TISSUE ENGINEERING

Volume 12, Number 9, 2006

# Mary Ann Liebert, Inc.

Chondrogenic Differentiation of Human Embryonic

Stem Cell–Derived Cells in Arginine-Glycine-Aspartate–
Modified Hydrogels

NATHANIEL S. HWANG, B.S., SHYNI VARGHESE, Ph.D., ZIJUN ZHANG, M.D.,

and JENNIFER ELISSEEFF, Ph.D.

ABSTRACT

Human embryonic stem cells (hESCs) have the potential to self-renew and generate multiple cell types,
producing critical building blocks for tissue engineering and regenerative medicine applications. Here,
we describe the efficient derivation and chondrogenic differentiation of mesenchymal-like cells
from hESCs. These cells exhibit mesenchymal stem cell (MSC) surface markers, including CD29,
CD44, CD105, and platelet-derived growth factor receptor-a. Under appropriate growth conditions, the
hESC-derived cells proliferated without phenotypic changes and maintained MSC surface markers.
The chondrogenic capacity of the cells was studied in pellet culture and after encapsulation in
poly(ethylene glycol)-diacrylate (PEGDA) hydrogels with exogenous extracellular proteins or arginine-
glycine-aspartate (RGD)-modified PEGDA hydrogels. The hESC-derived cells exhibited growth factor–
dependent matrix production in pellet culture but did not produce tissue characteristic of cartilage
morphology. In PEGDA hydrogels containing exogenous hyaluronic acid or type I collagen, no significant
cell growth or matrix production was observed. In contrast, when these cells were encapsulated in RGD-
modified poly(ethylene glycol)hydrogels, neocartilage with basophilic extracellular matrix deposition was
observed within 3 weeks of culture, producing cartilage-specific gene up-regulation and extracellular
matrix production. Our results indicate that precursor cells characteristic of a MSC population can be
cultured from differentiating hESCs through embryoid bodies, thus holding great promise for a po-
tentially unlimited source of cells for cartilage tissue engineering.

INTRODUCTION limited and decreases with age.2 Deleterious phenotypic

changes in the chondrocyte hinder the in vitro expansion of a

B ECAUSE OF THE INTRINSIC BIOLOGY OF CARTILAGE TISSUES,

such as limited blood supply and lack of self-
regeneration capacity, treatment of cartilage lesion remains
an intractable problem.1 Cell-based therapies and tissue
engineering may provide a solution for cartilage re-
construction. However, limited proliferative capacity of dif-
ferentiated chondrocytes and bone marrow-derived
mesenchymal stem cells (MSCs) pose a major challenge to
providing adequate cell numbers for transplantation therapy.
The self-renewal and proliferative capacity of MSCs is
clinically useful number of chondrocytes from a small
biopsy specimen, which may itself be diseased. Primary
isolated chondrocytes have the tendency to de-differentiate
in ex vivo culture.3
Human embryonic stem cells (hESCs), derived from the
inner cell mass of the blastocyst, may have significant po-
tential to affect cartilage tissue engineering.4 These cells are
being studied to understand early development and to for-
mulate cell- and tissue-regeneration therapies.5 The obvious
advantage of using embryonic stem cells (ESCs) for cartilage

Department of Biomedical Engineering, Johns Hopkins University School of Medicine, Baltimore, Maryland.

2695
2696
regeneration is that they are immortal and could potentially
provide unlimited numbers of differentiated chondrocytes
and chondro-progenitor cells for transplantation.6, 7 Re-
cently, ESCs were cultured on 3-dimensional (3D) scaffolds
for tissue engineering.8–10 However, application of ESCs to
tissue engineering still faces the difficulty of appropriately
differentiating the stem cells to the desired lineage in a
controlled and homogenous fashion.
Identification of appropriate biomaterials that support
cellular attachment, proliferation, and—most importantly in
the case of hESCs—differentiation is also critical for tissue
engineering and cellular therapy. The extracellular micro-
environment plays a significant role in controlling cellular
behavior.11–13 Currently, a number of scaffolding materials,
including synthetic and naturally derived biomaterials, have
been used in tissue engineering.14–16 Scaffold biomaterials
have been incorporated with specific peptides or naturally
occurring biological proteins to influence cell function.17–22
Hydrogels are 3D networks of hydrophilic polymers that im-
bibe a large quantity of water, as well as biological fluids.23
Poly(ethylene glycol) (PEG)-based hydrogels are ideal for
cartilage tissue engineering scaffolds because of their water
content, elasticity, biocompatibility, and ability to permit
diffusion of nutrients and bioactive molecules.15,24
Recent studies have indicated osteogenic and chondro-
genic lineage differentiation of hESCs.25–27 However, pro-
ducing discreet, well-developed cartilaginous structures on a
3D artificial scaffold remains a challenge. Here, we present
culture conditions for the derivation of mesenchymal-like
cells from embryoid bodies (EBs) and demonstrate specific
cell–extracellular matrix (ECM) interactions, in the form of
arginine-glycine-aspartate (RGD)-integrin binding, are re-
quired for enhanced chondrogenic commitment and carti-
laginous tissue formation. Given limited availability of cells
for cartilage tissue–replacement therapy, this work shows
promise for potential use of hESCs for cartilage tissue–
engineering applications.
MATERIALS AND METHODS
hESC culture and EB formation
The BG02 cell line was obtained from Bresagen (Athens,
GA) and cultured according to the manufacturer’s instruc-
tions.28 For EB formation, ESC cultures were dissociated
into small clumps by incubating at 378C for 30 min with
1 mg/mL collagenase IV (Gibco, Gaithersburg, MD). The
small ESC clumps were pelleted, resuspended in hESC
medium without basic fibroblast growth factor (bFGF), and
cultured in Petri dishes for 10 days with a medium change
every other day. The EBs were transferred to gelatin-coated
(0.1% w/v) plates. Upon 70% confluence, the cells were
further subcultured at an initial cell density of 2
104 cells/
cm2 for 4 passages in MSC growth medium consisting of
Dulbecco’s modified Eagle medium (DMEM, Gibco) sup-
HWANG ET AL.
plemented with 10% fetal bovine serum (Hyclone, Logan,
UT), 2 mM L-glutamine (Gibco), 100 U/mL penicillin, and
100 mg/mL streptomycin (Gibco). Human MSCs (Cambrex,
East Rutherford, NJ) were expanded in MSC growth med-
ium up to P5 and morphologically compared with ESC-
derived cells.
Pellet culture
For chondrogenic pellet cultures, 3
105 cells (P5) were
collected in 1-mL Eppendorf tubes and centrifuged at

150g for 5 min. Serum-free chondrogenic medium was pre-
pared with DMEM (Gibco) containing 2 mM L-glutamine;
100 nM dexamethasone; 50 mg/mL ascorbic acid phosphate
(Wako, Neuss, Germany); 1 mM sodium pyruvate; 40 mg/
mL proline; 1% insulin, transferrin, and selenious acid
(Collaborative Biomedical Products, Bedford, MA); and
10 ng/mL transforming growth factor (TGF)-b1 or 25 ng/
mL bone morphogenetic protein (BMP)-2 (Research Di-
agnostics, Inc., Flanders, NJ).
Photoencapsulation
hESC-derived cells (P5*P7) were encapsulated into 4
types of hydrogels. The primary hydrogel solution was pre-
pared by mixing 10% (w/v) poly(ethylene glycol)-diacrylate
(PEGDA; Nektar, Huntsville, AL) in sterile phosphate-
buffered saline (PBS) with penicillin (100 U/mL) and strep-
tomycin (100 mg/mL) (Gibco). Hydrogels with exogenous
ECM components were prepared by mixing 50/50 volume of
20% (w/v) PEGDA solution with type I collagen solution
(0.2% w/v in PBS) or hyaluronic acid (HA) solution (5 mg/
mL in PBS). RGD-modified PEG-based hydrogels were
prepared according to procedures previously described.20–22
Briefly, tyrosine-arginine-glycine-aspartate-serine (YRGDS)
was added to acryloyl-PEG-N-hydroxysuccinimide (3400 MW;
Nektar) in 50 mM TRIS buffer (pH 8.2) for 2 h at room tem-
perature. The product was lyophilized, and a final concentra-
tion of polymer solution containing 2.5 mM RGD was prepared
by mixing PEGDA and YRGDS-PEG-zcrylate in sterile PBS.
The hESC-derived cells were gently mixed with the polymer
solution at a concentration of 2
107 cells/mL. The photo-in-
itiator, Igracure 2959, was added to the cell–hydrogel solu-
tion and mixed thoroughly to make a final concentration of
0.05% (w/v). Photopolymerization of 100-mL cell–polymer–
photo-initiator suspension was conducted with 365-nm light
(4.5 mW/cm2) for 5 min. The constructs were then cultured
at 378C with 5% carbon dioxide in 2.5 mL chondrogenic
differentiation medium containing TGF-b1 (10 ng/mL) for
3 weeks.
FACS analysis
hMSCs (P5) and hESC-derived cells (4 passages) were
harvested and resuspended to approximately 3
105 cells in
50 mL PBS containing 0.1% bovine serum albumin. Cell
CHONDROGENIC DIFFERENTIATION OF hES-DERIVED CELLS
samples were separately labeled with fluorescein iso-
thiocyanate (FITC)-conjugated rat anti-human antigen CD45
(Becton Dickinson, San Jose, CA), phycoerythrin-conjugated
rat anti-human CD 29, CD45, CD73, and platelet-derived
growth factor receptor (PDGFR)-a (Becton Dickinson) on
ice for 30 min. Cells were also incubated with purified mouse
anti-human CD105 (Becton Dickinson) and then stained with
FITC-conjugated goat anti-mouse IgM ( Jackson Im-
munoResearch Laboratories, West Grove, PA). At least
15,000 events were collected from each run of flow cyto-
metry. Data were analyzed using the FACSCalibur cytometer
and CellQuest software (Becton Dickinson).
Swelling ratio
Acellular control hydrogels and hydrogels with exogen-
ous type I collagen (0.1% w/v) or HA (2.5 mg/mL) were
prepared (n ¼ 4). The wet weight was measured for swel-
ling after incubating the hydrogels up to 21 days in PBS at
378C. The swelling ratio was measured by comparing the
wet weight and lyophilized dried weight of hydrogels.
Biochemical assays
Constructs were lyophilized and digested in papain ac-
cording to Kim et al.,29 with the exception that digestion
buffer was adjusted to pH 6.3. Lyophilized constructs were
crushed with a tissue grinder (pellet pestle mixer, Kimble/
Kontes, Vineland, NJ), and then incubated with 1 mL 0.2-
mM papain digestion buffer (100 mM phosphate buffer,
10 mM cysteine, 10 mM ethylenediaminetetraacetic acid,
pH 6.3) containing 125 mg/mL papain type III (Worthington
Biomedical, Lakewood, NJ) at 608C for 16 h. Deoxyr-
ibonucleic acid (DNA) assay was performed as previously
described.30 Proteoglycan content was determined accord-
ing to chondroitin sulfate using dimethylmethylene blue
spectrophotometric assay at A525, as previously described.31
Chondroitin sulfate C (Sigma-Aldrich, St. Louis, MO) dis-
solved in de-ionized water was used to generate the standard
curve. The hydroxyproline content of insoluble collagen was
determined according to the method of Stegemann and
Stalder.32 After a portion of the papain-digested sample was
acid hydrolyzed, it was neutralized and oxidized with
chloramine-T/Ehrlich solutions, using 0.1 as the ratio of
hydroxyproline to collagen.
Histology and immunostaining
Pellets and hydrogel constructs were fixed in 4% paraf-
ormaldehyde, dehydrated in serial isopropanol dilutions,
and paraffin embedded. Hydrogels and pellets were cut into
5-mm sections and stained with hematoxylin and eosin,
Safranin-O/fast green, and Masson’s trichrome. For im-
munostaining, the hydrogel sections were de-paraffinized
with xylenes and hydrated with serial concentration of
100%, 95%, and 90% ethanol. Sections were then blocked
2697
with 5% normal goat serum in PBS for 30 min and in-
cubated with rabbit polyclonal antibodies against types I, II,
and X collagen (Research Diagnostics, Inc.) with 1:100,
1:00, and 1:40 dilutions, respectively. Sections were in-
cubated with FITC- or Texas Red–conjugated goat anti-
rabbit secondary antibodies (all 1:100 dilutions) for 1 h
( Jackson ImmunoResearch Laboratory, West Grove, PA).
Reverse transcriptase polymerase
chain reaction
Total ribonucleic acid was extracted with Trizol and
reverse-transcribed into complementary DNA using Super-
Script First-Strand Synthesis System (Invitrogen, Carlsbad,
CA). Reverse transcriptase polymerase chain reactions (RT-
PCRs) were performed for the following genes: aggrecan (F-
tgaggagggctggaacaagtacc, R-ggaggtggtaattgcagggaaca, 608C;
305bp), Type I collagen (F-tgacgagaccaagaactg, R-ccatc-
caaaccactgaaacc, 608C; 600bp), Type II collagen (F-
tttcccaggtcaagatggtc, R- cttcagcacctgtctcacca, 608C 377bp),
and link protein (F-gctctgtgcaatatcccatc, R-cccacttttgcaatct-
gagc, 608C; 232bp), with b-actin (F-tggcaccacaccttcta-
caatgagc, R-gcacagcttctccttaatgtc) as a reference.
Statistical analysis
Data are expressed as mean  standard deviation (SD).
Statistical significance was determined using single-factor
analysis of variance with p < 0.05 or p < 0.01.
RESULTS
Derivation of mesenchymal-like cells from hESCs
BG02 cells were induced to differentiate through embry-
oid body formation followed by culture on gelatin-coated
plates. Initially, the cultures contained a heterogeneous po-
pulation of cells that became more homogeneous with sub-
sequent passages (4 passages). Morphologically, the hESC-
derived cells have a similar morphology to fibroblast and
mesenchymal-like cells (Fig. 1). Flow cytometry analysis
confirmed that the hESC-derived cells expressed hMSC
surface markers (Fig. 2), including CD29, CD44, CD105,
and PDGFR-a. However, the hMSC marker CD73 was not
present. CD45, a negative marker for hMSC, was not ex-
pressed in the hESC-derived cells.
Growth factor response of hESC-derived
cells in pellet culture
To evaluate the chondrogenic differentiation capacity of
the cells, hESC-derived cells were induced to differentiate in
a standard pellet culture system with subsequent exposure to
BMP-2 or TGF-b1. After 3 weeks of culture, TGF-b1
treatment induced a greater increase in weight and matrix
production per cell than BMP-2 treatment (Fig. 3A, B).
2698 HWANG ET AL.

FIG. 1. Inverted light microscopy images of human mesenchymal stem cells (hMSCs) and Human embryonic stem cell (hESC)-
derived mesenchymal cells. hESC-derived mesenchymal cells (A) were morphologically comparable with hMSCs (B). hMSCs plated at
an initial cell density of 5
103 cells/cm2 were expanded up to 5 passages. Embryoid bodies (Ebs) were formed from hESCs using liquid
suspension methods for 10 days and plated onto gelatin-coated tissue culture plates. After 15 days of monolayer culture, EBs were
enzymatically dissociated and subsequently passaged at initial cell density of 20
104 cells/cm2 and expanded up to 4 passages.

Pellets exposed to TGF-b1 for 2 weeks and subsequently
exposed to BMP-2 for 1 week were equivalent in size and
matrix production rate as pellets treated with TGF-b1 for all
3 weeks of culture. Even though the cells in pellet culture
responded to TGF-b1 by increasing their size, chondrogenic
capacity of hESC-derived mesenchymal cells was limited
in pellet culture. Chondrogenic differentiation, evaluated
using Safranin-O staining, indicates lack of cartilage-related
proteoglycans (Fig. 3C).
Requirement of scaffold and ECM
microenvironment in chondrogenic
differentiation of hESC-derived cells
We subsequently evaluated whether addition of ECM
components known to induce chondrogenic responses
would promote the differentiation of hESC-derived me-
senchymal cell into the chondrogenic lineage. Exogenous
matrix proteins or specific peptide sequences known to
induce differentiation can be simply introduced into hy-
drogels using covalent or noncovalent mechanisms.20,33
Microenvironments for hESCs-derived mesenchymal cell
differentiation were created in PEGDA photo-polymerizing
hydrogels by adding exogenous type I collagen (0.1 mg/
mL) and HA (2.4 mg/mL) and covalently incorporating
RGD peptides (2.5 mM) into PEGDA hydrogels (Fig. 4A).
Amount of exogenous type I collagen and HA introduced
into the hydrogel was decided based on similar swelling
ratios of hydrogels. Control acellular hydrogels with exo-
genous HA and collagen show that these ECM components
are retained in the hydrogels for the duration of the ex-
periments (Fig. 5). hESC-derived mesenchymal cells were
encapsulated in photo-polymerizing hydrogels and cultured
for 3 weeks in chondrogenic medium containing TGF-b1.
Cells survived the hydrogel encapsulation process and
maintained viability throughout 3 weeks of culture in
chondrogenic medium containing TGF-b1 (data not shown).
Cell numbers measured according to DNA content of the
constructs and matrix glycosaminoglycan (GAG) content
indicated that individual components of the cartilage ECM,
HA, or collagen I, did not influence the growth or GAG
synthesis (Fig. 4B, C). hESC-derived mesenchymal cells
exposed to type I collagen and HA resulted in 20% and
43% less GAG accumulation, respectively, in the hydrogels
than cells encapsulated in the control PEGDA hydrogel
without any ECM components. However, the environment
created in the RGD-modified hydrogel significantly influ-
enced the behavior of hESC-derived mesenchymal cells
(Fig. 4C), resulting in 7% w/v of GAG accumulation, more
than a 200% increase in GAG content than in the control
PEGDA hydrogel constructs.
Histochemical and immunostaining analysis for pro-
teoglycans and collagen types I, II, and X performed after
21 days demonstrated significant differences between
scaffoldings used to differentiate hESC-derived mesench-
ymal cells. Safranin-O staining indicated that RGD-
modified hydrogels induced the hESC-derived cells to
produce basophilic ECM deposition containing proteogly-
cans characteristic of neocartilage, whereas no significant
Safranin-O staining was observed in the other hydrogel
constructs (Fig. 6). Cells in the RGD-modified hydrogels
had a consistent morphology, with a spherical shape typical
of chondrocytes, and produced intense and well-defined
staining with type II collagen antibody in the periphery of
the cells. Proliferating cells were present in lacunae, typical
of cartilaginous tissue. Cells in the PEGDA hydrogel pro-
duced minimal staining of cartilage-specific proteins,
whereas exogenous type I collagen or HA resulted in less-
intense staining of collagen types II and I and minimal
detection of type I collagen in PEGDA–collagen gels. Type
CHONDROGENIC DIFFERENTIATION OF hES-DERIVED CELLS 2699

FIG. 2. (A) Flow cytometry analysis of surface markers on human embryonic stem cell–derived mesenchymal cells. (B) Flow cytometry
analysis of surface markers on adult-derived human mesenchymal stem cells. PDGFR, platelet-derived growth factor receptor.

X collagen was weakly detected in all of the hydrogel
constructs.
RGD-modified PEG-based hydrogels induced
adhesive and TGF-b1-dependent chondrogenic
differentiation
After 7 days of culture, filopodia-like structures anchoring
the cells to the scaffold was evidence of interaction between
integrin receptors of differentiating hESC-derived cells and
RGD-containing PEG hydrogels. Cells in RGD-modified
hydrogels were more than twice the size of cells in non-RGD
hydrogels (Fig. 7). After 3 weeks of culture, significantly
greater rates of GAG production, as well as collagen syn-
thesis activities, were observed in cells in RGD-modified
hydrogels than in control hydrogels (Fig. 8). RGD signaling
was not sufficient to induce chondrogenic response alone
without exogenous TGF-b1 (data not shown). Reduced Sa-
franin-O staining was observed in the center of the hydrogel,
where TGF-b1 diffusion was limited (Fig. 8C, F).
To validate differentiation, RT-PCR was performed to
evaluate gene expression of chondrogenic markers (Fig. 9).
The time-course analysis of cartilage-related gene expression
further validated that the chondrogenic tissue lineage pro-
gression of hESC-derived mesenchymal cells in RGD-
modified PEG hydrogels was greater than that of control
PEGDA hydrogels. At day 7, hESC-derived mesenchymal
cells in PEGDA and RGD-modified PEG did not express
2700 HWANG ET AL.

FIG. 3. Chondrogenic differentiation capacities of human embryonic stem cell mesenchymal cells were limited in pellet culture.
2
105 cells were collected in 1-mL Eppendorf tubes and sedimented at
150g for 5 min. After 3 weeks of culture, initial treatment of
transforming growth factor (TGF)-b1 induced a greater increase in weight and matrix/cells than bone morphogenetic protein (BMP)-2-
treated pellets (A, B). However, chondrogenic differentiation, evaluated using Safranin-O staining, indicated no cartilaginous tissues (C)
(1) BMP-2 (25 ng/mL, 2 weeks) followed by TGF-b1 (10 ng/mL) treatment (1 week). (2) TGF-b1 treatment (2 weeks) followed by
BMP-2 (1 week) (3) TGF-b1 (3 weeks) *p < 0.05, **p < 0.01). DNA, deoxyribonucleic acid. Color images available online at
www.liebertpub.com/ten.

chondrocyte-specific genes, such as type II collagen, RGD-modified hydrogels was significantly upregulated.
aggrecan, and link proteins. Type I collagen, which is ex- Aggrecan and link protein expression were also upregulated
pressed in early mesenchymal cells, was expressed through- in the RGD-modified hydrogels, confirming the immuno-
out the culture. At day 21, type II collagen expression in staining, as well as the biochemical analysis.

FIG. 4. Gross image of an acellular poly(ethylene oxide)-diacrylate (PEGDA) photo-polymerizing hydrogel (A). Chondrogenic
differentiation capacities of embryonic stem cell–derived mesenchymal cells were investigated by adding extracellular matrix com-
ponents to hydrogels, as well as modifying the hydrogels with arginine-glycine-aspartate (RGD) peptides. Glycosaminoglycan (GAG)
production significantly increased in RGD-modified hydrogels (B). GAG amount was quantified using dimethylmethylene blue assay
and normalized to the dry weight of the construct for comparison. The deoxyribonucleic acid (DNA) content of the constructs was
normalized by dry weight for comparison (C) 1. Poly(ethylene glycol)-diacrylate (PEGDA). 2. PEGDA-collagen type I (0.1% w/v); 3.
PEGDA–hyaluronic acid (2.5 mg/mL). 4. PEGDA-RGD (2.5 mM). (* p < 0.05, ** p < 0.01).
CHONDROGENIC DIFFERENTIATION OF hES-DERIVED CELLS 2701

FIG. 5. (A) Swelling ratio of acellular poly(ethylene glycol)-diacrylate (PEGDA), PEGDA-collagen (Col), and PEGDA–hyaluronic
acid (HA) hydrogels. Comparable swelling ratio was observed in different hydrogels for the duration of the experiment, indicating that
exogenous extracellular matrix components are retained in the gel after 3 weeks of culture (n ¼ 4). (B) Acellular hydrogels containing
exogenous type I collagen (0.1% w/v) were incubated in phosphate-buffered saline up to 21 days, and collagen content was quantified
by measuring hydroxyproline content and normalized to the dry weight (n ¼ 4).

DISCUSSION wide differentiation potential.4,9 It has been proposed that

ESC differentiation through the formation of EBs mimics
hESCs, derived from the inner cell mass of the blas- the early developmental stages during embryogenesis, there-
tocyst, are a promising cell source for tissue regeneration by providing a window of opportunity to detect and pos-
applications because of their strong proliferative ability and sibly isolate tissue-restricted progenitor cells.34 Recent

FIG. 6. Addition of type I collagen (0.1% w/v) and hyaluronic acid (HA) (2.5 mg/mL) into poly(ethylene glycol)-diacrylate (PEGDA)
hydrogel resulted in no significant Safranin-O stained area, whereas covalent incorporation of arginine-glycine-aspartate (RGD) into
PEGDA resulted in chondrogenic differentiation, as evidenced by positive Safranin-O staining, and immunostaining for types I, II, and
X collagen. (A, E, I, M) PEGDA; (B, F, J, N) PEGDA-collagen type I (0.1% w/v); (C, G, K, O) PEGDA-HA (2.5 mg/mL); (D, H, L, P)
PEGDA-RGD (2.5 mm). Color images available online at www.liebertpub.com/ten.
2702
FIG. 7. Morphological analysis of cells encapsulated in poly
(ethylene glycol)-diacrylate (PEGDA) hydrogels (A) and
arginine-glycine-aspartate (RGD)-modified poly(ethylene glycol)
(PEG) hydrogel (B) after 7 days of encapsulation. Cell-matrix
interaction is evident in RGD-modified PEG hydrogels (arrow),
resulting in larger cell diameter (C). Bar ¼ 15 mm (**p < 0.01).
Color images available online at www.liebertpub.com/ten.
isolation of mesenchymal-like cells exhibiting CD73 from
ESCs provides evidence of lineage-restricted cells from
ESCs. However, this method requires long term co-culture
with murine OP9 cells, which might pose difficulties when
applying to therapeutic applications, and only a small number
of the co-cultured hESCs exhibited CD73.27 A large
number of fibroblastic cells with multipotent differentiation
capacity have been derived from differentiating EBs and
pushed toward adipogenesis and osteogenesis, but these
cells showed limited chondrogenic potential.35 In this study,
we demonstrate the derivation methods for mesenchymal-
like cells from differentiating embryoid bodies and their
therapeutic potential for cartilage tissue engineering on an
artificial 3D scaffold system.
Our results indicate that hESC-derived mesenchymal
cells exhibit the mesodermal progenitor cell marker,
PDGFR-a, as well as MSC markers CD29, CD44, and
CD105. hESC-derived mesenchymal cells also exhibited
fibroblastic phenotype that was comparable with that of
human MSCs, but they did not express CD73. Tissue en-
gineering of human cartilage is a complex process, because
the functional development of chondro-progenitors and their
differentiation from chondrocytes require that regulatory
signals be temporally and spatially displayed.36 The 3D
cellular interactions in the form of pellet or micro-mass
HWANG ET AL.
culture have been frequently used for efficient chondrogen-
esis of MSCs or chondro-progenitor cells.37 N-cadherin-
dependent cell–cell interactions leading to mesenchymal
condensation have been found to be distinct markers of
chondrogenesis.38 TGF-b and BMP act distinctly in terms
of their chondrogenic potential during mesenchymal con-
densation and limb cartilage development, TGF-b having an
early positive role in promoting chondrogenesis and BMP
having an early negative and late positive role during
chondrogenesis.7,39 Our results indicate that the hESC-de-
rived cells had the greatest response to TGF-b1. Initial ex-
posure of pellets to BMP for 2 weeks followed by 1 week of
TGF-b1 resulted in a smaller increase in matrix production
than with pellets that were treated for 2 weeks with TGF-b1
followed by 1 week of BMP-2 or pellets exposed to TGF-b1
for all 3 weeks.
A significant number of cells expressed PDGFR-a, a
marker indicating cells that have chondrogenic potential
upon exposure to TGF-b1.7 Even though growth factor–
dependent matrix production was observed, histological
analysis indicated that the chondrogenic capacity of these
cells was limited, perhaps requiring matrix-stimulated
chondrogenic response. Safranin-O staining for sulfated
glycosaminoglycans showed no indication of cartilaginous
matrix deposition. RT-PCR confirmed an absence of chon-
drocyte gene expression (data not shown). Lack of chon-
drogenesis could be related to the short culture time of 3
weeks, which may be insufficient to induce a chondrogenic
response of these cells. Also, the lack of CD73 expression,
which it has been shown is expressed in adult-derived MSCs,
may have contributed to the lack in chondrogenesis in pellet
culture. Alternatively, lack of bioactive signals in the cell-
matrix microenvironment may have resulted in failure to
initiate chondrogenic differentiation.
Various cues from the surrounding microenvironment
generally control differentiation of stem cells.11,40 The me-
chanisms involved in ECM-dependent phenotypic cell dif-
ferentiation have been increasingly studied in recent years.41
Briefly, ECM proteins, through specific peptide motifs, in-
teract with integrins, a family of heterodimeric transmem-
brane protein.42,43 This interaction changes the integrin
conformation, resulting in the activation of intracellular
pathways that are involved in a number of cell responses. To
create a microenvironment for specific matrix–cell interac-
tions in 3D culture, we encapsulated the hESC-derived
mesenchymal cells in hydrogels with different ECM com-
ponents known to induce chondrogenic responses in chondro-
progenitor cells. Microenvironments created by exogenous
type I collagen and HA have been shown to be beneficial for
viability and chondrogenic differentiation of MSCs.44–47
Hydrogels modified with an RGD-containing peptide se-
quence have been shown to promote cell multiplication and
facilitate cell adhesion and spreading.19,20,48 We introduced
exogenous proteins such as type I collagen (0.1% w/v) and
HA (2.5 mg/mL), as well as covalently linking RGD
CHONDROGENIC DIFFERENTIATION OF hES-DERIVED CELLS 2703

FIG. 8. Basophilic extracellular matrix (ECM) deposition characteristic of neocartilage from human embryonic stem cell–derived
mesenchymal cells was promoted using arginine-glycine-aspartate (RGD) and transforming growth factor (TGF)-b1. (A) Hematoxylin
and eosin (H&E) staining and (D) Safranin-O staining of cells encapsulated in poly(ethylene glycol)-diacrylate (PEGDA). No significant
matrix production and significant Safranin-O staining were observed in PEGDA alone. Cells encapsulated in RGD-modified poly
(ethylene glycol) showed TGF-b1 dependent chondrogenic response. Regions of hydrogel near the periphery showed strong matrix
production (B, E), whereas toward the center of the hydrogel, where diffusion of TGF-b1 is limited, less matrix was produced around
the cell (arrow) (C, F). RGD incorporation enhanced the secretion and accumulation of sulfated glycosaminoglycans (GAGs) and
collagen. GAG amount was quantified using dimethylmethylene blue assay and normalized to the total deoxyribonucleic acid (DNA) of
the construct (G). Collagen was quantified by measuring hydroxyproline content and normalized to the total DNA of the construct for
comparison (H). (*p < 0.05, **p < 0.01). Color images available online at www.liebertpub.com/ten.

(2.5 mM) motifs to the hydrogel macromers to create a
specific cell-matrix microenvironment for differentiation.
Immunostaining for specific chondrocyte matrix proteins
and Safranin-O staining indicated the varying degree of
matrix production induced by the microenvironments. Cells
encapsulated with exogenous type I collagen, which has
non-RGD integrin-binding sites, and HA, which interacts
with CD44, resulted in an inhibitory effect on GAG
synthesis and accumulation. The optimal differentiation, as
well as matrix production, was observed in the RGD-
modified hydrogels, resulting in 7% w/v of GAG accu-
mulation in 3 weeks of culture, which is higher than the
3.5% w/v GAG value reported by Williams et al. with
MSCs cultured in similar conditions for 6 weeks.49 Cells
encapsulated in RGD-modified hydrogel were larger than
cells encapsulated in PEGDA hydrogels and formed ex-
tensions to interact with the surrounding environment.
Although RGD-modified PEG hydrogels represent over-
simplified mimics of natural ECM, lacking the essential
natural temporal and spatial complexity, this RGD-mod-
ified synthetic biomaterial was sufficient to promote
chondrocyte-specific differentiation and morphogenesis and
cartilage tissue development. RT-PCR analysis indicated
that RGD–cell interactions induced the cells to express full
chondrocyte markers, including type II collagen and link
protein. Within 3 weeks of culture, basophilic ECM de-
position was observed in RGD-modified PEG hydrogels.
Immunostaining for type I, II, and X collagen and Safranin-
O staining for negatively charged proteoglycans indi-
cated that these ECM proteins are mainly localized around
the cells, having islands of ECM and showing limited
diffusivity within the hydrogel. Controlling ECM deposi-
tion and tissue formation by incorporating biodegradable
components into the hydrogel, as well as having longer
incubation period, would improve the quality of tissue
formation.
2704
FIG. 9. Reverse transcriptase polymerase chain reaction analy-
sis indicated distinct chondrogenic response of human embryonic
stem cell–derived mesenchymal cells in arginine-glycine-aspartate
(RGD)-modified poly(ethylene glycol) (PEG) hydrogel. At day 7,
no chondrocyte specific genes were detected in either culture
system (Columns 1 and 3). After 21 days of culture, cells en-
capsulated in poly(ethylene glycol)-diacrylate (PEGDA) hydrogel
minimally expressed aggrecan and type II collagen, with no de-
tectable level of expression of link protein (Column 3). Cells
encapsulated in RGD-modified PEG hydrogels resulted in signi-
ficant upregulation of aggrecan, type II collagen, and link protein
(Column 4). 1. D7-PEGDA, 2. D21-PEGDA, 3. D7-PEGDA-RGD,
4. D21-PEGDA-RGD.
Recent evidence indicates that RGD interaction with av
and b1 integrin subunits enhanced TGF-b1 secretion, and
RGD-dependent integrin activation has been linked to
modulation of TGF-b1 actions.50 RGD binding and acti-
vation of integrins increase the tyrosine kinase-dependent
phosphorylation of human mesangial cell proteins, as well
as integrin link kinase activity, which in turn converge
with TGF-b1 signaling pathways to regulate multiple
transcription factors.51 Indeed, RGD interaction alone
was not sufficient to induce chondrogenic response of
hESC-derived mesenchymal cells, and we observed limited
matrix production of hESC-derived mesenchymal cells
in the center of the hydrogels due to limited diffusion
TGF-b1.
Our data show that hESCs contain precursors to a MSC
population and that RGD-specific cell–matrix interactions,
which in turn may approximate the cell environment of
condensing mesenchyme in the developing limb in vivo,
can promote the differentiation of hESC-derived cells into
chondrocytes and create homogeneous structures of tissue
morphologically comparable with cartilage. Such micro-
environments for cell differentiation may be useful in tar-
geting stem cells for tissue-specific differentiation and
HWANG ET AL.
may serve to support further efforts toward characterizing
cell–ECM and cell growth factor roles in controlling and
eliciting differentiation.
ACKNOWLEDGMENTS
This study was supported by the Johns Hopkins Uni-
versity ( JHU)-Technion Joint Program and the Whitaker
Foundation. The authors are grateful to Ms. Yoojin An
(University of Pennsylvania) and Ms. Angela Ferran ( JHU)
for their critical review and technical assistance.
REFERENCES
1. Buckwalter, J.A., and Mankin, H.J. Articular cartilage: de-
generation and osteoarthritis, repair, regeneration, and trans-
plantation. Instr Course Lect 47, 487, 1998.
2. Fehrer, C., and Lepperdinger, G. Mesenchymal stem cell
aging. Exp Gerontol 41, 1, 2005.
3. Schnabel, M., Marlovitz, S., Eckhoff, G., Fichtel I., Gotzen,
L., Vecsei, V., and Schlegel, J. Dedifferentiation-associated
changes in morphology and gene expression in primary hu-
man articular chondrocytes in cell culture. Osteoarthr Cartil
10, 62, 2002.
4. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz,
M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. Em-
bryonic stem cell lines derived from human blastocysts.
Science 282, 1145, 1998.
5. Levenberg, S., and Langer, R. Advances in tissue engineering.
Curr Top Dev Biol 61, 113, 2004.
6. Hegert, C., Kramer, J., Hargus, G., Muller, J., Guan, K.,
Wobus, A.M., Miller, P.K., and Rohwedel, J. Differentiation
plasticity of chondrocytes derived from mouse embryonic
stem cells. J Cell Sci 115, 4617, 2002.
7. Nakayama, N., Duryea, D., Manoukian, R., Chow, G., and
Han, C.Y. Macroscopic cartilage formation with embryonic
stem-cell-derived mesodermal progenitor cells. J Cell Sci
116, 2015, 2003.
8. Liu, H., and Roy, K. Biomimetic three-dimensional cultures
significantly increase hematopoietic differentiation efficacy of
embryonic stem cells. Tissue Eng 11, 319, 2005.
9. Levenberg, S., Huang, N.F., Lavik, E., Rogers, A.B., Itskovitz-
Eldor, J., and Langer, R. Differentiation of human embryonic
stem cells on three-dimensional polymer scaffolds. Proc Natl
Acad Sci U S A 100, 12741, 2003.
10. Levenberg, S., Burdick, J.A., Kraehenbuehl, T., and Langer,
R. Neurotrophin-induced differentiation of human embryonic
stem cells on three-dimensional polymeric scaffolds. Tissue
Eng 11, 506, 2005.
11. Streuli, C. Extracellular matrix remodelling and cellular dif-
ferentiation. Curr Opin Cell Biol 11, 635, 1999.
12. Cukierman, E., Pankov, R., Stevens, D.R., and Yamada, K.M.
Taking cell-matrix adhesions to the third dimension. Science
294, 5547, 2001.
13. Battista, S., Guamieri, D., Borselli, C., Zeppetelli, S., Bor-
zacchiello, A., Mayol, L., Gerbasio, D., Keene, D.R., Am-
brosio, L., and Netti, P.A. The effect of matrix composition of
CHONDROGENIC DIFFERENTIATION OF hES-DERIVED CELLS
3D constructs on embryonic stem cell differentiation. Bio-
materials 26, 6194, 2005.
14. Kim, B.S., and Mooney, D.J. Development of biocompatible
synthetic extracellular matrices for tissue engineering. Trends
Biotechnol 16, 224, 1998.
15. Elisseeff, J., McIntosh, W., Anseth, L., Riley, S., Ragan, P.,
and Langer, R. Photoencapsulation of chondrocytes in poly
(ethylene oxide)-based semi-interpenetrating networks. J
Biomed Mater Res 51, 164, 2000.
16. Langer, R. Biomaterials in drug delivery and tissue en-
gineering: one laboratory’s experience. Acc Chem Res 33, 94,
2000.
17. Hubbell, J.A. Biomaterials in tissue engineering. Bio-
technology (NY) 13, 565, 1995.
18. Shin, H., Jo, S., and Mikos, A.G. Biomimetic materials for
tissue engineering. Biomaterials 24, 4353, 2003.
19. Alsberg, E., Anderson, K.W., Albeiruti, A., Rowley, J.A., and
Mooney, D.J. Engineering growing tissues. Proc Natl Acad
Sci U S A 99, 12025, 2002.
20. Yang, F., Williams, C.G., Wang, D.A., Lee, H., Manson,
P.N., and Elisseeff, J. The effect of incorporating RGD ad-
hesive peptide in polyethylene glycol diacrylate hydrogel on
osteogenesis of bone marrow stromal cells. Biomaterials 26,
5991, 2005.
21. Burdick, J.A., and Anseth, K.S. Photoencapsulation of os-
teoblasts in injectable RGD-modified PEG hydrogels for bone
tissue engineering. Biomaterials 23, 4315, 2002.
22. DeLong, S.A., Gobin, A.S., and West, J.L. Covalent im-
mobilization of RGDS on hydrogel surfaces to direct cell
alignment and migration. J Control Release 109, 139, 2005.
23. Hoffman, A.S. Hydrogels for biomedical applications. Adv
Drug Deliv Rev 54, 3, 2002.
24. Bryant, S.J., Nuttelman, C.R., and Anseth, K.S. The effects of
crosslinking density on cartilage formation in photo-
crosslinkable hydrogels. Biomed Sci Instrum 35, 309, 1999.
25. Bielby, R.C., Boccaccini, A.R., Polak, J.M., and Buttery, L.D.
In vitro differentiation and in vivo mineralization of osteo-
genic cells derived from human embryonic stem cells. Tissue
Eng 10, 1518, 2004.
26. Sottile, V., Thomson, A., and McWhir, J. In vitro osteogenic
differentiation of human ES cells. Cloning Stem Cells 5, 149,
2003.
27. Barberi, T., Willis, L.M., Socci, N.D., and Studer, L. Deri-
vation of multipotent mesenchymal precursors from human
embryonic stem cells. PLoS Med 2, 161, 2005.
28. Zeng, X., Mirua, T., Luo, Y., Bhattacharya, B., Condie, B.,
Chen, J., Ginis, I., Lyons, I., Mejido, J., Puri, R.K., Rao, M.S.,
and Freed, W.J. Properties of pluripotent human embryonic
stem cells BG01 and BG02. Stem Cells 22, 292, 2004.
29. Kim, M.S., Hwang, N.S., Lee, J., Kim, T.K., Leong, K.,
Shamblott, M.J., Gearhart, J., and Elisseeff, J. Musculoske-
letal differentiation of cells derived from human embryonic
germ cells. Stem Cells 23, 113, 2005.
30. Kim, Y.J., Sah, R.L., Doong, J.Y., and Grodzinsky, A.J.
Fluorometric assay of DNA in cartilage explants using
Hoechst 33258. Anal Biochem 174, 168, 1988.
31. Farndale, R.W., Buttle, D.J., and Barrett, A.J. Improved
quantitation and discrimination of sulphated glycosaminogly-
cans by use of dimethylmethylene blue. Biochim Biophys Acta
883, 173, 1986.
2705
32. Stegemann, H. and Stalder, K. Determination of hydro-
xyproline. Clin Chim Acta 18, 267, 1967.
33. Lum, L.Y., Cher, N.L., Williams, C.G., and Elisseeff, J. An
extracellular matrix extract for tissue-engineered cartilage.
IEEE Eng Med Biol Mag 22, 71, 2003.
34. Dvash, T., and Benvenisty, N. Human embryonic stem cells
as a model for early human development. Best Pract Res Clin
Obstet Gynaecol 18, 929, 2004.
35. Xu, C., Jiang, J., Sottile, V., McWhir, J., Lebkowski, J., and
Carpenter, M.K. Immortalized fibroblast-like cells derived
from human embryonic stem cells support undifferentiated
cell growth. Stem Cells 22, 972, 2004.
36. DeLise, A.M., Fischer, L., and Tuan, R.S. Cellular interac-
tions and signaling in cartilage development. Osteoarthr Cartil
8, 309, 2000.
37. Mackay, A.M., Beck, S.C., Murphy, J.M., Barry, F.P.,
Chickester, C.O., and Pittenger, M.F. Chondrogenic differ-
entiation of cultured human mesenchymal stem cells from
marrow. Tissue Eng 4, 415, 1998.
38. Tuli, R., Tuli, S., Nadi, S., Huang, X., Manner, P.A., Hozack,
W.J., Danielson, K.G., Hall, D.J., and Tuan, R.S. Trans-
forming growth factor-beta-mediated chondrogenesis of hu-
man mesenchymal progenitor cells involves N-cadherin and
mitogen-activated protein kinase and Wnt signaling cross-
talk. J Biol Chem 278, 41227, 2003.
39. Yoon, B.S. and Lyons, K.M. Multiple functions of BMPs in
chondrogenesis. J Cell Biochem 93, 93, 2004.
40. Spradling, A., Drummond-Barbosa, D., and Kai, T. Stem cells
find their niche. Nature 414, 98, 2001.
41. Grashoff, C., Aszodi, A., Sakai, T., Hunziker, E.B., and
Fassler, R. Integrin-linked kinase regulates chondrocyte shape
and proliferation. EMBO Rep 4, 428, 2003.
42. Martin, K.H., Slack, J.K., Boerner, S.A., Martin, C.C., and
Parsons, J.T. Integrin connections map: to infinity and be-
yond. Science 296, 1652, 2002.
43. Giancotti, F.G., and Ruoslahti, E. Integrin signaling. Science
285, 1028, 1999.
44. Meinel, L., Hofmann, S., Karageorgiou, V., Zichner, L.,
Langer, R., Kaplan, D., and Vunjak-Novakovic, G. En-
gineering cartilage-like tissue using human mesenchymal
stem cells and silk protein scaffolds. Biotechnol Bioeng 88,
379, 2004.
45. Batorsky, A., Liao, J., Lund, A.W., Plopper, G.E., and Ste-
gemann, J.P. Encapsulation of adult human mesenchymal
stem cells within collagen-agarose microenvironments. Bio-
technol Bioeng 92, 492, 2005.
46. Hegewald, A.A., Ringe, J., Bartel, J., Kruger, I., Notter, M.,
Barnewitz, D., Kaps, C., and Sittinger, M. Hyaluronic acid
and autologous synovial fluid induce chondrogenic differ-
entiation of equine mesenchymal stem cells: a preliminary
study. Tissue Cell 36, 431, 2004.
47. Miralles, G., Baudoin, R., Dumas, D., Baptiste, D., Hubert, P.,
Stoltz, J.F., Dellacherie, E., Mainard, D., Netter, P., Netter, P.,
and Payan, E. Sodium alginate sponges with or without so-
dium hyaluronate: in vitro engineering of cartilage. J Biomed
Mater Res 57, 268, 2001.
48. Mann, B.K., Tsai, A.T., Scott-Burden, T., and West,
J.L. Modification of surfaces with cell adhesion peptides
alters extracellular matrix deposition. Biomaterials 20, 2281,
1999.
2706 HWANG ET AL.

49. Williams, C.G., Kim, T.K., Toboas, A., Malik, A., Manson, Address reprint requests to:
P., and Elisseeff, J. In vitro chondrogenesis of bone marrow- Jennifer Elisseeff, Ph.D.
derived mesenchymal stem cells in a photopolymerizing hy- Department of Biomedical Engineering
drogel. Tissue Eng 9, 679, 2003. Johns Hopkins University School of Medicine
50. Ortega-Velazquez, R., Diez-Marques, M.L., Ruiz-Torres, Clark Hall 106
M.P., Gonzalez-Rubio, M., Rodriguez-Puyol, M., and Ro-
3400 North Charles Street
driguez-Puyol, D. Arg-Gly-Asp-Ser (RGDS) peptide stimu-
Baltimore, MD 21218
lates transforming growth factor beta1 transcription and
secretion through integrin activation. Faseb J 17, 1529, 2003.
51. Dedhar, S., Williams, B., and Hannigan, G. Integrin-linked E-mail: jhe@bme.jhu.edu
kinase (ILK): a regulator of integrin and growth-factor sig-
nalling. Trends Cell Biol 9, 319, 1999.