erinus L., Mimulus hybridus hort.ex A.
Siebert et Voss, Calceolaria herbeohybrida Voss, and
Campanula fragilis L. The first flowering date in chitosan-
treated T. fournieri Linden ex E. Fourn., E. affine Balf., B.
hiemalis Fotsch, S. speciosa (Lodd.), L. erinus L., M. hybridus
hort.ex A. Siebert et Voss were significantly earlier than with
the other treatments, but not in C. herbeohybrida Voss, and
C. fragilis L. (Ohta et al., 2004).
Chitosan was also involved in stomatal response. The
stomatal opening provides access to inner leaf tissue for many
plant pathogens. Therefore, the narrowing stomatal aperture
may be advantageous in plant defense. The stomatal aperture of
tomato and Commelina communis was reduced when the
epidermis was treated with chitosan (Lee et al., 1999). It was
found that foliar application of chitosan could decrease
transpiration in pepper plants, resulting in a reduction in water
use by 26–43%, while their biomass production and yield still
remained unchanged (Bittelli et al., 2001), suggesting that
chitosan could be an effective antitranspirant to conserve water
use in agriculture.
Our research goal is to study the effects of the application of
different types of chitosan molecule on Dendrobium orchid
production and to investigate plant responses at the cellular and
molecular levels. Six types of chitosan molecules, which were
polymeric and oligomeric chitosan with degrees of deacetyla-
tion of 75–80, 80–90, and >90%, were used in our
experiments. After the appropriate type and concentration
of chitosan molecule for orchid floral production was
determined from the cellular responses, the best type and
concentration was then applied to the orchid plants for
differential display experiment to identify chitosan-affected
genes. This research revealed the novel effects of chitosan
treatment on orchid plants.
2. Materials and methods
2.1. Plant materials
Four hundred pot plants of nine-month-old mericlone of the
Dendrobium ‘Eiskul’, grown in coconut husk filled in 4-in.
diameter clay pots, were used in the experiment to detect the
effect of chitosan type and concentration on floral production.
The same mericlone was also used for cellular and molecular
studies.
2.2. Chitosan
The chitosan used in this experiment was prepared from crab
shell by standard protocol as followed. The demineralization
step was accomplished by soaking 600 g of crab shells in 10
litters of 1.5 M hydrochloric acid (HCl) for 24 h. The acid
solution was replaced with a freshly prepared solution every
8 h. The deproteinization step was accomplished by soaking the
protein containing crab shells, from the demineralization step,
in 10 liters of 1.5 M sodium hydroxide (NaOH) for 24 h. The
sodium hydroxide solution was replaced with freshly prepared
solution every 8 h. The resulted chitin product was then
deacetylated. Deacetylation of chitin was performed in 50% (w/
w) sodium hydroxide for 48 h, the NaOH solution was changed
after the first 24 h. The chitosan product was washed in distilled
water until the pH was neutralized.
Six types of chitosan molecules were prepared; P-70
(400,000 Mw, 75–80% DD), P-80 (530,000 Mw, 80–90% DD),
P-90 (450,000 Mw, >90% DD), O-70 (30,000 Mw, >90% DD),
O-80 (45,000 Mw, >90% DD), and O-90 (110,000 Mw, >90%
DD). After chitosan preparation, the average of molecular mass
was determined by a gel permeation chromatography (GPC)
method and % DD was measured by UV spectrophotometric
method.
Molecular weight of chitosan was determined using gel
permeation chromatography (Waters 600E, U.S.A.). Test
conditions; eluent: 0.5 M acetate buffer pH 4, flow rate
0.6 ml min-1, injection volume: 20 ml, temperature 30 8C,
column set: ultrahydrogel linear 1 column (Mw resolving rage
1000–20,000,000) + guard column, polymer standard: poly-
saccharide (pullulan: Mw 5900–788,000), calibration method:
polysaccharide standard calibration. Chitosan (2 mg ml-1) was
dissolved in eluent and filtered using nylon 66 membrane (pore
size 0.45 mm) before injection.
The degree of deacetylation (DD) of chitosan was
determined by the first derivative UV-spectrophotometry with
modified version of the method described by Muzzarelli and
Rocchetti (1985). Briefly, 0.2 g chitosan was dissolved in
100 ml of 0.2 M acetic acid and stirred at 100 rpm for 24 h
following by filtration with filter paper (Whatman no. 5). The
chitosan solution (5 ml) was diluted in 100-ml distilled water to
get the final concentration of 0.1 mg ml-1. The solution was
transferred into 1-cm cuvette for the determination using a UV–
vis spectrophotometer (Agilent G1103A, U.S.A.). The DD was
calculated as following formula:
 
1  fA=ðð10  WÞ  204AÞ þ Ag
% DD ¼  100
161
where A is concentration of N-acetyl-D-glucosamine (g/l)
divide by 204, W the chitosan weight (g) in 100 ml 0.01 M
acetic acid, 204 the molecular weight of N-acetyl-D-glucosa-
mine and 161 is the molecular weight of D-glucosamine.
 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72
2.3. Experimental design and data collection for the floral
production study
A randomized completely block design (RCBD) was
conducted with 4 replications of 25 treatments to compare the
6 molecule types of chitosan, P-70, O-70, P-80, O-80, P-90 and
O-90, each of which was applied in 4 concentrations, 1, 10, 50
and 100 ppm. For chitosan treatment, the chitosan was mixed
with fertilizer solution containing 1.6 g/l of 30-10-10, alter-
natively with 10-52-10 fertilizer, plus 0.01% Triton X-100 to
spray to the plants every week. Orchid plants without chitosan
application were used as a control. The plants were grown in a
wall-less house using 60% shade saran as the roof, which resulted
in the average light intensity of 200 mmol m2 s1, the
temperature between 25–36 8C during the experiment period
of 68 weeks. Sprinkler irrigation was applied twice daily in the
morning and late afternoon. The data of floral production,
flowering time, inflorescence number (IN) and flower per
inflorescence (FPI) was collected. Statistical analysis was
performed using one way analysis of variance (ANOVA)
followed by Duncan’s multiple range test (DMRT) with 4
replicates. P-values 0.05 were considered as significant.
2.4. Leaf anatomical study
To study the effects of chitosan at cellular level, the fertilizer
solution, supplemented with chitosan O-80 at concentration of 1,
10, 50 and 100 ppm, supplemented with 0.01% Triton X-100 was
sprayed on orchid plants once a week for 1 year. The orchid plants
sprayed with fertilizer only were used as controls. Four replicates
were conducted for each treatment. Comparison of leaf anatomy
was carried out among plants treated with various concentration
of chitosan O-80 (1, 10, 50, and 100 ppm.) and the non-chitosan-
treated plants, as O-80 at all concentration showed the effects on
floral production of Dendrobium ‘Eiskul’.
To investigate the cellular responses, leaves from the
youngest mature pseudobulb of each plant were used as
representative for intracellular study. The top leaf was
considered as a young leaf, while the bottom leaf was consider
as an old one. Leaves were sectioned with 70–80 micron
thickness using microtome. The sections were examined and
digitally recorded with an Olympus BH-2 microscope
(Olympus America, Inc.) equipped with Olympus DP70
camera and DP controller software. Dimensions of chloroplasts
were determined from micrographs using DP controller
software. Tissues were stained with safranin-O for a clear
view of silica bodies. Chloroplast diameter (CD) and
percentage of vascular bundle containing silica bodies were
subjected for statistical analysis using one way analysis of
variance followed by Duncan’s multiple range test. P-values
0.05 were considered as significant.
2.5. Differential display
For differential display experiment, mericlone of Dendrobium
‘Eiskul’ was cultured as indicated above. Plants were separated
into 2 groups, one as the untreated control, and the other being
67
chitosan-treated. The treated orchid plants were sprayed with
fertilizer solution with the addition of 10 ppm of the most
appropriate chitosan type (O-80), plus 0.01% Triton X-100, until
fully soaked. The non-treated control was sprayed at the same
time with the fertilizer solution, plus 0.01% Triton X-100. Young
leaf tissues from each group were harvested 24 h after treatment
for differential display and gene expression study.
Total RNA was isolated from the young leaves of
Dendrobium according to the method described by Yu and
Goh (2000) with some modifications. Frozen materials (0.1 g)
were ground in liquid nitrogen and mixed with the buffer
containing 100 mM Tris–HCl (pH 7.5), 20 mM EDTA, 2 M
NaCl, 1% (w/v) polyvinylpolypyrrolidone (PVPP), 2% (v/v) b-
mercaptoethanol, and 2% (w/v) CTAB. The buffer was heated
in a water bath at 65 8C for 15 min to dissolve CTAB. After
centrifugation, the aqueous phase was extracted at least twice
with an equal volume of chloroform: isoamyl alcohol (24:1, v/
v). Then, total RNA was precipitated by adding 0.25 volume of
10 M lithium chloride before incubating overnight at 20 8C.
After precipitation, the pellet was washed twice with 70%
ethanol. The dried pellet was dissolved in diethylpyrocarbonate
(DEPC)-treated water. The purity and concentration of the
RNA were determined using a spectrophotometer and agarose
gel electrophoresis.
Total RNA samples from non-treated control and chitosan-
treated plants were digested with RNase-free deoxyribonu-
clease I to remove the residual DNA. Two micrograms of
treated total RNA was used for the first-strand cDNA synthesis
using anchored and arbitrary primers (Operon Technologies,
Inc. and UBC, Inc.). PCR products were separated on 6% (w/v)
native polyacrylamide gel at 90 volts for 7 h under thermostatic
conditions. The amplified cDNAs were then visualized by silver
staining (De Moreno et al., 1985) with some modifications.
The selected cDNA fragments were purified from the
polyacrylamide gel following the method described by
Sambrook et al. (1989), and then used as the templates for
reamplification by PCR. Subsequently, the PCR products were
purified using an Ultraclean 15 DNA Purification kit (MO BIO
laboratory) after agarose gel electrophoresis, and cloned into
pGEM-T vector using pGEM-T Cloning kit (Promega)
following the manufacturer’s procedure. The sequences of
the differentially expressed genes were determined and
submitted to the GenBank database.
2.6. Detection of gene expression by reverse transcription-
polymerase chain reaction
Total RNA was extracted from the young leaves after 24 h of
chitosan/non-chitosan treatment as indicated above. Using
oligo (dT) 18 primers, cDNA was synthesized with Superscript
III reverse transcriptase (Invitrogen). PCR was carried out using
a PTC-100TM programmable thermal controller (MJ Research,
Inc.) along with a primer pair specific to Dendrobium Ycf2
gene; a forward primer: GTAGACCCGTTAGGTATGAA, and
a reverse primer: TGTAGACCCGTATCAATAAT. The reaction
solution was incubated at 94 8C for 5 min. Then, the PCR was
performed by 35 cycles of denaturation at 94 8C for 30 s and
68 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72

5.66  0.6
6.30  0.4
6.33  0.1
6.14  0.4
6.11  0.2
annealing at 54 8C for 2 min, polymerization at 72 8C for 30 s
and final extension at 72 8C for 5 min. The products were

FPIns
detected on 1.5% agarose gel. To normalize gene expression, a
parallel amplification of b-actin, the housekeeping control

6.25  0.6ab
7.50  0.6b
5.50  0.5a

5.50  0.9a
5.75  0.5a
gene, was performed using Dendrobium actin specific primer;
forward primer: GCTGGTCGTGACCTGACTGA and reverse

Data are the means with standard deviations. Different letters in the same column are significantly different between the treatments at 5% level according to Duncan’s multiple range tests.
O-90
primer: TGGTCAACGGAACCTCTCAG with the condition

IN
for 40 cycles of PCR as follows: 94 8C for 30 s and annealing at
54 8C for 45 s, polymerization at 72 8C for 45 s and final

5.66  0.6
5.99  0.3
5.44  0.2
5.95  0.5
6.03  0.3
extension at 72 8C for 5 min.

ns
FPI
3. Results

7.00  0.4b
8.00  1.2b
5.50  0.5a
5.75  0.8a

5.25  1.1a
3.1. Chitosan affects on Dendrobium ‘Eiskul’ flowering

P-90
IN
The effect of chitosan types and concentration on inflorescence number (IN) per plants and flowers per inflorescence (FN) during 68 weeks of application
The chitosan used in our experiments showed a difference in
the average of molecular weight (Mw) as followed: P-70 with

5.99  0.5 ab

6.18  0.4 ab
6.89  0.6 b
5.66  0.6 a

5.74  0.2 a
Mw = 400,000, O-70 with Mw = 30,000, P-80 with Mw =
530,000, O-80 with Mw = 45,000 P-90 with Mw = 450,000,

FPI
and O-90 with Mw = 110,000.
The effects of molecule type and concentration of chitosan

7.75  0.3 b
7.50  0.9 b
6.50  0.3 b
on the inflorescence number of Dendrobium ‘Eiskul’ were

7.75  0.6b
5.50  0.5a
determined. The O-70 chitosan at the concentration of

O-80
100 ppm was found to significantly increase IN. However,

IN
this effect was not detected in the other concentrations tested
for both polymeric and O-70 chitosan. A significant increase

5.66  0.6
6.41  0.4
6.01  0.2
5.80  0.3
6.44  0.4
in IN was also found when O-80 chitosan was sprayed onto

ns
the plants at all concentrations tested. On the contrary, this

FPI
effect was found only when P-80 was used at 1 and 10 ppm
concentration. To the same level, the IN of the tested plant

7.25  1.5 ab
6.50  0.6 ab
8.25  1.0 b
7.50  1.0 b
was significantly increased when P-90 chitosan at 10 and 5.50  0.5 a
50 ppm, and oligomeric chitosan at 1 ppm were used
P-80
IN

(Table 1).
When the numbers of flower per inflorescence (FPI) was
5.66  0.6
6.31  0.4
6.20  0.3
6.24  0.5
5.70  0.1
considered, it was found that only P-70 chitosan at 100 ppm and
O-80 chitosan at 10 ppm were able to significantly increase the
ns
FPI

FPI (Fig. 2). No significant difference in FPI was detected in the

rest of the treatments when compared with the control.
ab
ab

Chitosan also induced earlier flowering time in Dendrobium

b
a
a
5.50  0.5
6.00  0.0
6.50  0.6
6.25  1.2
7.00  0.8

‘Eiskul’. All chitosan-treated plants flowered 2–16 weeks

earlier than the untreated ones, depending on the type of
O-70
IN

chitosan molecule. Up to 16 weeks earlier flowering time was

found in the treatment of 100 ppm O-70, 10 ppm and 100 ppm
6.51  0.3 ab
6.80  0.3 b
5.66  0.6 a
6.21  0.2 a
5.95  0.5 a

P-70, 1 ppm and 50 ppm O-80, 10 ppm and 50 ppm P-80,

1 ppm, 50 ppm, and 100 ppm O-90.
FPI

3.2. Chitosan enlarged chloroplast size and increased

Chitosan type

number of silica bodies in Dendrobium ‘Eiskul’

5.50  0.5
7.00  1.2
6.00  1.1
7.00  1.4
6.75  0.9
P-70
ns

Chitosan did not affect mesophyll and epidermal cell

IN

character, but the chloroplasts were found to be enlarged.

Minimum of 30 chloroplast diameters randomly measured from
Concentration (ppm)

5 areas in each leaf was indicated as the average chloroplast

diameter in each treatment. Statistical analysis was performed
using one way analysis of variance followed by Duncan’s
Table 1

multiple range test to distinguish the effect of chitosan on

0
1

100
10
50

chloroplast enlargement in both young and old leaves.

 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72 69

Chitosan O-80 significantly increased the chloroplast
diameter of Dendrobium ‘Eiskul’ in young leaves, when the
plants were treated with 10 and 50 ppm of chitosan O-80. At
concentration of 50 ppm, chitosan O-80 also significantly caused
chloroplast enlargement in the old leaves (Fig. 1, Table 2).
3.3. Chloroplast gene expression was affected by chitosan
treatment
Differential display was used to isolate the Dendrobium
‘Eiskul’ gene responsive for chitosan O-80 application. One of
the cDNA (GenBank accession no. DQ268736) isolated showed
the similarity to Ycf2 gene in Phalaenopsis aphrodite subsp.
formosana (GenBank accession no. AY916449). The translated
gene product showed a similarity to the same protein with 96%
identity (GenBank accession no. YP358645). This region is one
of the two giant open reading frame, ycf1 and ycf2, conserved in
chloroplast genome of Angiosperm. It has been suggested that
ycf1 and ycf2 are functional genes and encode products that are
essential for cell survival (Drescher et al., 2000).
Specific primers for ycf2 gene were used to detect ycf2
gene expression after chitosan O-80 treatment via reverse

Fig. 1. Chitosan O-80 effect on chloroplast enlargement in old (a, c, e, g, and i) and young (b, d, f, h, and i) leaves. Dendrobium ‘Eiskul’ plants were treated with
chitosan at concentration of 1 (a and b), 10 (c and d), 50 (e and f), and 100 (g and h) ppm. The non-chitosan-treated plants were used as controls (i and j). Bar = 50 mm.
70 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72

Table 2
Effects of oligomeric chitosan with 80% degree of deacetylation (O-80) on
chloroplast diameter (CD) and percentage of vascular bundle containing silica
bodies (SB) in old and young leaves
Conc.(ppm) Young leaves Old leaves
CD (mm) SB (%) CD (mm) SB (%)
a a b
0 9.15  0.8 26.19  4.1 7.97  0.5 41.80  9.3a
1 9.23  1.4 a 48.73  11.3b 6.55  0.5 a 67.54  9.8b
10 12.16  1.3 b 78.66  10.5c 8.60  0.8 b 92.58  5.1c
50 11.87  0.6 b 96.92  0.6 d 10.43  1.1 c 84.22  8.9c
100 10.73  1.3 ab 92.40  5.8 cd 8.98  0.9 b 94.62  9.3c
CD and SB values are the means with standard deviations. Different letters in
the same column are significantly different between the treatments at 5% level
according to Duncan’s multiple range tests.

transcription-polymerase chain reaction (RT-PCR) method.

Chitosan treatment resulted in a reduction of ycf2 gene Fig. 3. Silica bodies in the Dendrobium ‘Eiskul’.
expression after 12, 24 and 48 h (Fig. 2).

3.4. Silica cells also increased after chitosan application
Silica cells, or stegmata, sheathing vascular bundles and
fiber bundles in longitudinal rows, can be found in all major
orchid groups (Moller and Rassmussen, 1984), except that
silica bodies are entirely absent from the subfamilies
Vanilloideae and Orchidoideae and most Epidendroideae
(Prychid et al., 2003). However, silica bodies were found in
Dendrobium ‘Eiskul’, which is in the subfamily Epidendroi-
deae. The older leaves contained more vascular bundle
sheathing with silica cells (Fig. 3, Table 2). Chitosan O-80
treatment increased the number of vascular bundle sheathings
with stegmata in both old and young leaves.
4. Discussion
4.1. Chitosan-affected Dendrobium ‘Eiskul’ flowering
This clearly shows that, at specific concentrations, some
molecule types of chitosan can significantly promote flower
production of Dendrobium ‘Eiskul’. Our studies suggest that O-
80 chitosan was the most suitable, since it could increase IN of
the plants at all concentration tested. The only chitosan type
tested that did not show a significant effect on the IN was P-70
chitosan.
Our report is the first to show that chitosan affects
Dendrobium floral production in a chitosan molecular type
Fig. 2. Ycf2 gene expression affected by 10 ppm of chitosan O-80 treatment.
Actin gene was used for internal control of RNA loading.
and concentration dependent fashion. Chitosan effect on
floral production has also been previously reported in E.
grandiflorum (Ohta et al., 1999), T. fournieri Linden ex E.
Fourn., E. affine Balf., B. hiemalis Fotsch, S. speciosa
(Lodd.), L. erinus L., M. hybridus hort.ex A. Siebert et Voss
(Ohta et al., 2004). Chitosan of different MWs was observed
to have different capacities to induce defence responses in
rice (Lin et al., 2005). Although, several researchers have
reported chitosan as a plant growth stimulator, for example in
E. grandiflorum (Ohta et al., 1999), wheat (Tham et al.,
2001), grape (Vitis vinifera L. cv. Chardonnay) (Barka et al.,
2004), and Dendrobium protocorm-like bodies (Nge et al.,
2006), our data on shoot fresh weight, dry weight and leaf
area which we collected every 6 weeks for 1 year from
Dendrobium ‘Eiskul’ did not show any significant difference
compared with the control. Unfortunately, the molecular
characteristic of chitosan used in the previously reported
experiments was not reported. In spite of the observation
from our experiments, the role of chitosan on growth and
development in Dendrobium orchid should be further
investigated in detail.
4.2. Chitosan enlarged chloroplast size and increased
number of silica bodies in Dendrobium ‘Eiskul’
This was the first evidence for a chitosan effect on
chloroplast response in plants. It has been reported that foliar
application of chitosan reduced stomatal apertures in tomato
and C. communis (Lee et al., 1999). Ca2+ and H2O2 were
suggested to mediate these processes. The reduction of
stomatal aperture by chitosan should have resulted in growth
inhibition due to carbondioxide fixation reduction. However,
several reports showed growth enhancement in plants treated
with chitosan (Ohta et al., 1999; Tham et al., 2001; Barka
et al., 2004; Nge et al., 2006). Moreover, foliar application of
chitosan reduced the water use of pepper plants by 26–43%
while maintaining biomass production and yield (Bittelli
et al., 2001). This suggests that chitosan functions in
 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72
processes that maintain or stimulate plant growth. The
chloroplast enlargement may be one of the results in that
pathway. However, in our experiments, no significant
increase in the fresh weight and dry weight of Dendrobium
‘‘Eiskul’’ could be detected after chitosan treatment over 1
year of experiment (data not shown). Only an increase in
floral production was observed.
4.3. Chloroplast gene expression was affected by chitosan
treatment
The chitosan effect on chloroplast gene expression is
consistent with the cellular response showing the changes
in chloroplast size. This suggests that chitosan O-80
directly affects the chloroplast of the Dendrobium
orchid and has a long-term effect resulting in chloroplast
enlargement.
4.4. Silica cells also increased after chitosan application
Regarding to our experiment, chitosan treatments caused
more bundle sheathed with silica cells in Dendrobium ‘Eiskul.
This suggested the influence of chitosan on silica uptake and/or
silica metabolism in this orchid. Accumulation of silica bodies
was reported for the role in heat, wind and salt stress tolerance
(Hodson and Sangster, 2002).
5. Conclusion
Chitosan exhibits the ability to increase floral production of
the Dendrobium ‘Eiskul’, which makes chitosan a prospective
agent for agricultural application. Chloroplast is reported to be
one of the major sites for chitosan action in Dendrobium
‘Eiskul’ as the chloroplast gene expression, ycf2 is decreased
after treated with chitosan for 12 h, and chloroplasts were
enlarged after long-term use. Moreover, chitosan O-80 causes
anatomical leaf changes by increasing silica bodies, which may
play a role in stress tolerance.
Acknowledgements
The research was supported by Ratchdaphiseksompoj
Endowment, Chulalongkorn University and Ministry of
Education. We would like to thank Mr. Sahut Juntanaorapint
for his advice in microscope photography. This work was
partially supported by the Center of Chitin-Chitosan Bioma-
terials, Metallurgy and Materials Research Institute, Chula-
longkorn University, Bangkok, Thailand.
References
Babel, S., Kurniawan, T.A., 2003. Low-cost adsorbents for heavy metals
uptake from contaminated water: a review. J. Hazard. Mater. B97 219–
243.
Barka, E.A., Eullaffroy, P., Clement, C., Vernet, G., 2004. Chitosan improves
development and protects Vitis vinifera L. against Botrytis cinerea. Plant
Cell Rep. 22, 608–614.
71
Bell, A.A., Hubbard, J.C., Liu, L., Davis, R.M., Subbarao, K.V., 1998. Effects of
chitin and chitosan on the incidence and severity of Fusarium yellows in
celery. Plant Dis. 82, 322–328.
Ben-Shalom, N., Ardi, R., Pinto, R., Aki, C., Fallik, E., 2003. Controlling gray
mould caused by Botrytis cinerea in cucumber plants by means of chitosan.
Crop Prot. 22, 285–290.
Bittelli, M., Flury, M., Campbell, G.S., Nichols, E.J., 2001. Reduction of
transpiration through foliar application of chitosan. Agric. For. Meteorol.
107, 167–175.
De Moreno, M.R., Smith, J.F., Smith, R.V., 1985. Silver staining of proteins in
polyacrylamide gels: Increased sensitivity through a combined coomassie
blue-silver stain procedure. Anal. Biochem. 151, 466–470.
Department of Agriculture Extension, 2003, http://www.doae.go.th/.
Doares, S.H., Syrovets, T., Weiler, E.W., Ryan, C.A., 1995. Oligogalacturonides
and chitosan activate plant defensive genes through the octadecanoid
pathway. PNAS 92, 4095–4098.
Drescher, A., Ruf, S., Calsa Jr., T., Carrer, H., Bock, R., 2000. The two largest
chloroplast genome-encoded open reading frames of higher plants are
essential genes. Plant J. 22, 97–104.
Eikemo, H., Stensvond, A., Tronsmo, A.M., 2003. Induced resistance as a
possible means to control disease of strawberry caused by Phytophthora spp.
Plant Dis. 87, 345–350.
Hodson, M.J., Sangster, A.G. 2002. Silicon and abiotic stress. In the proceed-
ings of the ‘‘Second Silicon in Agriculture Conference’’ held in Tsuruoka,
Yamagata prefecture, Japan pp. 99–104.
Lee, S., Choi, H., Suh, S., Doo, I.-S., Oh, K.-Y., Choi, E.J., Schroeder Taylor,
A.T., Low, P.S., Lee, Y., 1999. Oligogalacturonic acid and chitosan reduce
stomatal aperture by inducing the evolution of reactive oxygen species
from guard cells of tomato and Commelina communis. Plant Physiol. 121,
147–152.
Lin, W., Hu, X., Zhang, W., John Rogers, W., Cai, W., 2005. Hydrogen peroxide
mediates defence responses induced by chitosans of different molecular
weights in rice. J. Plant Physiol. 162, 937–944.
Mason, M.E., Davis, J.M., 1997. Defense response in slash pine: Chitosan
treatment alter the abundance of specific mRNA. Mol. Plant-Microbe
Interact. 10, 135–137.
Moller, D.J., Rassmussen, H., 1984. Stegmata in Orchidales: character state
distribution and polarity. Bot. J. Linn. Soc. 89, 53–76.
Muzzarelli, R.A.A., Rocchetti, R., 1985. Determination of the degree of
acetylation of chitosan by first derivative ultraviolet spectrophotometry.
Carbohydr. Polym. 5, 461–472.
Nge, K.L., Nwe, N., Chandrkrachang, S., Stevens, W.F., 2006. Chitosan
as a growth stimulator in orchid tissue culture. Plant Sci. 170,
1185–1190.
Obara, K., Ishihara, M., Ishizuka, T., Fujita, M., Ozeki, Y., Maehara, T., Saito,
Y., Yura, H., Matsui, T., Hattori, H., 2003. Photocrosslinkable chitosan
hydrogel containing fibroblast growth factor-2 stimulates wound healing in
healing-impaired db/db mice. Biomaterial 24, 3437–3444.
Ohta, K., Tanguchi, A., Konishi, N., Hosoki, T., 1999. Chitosan treatment
affects plant growth and flower quality in Eustoma grandiflorum.
Hortscience 34, 233–234.
Ohta, K., Morishita, S., Suda, K., Kobayashi, N., Hosoki, T., 2004. Effects
of chitosan soil mixture treatment in the seedling stage on the growth
and flowering of several ornamental plants. J. Japan. Soc. Hort. Sci. 73,
66–68.
Prychid, C.J., Rudall, P.J., Gregory, M., 2003. Systematics and biology of silica
bodies in Monocotyledons. Bot. Rev. 69, 377–440.
Sambrook, J., Fritsch, E.F., maniatis, T., 1989. Molecular Cloning:
Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press,
New York.
Stratmann, J.W., Ryan, C.A., 1997. Myelin basic protein kinase activity in
tomato leaves is induced systemically by wounding and increases in
response to systemin and oligosaccharide elicitors. In: Proceedings of
National Academy of Science, 94. pp. 11085–11089.
Tada, Y., Hata, S., Tahata, Y., Nakayashiki, H., Tosa, Y., Mayama, S., 2001.
Induction and signaling of an apoptotic response typified by DNA laddering
in the defense response of oats to infection and elicitors. Mol. Plant-Microbe
Interact. 14, 477–486.
72 P. Limpanavech et al. / Scientia Horticulturae 116 (2008) 65–72

Tham, L.X., Nagasawa, N., Matsuhashi, S., Ishioka, N.S., Ito, T., Kume, T.,
2001. Effect of radiation-degraded chitosan on plants stressed with vana-
dium. Radiat. Phys. Chem. 61, 171–175.
Wang, X.H., Li, D.P., Wang, W.J., Feng, Q.L., Cui, F.Z., Xu, Y.X., Song, X.H.,
van der Werf, M., 2003. Crosslinked collagen/chitosan matrix for artificial
livers. Biomaterials 24, 3213–3220.
Worrell, D.B., Sean Carrington, C.M., Huber, D.J., 2002. The use of low
temperature and coatings to maintain storage quality of breadfruit, Arto-
carpus altilis (Parks.). Fosb. Postharvest Biol. Technol. 25, 33–40.
Yu, H., Goh, C.J., 2000. Identification and characterization of three orchid
MADS-BOX genes of the AP1/AGL9 subfamily during floral transition.
Plant Physiol. 123, 1325–1336.