+2 Previous Year Zoology QP 2023 Updated

NAVAS CHEEMADAN SOHSS-AREEKODE
HUMAN REPRODUCTION
AND
REPRODUCTIVE HEALTH
HSE-March 2023
1. Select the odd one. Justify your selection. (1)

(Rete testis, Vasa efferentia, Fallopian tube,
Vas deferens)
2. Placenta also acts as an endocrine tissue and
produces several hormones. (2)
(A) Name any two placental hormones.
(B) Write two functions of Placenta.
(other than endocrine function)
3. The graph given below shows the ovarian events
and ovarian hormone levels during menstrual
cycle. (2)
9. Diagrammatic view of male reproductive system is

given below : (5)
(i) Name hormones A and B.

(ii) Write the ovarian events during luteal phase.
4. What are IUDs ? Name one copper releasing and
one hormone releasing IUDs (2)
5. (A) What are STIs ? (3)
(B) Give two examples.
(C) Write any two preventive measures of STIs
HSE- July 2022 (SAY/IMP.) (a) Identify the parts labelled as (A), (B), (C) and (D)
and name the part which is cut or tied up during male
6. First menstruation in a female begins at puberty sterilisation.
and is called _______. (1) (b) Mention the surgical contraceptive methods in
7. Expand the term IUD. (1) male and female.
8. Identify the figure and label the parts marked as HSE-March- 2022
(A), (B) and (C) (2)
10. Expand the term ZIFT (1)
11. Mitotic division of zygote results in the formation
of blastomeres is called ________ (1)
Previous year Question/+2/2023 navas9895@gmail.com

12. Write the functions of the following structures in b)Among these 3 layers, which layer is glandular
human reproduction : (2) and undergo cyclic changes during menstrual cycle
(a) Leydig cells (b) Corpus luteum ?
13. (a) Name the cap-like structure present in sperm 25. Identify the pars of oviduct (fallopian tue) from
head. below description :
(b) Write its function. (2) a)Finger like projection of oviduct that helps in
14. “Sex of a child is determined by father.” collection of the ovum after ovulation
Substantiate the statement. (3) b)The part of oviduct with narrow lumen that joins
15. ‘Incidents of STDs are very high among the age the uterus
group of 15-24 years.’ c)Funnel shaper part of oviduct that is closer to the
(a) What is STD ? (b) Name any four STDs. (3) ovary (3)
26. Explain different types of Intra uterine devices with
HSE-August 2021 their example (3)
16. Expand the following terms (1) HSE-March 2021

a)MMR b)IMR
17. Identify the odd one (1) 27. Name the oral contraceptive for female developed
(hPL, Androgen, Relaxin, hCG ) by CDRI. (1)
18. Disease or infections which are transmitted 28. During luteal phase of menstrual cycle, Graafian
through sexual intercourse are called sexually follicle transforms into ____ (1)
transmitted disease (STDs) 29. Expand the following terms related with Assisted
a)Give any two examples for STDs Reproductive Technologies : (2)
b)Write any two preventive measures to avoid (a) ICSI (b) GIFT
STDs ? (2) 30. Fill in the blanks to complete the schematic
19. Identify the two types of cells lined on the inside of representation (2)
seminiferous tubule. Distinguish their function (2)
20. Mention two programmes implemented in India to
attain total reproductive health? (2)
21. How many spermatozoa and ova are produced
from 25 primary spermatocyte and 25 primary
oocytes ? (2)
22. Distinguish between spermiogenesis and
spermiation ? (2)
23. Fill in the blanks with suitable terms given in 31. Write any four objectives of Reproductive and
bracket Child Health Care (RCH) programmes (2)
(Progestogen, Multiload-375, Vaults, Periodic 32. Write any four differences between
abstinence, Tubectomy, Saheli) (2) Spermatogenesis and Oogenesis. (2)
33. In women, some hormones are secreted only
Barrier Copper Natural Surgical during pregnancy. Name any such hormones (2)
method releasing method method 34. Match the following (2)
IUDs
Condom (B) Coitus (D)
interrupts
(A) Cu-T (C) Vasectomy
24. The wall of uterus has 3 layers of tissues (2)

a)Name the three layers of uterine wall
35. Match the following (2)

(i) Inability of the male partner to inseminate
the female.
(ii) Female cannot produce ovum but can
provide suitable environment for
fertilisation and further development.
36. ‘LH and FSH play significant role in 42. Observe the diagrams A and B given below related
spermatogenesis.’ (3) to contraceptive methods. (3)
(a) Write the functions of LH and FSH in
spermatogenesis.
(b) Write a single term used to denote LH and FSH
together.
37. Sexually Transmitted Diseases (STDs) are seen to
(a) Identify A and B.
be high among people with age group 15 – 24 yrs.
(b) Explain this surgical method.
(a) Write the names of any 4 STDs.
(c) Why this method is generally advised as a
(b) Mention the measures to be taken to prevent
terminal method of contraception ?
STDs. (3)
HSE –March-2020
HSE –July-2020
43. Name the technique of transferring embryos up to
38. The embryo with 8 to 16 blastomeres is called a
8 blastomeres into the fallopian tube. (1)
________. (1)
a)GIFT b)ZIFT c)ICSI d) IUI
(a) Gastrula (b) Morula
44. “All copulations lead to fertilization and
(c) Blastula (d) Trophoblast
pregnancy”. Do you agree with this statement?
39. Observe the diagrammatic view of male
Justify your answer. (2)
reproductive system given below and name
45. Amniocentesis for sex determination is legally
theparts labeled ‘a’, ‘b’, ‘c’ and ‘d’.
banned now. (2)
(2)
(a) What is amniocentesis ?
(b) Why it is banned ?
46. The graph given below shows the level of the
ovarian hormones in a normally menstruating
woman during the follicular phase. (3)
40. Rearrange the following human reproductive (a) Name ‘A’ and ‘B’.
events in the correct order of theiroccurrence (2) (b) Reconstruct the graph showing the level of
hormones in luteal phase.
(c) Name the hormone secreted by Corpus Luteum
and mention its function.
41. (a) Expand ART. (2)
HSE-June-2019
(b) Suggest the ART which may be successful in the
following condition : 47. Find out the correct sequence : (1)
(a) Fertilisation- zygote - Blastula - Morula - (b) Cite any two examples for STD.
cleavage - Implantation (c) Suggest any two methods for the prevention of
(b) Fertilisation- zygote - cleavage - Morula - STDs. (3)
Implantation - Blastula
(c) Fertilisation- zygote - Morula - cleavage - HSE-June-2018
Implantation - Blastula
55. Number of spermatids produced from 25
(d) Fertilisation- zygote - cleavage - Morula -
primary spermatocytes are ........... (1)
Blastula – Implantation
a) 25 b)50 c)100 d)250
48. 'LH Surge' induces the rupture of Graffian follicle
(a) Which gland produces LH and in which day LH 56. Select the relationship between the first two
Surge happens? words and fill the lank space with a suitable
(b) Write the role of LH in males. (2) word (1)
49. There are several method of in vitro fertilisation to Sterilization in male : Vasectomy
assist couples who lack the ability of fertilisation. Sterilization in female :.............
(a) Give the popular name of the programme 57. The incidence of STDs are reported more
(b) Suggest two techniques of in vitro fertilisation among the age groupbetween 15-24
and their conditions of transfer to assist these years.(2nci)
people (3) (a) What are STDs?
HSE-March-2019 (b) Suggest methods to prevent STDs,
58. Match the column B&C with column A (3)
50. The milk produced during the initial few days of
lactation is called…………………. (1)
51. "The sex of the baby is determined by the father
and not by the mother. Do you agree with this
statement ? Substantiate your answer. (2)
52. Observe the diagram given below showing the
reproductive system of the female and name the
parts labeled 'A', sectional view 'B', C' &'D' (2) HSE-March-2018
59. Name the cells in testis which synthesize and

secrete androgens? (1)
60. Different contraceptive methods are given
below. Pick out the odd one (1)
a)Cu T b)Saheli
c)Multiload 375 d)Lippes loop
61. In a class room discussion, a student said that
sex of the baby is determined by the father.
53. A wide range of contraceptive methods are Analyse the statement and give reason for it ?
presently available. If so, (HSE-March-2019)(2) (2)
(a) Name one contraceptive method having least 62. Different contraceptive methods are used to
side effect.
control population explosion. Summarise the
(b) Which contraceptive method is generally
natural method and barrier method of
advised for females as a termination method to
contraception ? (2)
prevent any more pregnancies?
(c) List out any two possible ill-effects of the usage 63. Sexually transmitted disease (STD) are mainly
of contraceptive methods. transmitted through sexual contact (3)
54. (a) Expand STDs. a)Name any two examples of STD?
b)Explain any two methods adopted to prevent b)Hepatitis B, Gonorrhoea
STD ? c)Symphils, Gonorrhoea
d)Chlamydomonas, Genital Herpes
71. Feeding...................in the first few days is
HSE-March-2018-Model Exam essential for preventing infection in a newly
born baby (1)
64. The middle layer of uterus is called……… (1) 72. LH and FSH are gonadotrophins. Distinguish
65. Vasectomy and tubectomy are said to be their roles in male and female? (2)
effective and irreversible contraceptive 73. What is ART ? Categorize the following ART’s
methods. Differentiate between these two based on their application in male sterility and
methods. (2) female sterility:
66. From an infertility clinic a doctor advised a GIFT, AI
childless coupleto undergo GIFT.
l. Expand GIFT HSE-June-2016
2. Mention the steps involved in this
74. The process of fusion of sperm with ovum is
procedure (2)
called......................... (1)
HSE-JUNE-2017 75. Match the column A and B (2)
67. Human female possess 44+XX chromosome

number. The chromosome number of
secondary oocyte is (1)
a)44+XX b)22+X c)44+XX d)22+XX
68. Observe the diagram and answer the question
(2)
76. Select the odd one and justify your selection?

Malaria, Gonorrhoea ,Amoebiasis, filariasis (1)
77. Diagnostic report of two couples having
infertility problem are given below : (2)
1) The Women cannot produce ovum
2) The man has very low sperm count in
semen.
a) Identify A and B Suggest a suitable assisted reproductive
b) Write the function of B technology (ART) for each problem in
69. Prepare a brief notes to be presented in an expanded form.
awareness programme for adolescent about HSE-March-2016
AIDS, their causes and preventive measures? 78. Breast feeding during initial period of infant growth
(3) is necessary to develop immunity of new born
babies. Why ? (1)
HSE-March-2017 79. Categorise the given birth control methods into
three groups with proper heads.
70. Which of the following pairs of STDs is (Cervical caps, Vasectomy, Cu T, Tubectomy,
completely curable ? (1) Diaphragms, Condoms, LippesLoop ) (3)
a)HIV, Hepatitis B
80. match the columns A and B (2) c) invitro fertilisation followed by embryo
A B transfer is known as .......
Corpus Luteum Embryo 85. 1)In which part of human reproductive
Leydig cells Implantation system the following events occur? (2)
Blastocyst Progesterone
a)Fertilisation b)Implantation
Inner cell mass Androgens
2)Diagram of a Human blastocyst is given
Prolactin
below .Identify A and B
HSE-June-2015
81. Choose the odd one from the following and

write common features of others. (1)
a)Estrogen b)Anrogen c)Relaxin
d)Progesterone
82. Some techniques commonly used for
infertility treatment are given below. Read 86. It is evident that, it is the genetic makeup of
them carefully and answer the question the sperm that determine the sex of the child
ZIFT,GIFT,ICSI,IUI,IVF (3) in human being. Substantiate. (2)
a)which of the above techniques is used 87. Identify the diagram and write how it acts (1)
for the collection of sperm from the
husband or a healthy donor and artificially
introduced into the vagina or uterus of
the female?
b)Distinguish between ZIFT and GIFT
c)Write the common term used to denote
the techniques given below ?
83. Complete the flow chart showing
spermatogenesis by filling A and B and answer
the question (2)
88. Mothers milk is considered essential for new
born infants (1)
a)Name the fluid secreted by mother from
breast during the initial days of lactation
a)what is the chromosome number of b)What type of immunity it provides
primary spermatocyte?
b)what is the significance of reduction 89. Schematic representation of Gametogenesis
division in spermatognenesis? is given below . Identify A. Write one
difference between A and B (1)
HSE-March-2015
84. Foetal sex can e determined by a test based

on chromosomal pattern from the amniotic
fluid (2)
a)What is this test?
b)Revealing of sex determination through this
test is banned. Is this ban is necessary ?
HSE-June-2014 95. One of our neighbour is suffering from
itching, fluid discharge, slight pain and
90. ........... and ..........are two surgical
swelling in the genital region (2)
contraceptive methods in male and female
a)What do you think the disease he is
respectively (1)
suffering from?
91. Diagram of mammalian sperm is given below.
b)What measures are to be taken to prevent
Label the parts marked (1)
such disease
96. Expand the following abbreviations which are
commonly used in reproductive health
a)ART b)ZIFT (1)
HSE-SAY-2013
97. Though one ovum is produced from a primary
oocyte it can result into a male or female
child after fertilisation. But in these case of
spermatocyte though 4 sperms are produced
only two of the can result to a female child
92. Sex of the bay is determined by the father, after fertilisation justify? (1)
not by the mother. Substantiate? (2) 98. Sterilization and IUDs are effective birth
93. Amniocentesis for sex determination is control measures, but lactational
banned in our country? Is this Ban necessary? amenorrhoea may not be so effective
Comment one use of amniocentesis? (2) a)How the sterilization procedure of male
differ from that of female in preventing
HSE-MARCH-2014 pregnancy? (2)
94. Observe the diagram and answer the question b) Which part of the female reproductive
(3) organ is utilized for the IUD procedure? How
a) Identify A and B this procedure prevents pregnancy? (2)
b) What is the function of C c)Why the lactationalamenrrhoea is not so
c) In which of the marked part reduction effective? (1)
division takes place? What is the significance HSE-MARCH-2013
of it? 99. The following statements compare the
process of Oogenesis and spermatogenesis.
Which one is not true
a)Production of ovum ceases at certain age,
but sperm production continues even in old
men
b)Oogenesis begins in the embryonic stages,
but spermatogenesis starts at the oneset of
puberty.
c)Meiotic arrest occurs both in Oogenesis and
spermatogenesis.
d)Polar bodies are formed in Oogenesis (1)
100. Suggest the ART which may be successful
in the following conditions (3)
a)A female cannot produce an ovum, but can
provide suitable environment for fertilization
and further development
b)Male partner is unable to inseminate the
female or has very poor sperm count
c)Fusion of gamete and zygote formation
doesnot occur within the body of female
101. The diagram represents a process of a)Label A and B
gametogenesis. Closely observe it and answer b)On which day of menstrual cycle Graffian
the following (2) follicle rupture?
a)Is it spermatogenesis or Oogenesis? c)Name the process induces the rupture of
b)What does smaller shaded circle represent? graffian follicle
c)Write down two significance of production d)Write the name and function of the
of same? structure forming inside the ovary after
rupture of Graffian follicle?
HSE-March-2012
105. “STDs present a major health concern in
both industrialization and developing
countries”(3)
a) What you meant by STD?
b) Name two STDs?
c) Suggest two preventive measures?
106. Some stages of embryonic development are
given below. Observe these diagram and
answer the question (3)
HSE-SAY-2012
102. Find out the odd one from the following,

write the reason
(1) a)What is A and B?
a)Cu T, b)Cu 7 c)LNG-20 d)Multiload-375 b)Name the two types of cells found in the
103. One couple came to know that they have a Blastocyst?
girl child during fourth month of pregnancy c)Which layer of blastocyst is attached to the
and they decided to do MTP (2) endometrium? And Name the process?
a)What is MTP?
b)At which stage of pregnancy MTP relatively HSE-SAY-2011
safe? 107. Note the relationship between first two
c)How will you respond to the decision of terms and suggest a suitable terms for the
female foeticide by the couple? fourth place (1)
104. Observe the diagram provided (do not copy a)Progesteron : Corpus luteum
the picture) (3) HCG : ........................
b)GIFT : Gamete
ZIFT : ........................ How will you justify the doctor’s opinion in
108. Observe the Graph provided the light of your knowledge of immunity? (2)
HSE-MARCH-2011
112. One among the contraceptive method is
peculiar. Find the odd one and what is the
common among others? (1)
a)Periodic abstinence
a)What do A and B stands for? (1) b)coitusinterruptus
109. Nalini is four month pregnant at the c)Lactational amenorrhea
insistence of her mother in law, she d)IUDs
underwent an illegal diagnostic procedure by
which the sex of the baby was determined to 113. The treatment facility advertised on the
be female .Nalini’s mother in law cursed her brochure of a private clinic is shown below
for conceiving a girl child. a)Can you suggest what type of clinic is?
a)What is the diagnostic procedure used b)Make a brief note on any three of the
here? treatment procedure? (2)
b) “scientifically, Nalini is not responsible for IVF ZIFT GIFT IUI
conceiving a girl child”. How will you
substantiate this statement? (1)
110. Observe the diagram provided and
identify the process: (2)
114.
The above graph shows the level of ovarian
hormones in a normally menstruating women
during follicular phase (3)
a)Name A and B
b)Mention the role of pituitary hormones in
a)Label; A,B,C and D maintaining this condition
b)Why the gametes produced are haploid c)Reconstruct the graph for luteal phase?
even though the gamete mother cells are
diploid? HSE-SAY-2010
111. Raju has lost his mother at birth. He is 115. Select the ART that uses an early embryo
unhealthy and contract diseases easily. In his with upto 8 blastomeres (1)
Doctor’s opinion, Raju’s ill health is due to his a)ZIFT )IUT c)GIFT d)IUI
not drinking mother’s milk. 116. The total population in India is alarmingly
increased to 1 billion according to 2001

censes. The population growth rate was still b) Mention any two IUDs to prevent
around 1.7%, a rate at which our population conception?
could be double in 33 years c)what is surgical method of male sterilization
Cite the probable reasons for such an called?
increase in population growth rate? (2)
117. The graph shown below shows the levels Click here to watch video lesson/Scan the QR
of LH and FSH at various stages of menstrual
cycle. (3)
Human Reproduction
a)Name the source of LH and FSH
b)The level of LH is maximum during the
middle day of cycle. Mention its effect?
c)Note the function of LH in male?
HSE-March-2010
118. Given below is the diagrammatic
representation of Human blastocyst. Observe
the diagram and answer the following
questions. (2)
Reproductive Health
a)Identify A and B
b)Write the function of A and B
119. When the urine sample of a lady is tested,
presence of Human chorionic gonadotropin
(HCG) was detected (2)
a)What does the presence of HCG indicate?
b)Which is the source of HCG?
120. Diagram shown below is a surgical
method used for female sterilization
(2)
a) What is the method shown in the diagram?

Navascheemadan SOHSS-AREEKODE
c)The inborn error metabolism and affected
individual lacks an enzyme that converts Phenyl
PRINCIPLES OF INHERITANCE alanine to Tyrosine.
HSE- March 2022
AND VARIATION
6. (a) Distinguish between Male heterogamety and
Female heterogamety. (2)
HSE-March 2023 (b) Write one example for each.
7. “Sex of a child is determined by father.”
1. Match the following (2) Substantiate the statement (3)
HSE- August 2021
8. Identify the symbol used in pedigree analysis(1)
9. T.H Morgan selected Drosophila melanogaster as

2. Cross between Red flower (RR) and white flower a suitable experimental organism. Mention any
(rr) bearing plants of Snapdragon produced all two reason for selecting Drosophila as
plants with pink flowers in F1 generation. (3) experimental organism (2)
(A) Name the genetic phenomenon of this cross. 10. Consider the two statements regarding the
(B) Illustrate F2 generation of this cross using haemophilia disorder (2)
Punnet square (i) It is an autosome linked dominant disease.
HSE- July 2022 (SAY/IMP.) (ii) The heterozygous female (carrier) for
haemophilia may transmit the disease to son.
3. Various symbols are used in human pedigree Select the wrong statement and correct it.
analysis. Identify the following symbols
(2) HSE-March 2021
11. Name the genetic disorder in which a blood

clotting protein is affected leading to non-stop
bleeding even through a simple wound. (1)
12. Presence of an additional copy of chromosome 21
was observed in a person during diagnosis. (2)
(a) Identify the genetic disorder
(b) Write the characteristic features of this
disorder
4. TH Morgan carried out several dihybrid crosses in 13. If a father is with ‘O’ blood group and mother is
Drosophila. Mention two reasons for selecting with ‘B’ blood group, write the possible blood
Drosophila as an experimental organism? groups of their children. (2)
(2)
14. Micrograph of Red blood cells of two persons
5. Characters of certain genetic disorders are given (A) and (B) are shown below. Person B is affected
below. Identify the given disorders with a specific genetic disorder.
(3) (i) Identify the genetic disorder.
a) Sex linked recessive disorder that affect the (ii) Write reason for this disorder.
clotting of blood
b)The disorder caused by the substitution of
Glutamic acid by Valine at the sixth position of
beta globin chain of Haemoglobin
Previous year Question Paper/+2/2023 navas9895@gmail.com

15. ‘Incomplete Dominance’ is an example for
deviation from Mendelian Inheritance. Illustrate
with example (3)
16. Consider the two statement regarding the
haemophila disorder
a)It is an autosome linked dominant disease
b)The heterozygous female (carrier) for
haemophilia may transmit the disease to son
Select the wrong statement and correct it
17. A monohybrid cross is given below :
(a) Identify the cross

(b) Which are the laws proposed by Mendel based on
Find the F2 phenotype and genotype ratio (2)
this observations ? (2)
24. Correct the following statements, if there is any
18. Distinguish male heterogamety and female
mistake :
heterogametywith example (3)
(a) Haemophilia is a autosome linked recessive
HSE-July-2020 disease.
(b) Turner’s syndrome is due to the presence of an
19. Select a female heterogametic animal from the additional copy of X chromosome
following : (1)
HSE-June-2019
(a) Human beings (b) Drosophila
(c) Birds (d) Grasshopper
25. Identify the following symbols in pedigree Analysis
20. Complete the table using appropriate terms : (2)
(1)
26. Observe the cross of a pure violet and white
flower (2)
21.
In a cross between a true breeding red flowered
and a true breeding white floweredplants, the F1
generation was pink coloured flowers. From this
cross – (2)
(a) Identify the Inheritance.
(b) Give an example for this type of Inheritance.
(c) Write the F2 phenotypic and genotypic ratio.
HSE-March-2020
22. From the following, find out the symbol used in
the human pedigree analysis representing male. a) By using the F, progeny design a test cross.
(1) b) Mention the significance of test cross
27. Each symptom of two chromosomal disorders are
given below : (2)
 Gynaecomastia
 Rudimentary ovary and lack of secondary
23. Observe the figure given below showing Mendel’s sexual characters
experiment using pea plants. (2) (a) Identify the disorders.

(b) Give the reason for these disorders
HSE-March-2019
28. Find the odd one out. Justify your answer.

Down's syndrome, Turner's syndrome,
phenylketonuria, Klinefelter’s syndrome (2)
29. The amino acid composition of the relevant
portion of β chain of two haemoglobin molecule a) Which among the above indicate sickle cell
molecules (A & B) are shown below (3) anemic condition?
b) Justify your answer?
c) Describe what is single base substitution?
32. The blood group of a child is 'O'. His father is with
'A' blood group and mother with‘B' blood group.
Write, down the genotype of the child and
genotypes of parents.(2)
(a)Which one of the polypeptide chain is

abnormal? HSE-March-2018
(b) Name the disorder caused by it.
(c) What is the reason for this abnormality? 33. ln a classroom discussion, a student said that the
(d) What is the effect of this abnormality in such sex of the baby is determined by father. Analyze
individuals? the statement and give reason for it ? (2)
34.
HSE-June-2018
30. Observe the following cross between

heterozygous dominant progeny and homozygous
recessive parent. Answer the following questions
(2)
a) Identify the cross?

b) Mention the significance of this cross?
31. The following diagram shows amino acid
sequences of a part of β chain of haemoglobin of
2 individuals. Observe the amino acid sequence
and answer the following questions : (2)
a) Observe the above cross and name this

phenomenon?
b)Write down the theoretically given
explanation of the phenomenon (2)

35. Haemophilia, Sickle cell anaemia and Phenyl
Ketonurea are Mendelian disorders
(a)What do you mean by mendelian disorder a) Describe the type of inheritance shown in the
(b) which one of the above is an example of in diagram
born error of metabolism? Mention the cause b)Distinguish between Mendelian disorder and
of disorder? (2) chromosomal disorder with example?
HSE-Model Exam -2018 40. Observe the following diagram and answer the
36. Construct a monohybrid cross between question
homozygous violet and white coloured flowers of (Hint: step in making a cross in pea plant ) (2)
a pea plant How can one determine whether the
F1 Progenies are homozygous or heterozygous?
(2)
37. From a clinical laboratory, Ramu's blood group
was identified as 'AB' goup. But his father has 'A'
blood group and mother has is 'B’ blood group.
a) Is Ramu's blood group identification correct?
b) Substantiate your answer using co dominance
principle. (2)
38. Identify the syndromes ’A' and 'B' (2)
a) Name the process marked as A and writes its

significance?
b) Diagrammatically represent a monohybrid
cross between Tall and dwarf pea plant
HSE-MARCH-2017
41. The following table shows the F2 generation
of a Dihybrid cross. Identify the phenotype
with homozygous recessive genotype. Find
out A:B:C:D (2)
HSE-JUNE-2017
39. Observe the diagrammatic representation of 42. Which of the following do not have similar sex
following pedigree analysis and answer the chromosome? (homogametic ) (1)
question. (3)
(1) Human female
(2) Drosophila female
(3) Bird female
(4) Bird male
43. Examine the following fragment of beta globin

chain in human haemoglobin and identify the
hereditary disease with reason(2)
HSE-June-2016
44. Observe the figure below and answer the

question following : (2)
a)Write the genotypes of Father, Mother and

Son.
b)The type of dominance of human blood
group inheritance is………………… (2)
48. Observe the figure and answer the question

(2)
a)Identify the figure?
b)what show the shaded symbols used?
45. a)Complete the flow chart of chromosomal

disorder by filling the blank boxes (A and B)
(3)
a) Identify the syndromes A and B.?

b)What is the chromosome numbers in A and
B?
HSE-SAY-2015
49. Diagrammatic representation of the pedigree
analysis of the inheritance of sickle cell
anaemia is shown below. (3)
b)What is aneuploidy ?
HSE-March-2016
46. Which of the following is not a

Mendeliandisorder
(1) a)Name the type of inheritance shown in the
Colourblindness, Down's syndrome,
figure ?
Haemophilia, Thalassemia b) Write the genotype of A and B?
47. Study the following cross and answer the (Hint : Disease is controlled by a pair of allele
questions. HbAand Hbs)
[Hint: ABO blood group in man is controlled c)Represent pedigree analysis of an X linked
by three alleles IA, IB and i.] Recessive Inheritance diagrammatically
50. Observe the inheritance shown in A and B 54. Correct the amino acid sequence of sickle cell
hamemoglobin (1)
55. Identify they syndrome from the genotype given

below: (1)
a)44 Autosome + XXY
b) 44 Autosome +XO
a)Name the type of inheritance shown in A 56. Sex of the Baby is determined by the father, not
and B? by the mother. Substantiate (2)
b)What is the difference between the two 57. a)Define mutation (1)
types of inheritance? (2) b)What are the different types of mutation? (1)
58. The family of Queen Victoria shows a number of
Haemophilic descendants as she was the carrier of
the disease. Name the pattern of inheritance of
this Royal disease. (1)
HSE-March-2015 59. a)Paternity or maternity can be determined by
certain scientific methods. What is it? Define
51. b)Briefly write the methodology involved in the
technique ?
c)comment on its other application (3)
HSE-March-2014
60. Explain the phenomenon shown in the following

figure and the reason for difference in the
production of recombinant in Cross A and cross B
as explained by Morgan. (3)
a)Identify the syndrome from the diagram, and

write the genotype?
b)It occurs in both sexes (Male and female)? Write
the reason (2)
52. Fill in the blanks: (1)
a)...............is a metabolic disorder that occurs due
to the lack of an enzyme that converts phenyl
alanine to tyrosine.
b)...............is a disease caused by the substitution
of glutamic acid by valine at the 6th position
53. It is evident that, it is the genetic make of a sperm

that determine the sex of the child in human
beings. Substantiate (2)
HSE-SAY-2014 61. Difference in chromosome number of some
human being A,B,C, and D is given below:
A)22 pairs of Autosome

B)22 pairs of Autosome +XO
C)22 pairs of Autosome+ 1 autosome
D)22 pairs of Autosome+ XXY
a) Identify the person with who suffers from Y- Yellow
Klinfelter’s syndrome. Write its symptoms
W- White
b)Differentiate between aneuploidy and
polyploidy ? (3) M- Miniature
62. Gopalan argues that if the father is of ‘A’ blood a)Which genes are more linked?
group, Mother is of ‘B’ blood group. Their children b)Who mapped chromosome firstly?
can be only be ‘A’ group, ‘B’ group or ‘AB’ group. c)Tightly linked genes show low
a) Do you agree with Gopalan’sarguement? recombination. Why?
b) Give reason for your argument? (2)
67. Work of a student is given below: (3)
HSE-SAY-2013
63. In the given pedigree the shaded figure denotes

individuals expressing a specific trait (2)
a) From the above give an example for genotype

and phenotype?
b) Complete the work using the punnet square
Which of the following is the most probable mode and find out the phenotypic ratio in the F2
of inheritance of this trait generation?
A-Simple mendalian recessive inheritance
B-Co dominant Relationship of a single pair of HSE-March-2012
allele
C-X linked recessive transmission 68. Complete the tale using suitable term (2)
D-X linked dominant transmission
E-Polygenic inheritance Turner’s syndrome ..........a........
Sterile female
---------b-------- 44A+XXY ..........c.........
HSE-March-2013 --------d--------- Trisomy-21 Mental
retardation
64. Identify the trait from pedigree chart. Give one 69. In Pea plant the gene for yellow seed colour is
example each. (2) dominant over green and round seed shape is
dominant over wrinkled. Write the four types of
gametes formed in heterozygous pea plant with
Yellow and round seeds (YyRr) (1)
70. The first child of a couple is affected with
Phenyketonuria. During the second pregnancy
they visited a genetic counsellor and Prepared a
65. A poultry farm manager was cursing his hens for pedigree chart of their family. (2)
producing lion share of cocks in its progeny. a)What is pedigree analysis?
Hearing this, Kumar-farm manager starts to lame b)Draw the symbols for
his wife for delivering consecutive girl children. i) Affected female
Analyse the situation scientifically and state ii) Sex unspecified
whether you agree with kumar? (3) iii)Consanguineous mating
HSE-SAY-2012
66. Diagrammatic representation of chromosome

map of Drosophila is given below (2)
HSE-say-2011 75. After analyzing the karyotype of a short statured
Round headed person with mental retardation, a
71. Symbols used in human pedigree analysis and general physician noticed an addition of
their meanings are provided in the table. Fill in the autosomal chromosome .
blanks with suitable meaning or symbols (1) Answer the following question (2)
a)Addition or deletion of chromosome generally
result in.............
b)What may be the possible syndrome or disorder
of the above person should suspected to be?
c)Suggest two or more morphological peculiarity
to confirm the chromosome disorder in that
person?
76. A couple has 2 daughters. The blood group of
husband and wife is O (2)
a)What is possible blood groups of the children
should have?
72. Certain facts related to human disorder are given: b)Whether any change in blood group will occur if
1)It is inborn error in metabolism they have two sons instead of daughters?
2)It is inherited as an autosomal recessive trait
3)The affected person is mentally retarded HSE-SAY-2010
a)name the disorder
b)What are the physiological processes behind 77. Some genetic abnormalities, their genotype and
this mental retardation (2) features are distributed in Column A,B and C
73. A genetic cross is represented below (2) respectively . Match them correctly (1.5 mark)
Column A Column B Column B
Down’s 44A+XO Rudimentary
syndrome ovary and
sterility
Turner’s 44A+XXY Furrowed
syndrome tongue and
partially opened
mouth
Klinfelter’s 45A+XX/XY Gynaecomastia
syndrome and sterility
a) Identify the given cross?
b) Elaborate upon the significance of such cross? 78. The flow chart A and B given below represents the
inheritance of normal haemoglobin and sickle cell
HSE-March-2011 haemoglobin (3.5)
74. The frequency of occurring Royal disease or

Haemophilia is high in the pedigree of Royal
families of Queen Victoria. Which of the following
cannot be generally inferred from this? (1)
a)Queen Victoria was not homozygous for the
disease
b)Many heterozygous families were there in the
Royal family
c)Non-Royal families were not affected with
haemophilia a) Observe the Flow chart A and complete the
d)There is less possibility to become a female flow chart B
diseased b) Note down the genotype of a sickle cell
e)Generally a diseased female cannot survive anaemia patient and mention the symptom of
after the first menstruation the disease
f)Pedigree analysis is the study of inheritance c) Mention the peculiarity of HbAHBs phenotype
patterns of traits in human female.
HSE-March-2010
79. To findout the unknown genotype of a violet

flowered pea plant a researcher done the
flowering cross. Observe the diagram and answer
the following question:
(Hint :Violet flower colour in pea plant is
dominant over white )
a)What would be the above cross called?

b)can you determine the unknown genotype of
violet flowered parent by drawing Punnet square?
80. Polypeptide chains of two haemoglobin molecules
are shown below. One of the chains shows an
abnormality. Observe the diagram and answer the
following questions
a) Which of the polypeptide chain in the

haemoglobin is abnormal leading to a disease?
b)What is the reason for this abnormality ?
c)What will be the effect of this change in
polypeptide chain ?
Click here/Scan QR to watch video lesson

MOLECULAR BASIS OF INHERITANCE 8. ‘Codon AUG is known as initiator codon. (a) Name
the amino acid coded by AUG. (b) Write any two
HSE-March 2023 stop codons (2)
9. (a) Expand the term DNA. Who proposed double
1. Write the Central dogma in Molecular biology. (1) helical model of DNA ? (b) List out the nitrogen
2. Schematic representation of a transcription unit is bases in DNA.
given : (2) (3)
10. Schematic diagram of a transcription unit is given
below : (5)
(i) Fill up the missing parts A and B.

(ii) Write the role of template strand in (a) Identify the parts A and B.
transcription. (b) What is transcription ?
3. Explain the transformation experiments (c) Write the complementary DNA strand by observing
performed by Frederick Griffith with bacteria the strand given below : 5'-ATGCATGCAT-3'
Streptococcus Pneumoniae. (3)
HSE-August 2021
11. Fill in the Blanks (1)
HSE- July 2022 (SAY/IMP.) YAC: Yeast artificial chromosome
BAC :…………………………………….
4. Mention the triplet codon acts as initiator codon 12. Observe the diagram of lac operon (2)
during translation. (1)
5. Describe the different stages or steps in the
process of transcription. (3)
6. Flow chart showing the various steps of DNA
finger-printing is provided :
a)Complete the flow chart (5)
a)Write the name of enzymes labeled as A,B and C

b)Which act as the inducer in Lac operon
13. Observe the diagram below
(b) Write any two applications of DNA finger-printing.
HSE-March 2022
7. Name the enzyme that joins the DNA fragments in a) Identify the type of RNA Molecule
dis-continuous strand during replication. (1) b) Write the base sequence complementary to
the anticodon loop ? (2)
NAVAS CHEEMADAN navas9895@gmail.com

HSE-March 2021
14. Under microscope, chromatin is seen as ‘beads-

on-string’ like structure. Here, ‘beads’ represent
the structures called _____. (1)
15. ‘In a cell, euchromatin and Heterochromatin can
be observed under microscope.’ Distinguish
between euchromatin and Heterochromatin. (2)
16. In eukaryotes, gene expression can be regulated
at several levels. Write different levels at which
gene expression can be regulated. (2)
17. Figure of ‘lac operon’ in the absence of lactose (b) Who developed the DNA finger-printing
(inducer) is given below. Draw the diagram of ‘lac technique ?
operon’ in the presence of lactose and label it. (3) (c) Write the full form of VNTR.
20. Schematic structure of a transcription unit is given
below : (2)
18. The diagram represent DNA Replication process

(a) Identify a, b and c.
(b) The coding sequences/expressed sequences in
eukaryotes are known as ________.
21. Lactose catabolism in the absence of inducer in E.
Coli is given below (3)
a)Re draw the diagram, rectifying if any mistakes

b)Name the two enzymes involved in DNA
(a) Identify ‘P’.
Replication process (3)
(b) Draw the diagram in the presence of inducer.
(c) Write the enzymes produced by the structural
HSE-July-2020
genes ‘z’, ‘y’ and ‘a’.
19. (a) Complete the flow chart given below showing
DNA finger-printing technique. (2) HSE-March-2020
22. One of the salient features of genetic code is

“Universal”. (2)
(a) Write any other two salient features of Genetic
code
b) Which is the initiator codon ? And name the
amino acid it codes.
23. Observe the figure given below : (3)
27. The following diagram shows a process
in the Ribosome : (2)
(a) Identify the process in the picture.

(b) Name any two enzymes needed for this Identify the Process and explain
process.
(c) Write the peculiarities of the newly 28. Transcription of eukaryotes is more
synthesized daughter strands
complicated than that of prokaryotes.
24. A DNA sequence is provided below. 5' –
ATGCATGCATGCATGCATGCATGCAT – 3' (3)
Explain any two additional
(a) Write down the sequence of its complexitiesfound in the transcription
complementary strand. of eukaryotes.
(b) Name the enzyme involved in transcription of
(3)
DNA.
(c) What would happen if both the strands of the HSE March 2019
DNA act as templates for transcription? 29. Diagrammatic representation of the
central dogma given below is not
correct. make necessary corrections
HSE-June-2019 and redraw it (1)
25. In a double stranded DNA, the ratios

between Adenine and Thymine,
Guanine and Cytosine are constant and
equal one. Who observed this fact ? (1) 30. Observe the figure given below :
26. Observe the diagram of a double
stranded DNA strand : (2)
a) Identify the figure.

b)How many histone molecules are
Identify the bonds A, B, C & D. present in the Histone core ?

c)Distinguish betweenEuchromatin and 33. “Human genome project is a mega
Heterochromatin.(2) project” give two reason to explain
31. The diagrammatic representation of this? (2)
the DNA fingerprint from a crime scene 34. Observe the diagram and answer the
and that of a suspected persons are following (2)
give below (3)
a)What is your conclusion about the

a)Identify the diagram ?
suspects based on DNA Fingerprint
b)Name the enzymes A,B, and C
given ?
35. “Genetic code is universal in nature”
(b) What is VNTR ?
a)Substantiate this statement ?
(c) Who developed this technique first?
b)mention any two other salient
32. The diagrammatic representation of a
features of genetic code (2)
process in bacteria is given below (3)
36. Expand the following (3)
a)SNP b)BAC c)YAC
HSE MARCH 2018
37. Expresses sequence in the gene is

called (1)
a)Introns b)Muton
c)Exons d)Cistron
38. DNA is tightly packed structure and is
found as units called nucleosomes
(a) Explain the concept of nucleosomes
a) Identify the process. (b)Differentiate between euchromatin
b) Name the enzyme involved in this and hetero chromatin (2)
process. 39. Identify the disadvantages of RNA over
c) Explain the three major steps in this DNA as a genetic material and explain
process. it ? (2)
HSE JUNE 2018

40. a) In Lac-operon lactose act as inducer
molecule. Evaluate the statement and
explain it (3)
b) Observe the diagram of Lac –Operon
and Identify Labelled part A,B,C and
HSE-Model-2018
41. Complete the flow chart of Southern

a)Identify the above process.
blot hybridization (2)
b) Name the enzyme required to
polymerise the DNAstrand.
c) Name the enzyme required to join the
discontinuous strands
d) In eukaryotes replication of DNA occurs
at ……………phase ofcell cycle.
44.
a) Name 'A' and ‘B' from the above

c)Mention two uses of DNA fingerprinting. diagram.
b. Describe the following terms
42. Read the following statements and
i) Capping ii)Tailing
answer the following questions
1-A genetic material should be able to
HSE-JUNE-2017
generate its replica
45. Find the odd one and write the
2-A genetic material should not provide
common feature of the other(1)
scope for mutation
Cytidine,adenine,Thymine,guanine
3- A genetic material should be able to
46. Observe the diagram(2)
express itself in the form of mendelian
characters.
a. Choose the correct statements from
the above. b. Rewrite the wrong
statement to correct one (2)
43. Observe the given diagram and answer
the following questions. (2)

49. Examine the diagram of Mrna given
below . Mark the 5’ end 3’ end of Mrna
by giving reason(2)
50. A small fragment of a skin of different

person was extracted from nails of a
murdered person. This fragment of skin
led the crime investigators to the
murder. Ased on this incident answer
a)Redraw the diagram correctly if any
the following questions (3)
mistake is there ?
(1) What technique was used by the
b)what does the diagram indicate?
investigators
b)What is the function of DNAL ligase in
(2) What is the procedure involved
this process ?
in this technique
47. Read the codon sequence in the mRNA
Or
unit which is undergone translation
51. In an E.coli cultre lactose is used as
(3)
food instead of glucose. If So, answer
the following questions(3)
(1) How do the bacteria respond to
a)What will happend if the nitrogen
the above situation at genetic
base ‘U’ in the 6th position is replaced
level?
by ‘A’ by point mutation
(2) If lactose is removed from the
b)Name and define this type of
medium what will happen?
mutation
HSE-June 2016
c)draw the base sequence in the coding
52. Observe the figure of mRNA and
DNA strand from which the above
answer the following question (3)
mRNA is transcribed ?
HSE-March 2017
48. Which of the following combinations
do not apply to DNA ?(1)
a)Find the start codon and stop
codon?
b)How many amino acids will be
present in the protein translated
from this Mrna ?

c)The additional sequences that are b)which property of DNA is proved
not translated in the mRNA is by experiment ?
called......
53. a) The hints of lac Operon is given
below (HSE-June-2016) (3)
a)which substance is acting as

inducer in this operon ?
b)explain the working of operon in 56. Read carefully the sequence of codon
the presence of inducer ? in the mRNA unit and answer the

OR question (2)
54. b)With the help of the figure given,
explain the processing of hnRNAmRNA
in eukaryotes(3)
a)what changes is needed in the
first codon to start the translation
process ?
b)if translation starts by that
change, till which codon it can be
continues ?
57. Schematic representation of DNA
finger prints as shown below
HSE-March 2016
55. Results of a famous experiment is given a)which one of the suspected
in the figure .Answer all (2) individual may involve in the crime ?
a)Identify the experiment ? b)write any other use of DNA figure
print ? (2)

HSE-June -2015 b)Mention the application of DNA
58. Observe the following diagram and finger printing (3)
answer the question?(3)
62. The flow of genetic information is

shown below. Name the process of A
and B (1)
a) Diagrammatically represent changes
takes place when lactose is added to
medium?
b) What is the role of z,y, and a gene in
HSE-June-2014
this metabolic pathway ?
59. Observe the diagram and answer the 63. Diagrams of components of DNA are
question? (3) given below: (1)
Identify and differentiate the two
diagrams I and II
64. a)Identify the diagram and explain
a)what is the difference in the

replication process ins strand A and
b)In some cases DNA is produced from
strand B ?
RNA. Name this process and give
b)what is the role of DNA ligase in
example ? (2)
the replication process in B strand ?
65. a)Paternity and maternity can be
c)what is meant by replication fork ?
determined by certain scientific
HSE-March-2015
methods. What is it? Define?
60. Explain Transcription. A transcription
b)Briefly write the methodology
unit in a DNA is defined by 3
involved in the technique ?
regions.Write the name of any 2
c)Comment on its other application?
regions? (2)
(3)
61. a) The steps in DNA Finger printing are
66. a)Define mutation ?
given below. Complete the flow chart
(A and B)
b)What are the different types of 70. Presence of lactose enhances the
mutation ? (2) production of beta galactosidase and
HSE-March-2014 other enzymes in bacteria . How will
67. “Prediction of the sequence of you explain this phenomenon ?(1)
aminoacids from the nucleotide 71. A DNA sequence for coding a peptide is
sequence in mRNA is very easy, but the given below
exact prediction of nucleotide
sequence in mRNA from the sequence
of amino acids coded by mRNA is
difficult”
a)Which property of genetic code is the
reason for the above condition ?
Explain
b)Which are the stop codons in DNA
transcription ? (3)
68. Diagrammatic representation of
‘Central Dogma’ is given below : a)Write the complementary mRNA coding
Observe the diagram carefully and sequence for it ?
redraw it making appropriate
b)Find out the amino acids sequence of
corrections (1)
peptide chain using the codon given in the
hints
69. Observe the diagram and answer the c)if a mutation causes a change in the
question (2) sixth codon CTC to CAC. It leads to a
a)Identify the process shown in the mendelian disorder. Identify the disease
figure and define it ? and write the specific characteristic of the
b)Identify the structure ‘B’, write any disease ?(4)
one function of it in the process shown
72. Draw the flow chart showing the steps
in the diagram ?
of southern blot hybridisation using
radiolabelled VNTR ?(3)
HSE-March 2013
73. The flow of genetic information is

shown below (2)
HSE-Sept-2013

77. DNA is the better genetic material than
RNA, Do you agree with this
statement? Substantiate (1.5)
78. Given below is the diagrammatic
representation of first stage of a
a)Name the process a,b,c and d
process in a bacteria
74. Given below is the figure showing the
functioning of lac operon in presence
of lactose. Redraw the figure and label
the parts numbered 1 to 6 (3)
a)Identify the process

b)Name the enzyme catalyses this process
c)What are the additional complexities in
eukaryotes in this process ? (3)
75. RNA is not an ideal molecule as genetic

material because (1) HSE-March-2012
79. A transcription unit is given below.
Observe it and answer the question (3)
HSE-June-2012
76. Following are the first two steps in

Griffiths transformation experiment a)How can you identify the coding strand ?
b)Write the sequence of RNA formed from
this unit ?
c)what would happened if both strand of
a)If there is any mistake correct it
DNA act as template for transcription ?
b)write the remaining steps ? (1.5)
80. In E.coli Lactose catabolism is
controlled by Lac Operon. Lac operon

in the absence of inducer (Lactose) is
given below. (3)
a)What is ‘P’?
b)Name the enzyme produced by the
structural gene ‘Z’,’Y’, and ‘A’ ?
c)Re draw the diagram in the presence of
an Inducer
Click here/Scan to watch video lesson

(b) Mention any four factors those
EVOLUTION affect this principle
7. Choose the correct terms from the
1. (A) Define Analogous organs.
bracket to fill in the blanks and
(B) Identify analogous organs from the
complete the table :
given examples : (HSE-March 2023)(2)
(HSE March 2022)(2)
(i) Eyes of octopus and mammals
(Bigbang theory, Miller’s experiment,
(ii) Vertebrate hearts
Lamarkism, Darwinism)
(iii) Wings of butterfly and bird
(iv) Forelimbs of Cheetah and Human
Using the given terms in brackets,
complete the following evolutionary
stages of man : (HSE-March 2023)(2)
(Homo sapiens, Homo habilis, Homo 8. Identify the relationship and fill the
erectus, Australopithecines) blank (HSE August 2021)(1)
Dryopithecus  Ramapithecus ……A…-
a)Homologus organs : Divergent
……….B…….. ………..C…--> Neanderthal man
…….D…….. evolution
2. Allele frequencies in a population ................................: Convergent
represented as p2 + 2pq + q2 = 1. Name evolution
the evolutionary principle. 9. The original seed eating finches in
(HSE- July 2022) (1) (SAY/IMP.) Galapagos island evolved into many
3. Who proposed the ‘rivet popper other forms with altered beaks.
hypothesis’ ? Identify the evolutionary phenomenon
(HSE- July 2022) (1) (SAY/IMP.) and define it (HSE August 2021)(2)
Mention any two theories that explain 10. a) Define Hardy-Weinberg principle
origin of life. b)Mention any four factors that affect
(HSE- July 2022) (2) (SAY/IMP.) Hardy-Weinberg equilibrium
4. Write any three factors that affect (HSE August 2021)(3)
Hardy-Weinberg equilibrium. 11. Select an example for homologous
(HSE- July 2022) (2) (SAY/IMP.) organs. (HSE March 2021)(1)
5. Homologous organ : Divergent (a) Eyes of octopus and mammals
evolution :: Analogous organ : (b) Forelimbs of Whales and Bats
________ (HSE March 2022)(1) (c) Flippers of Penguins and Dolphins
6. “Allele frequencies in a population are (d) Wings of Birds and Butterflies
stable and is constant from generation 12. Evolution of Darwin finches is an
to generation.” (HSE March 2022)(3) example for ‘Adaptive radiation’.
(a) Name the principle. (a) What is meant by ‘Adaptive
radiation’ ?
Previous Year Question/+2/2023 navas9895@gmail.com
(b) Give two other example for (ii) What is the evolutionary significance of ‘b’
organisms those exhibit Adaptive ?
radiation. (HSE March 2021)(2) 17. Which of the following human ancestor
13. (a) Identify the equation related with is more ‘ape’ like? (HSE March 2020)(1)
genetic equilibrium given below : (a) Homo habilis
p2 + 2pq + q2 = 1 (b) Dryopithecus
(a) Write the factors affecting genetic (c) Australopithecines
equilibrium resulting in evolution. (d) Homo erectus
(HSE March 2021)(3) 18. Fill the blanks in Column A and B using
14. Which among the following is an appropriate terms. (HSE March 2020)(2)
example for homology ?(HSE JULY 2020)(1)
(a) The eye of the Octopus and of
Mammals
(b) Sweet potato and potato
(c) Thorns and tendrils of Bougainvillea
and Cucurbita
(d) Wings of butterfly and of birds
15. Define Hardy – Weinberg principle.
(b) List out any two factors affecting
Hardy – Weinberg Equilibrium. 19. p2 + 2pq + q2 = 1 denotes an
(HSE JULY 2020)(2)
evolutionary principle.
16. Diagrammatic representation of the (HSE March 2020)(2)
operation of natural selection on (a) Name the principle.
different traits isshown below :(HSE JULY (b) Mention any three factors affecting
2020)(2)
this.
20. Based on evolution in the geological
period arrange the plants and animals
in the correct order in various million
years ago. Choose the appropriate
organisms from the bracket.
[Reptiles, Plants, Sea-weeds, Jawless
fish, Fish with stout fin]
(i) Identify ‘a’, ‘b’ and ‘c’.

(HSE-June-2019)(2)
21. Make a flow chart using the following
terms : (HSE-June-2019)(2)
(Natural selection, Struggle for
existence, Variation, Origin of species,
'Over production, Survival of the
fittest]
22. Prepare a flow chart showing the
evolution of modern man in the
hierarchical order of their evolution
using the details given below :
Homo erectus, Homo habilis, Dryopithecus, 25. p2+2pq+q2=1 is the gene frequency of
Australopithecines, Homo sapiens, Rama pithecus,
the population showing an
Neanderthalnman(HSE-March-2019)(2)
evolutionary principle
23. Some examples of evolutionary
a)Name the principle
structures are given below. Classify
b)enlist any three factors affecting this
them under suitable headings:
principle (HSE-June 2018)(2)
(a) Forelimb of Man, Cheetah, Whale,
26. Prepare a flow chart of evolution of
Bat.
man in descending order by choosing
(b) Wings of Butterfly, Bird.
the names given below
(c) Thorns and tendrils of Bougainvillea
(HSE-June 2018) (3)
and cucurbita.
(d) Vertebrate hearts or brains.
(e) Eye of the Octopus and Mammals.
(f)Flippers of penguins and Dolphins.
(HSE-March-2019)(2)
24. Above homologous organs provide 27. Complete the boxes with the suitable
evidence of a particular type of words given below, :
evolution.(HSE-June 2018) (2) [Analogus, Homologus. Convergent
(a) identify the type of evolution. evolution. Divergent evolution]
(b) What do you (HSE-March 2018)(2)
meanbyHomologousorgans ?
28. Explain the factors affecting hardy-

Weinberg equilibrium
(HSE-March 2018)(2)

DiagrammaticrepresentationofMiller 32. Diagrammatic representation of the
experiment is given below. Answer the operation of Natural selection on
following questions(HSE-Model 2018)(2) different trait is given. Observe it and
answer the questions :
(HSE-JUNE-2017)(3)
1. Name A and B
2.From those given below chose the
new molecules obtained by the other
scientists from similar experiment.
(Amino acid, sugar, fat, Alkaloid,
pigment , flavanoid ) a) What do B and C represent
29. A collection of moths made in England b) Explain the process shown in B and C
during 1850, supported evolution by 33. Z value of a frugivorousspecies are
natural selection' given below . which value is not
Write anote onthe process ofnatural applicable to continents
selectionon moths influenced by (HSE-March-2017)(1)
industrialisation .(HSE-Model 2018)(2) (1) 0.6 (2) 0.65 (3) 0.20 (4)0.68
30. Arrangethe following names in 34. A population of 208 people of MN
ascending orderofevolution. blood group was sampled and it was
Homo sapiens, Ramapitrecus, found that 119 were MM group, 76MN
Australopithecines,Homohabilis, blood group, 13NN group. Answer the
Neanderthal, Homo erectus following questions
(HSE-Model 2018)(3) (HSE-March-2017)(3)
31. Rearrange the following in the order of a) Determine the gene frequencies of
their evolution period M and N alleles in the population
(HSE-JUNE-2017)(1) b) How does the above frequency
-Australopithecines affect evolution?
-Neanderthal man Or
-Homo sapiens Examine the pictures of Darwin’s
-Homo erectus finches given below and answer the
-Dryopithecus following questions

a)What phenomenon in evolution is 39. ‘Natural selction can lead to
represented in the picture ? stabilisation ,directional change and
b)explain the phenomenon with the disruptive change’
help of an additional example ? Explain the term stabilization,
directional and disruptive change
mentioned above ?
(HSE-March 2016)(3)
40. Read the principle and answer the
question:(HSE-March 2016)(3)
35. Which of the following sets of gases
“Allele frequency in a population are
were used in Miller’s experiment? stable and constant from generation
(HSE-March-2017)(1) to generation called genetic
equilibrium”
a)Name the principle mentioned here?
b)mention any two factors affecting
equilibrium ?
36. Observe the diagram and answer the
c)what is the significance of
questions given below
disturbance occur in genetic
(HSE-June-2016) (1)
equilibrium ?
41. Observe the diagrammatic
representation and answer the
question (HSE-June 2015)(4)
a)Identify the type of evolution in the

concept diagram A and B ?
b)write example pair each for
homologous and analogous organs ?
37. Statement below show features of
some human fossils. Read carefully and
identify the fossil (HSE-June 2016)(2)
a)Human like being with brain capacity
650-800cc a)Explain the phenomenon shown in
b)Lived in east and central asia with the figure ?
brain capacity 1400 cc b)How can it consider as an evidence of
38. Which theory talks about huge evolution?
explosion that lead to origin of c)Write any other example for this
universe ?(HSE-March 2016)(1) phenomenon. Explain
42. Four groups of organs are given below: in Australian marsupials. Identify the
Read them carefully and answer the evolutionary phenomenon and
questions(HSE-June 2015)(4) comment on
b)Give another example for such type
of evolutionary process and explain
?(HSE-June 2014)(3)
a)Categorize the four groups of organs
as homologous and analogous organs ?
b)Based on each group of organs
differentiate convergent evolution and
divergent evolution ?
c)illustrate homologous and analogous
organ as evidences of evolution ?
43. Match the following
(HSE-March-2015)(2) 47. Given below is the diagrammatic
representation of operation of natural
selectionon different traits
a)Identify the type of natural selection
A,B, and C with explanation of each.
b)Define Hardy-weinberg principle?
(HSE-March 2014)(4)
44. The above shown pictures are beaks of
a particular type of bird seen in an
island during Darwin’s journey
(HSE-March 2015)(2)
a)identify the bird and name the
island?
b)write the significance of this process
in evolution ?
45. Arrange the following in a hierarchical
manner in ascending order based on
their period of evolution.
(HSE-June 2014)(1) 48. A specific rat population was controlled
for about decade by a poison. After
population decline for about 10 years,
the rat population was increased and
46. a)The diagram given below shows a stabilized.
particular type of evolutionary process
a)Which is the species found most at

200 million years ago ?
b)Birds are most close relative to which
group of organism?
c)what is the trend observed in the
evolution of amphibians?
Resistance to poison is governed by a 50. Arrange the following examples under
dominant autosomal gene ‘R’. In 1975 two heads viz-Homologous organ and
majority of the resistant animals are analogous organ(HSE-March 2013)(2)
heterozygous at this locus (Rr)  Fore limb of whale and bat
a)What was the major genotype of rat  Wings of butterfly and bat
population before 1961  Heart of man and cheetah
A)RR B)Rr C)rr  Eye of octopus and mammal
D)R is absent as it produced by a
mutation 51. Theory of chemical evolution is a
b)What explanation you give for the version of theory of abiogenesis.
development of resistance against Analyze the statement.
poison in these rats ? (HSE March -2013)(2)
c) “This illustration can be used to 52. Diagrammatic representation of the
explain theory of evolution” operation of the natural selection in a
Substantiate(HSE May-2013)(2) population is given (june-2012)(1)
49. The diagram shows how the number of
species in different group of
vertebrates has changed between 400
million years ago and 5 million years
ago. The wider a block indicate the
more species there are
(HSE-May 2013)(3)
Redraw the diagram when nature
select large sized and small sized
individuals
53. Complete the flow chart showing the
evolution of man using age, name and
brain capacities of fossils
(June-2012)(3)

56. An evolutionary process occurred in
the evolution of marsupial mammals in
Australia is given below ?
(March-2012)(1.5)
54. Note the relationship between the first

pair and complete second pair
(March-2012)(1) a)Name this evolutionary process?
a)Natural selection : Darwin b)suggest another example for this
Inheritance of acquired character phenomenon ?
:.......................
b)Heart of vertebrate : Homologous
organ
flipper of penguin and Dolphin
:..............
55. A collection of peppered moths made
in England during different period is
given below (March-2012)(1.5)
a)What is your observation ?

b)Name the evolutionary process
behind this process?
c)write the reason for decreased
number of white winged moth in 1920
?

NAVAS CHEEMADAN SOHSS AREEKODE
10. Match the following(HSE-August 2021)(2)
A B
MICROBES IN HUMAN WELFARE 1)Trichodermapolysporu a)Streptokinas
m e
2)Monascuspurpureus b)Ethanol
1. Which microbe is called baker’s yeast ? 3)Streptococcus c)Cyclosporin
4)Sacharomycescervisia d)Statin
(A) Propionibacterium sharmanii
e
(B) Lacto bacillus
(C)Saccharomyces cerevisiae 11. Organic pollutants in sewage water is
(D) Aspergillus niger (HSE-March 2023)(1) measured as _____(HSE March-
2. Two bioactive molecules are given : 2021)(1)(a) GMO (b) MTP (c) BOD (d)
(i) Cyclosporin-A HGP
(ii) Streptokinase 12. Enzyme used in detergents for removing
(A) Name the microbe which produces oily stains from laundry is _____.
these bioactive molecules. (a) Lipase (b) Protease
(B) Write its use. (HSE-March 2023)(2) (c) Amylase
3. Who discovered the first antibiotic (d) Pectinase (HSE March- 2021)(1)
Penicillin ? (HSE-July 2022)(1) 13. Fill in the blanks to complete the table :
4. Write the use of following microbial
product : (HSE-July 2022)(2)
(a) Pectinase and Protease
(b) Streptokinase
5. The first antibiotic discovered was
_______. (HSE-March 2022)(1)
6. Match the following :(HSE-March 2022)(2) (HSE March- 2021)(2)
14. A free living nitrogen fixing bacteria in the

soil. (HSE-July-2020)(1)
(a) Rhizobium (b) Azospirillum
(c) Nostoc(d) Anabaena
7. (a) Expand the term AIDS. Mention the 15. Match the following : (HSE-July-2020)(2)
name of virus that causes AIDS. (a) Acetic
(b) Name the widely used diagnostic test acid (i)Trichodermapolysporum
for AIDS. (b) Citric acid (ii) Acetobacteraceti
(c) List out any four practices for the (c) (iii) Lactobacillus
prevention of AIDS. Cyclosporine
(HSE-March 2022)(5) A
(d) Lactic acid (iv) Aspergillusniger
(v)Monascuspurpureus
8. Name the free living fungus used as an
effective biocontrol agent of several plant
16. Microbe which help in the production
pathogen (HSE-August 2021)(1)
9. Biogas is a mixture of gases produced by of Biogas (HSE-March-2020)(1)
the microbial activity and used as a fuel (a) Aspergillusniger
.Mention the name of bacteria used for (b) TrichodermaPolysporum
production of biogas (c) Saccharomyces cerevisiae
(HSE-August 2021)(1) (d) Methanobacterium
Previous year Questions/+2/2023 navas9895@gmail.com

17. Some examples of microbes in human 22. Complete the table with appropriate
welfare are given. Classify them under terms(HSE-March 2018)(2)
the headings given below.
[Egs : Rhizobium,
Propionibacteriumsharmanii,
Azaspirillum, Lactic acid bacteria,
Anabaena, Azotobacter,
Aspergillusniger, Saccharomyces 23. Find the odd one out
cerevisiae...] (HSE-March-2020)(2) a)Trichodermapolysporum
b)Clostidiumburyliorm
c)Acetobacteraceti
d)Aspergillusruger
18. Match the following(HSE-June-2019)(2) (HSE-model 2018)(1)
24. a)Name the yeast used for the
commercialproduction ofethanol.
b)Name the yeast used for the
production of statins
(HSE-model 2018)(2)
25.Complete the table by filling A,B,C and
19. Bio-fertilisers are organisms that enrich D using hints from the bracket
(HSE-JUNE-2017)(2)
the nutrient quality of the soil. How
these biofertilisers enrich the soil (Gobar gas, biological control, anabaena,
Sacharomycescerviciae
nutrients ? Give two examples
,Prpionibacteriumsharmanii )
(HSE-June-2019)(2)
20. Microbes are useful to human beings in
Methanogen- ........A.............
diverse ways. If so, name the following
Bread making-.........B.............
: (HSE-March-2019)(2)
Biofertilizer:.............C............
(a) Microbe known as "Baker's Yeast".
Trichoderma:...........D..........
(b) Lactic acid producing bacterium.
(c)Fungus which helps in theproduction 26. What are the advantages of
biofertilizers over chemical fertilizers?
of bio-active molecule –cyclosporine A.
(d) Symbiotic nitrogen fixing bacterium. Give an example for biofertilizer?(HSE-
March-2017)(2)
21. In Sewage Treatment plant microbes
27. Chose the correct answer from the
play a significant role. Distinguish
bracket (HSE-June-2016) (1)
between primary and secondary
Cyclosporin A is produced by.......
treatment in sewage plant?(HSE-June
2018)(2) (a)Aspergillus (b)Clostridium
(c)Trichoderma (d)Acetobacter
28. Select a bio-control agent from the
given microbe (HSE-June-2016)(1)
a)Baculo virus b)Rhino virus
c)Picorna virus d)Adeno virus
29. “BOD is commonly calculated as an
index of water pollution”
a)Do you agree with this statement? Why?
b)Expand BOD?(HSE-March 2016)(2)
30. In our state waste management is a
problem. Government promote and
give subsidy to biogas plants. Comment
the functioning of biogas plants with 34. Some bioactive molecule, their sources
the help of microbe. and their medical importance are given
(HSE-June 2014)(2) in the table below.Fill up the missing
31. BOD of some water sample is given part(HSE-March 2013)(2)
below (HSE-June 2015)(2)
A- Sample-1 200mg/L
B- Sample-2 80mg/L
C- Sample-3 300mg/L
D- Sample-4 25mg/L
a)Which of above water sample is most
polluted ? 35. Match the following (june-2012)(2)
b) what is meant by flocs/ what is its
role in sewage treatment ?
32. Microbes can also be used as a source
of energy. Substantiate with
example?(HSE-March 2015)(2)
33. Complete the illustration appropriately
? (HSE-MAY 2013)(2)

36. Rearrange the coloumn B & C with
respect to A (March-2012)(2)
A B C
Monascuspup Streptoki Antibiotic
ureus nase
Streptococcus Statin Immunosuppr
essant
Pencilliumnot Cylospor Clot buster
atum in-A
Trichodermap Pencillin Cholesterol
olysporum lowering agent

HUMAN HEALTH AND DISEASE
1 Pick out the correct pair of disease and

its pathogen : (HSE March-2023)(1)
(A) Filaria – Rhino virus
(B) Typhoid – Streptococcus
(C) Malaria – Plasmodium 7 Write any four ill-effects of
(D) Ascariasis – Entamoeba Drug/Alcohol abuse.
2 Differentiate between Active immunity (HSE March 2022)(2)
and Passive immunity. 8 (a) Expand the term AIDS. Mention the
(HSE March-2023)(2) name of virus that causes AIDS.
3 (b) Name the widely used diagnostic
test for AIDS. (HSE March 2022)(5)
(c) List out any four practices for the
prevention of AIDS
Write some important measures that
9 Innate immunity is characterised by
would be useful for the prevention and
providing different types of barriers.
control of alcohol and drug abuse
Name the four types of barriers of
among adolescents. (Write relevant
innate immunity (HSE August 2021)(2)
four points) (HSE March-2023)(2)
10 World Health Organisation has started a
4 Mention any four measures useful for
number of programmes to prevent the
prevention and control of alcohol and
spreading of HIV Infection. Mention any
drug abuse (HSE July 2022)(2)
four preventive measures against HIV
5 Match the column (A) with column (B)
infection (HSE August 2021)(2)
(HSE July 2022)(2)
11 Which is the causative organism for
malaria disease ? Name the two hosts
required for the malarial parasites to
complete its life cycle
(HSE August 2021)(2)
12 Observe the figure
(HSE March 2021)(2)
6 Match the Column (A) with Column (B)

and (C) : (HSE July 2022)(2)

17 Name any two protozoan diseases, its
causative organism and any two
symptoms. (HSE-March-2020)(2)
18 Complete the illustration chart given
below. (HSE-March-2020)(2)
19 Explain the measures useful for
prevention and control of alcohol and
drugs abuse among adolescents.
(HSE-March-2020)(3)
(a) Identify the molecular structure 20 'Don't die of ignorance.'
given in the figure. (a) About which it is mentioned ?
(b) Name the regions labelled as A, B (b) List two measures taken by WHO to
and C. prevent it (HSE-June-2019)(2)
13 Drug/Alcohol abuse results in 21 Observe the figure and answer the
immediate and far reaching effects. following questions (HSE-June-2019)(2)
Write some effects you have studied. a) Identify the given molecule.
(HSE March 2021)(2) b)Mention two types of immune
14 Vaccines are given to children at various responses in human body.
stages of their development. (a) What is
meant by ‘vaccine’ ?
(b) Write the principle of vaccination.
(HSE March 2021)(2)
15 Observe the list of certain common
diseases in human given below and
answer thefollowing :(HSE-July-2020)(2)
(a) Identify the bacterial disease among

the enlisted. 22 Write the effect of the following drugs
(b) Name its causative organism. in human body (HSE-June-2019)(3)
(c) Mention any two symptoms of it. (a) Ophiods (b) Cannabinoids
16 Prepare a pamphlet as part of an (c) Coca alkaloids
awareness programme in your school 23 Complete the flow chart given below
regarding the“Prevention and control of
Alcohol and Drug abuse in adolescents”.
[Hint :Prevention and control measures]

(HSE-July-2020)(3)

28 Complete the table given below
(HSE-March 2018)(2)
(HSE-March-2019)(2) 29 Consumption of drug and alcohol affect

24 List of some diseases commonly the person’s mental and physical
occurring in man are given below. health very badly. List the warning sign
Arrange them based on causative of alcohol or drug abuse
organism in the table. Malaria, (HSE-March 2018)(2)
Common cold, Typhoid, Ascariasis. 30 Study the relationship between the first
Pneumonia, Ring worm, Amoebiasis twowords and fill the blank space with a
(HSE-March-2019)(2) suitable word
Bacteria Fungus Virus Protozoan Pnemonia : Streptococcus
pneumonae
Typhoid:..................
(HSE-Model 2018)(1)
25 Identify the bacterial disease from the 31 Prepare a hand out to educate
following (HSE-June 2018)(1) students aboutthe symptoms ofthe
a)Typhoid b)Amoebiasis dreaded disease cancer, itsdetection
c)Malaria d)Filariasis and treatment (HSE-Model 2018)(3)
26 Classify the following barriers of innate 32 Prepare a brief note to be presented in
immunity under 3 suitable heading an awareness programme for
(HSE-June 2018)(3) adolescents about AIDS, their causes
and preventive measures
(HSE-June-2017)(3)
33 Fill the box A,B,C and D (HSE-JUNE-2017)(2)
27 Innate immunity is a non-specific type
of defense and consists of four types of
barriers. Categorize the barriers and
give one example for each.
(HSE-March 2018)(2)

34 Fill the blanks A,B,C and D using correct

terms given in the box
(HSE-JUNE-2017)(2)
Passive immunity
Sensitivity to some particles
Metastasis
Active immunity
Autoimmune deficiency
Immune deficiency disease
a)Identify the part X and Y ?
a)....A............ – Cancer b)Name any two type of this
molecules ?
b)Allergy -..B......... 39 Select odd one out and justify your
C).....C.......-AIDS selection (HSE-June 2016)(1)
Malaria, Gonorrhoea, Amoebiasis,
d)Rheumatoid arthritis-.......D...... filariasis.
35 Morphine is said to be an abused drug. 40 Identify the disease shown in the
Discriminate the term ‘use’ and ‘abuse’ following figure and write the
of the drugs based on this example ? causative organism of the disease
(HSE-March-2017)(2) (HSE-March 2016)(1)
36 Differentiate active immunity from
passive immunity. Give an example for
passive immunity ?
(HSE-March-2017)(2)
37 Complete the table by filling a,b,c and d
(HSE-June 2016)(2)
41 “Blood of a man is tested positive for

cannainoid”
a)what are these?
b)from where there are extracted
38 Answer the question about the given naturally ?
figure (HSE-June 2016)(2) c)which part of the body is affected
by these ?(HSE-March 2016)(3)

42 Match the terms given in three
coloumn of table correctly Typhoid,
Malaria, Pneumonia
(HSE-June 2015)(2)
Diphtheria
Amoebiasis
48 Prepare a pamphlet for an awareness

programme in your school about the
measures to prevent and control
alcohol and drug abuse in adolescents
(March-2014)(2)
43 “If proper care and attention is not 49 The meaning of ‘antibiotics’ is
given by adults, adolescent may ‘against life’, where as with reference
become addicted to drug or alcohol”. to human being is is ‘pro life’
What is your opinion about this (March-2014)(2)
statement ?substantiate your answer ? Substantiate this statement with
(HSE-June 2015)(2) suitable example ?
44 Cancer is one of the most dreaded 50 Prepare a pamphlet for adolescent
diseases of human beings, and is major children to make them aware of
cause of death all over the globe alcohol and drug abuse?
(HSE-March-2015)(3) (HSE-May 2013)(2)
a)what are the causes of cancer? 51 “Prevention is better than cure” . This
b)what are the methods for statement is true in the case of AIDS
detection of cancer? as well as immunisation .
c) What are the types of treatment Substantiate (HSE-May 2013)(2)
of cancer? 52 Most often HIV Infection occur due to
45 Briefly describe the characteristic of conscious behaviour patterns. Do you
cancer cells ? (HSE-June 2014)(2) agree with this statement ?
46 It is said that “Chikunguniea” once Substantiate your answer?
affected will not a person in next half (HSE-March 2013)(2)
of his life. Justify this statement 53 Nature has as many verities of plants
(HSE-June 2014)(2) which give drugs for abuse, as there
47 Classify the diseases given in the box are medicinal plants which give
as two groups based on their medicines. Substantiate with two
causative organism. Specify the type examples (HSE March 2013)(2)
of causative organism for each group 54 Note the relationship between first two
(HSE-March-2014)(2) terms and suggest a suitable term for
the fourth place(june-2012(1)
a)Erythroxylum coca : Cocaine
Papaversomniferum :...............
b)salmonellatyphi : Typhoid fever
plasmodium falciparum :............
55 One of your Friend Argued that anti-
retroviral drugs are effective
medicine to treat AIDS (June-2012)(3)
a)What is your opinion about it?
b)How HIV affect our immunity ?
56 Arrange the following diseases in the

following coloumn in correct order
(March-2012) (2)
Typhoid,Ring worm, Amoebiasis,
AIDS, Malaria, Pneumonia, Common
Cold
57 In a class room discussion a student

argues that allergic reaction are more
common in metro cities than in
villages.(March-2012)(2)
a)Do you agree with this statement ?
b) Which type of immunoglobulin is
responsible for allergic reactions?
c) suggest two drugs which reduce
allergic symptoms ?

conservation with two examples
each (HSE July 2022)(2)
BIODIVERSITY AND CONSERVATION
5. The term ‘Biodiversity’ was
1. Identify two ex-situ conservation popularised by the scientist
approaches of organisms from the ________. (HSE-March 2022)(1)
following list : (HSE March 2023)(1) 6. (a)Write four major causes of
(Zoological Park, Biosphere Reserve, Biodiversity loss.
National Park, Botanical Garden) (b) Give one example for in-situ
2. A figure showing the global conservation and ex-situ
biodiversity of invertebrates and conservation of Biodiversity.
vertebrates are given : (HSE-March 2022)(3)
7. Biodiversity can be descried at 3
(HSE March 2023)(2)
levels of biological organizations
a) Mention three levels of biological
diversity ?
b)Who popularized the term
“Biodiversity” (HSE-August-2021) (2)
8. Mention the two conservative
approaches to protect our
biodiversity. Give one example for
(A) Identify the most diverse groups each conservative approach ?
of vertebrates and invertebrates. (HSE-August-2021) (2)
(B) What are the three important 9. Now-a-days, the world is facing a
levels of biodiversity ? problem of increased rate of species
3. The given illustration shows ‘Evil extinction due to human activities’.
Quartet’ of biodiversity loss : Write major causes of biodiversity
losses (HSE March 2021)(2)
10. “Species diversity is greater in
tropical regions than in temperate
regions.” Give reasons.
(HSE March 2021)(2)
(i) Fill up ‘A’ and ‘B’. 11. (a) The term ‘biodiversity’ was
(ii) Explain Co-extinction and Alien popularised by _________.
species invasion with suitable (b) Name the two types of
examples (HSE March 2023)(3) biodiversity conservation.
4. Differentiate between in-situ and ex- (c) Write any three causes of
situ approaches of biodiversity biodiversity loss.
(HSE-July 2020)(3)
12. Select the cause of extinction of 18. Observe the graph and answer the
Cichlid fish in lake Victoria of East following questions
Africa. (HSE-March 2020)(1) (HSE-March 2018)(3)
(a) Habitat loss and fragmentation
(b) Over-exploitation
(c) Alien species invasions
(d) Co-extinctions
13. Tropical Amazonian rainforest in
South America has the greatest
biodiversity on earth. Do you agree
with this? Explain.
(HSE-March 2020)(2)
14. In your school the Science Club
decided to conduct a seminar about a) Name S,A,C and Z in the graph
"Biodiversity conservation - b) Name the scientist who explained
Approaches". You are invited species-area relationship
to.present a paper on this seminar. 19. "Theaccelerated rates of species
List out the main points you extinction thatthe world is facing
included in the presentation. today is largely due to human
(Hint : In Situ, Ex-Situ conservation) activities".(HSE-Model 2018)(3)
(HSE-June-2019)(3) Do you agree with this
15. Which among the following belongs statement.Justify youranswer.
to ex-situ conservation? 20. Explain the levels of
Wildlife sanctuaries, Bio sphere biodiversity?(HSE-JUNE-2017)(3)
reserves, Zoological parks, National 21. Explain different types of
parks, Sacred groves biodiversity conservation with
(HSE-March-2019)(1) example(HSE-JUNE-2017)(3)
16. The causes of biodiversity loss are 22. Distinguish between in
designated as "EVIL QUARTET". situconservation from ex
Explain the Evil Quartet in situconservation with one example
biodiversity loss. each ?(HSE-March-2017)(2)
(HSE-March-2019)(2) 23. “When we conserve and protect
17. Human beings can conserve and the whole ecosystem, its
protect ecosystem and biodiversity. biodiversity at all levels is
Prepare a handout to show protected”. Based on this statement
different methods of biodiversity explain the strategies of biodiversity
conservation? (HSE-June 2018)(2) conservation (HSE-June 2016)(3)

24. “when need turns to greed, it leads
to biodiversity loss”. Substantiate
this statement by explaining two
causes of biodiversity loss.
(HSE-June 2016)(3)
25. Observe the concept diagram of Evil
Quartet of biodiversity loss a)Identify the type of conservation
(HSE-March 2016)(2) shown in A and B?
b)Write the difference between two
types of biodiversity conservation
shown in A and B?
c)Which of the above approach is
more desirable when there is an
urgent need to save species ?
28. We have moral responsibility to
take good care of earth’s
biodiversity and pass it on in good
order to next generation.
a)Define biodiversity?
b)write causes for biodiversity loss?
a)Write A and B c)Name two type of biodiversity
b)What is co-extinction ? conservation ?(HSE-March 2015)(3)
29. a)Variety of species are present
26. Read the statement and chose the around us, what they constitute and
correct option (HSE-March 2014)(1) comment?
b)comment on in situ conservation
and ex situ conservation?
c)In these aspect explain the
concept of hot spot with example-
give importance to recent issues
with regard to western ghat
27. Two approaches for the (HSE-June 2014)(3)
conservation of biodiversity is 30. “Nature provides all for the need of
shown as A and B(HSE-June 2015)(3) man but not for his greed”
a)Do you agree with this statement?
Justify your answer
b)distinguish between two types of
biodiversity conservation ?
(HSE-March 2014)(3)
31. While preparing the species are
relationship graph of 4 areas, the
following Z values are obtained
Area A =0.1
Area B= 0.8
Area C =1.2
Area D= 0.3
a)Which area show maximum
species richness ?
b)what are the expected reasons for
the loss of biodiversity in area with a)What is your observation ?b)List the
low species richness ? three reasons for greater biodiversity in
(HSE-May 2013)(3) tropical region ?
32. “Nature does lot of service for c)Write 2 causes of biodiversity loss ?
which an economic value or price
tag cane put” substantiates giving
examples. (HSE-March 2013)(2)
33. “Conservation of biodiversity is a
collective responsibility of all
Click here to watch video lesson
nations”. Write a slogan stressing
the significance of biodiversity
conservation? (HSE-March 2013)(1)
34. Last twenty years alone have
witnessed the disappearance of 27
animal species from earth.
(June2012)(3)
a)Name the animal disappeared
recently
b) What may be the causes of this
loss ?
c) How can we conserve
biodiversity?
35. The given graph shows the
distribution of insects in different
latitude of earth (March-2012)(3)

+2 Previous Year Zoology QP 2023 Updated

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

+2 Previous Year Zoology QP 2023 Updated

Uploaded by

Copyright:

Available Formats

NAVAS CHEEMADAN SOHSS-AREEKODE

1. Select the odd one. Justify your selection. (1)

9. Diagrammatic view of male reproductive system is

(i) Name hormones A and B.

Previous year Question/+2/2023 navas9895@gmail.com

16. Expand the following terms (1) HSE-March 2021

24. The wall of uterus has 3 layers of tissues (2)

Previous year Question/+2/2023 navas9895@gmail.com

fertilisation and further development.

59. Name the cells in testis which synthesize and

67. Human female possess 44+XX chromosome

76. Select the odd one and justify your selection?

81. Choose the odd one from the following and

84. Foetal sex can e determined by a test based

102. Find out the odd one from the following,

Previous year Question/+2/2023 navas9895@gmail.com

Previous year Question/+2/2023 navas9895@gmail.com

8. Identify the symbol used in pedigree analysis(1)

9. T.H Morgan selected Drosophila melanogaster as

11. Name the genetic disorder in which a blood

Previous year Question Paper/+2/2023 navas9895@gmail.com

17. A monohybrid cross is given below :

(a) Identify the cross

Previous year Question Paper/+2/2023 navas9895@gmail.com

28. Find the odd one out. Justify your answer.

(a)Which one of the polypeptide chain is

30. Observe the following cross between

a) Identify the cross?

a) Observe the above cross and name this

Previous year Question Paper/+2/2023 navas9895@gmail.com

a) Name the process marked as A and writes its

43. Examine the following fragment of beta globin

44. Observe the figure below and answer the

a)Write the genotypes of Father, Mother and

48. Observe the figure and answer the question

45. a)Complete the flow chart of chromosomal

a) Identify the syndromes A and B.?

46. Which of the following is not a

55. Identify they syndrome from the genotype given

60. Explain the phenomenon shown in the following

a)Identify the syndrome from the diagram, and

53. It is evident that, it is the genetic make of a sperm

Previous year Question Paper/+2/2023 navas9895@gmail.com

63. In the given pedigree the shaded figure denotes

a) From the above give an example for genotype

66. Diagrammatic representation of chromosome

74. The frequency of occurring Royal disease or

79. To findout the unknown genotype of a violet

a)What would be the above cross called?

a) Which of the polypeptide chain in the

Click here/Scan QR to watch video lesson

Previous year Question Paper/+2/2023 navas9895@gmail.com

(i) Fill up the missing parts A and B.

a)Write the name of enzymes labeled as A,B and C

(b) Write any two applications of DNA finger-printing.

NAVAS CHEEMADAN navas9895@gmail.com

14. Under microscope, chromatin is seen as ‘beads-

18. The diagram represent DNA Replication process

a)Re draw the diagram, rectifying if any mistakes

22. One of the salient features of genetic code is

(a) Identify the process in the picture.

25. In a double stranded DNA, the ratios

a) Identify the figure.