General and Comparative Endocrinology 251 (2017) 66–73

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier.com/locate/ygcen

Research paper

Ovaprim, a commercial spawning inducer, stimulates gonadotropin

subunit gene transcriptional activity: A study correlated with plasma
steroid profile, ovulation and fertilization in the catfish Heteropneustes
fossilis
A. Acharjee a, R. Chaube a, K.P. Joy b,⇑
a
Department of Zoology, Centre of Advanced Study, Banaras Hindu University, Varanasi 221005, India
b
Department of Biotechnology, Cochin University of Science and Technology, Kochi 682022, India

a r t i c l e i n f o a b s t r a c t

Article history: The commercial fish spawning inducer Ovaprim (OVP) containing a salmon gonadotropin-releasing hor-
Received 4 January 2016 mone analogue and domperidone (a dopamine receptor-2 antagonist) has been widely used as an effec-
Revised 18 September 2016 tive spawning inducer in artificial breeding of fishes. It induces a preovulatory LH surge resulting in final
Accepted 1 October 2016
oocyte maturation (FOM) and ovulation through a mechanism involving a steroidogenic shift to secrete a
Available online 5 October 2016
maturation-inducing steroid (MIS). In the present study, a 0.5 lL/g body weight dose of OVP each injected
at 0 h and 24 h intraperitoneally into gravid female catfish, Heteropneustes fossilis resulted in periovula-
Keywords:
tory changes in gonadotropin (GtH) subunit gene expression and steroid hormone levels. The OVP injec-
Catfish
GPa- FSHb- LHb mRNA expression
tions induced ovulation time-dependently from 6 h onwards with 100% ovulation recorded from 24 h to
Ovaprim 48 h. The fertilization rate was high from 6 h to 18 h and declined from 24 h onwards. The OVP treatment
Ovulation and fertilization up regulated the expression of GtH subunit genes differentially. The expression of glycoprotein-a (GPa)
Steroidogenic shift and luteinizing hormone (LHb) peaked at 6 h and 12 h, and declined at 18 h and 24 h after the first injec-
tion. The second OVP injection at 24 h elicited only a transient increase in the GPa expression at 6 h and a
sustained increase in the LHb expression from 6 h to 18 h after the second injection, but both transcripts
decreased subsequently. The follicle-stimulating hormone (FSHb) expression responded to the OVP treat-
ment from 12 h onwards and maintained a constant level from 18 h to 36 h after the first injection; the
second dose had little effect. Plasma steroids were differentially altered: the levels of estradiol-17b
decreased while that of the MIS 17,20b-dihydroxy-4-pregnen-3-one; 17,20b-DP increased, causing the
steroidogenic shift preceding FOM and ovulation. The present results indicate that LHb expression coin-
cides with the ovulation response and the late induction and maintenance of the FSH expression may be
related to post-ovulatory events in the ovary.
Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction goldfish (Carassius auratus) and African catfish (Clarias gariepinus)

In teleosts, gametogenic activity is mainly regulated by the
pituitary glycoprotein hormones namely, follicle-stimulating
hormone (FSH) and luteinizing hormone (LH). In females, FSH is
concerned with oocyte development and growth while LH induces
final oocyte maturation (FOM) and ovulation. However, the role of
FSH is rather enigmatic in catfishes since the presence of the native
protein is not yet determined (reviewed in Chaube et al., 2015).
Under captive conditions, many fishes do not breed and hence
spawning is to be induced artificially. Investigations primarily in
⇑ Corresponding author.
E-mail address: kpjoybhu@gmail.com (K.P. Joy).
have shown that the gonadotropin-releasing hormone (GnRH,
LHRH)-induced LH stimulation is inhibited by dopamine (DA)
through DA2 receptors at the pituitary level, and DA2 receptor
antagonists like domperidone, pimozide, etc., potentiate the GnRH
action (Chang and Peter, 1984; De Leeuw et al., 1987; Dufour et al.,
2005; Goos et al., 1987; Lin et al., 1986; Peter et al., 1988; Peter and
Yu, 1997; Yaron et al., 2003; Zohar et al., 2010). Hence the combi-
nation of a GnRH analogue and DA2 receptor blocker (Linpe
method) has been widely used to induce the preovulatory LH surge
to initiate FOM and ovulation. The Linpe method (Peter et al., 1988;
Peter and Yu, 1997) was first successfully used in co-operative
farming of carps in China. It was further extended to other species
(Halder et al., 1991; Hill et al., 2009; Kahkesh et al., 2010;

http://dx.doi.org/10.1016/j.ygcen.2016.10.001
0016-6480/Ó 2016 Elsevier Inc. All rights reserved.
 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73
Manickam and Joy, 1989; Sahoo et al., 2007; Tharakan and Joy,
1996). Based on the Linpe method, spawning aids such as Ovaprim,
Ovopel, Ovatide, etc., are commercially available for fish breeding
practices.
The catfish Heteropneustes fossilis is highly valued for food and
rejuvenating properties. The ability to survive under harsh condi-
tions makes it ideal for derelict/waste water aquaculture. In the
wild, the males and females attain sexual maturity and reproduce
seasonally once in a year at the onset of monsoon. In captivity,
even under optimal conditions, the catfish does not breed sponta-
neously. The ovarian follicles undergo growth and development
but the final events of FOM and ovulation do not occur. Tharakan
and Joy (1996) demonstrated that the combination of a mam-
malian GnRH analogue and pimozide induced the preovulatory
LH surge in the catfish, resulting in a high rate of ovulation and
fertilization. However, the effect of ovaprim on the gonadotropin
dynamics was not investigated nor its effect on the gonadotropin
subunit gene expression. Recently, we cloned and characterized
the GtH subunit mRNA in the catfish (Acharjee et al., 2015). This
has led to the development of qPCR-based assays of GtH subunit
mRNAs to assess transcriptional activity especially FSHb subunit
expression. The role of FSHb in FOM and ovulation is less defined
as a result of non-availability of FSH assays in fish species. In the
catfish, both LHb and FSHb transcript levels showed seasonal
changes with high abundance in the recrudescent phase and low
abundance in the quiescent phase. Furthermore, the FSHb and
LHb transcripts showed distinct seasonal patterns.
The present study reports periovulatory changes in the expres-
sion of GtH subunit mRNA transcripts (GPa, LHb, FSHb) during the
ovaprim-induced ovulation of the catfish. The data were compared
with other functional attributes such as plasma and ovarian steroid
hormone profiles, ovulation and fertilization.
2. Material and methods
2.1. Animal collection and acclimatization
Gravid female H. fossilis (50–60 g) of the first sexual cycle were
purchased from local fish markets in Chaukaghat area of Varanasi
during the month of July (gonadosomatic index, GSI- 11.4%, spawn-
ing phase). The fish were acclimatized in flow-through water tanks
(cement tanks of 0.35
0.35
0.45 m3 of 55 L capacity with 30 L
water filling) for 48 h under normal photoperiod and ambient
temperature (14.5L:8.5D; 28 ± 2 °C). During maintenance, the fish
were fed with boiled minced goat liver ad libitum.
All experiments were performed in accordance with the guide-
lines of the Animal Ethics Committee, Faculty of Science, Banaras
Hindu University for experimentation in animals and all care was
taken to prevent cruelty of any kind.
2.2. Chemicals and reagents
The following molecular biology kits and reagents were used:
RNeasy lipid tissue mini kit (Qiagen GmBH, Germany), Revert-Aid
H minus first strand cDNA synthesis kit (Fermentas, Hanover,
MD, USA), DNase I RNase-free (Ambion Inc., Austin, TX, USA),
RNAlater (Ambion Inc., Austin, TX, USA), 2
PCR master mix
(Fermentas, Hanover, MD, USA), 2
VeriQuest SYBR Green qPCR
Master Mix Ex (Cleveland, Ohio, USA), The primers used in the
present study were synthesized by Integrated DNA Technologies
(Coralville, IA, USA). Ovaprim (Syndel Laboratories, Canada) was
purchased from Virbac Animal Health India Pvt. Ltd., Mumbai.
ELISA kits were purchased from Labor Diagnostika Nord GmbH &
Co. KG, Germany. 17,20b-dihydroxy-4-pregnen-3-one (17,20b-DP)
was purchased from Sigma Aldrich Ltd., USA. Other chemicals used
67
in the study were of molecular biology grade and purchased from
E. Merck, Mumbai, India. Degassed and filtered nanopure water
(Barnstead International, Dubuque, IO, USA) was used throughout
for HPLC.
2.3. Experiments
2.3.1. Ovaprim treatment
The acclimatized female catfish were divided into three groups
of 150 fish each. Group 1 was injected intraperitoneally (i.p.) with
Ovaprim (OVP, 0.5 lL/g body weight of fish; Sahoo et al., 2007).
OVP contained 20 lg/mL of the analogue of salmon gonadotro-
pin–releasing hormone (D-Arg6, Trp7, Leu8, Pro9 NEt)-LH-RH and
10 mg/mL domperidone, a dopamine DA2 receptor antagonist in
propylene glycol. The dose was calculated according to the weight
of the fish and propylene glycol was added to make a 100 lL vol-
ume for the injection. The group 2 fish was given an equal volume
of propylene glycol (100 lL, vehicle control). The group 3 fish was
maintained as untreated control fish. A second dose was given after
24 h of the first injection to monitor multiple ovulations over a
period of 48 h. Batches of fish from the OVP, vehicle control and
untreated control groups were sampled at 0, 6, 12, 18, 24, 30, 36,
42 and 48 h. They were checked for ovulation by hand-stripping
and scored. The ovulated eggs were mixed with milt collected from
male fish in a Petri dish and the fertilized eggs and unfertilized
eggs were scored after 1 h for calculation of percentage fertiliza-
tion. A second set of the fish from the OVP, vehicle control and
untreated control groups were anaesthetized by immersing in a
0.01% solution of tricaine methanesulfonate (MS222; Sigma St.
Louis, USA) and sacrificed by rapid decapitation. Blood was
collected in heparinized syringe by caudal vein puncture and
centrifuged at 2800g for 15 min at 4 °C to collect plasma. Plasma
was stored at 80 °C until steroid hormone assays. The pituitaries
were dissected out of the brain under aseptic conditions. Fifteen
pituitaries from each group were pooled to make a sample
(n = 5) and immediately stored in RNAlater at 80 °C till RNA
extraction, cDNA synthesis and qPCR assay. Ovaries were stored
at 80 °C and processed for steroid extraction.
2.3.2. Total RNA extraction, cDNA synthesis and qPCR
The pituitaries from each group were homogenized using a T10
basic ULTRA-TURRAX homogeniser (IKA, Germany) in 1 mL QIAZOL
(Qiagen) buffer and total RNA was isolated with RNeasy lipid tissue
Mini kit (Qiagen). Total RNA was treated with 2 U DNaseI RNase-
free (Ambion) for 30 min at 37 °C, following the manufacturer’s
protocol to remove genomic DNA contamination. The quality of
RNA was analyzed after separation on a 1% agarose gel containing
2.2 M formaldehyde. The total RNA yield was determined in a
NanoDrop (ND-1000 Spectrophotometer, NanoDrop Technologies,
Rockland, DE) and quality assessed by gel electrophoresis. The
RNA samples with a A260/A280 ratio from 1.6 to 2.0 were used
in the cDNA synthesis reaction. For reverse transcription (RT),
1 lg of total RNA of each sample was reverse transcribed in a
20 lL reaction with the Revert Aid H Minus first strand cDNA
synthesis kit (Thermo Scientific), following the manufacturer’s
protocol. Briefly, in a sterile nuclease-free tube on ice, the following
reagents were added: total RNA template (1 lg), random hexamer
primer (100 pM, 1 lL) and nuclease-free water (12 lL). After
mixing gently and centrifuging briefly, the mixture was incubated
at 65 °C for 5 min. The mixture was chilled on ice, centrifuged and
the vial placed back on ice and 4 lL of 5
reaction buffer, 1 lL of
RiboLock RNase inhibitor (20 U/lL), 2 lL of 10 mM dNTP Mix and
1 lL of RevertAid H Minus M-MuLV Reverse Transcriptase
(200 U/lL) were added. The mixture was incubated for 5 min at
25 °C, followed by 60 min at 42 °C. The reaction was terminated
by heating at 70 °C for 5 min. cDNA was stored at 80 °C.
68 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73
Table 1
Details of gene-specific primers.
Experiment Primer name Sequence 50 -30
qRT-PCR GPa Forward Primer CCAACTCCCTTGAGGTCCAAGAA
GPa Reverse Primer GCAGTCTGTGTGATTCACCAGC
FSHb Forward Primer ATCACCGTGGAGAGTGACGAG
FSHb Reverse Primer CCCTGAAGTTACAGGTGTTCTGG
LHb Forward Primer CTGAGCGATCACGGCAAAAGCT
LHb Reverse Primer CGGTCTCATTCACAGGTTGGCA
Internal control b-actin Forward Primer TGGCCGTGACCTGACTGAC
b-actin Reverse Primer CCTGCTCAAAGTCAAGAGCGAC
The transcripts encoding GtH subunit genes were amplified
using real time qPCR. The real time qPCR was done with an ABI
Prism 7500 Sequence Detection System (PE Applied Biosystems,
CA, USA). The PCR reaction mixture (20 lL) contained 1 lL sample
cDNA (diluted 1:10), 1 lL of 10 pM forward and reverse primers
(Table 1) and 10 lL 2
VeriQuest SYBR Green qPCR Master Mix
Ex (Cleveland, Ohio, USA). The PCR condition was, 95 °C for 30 s,
40 cycles at 95 °C for 5 s, and 60 °C for 20 s. The PCR amplicon size
was 157 bp for b-actin, 132 bp for GPa, 136 bp for FSHb and 128 bp
for LHb. The specificity of the amplification of each cDNA was ver-
ified by melting curve analysis and gel electrophoresis of the PCR
product on a 3% agarose gel and visualized with ethidium bromide
in addition to sequencing of qPCR products. In each assay, sample
cDNAs were amplified in duplicate. A non-template control and
dissociation curve were performed to ensure that only one PCR
product was amplified and that stock solutions were not contami-
nated. A cDNA synthesis sample without reverse transcriptase (no
RT control to check genomic DNA contamination) was tested for all
the genes and no amplification was detected. b-actin was taken as
the reference gene as its expression in the pituitary was found to
be consistent throughout the seasons. The PCR efficiency for each
gene was measured using serial dilutions of stock cDNA. The
amplification efficiencies of all the genes were approximately
equal and ranged from 95% to 103%. Cycle thresholds were
obtained from the exponential phase of the PCR amplification
curves and the expression of GtH subunit mRNAs were normalized
to the expression of b-actin mRNA. The relative expression levels
were calculated using the 2DDCt method (Livak and Schmittgen,
2001), where the untreated initial control pituitary cDNA was
taken as the calibrator.
2.4. Steroid assays
2.4.1. Steroid extraction
The ovarian tissues were homogenized (n = 5) in 4 vol of cold
PBS (0.02 M, phosphate buffered saline, pH 7.4) with an ultrasonic
homogenizer (XL-2000 Microson, Misonix, USA) at 0 °C for 5–10 s.
The homogenate was centrifuged at 5000g for 20 min at 4 °C and
extracted with 3 vol of diethyl ether, three times. The three ether
fractions were pooled to constitute one tissue sample, evaporated
and dried under N2 and stored at 20 °C. The process was repeated
for other tissue samples. Plasma was directly extracted with
diethyl ether, as described above. The ether fractions were col-
lected, pooled, evaporated, dried under N2 and stored at 20 °C.
2.4.2. Estradiol-17b assay and validation
E2 was assayed using an ELISA kit according to the manufac-
turer’s (Labor Diagnostika Nord GmbH & Co. KG, Germany) instruc-
tions. Briefly, the samples were reconstituted and 50 lL each of
the sample and E2 standard (0, 20, 100, 300, 800 and 3200 pg/mL)
were introduced into the anti-E2 Immunoglobulin G (IgG)-coated
plate wells. A hundred microliter of E2-horseradish peroxidase
(HRP) conjugate was added to each well and incubated at 37 °C
for 1 h on a plate shaker at 200 rpm. The content from each plate
was drained and washed with 300 lL wash buffer, 3 times. The
wash buffer was completely drained out from each well. Next,
150 lL tetramethylbenzidine (TMB) substrate was added into each
well and incubated at room temperature for 10–15 min on a plate
shaker. Color development was stopped by adding 50 lL 1 M sul-
phuric acid. Absorbance was taken at 450 nm using a Multiscan
microplate reader (Thermo Electron Corporation, USA).
The concentration–response curves for E2 were linear over
20–3200 pg/mL range. The sensitivity of the E2 assay was 10 pg/mL.
Cross reactivity of the E2 antibody was, estradiol- 17b – 100%,
estriol – 1.6%, estrone – 1.3%, progesterone – 0.1%, cortisol –
0.1%, testosterone – 0.0001%, deoxycorticosterone – 0.0001% and
17,20b-DP – 0.0001%. Known concentrations of E2 were processed
in the same manner as samples. Percentage recovery of E2
(77.417 pg/mL added) was 98.2 ± 1% (n = 5). The coefficients of
inter- and intra-assay variations were 9.2% and 9.9%, respectively.
2.4.3. HPLC assay for 17,20b-DP and validation
Methanol reconstituted samples for 17,20b-DP were assayed by
HPLC, as described by Mishra and Joy (2006). In brief, a Shimadzu
HPLC system (Kyoto, Japan) was used and equipped with two
pumps (LC-10ATVP), system controller (SCL-10AVP) and an UV
detector (SPD-10AVP) with a variable wavelength (190–370 nm)
range. The system was operated with Shimadzu Class VP series
software. The elution was done with a reversed phase C18 column
(150
4.5 mm, i.d., 5 lm, Luna, Phenomenex) connected to a
guard column filled with the same material. The mobile phase
was 60% methanol in water at a flow rate of 1.5 mL/min. The run
time was 30 min. The absorbance was taken at 240 nm. For stan-
dard, 17,20b-DP was dissolved in ethanol and serial dilutions were
made. The diluted standard solutions and samples were injected
into 20 lL loop of the HPLC system with the help of a Hamilton
microliter syringe. The different concentrations of the standard
were tested individually to record detection limit, retention time
and peak area under isocratic conditions. This was repeated
five times with each concentration to verify the concurrence of
the retention time and to set up concentration vs. peak area curve.
The response was linear with the concentration ranges used
(1–1000 ng/mL).
With the said chromatographic conditions we adopted, the
retention time of 17,20b-DP was 12.2 min. In the sample runs,
the retention time showed minor shifts. Therefore, the peaks were
authenticated by spiking the samples with known concentrations
of the standard in a mixture. Known concentrations of the standard
in different dilutions were processed in the same manner as tissue
samples and were injected into the column. The percentage recov-
ery was calculated from the concentration of the standard injected
directly and that measured after the extraction. The percentage
recovery (n = 5) was 94 ± 0.8% but no corrections were made in
the final values. The samples were also co-eluted with a known
concentration of the standard and compared with the elution of
the standard alone for the authentication of the peak.
2.5. Statistical analysis
The percent ovulation and percent fertilization data were arc-
sine transformed before the analysis and the data were presented
as mean ± SEM. Gene expression studies were replicated five times
with five different batches of fish. The cycle threshold (Ct) value of
GPa, FSHb and LHb mRNA was normalized with the Ct value of
b-actin for each sample. The initial control sample was taken as
the calibrator to give a relative ratio of the mRNA expression. Data
were presented as mean of Log RQ ± SEM. The steroid assay data
were presented as mean ± SEM. Data were checked for homogene-
ity and normality and further analyzed for statistical significance
 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73 69

using the Statistical Package for the Social Sciences software pro-
gram (version 10.0; SPSS). One way analysis of variance (ANOVA,
P < 0.001), followed by Tukey’s test was used to compare
differences at a significance level of P < 0.05.

3. Results

3.1. Ovulation and fertilization

The injection of OVP elicited the first sign of ovulation at 6 h

with 2 out of the 15 fish ovulated by hand-stripping and the
response increased steadily, through 12 h and 18 h, with all the
15 fish ovulated at 24 h (Fig. 1). The second injection of OVP at
24 h sustained the response till the end of the experiment at
48 h. The fertilizing ability of the ovulated eggs was tested at dif-
ferent time points after the OVP injections (Fig. 2). The percentage
of fertilization (arcsine transformed values) of ovulated eggs was Fig. 2. Percent fertilization of eggs stripped at different intervals after Ovaprim
treatment in the female catfish Heteropneustes fossilis. The arcsine transformed
60% at 6 h, and 65% at 12 h and 18 h. The fertilization
values of the fertilization data were presented as mean ± SEM (n = 5). Data were
rate decreased to 50% at 24 h and lowered further down after analyzed by one way ANOVA (P << 0.001), followed by Tukey’s test (P < 0.05). The
the second injection at 24 h. groups with different letters are significantly different.

3.2. Effects of OVP on gonadotropin subunit expression

The OVP injections caused significant periovulatory increases in

the expression of GtH subunit genes in comparison to the control
groups (P < 0.001, one way ANOVA, FGPa = 166.18, FFSHb = 604.36
and FLHb = 515.57, respectively). The GPa transcript levels
increased significantly to the highest levels at 6 h and 12 h
(2-folds) (Fig. 3; P < 0.05, Tukey’s test). Afterwards, the transcrip-
tional activity declined successively at 18 h and 24 h. The second
dose of OVP at 24 h could significantly increase the transcript level
at 30 h (6 h after the second injection) but the levels subsequently
decreased until the end of the experiment at 48 h. In contrast to the
GPa expression, the FSHb expression responded only from 12 h
onwards after the first OVP injection (Fig. 4; P < 0.05). The fold
increase was low at 12 h (0.5 times) and peaked at 18 h and
24 h (1.5 times) without any significant variation. The second
OVP injection at 24 h sustained the transcript levels, which
remained constant till 36 h of the first injection and the levels
decreased subsequently until the end of the experiment. In close Fig. 3. Expression of pituitary GPa mRNA levels at different intervals after the
parallel with the GPa expression, the LHb expression was up regu- administration of Ovaprim in the female catfish Heteropneustes fossilis. Data were
expressed as log RQ mean ± SEM (n = 5) and analyzed by one way ANOVA
lated by the OVP injections from 6 h onwards (Fig. 5; P < 0.05). The
(P < 0.001), followed by Tukey’s test (P < 0.05). The initial control (IC) group was
transcript levels reached the peak, insignificantly different at 6 h taken as the calibrator. The groups with different letters are significantly different.

Fig. 1. Ovaprim-induced ovulation response at different times in the female catfish

Heteropneustes fossilis. The arcsine transformed values of the ovulation were
presented as mean ± SEM (n = 15). Data were analyzed by one way ANOVA
(P < 0.001), followed by Tukey’s test (P < 0.05). In the figure, the groups with
different letters are significantly different. Figures in the parentheses indicate the
number of fish that ovulated out of 15.
Fig. 4. Expression of pituitary FSHb mRNA levels at different intervals after the
administration of Ovaprim in the female catfish Heteropneustes fossilis. Data were
expressed as log RQ mean ± SEM (n = 5) and analyzed by one way ANOVA
(P < 0.001), followed by Tukey’s test (P < 0.05). The initial control (IC) group was
taken as the calibrator. The groups with different letters are significantly different.
70 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73

Fig. 5. Expression of pituitary LHb mRNA levels at different intervals after the
administration of Ovaprim in the female catfish Heteropneustes fossilis. Data were
expressed as log RQ mean ± SEM (n = 5) and analyzed by one way ANOVA
(P < 0.001), followed by Tukey’s test (P < 0.05). The initial control (IC) group was
taken as the calibrator. The groups with different letters are significantly different.
Fig. 7. Ovarian estradiol-17b (E2) levels after the administration of Ovaprim in the
female catfish Heteropneustes fossilis. The data were presented as mean ± SEM
(n = 5) and analyzed by one way ANOVA (P < 0.05), followed by Tukey’s test
(P < 0.05). The groups with different letters are significantly different.

and 12 h (2-folds) and declined subsequently at 18 h and 24 h.

The second OVP injection at 24 h further stimulated the levels,
which remained constant until 42 h and then further declined till
the end of the experiment at 48 h.

3.3. Effects of OVP on plasma and ovarian steroid levels

The injections of OVP produced overall significant effects on E2

(P < 0.001, one way ANOVA; FPlasma = 252.23, FOvary = 248.92). The
first dose of OVP produced a steady decrease in plasma E2 from
0 h to 24 h (Fig. 6; P < 0.05, Tukey’s test). The second injection of
OVP at 24 h arrested the continuous decrease in the steroid level
maintaining constant levels until 30 h after the first injection. A
further significant decrease occurred at 36 h after the first injection
maintaining low levels until the end of experiment at 48 h. The
ovarian E2 levels also showed a steady decrease from 0 h to 30 h Fig. 8. Plasma 17,20b-dihydroxy-4-pregnen-3-one (17,20b-DP) levels after the
and the second OVP injection at 24 h could not arrest the decrease administration of Ovaprim in the female catfish Heteropneustes fossilis. The data
unlike the plasma E2 (Fig. 7; P < 0.05). The ovarian E2 maintained were presented as mean ± SEM (n = 5) and analyzed by one way ANOVA (P < 0.05),
followed by Tukey’s test (P < 0.05). The groups with different letters are signifi-
cantly different.

Fig. 9. Ovarian 17,20b-dihydroxy-4-pregnen-3-one (17,20b-DP) levels after the

Fig. 6. Plasma estradiol-17b (E2) levels after the administration of Ovaprim in the administration of Ovaprim in the female catfish Heteropneustes fossilis. The data
female catfish Heteropneustes fossilis. The data were presented as mean ± SEM were presented as mean ± SEM (n = 5) and analyzed by one way ANOVA (P < 0.05),
(n = 5) and analyzed by one way ANOVA (P < 0.05), followed by Tukey’s test followed by Tukey’s test (P < 0.05). The groups with different letters are signifi-
(P < 0.05). The groups with different letters are significantly different. cantly different.
 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73
steady low levels till the end of the experiment at 48 h. Both
plasma and ovarian E2 did not show any significant change in the
control groups.
On the other hand, 17,20b-DP levels increased significantly after
the OVP injections (P < 0.001, one way ANOVA; FPlasma = 210.36
FOvary = 151.24). The plasma 17,20b-DP increased significantly at
6 h compared to the control groups and further increased at 12 h
maintaining steady levels till the end of the experiment at 48 h
(Fig. 8; P < 0.05). The second OVP injection had little effect on the
steroid levels. The ovarian 17,20b-DP increased steadily from 6 h
onwards, giving the peak mean value at 24 h. The levels were not
significantly different at 18 h, 24 h and 30 h (Fig. 9; P < 0.05). The
second OVP injection did not sustain the increase but the levels
decreased at 36 h and were maintained till the end of the experi-
ment. Both plasma and ovarian 17,20b-DP levels did not show
any significant change in the control groups.
4. Discussion
The administration of two doses of OVP (0.5 lL/g body weight
of fish) 24 h apart induced ovulation at multiple time points over
48 h in the catfish with 80% response at 12 h, and 100% at 24 h
onwards. The ovulation-inducing potential of OVP is similar to that
reported previously in this species and others (see Introduction).
However, only the eggs stripped at 12 h and 18 h of the OVP injec-
tion elicited a high rate of fertilization efficiency and the ability
decreased significantly after 24 h onwards. Though the second
OVP injection could induce 100% ovulation, the fertilization ability
was significantly compromised. This could be due to the deteriora-
tion in egg quality, as reported earlier (Haraldsson et al., 1993). In
white bass females, delaying the stripping of ovulated eggs for
more than 1 h after ovulation had significant negative effects on
fertilization (Mylonas et al., 1996). Working on the Japanese eel,
Anguilla japonica, Ohta et al. (1996) reported that the ovulated eggs
were over-ripe when retained in the ovarian lumen for an
extended period. Mishra and Joy (2004) reported in the catfish that
the fertilization rate and viability of eggs decreased with the time
of stripping (16 h, 18 h, 24 h), and the decrease was correlated with
a decline in glucose content and an increase in fructose level in the
ovulated eggs. In the present study, the administration of OVP
resulted in a high rate of ovulation after 6 h, 12 h and 18 h and
the retention of the eggs in the ovarian cavity beyond 18 h might
have led to over-ripping resulting in low fertilization rate. The low-
est fertilization rate was obtained for oocytes from the females that
were stripped at 48 h post injection. Hence, a single dose injection
of OVP with a latency of 12–18 h is highly desirable to obtain a
high rate of ovulation and fertilization in the catfish and spawning
trials beyond 24 h yield more unviable eggs.
The neuroendocrine mechanism leading to the induction of
FOM and ovulation is initiated by the preovulatory pituitary LH
surge caused by the GnRH analogue and DA2 receptor blocker
domperidone contained in the OVP formulation (Lin et al., 1986;
Peter et al., 1988). The effectiveness of the combination technology
has been demonstrated in the artificial breeding of several species
including carps and catfishes (De Leeuw et al., 1987; Dufour et al.,
2005; Goos et al., 1987; Yaron et al., 2003; Zohar et al., 2010). In
H. fossilis, the administration of a mammalian GnRH analogue
along with pimozide, a DA2 receptor antagonist, caused the pre-
ovulatory LH surge and a high rate of ovulation and fertilization
(Tharakan and Joy, 1996). However, the effect of OVP or similar for-
mulations on periovulatory behavior of FSH has not been studied.
In catfishes particular, the native FSH protein is not characterized
and detected (Chaube et al., 2015) and hence FSH protein measure-
ment has been a constraint. The assay of FSHb mRNA is an
alternative to monitor FSH dynamics. Our present results showed
71
that the spawning agent influenced both LHb and FSHb mRNA
expression but with marked differences in the temporal pattern
and turnover (fold changes) of the subunit gene expression. The
GPa and LHb mRNA expression showed a robust early up regula-
tion, eliciting almost a similar and parallel periovulatory behavior
in response to the OVP treatment, implicating a major role of LH in
FOM and ovulation. Both transcript levels responded sharply much
early (6 h) with about 2-folds increase to the first OVP dose,
making a very high pool of transcripts for LH synthesis. In catfishes,
the surge in plasma LH was recorded from 6 h to 12 h of the GnRH
analogue – DA2 receptor blocker administration and the level
decreased subsequently after ovulation (De Leeuw et al., 1987;
Goos et al., 1987; Tharakan and Joy, 1996), suggesting a high rate
of pituitary LH synthesis and release. Similarly, the transcript levels
declined at 18 h and 24 h, suggesting reduced transcriptional or
high translational activity, or both. The second OVP injection at
24 h could only transiently increase (a minor surge) the GPa level
after 6 h of the injection, which then decreased subsequently but
remained high till the end of the experiment with respect to the
controls. In the case of LHb mRNA, the second OVP injection
elevated the LH b mRNA levels for a longer time (till 18 h of the
second injection) and declined at the end of the experiment, like
Gpa. The high levels of GPa and LHb transcripts vis-a-vis LH may
be responsible for the extended ovulatory response till the end of
the experiment. In contrast, the FSHb expression responded much
later (12 h) after the first OVP injection, reached the peak expres-
sion (<1.5-folds increase) at 18 h which lasted for 36 h of the first
injection. The second OVP injection had little effect on the FSHb
levels compared to the 24 h level and declined further low at
42 h and 48 h. GPa is co-valently bound to b subunits of LH and
FSH (TSHb as well) and its temporal pattern is closely linked to
the dynamics of both LHb and FSHb. On a comparison of the tem-
poral response of ovulation with that of the LHb and FSHb mRNA
expression, it is evident that the ovulation process is initiated
and coincided with the temporal increases in LHb expression.
The LH surge induces the steroidogenic shift (see below) leading
to the synthesis of the MIS in the ovary to trigger the resumption
of follicular meiosis (Nagahama, 1997). On the other hand, the
temporal pattern of FSHb mRNA expression is not coinciding with
the ovulation response at least initially excluding a role of FSH in
early part of ovulation. The functional significance of the increased
FSHb expression after the completion of the LH-driven ovulation is
not clear. It is likely that FSH may be involved in the post-ovulatory
processes in the ovary such as recruitment of new cohorts of
follicles for the next cycle. In vitro bioassays using goldfish revealed
that common carp GtH I (FSH) and GtH II (LH) share the same
spectrum of biological activities causing stimulation of ovarian
and testicular steroidogenesis and induction of oocyte final matu-
ration (Van der Kraak et al., 1992). It is possible that the role of FSH
in FOM and ovulation may be dependent on the species under
investigation. More studies are required in this direction.
Concerning the mechanism of OVP up regulation of GtH
transcript levels, the role of GnRH and/ or DA may be considered.
Earlier studies have shown that salmon GnRH implants in the pitu-
itary of maturing sockeye salmon elevated the expression of LHb
subunit gene and accelerated final maturation (Kitahashi et al.,
1998). Sosnowski et al. (2000) reported that the activation of the
mRNA translation in gonadotropes is under the control of GnRH.
Apart from LH stimulation, GnRH may act as a stimulator of the
synthesis of fresh FSHb and GPa transcripts. In addition, the fall
in E2 levels during the periovulatory period (see below) may act
as a potent stimulus to increase the synthesis of fresh FSHb sub-
unit. In our study, the response of GPa and LHb mRNA expression
was higher than that of FSHb expression. Similar results were
obtained in male striped bass (Morone saxatilis) (Hassin et al.,
1998), goldfish (Klausen et al., 2001), carp (Kandel-Kfir et al.,
72 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73

2002) and tilapia (Yaron et al., 2003). The differential expression of

the subunit genes may imply differences in their control mecha-
nism. This may be responsible for a higher quantity of LH stored
in the pituitary than FSH (Aizen et al., 2007; Weltzien et al.,
2004). The differential responses are attributed to differences in
ion channel expression levels (excitability and Ca2+ influx) to GnRH
in the LH- and FSH-producing gonadotropes (Hodne et al., 2013).
The distinct control is facilitated by the anatomical features of
the gonadotropes and molecular architecture of the genes. Individ-
ual FSH cells exhibited a closer association with the vasculature
and GnRH terminals than the LH cell (Golan et al., 2015). Studies
in zebrafish have indicated that there exists a dual mode of
gonadotropic regulation by GnRH through distinct neuroglandular
and neurovascular relationships. The FSH cells have significantly
better access to GnRH signals than LH cells. GnRH signaling is
central to activating the FSH promoter (Chong et al., 2005).
In goldfish FSHb promoter, the conserved smad-and GnRH-
responsive steroidogenic factor 1 (Sf1) element has been identified
located adjacent to an estrogen-responsive site (Lau et al., 2012).
Apart from these, several other smad-binding sites and estrogen-
responsive elements (EREs) have been found on FSHb promoters
in tilapia and zebrafish (Golan et al., 2014). The teleost LHb gene
promoters contain putative response elements for Sf1 and pituitary
transcription factor 1 (Pitx1) but, unlike mammals, do not have an
early growth response factor 1 (Egr-1) response element. The Sf1
binding site on the Chinook salmon (cs) LHb promoter is functional
and vital for its basal action (Melamed et al., 2006). Pitx1 is also
instrumental in the basal activation of the gene (Melamed et al.,
2002). Although the ERE-like element is not necessary for the
estradiol receptor a (ERa) to trigger the csLHb gene transcription,
it is extremely important for the GnRH effect due to binding of
GnRH-regulated c-jun to this element. C-Jun plays a decisive part
in mediating the GnRH effect, acting together with Sf1 and Pitx1,
while interacting physically with both proteins (Melamed et al.,
2006). Apart from these, combinations of adjacent Sf1and ERE
boxes are also found on zebrafish and tilapia proximal LHb promot-
ers including androgen and glucocorticoid receptor-binding
elements (Golan et al., 2014). Though the architecture of the catfish
FSHb and LHb is not known, the differences in the expression
pattern of LHb and FSHb due to ovaprim might be due to a combi-
nation of all these factors.
The changes in the ovarian and plasma profiles of E2 and
17,20b-DP is indicative of a shift in ovarian steroidogenesis follow-
ing the OVP treatment: the E2 levels decreased over time with a
simultaneous increase in 17,20b-DP levels. In the catfish, 17,20b-
DP is the MIS which is induced by the injection of hCG (LH) with
a concomitant decrease in the E2 level (Mishra and Joy, 2006). In
the present study, the steroidogenic shift coincides with the
increase in LHb expression at 6 h and 12 h. Both plasma and
ovarian E2 levels decreased continually till 24 h. The second OVP
injection maintained the level in the plasma until 30 h but could
not arrest the decrease in the ovary. The differences may be due
to the fact that E2 is synthesized and released rapidly into the blood
where it is stored in a bound form. The decrease in E2 levels
may be due to the gonadotropin-induced hydroxylation of E2 to
2-hydroxyestradiol-17b in the ovary (Mishra and Joy, 2006).
Two-hydroxyestradiol-17b, in turn, stimulates MIS (17,20b-DP)
synthesis. The ovarian MIS level increased steadily to the peak at
24 h in response to the first OVP injection and then declined till
the end of the experiment. The second OVP injection could not
arrest the decline but sustained the increase compared to the con-
trol groups till the end of the experiment. In the plasma, the MIS
level was maintained constant from 24 h to 48 h, possibly due its
binding with blood proteins. The temporal pattern of FSHb expres-
sion is not related to the steroidogenic shift at least initially, which
is evident from Fig. 10 that depicts a summary of the temporal
Fig. 10. The temporal relationships of pituitary GPa, FSHb and LHb expression, and
plasma E2 and 17,20b-DP levels during the Ovaprim treatment in the female catfish
Heteropneustes fossilis.
relationships of the GtH subunit mRNA expression with plasma
changes in E2 and MIS levels. Whether the fall in E2 or the increase
in 17,20b-DP had resulted in feedback control of GtH subunit
expression was not examined in this study, and needs to be further
investigated.
In conclusion, the results clearly show that OVP stimulates pitu-
itary GtH subunit mRNA expression, implying synthesis and
release of new LH and FSH molecules during the hormone-
induced ovulation. However, the temporal patterns of the mRNA
expression vary for LH and FSH. The ovulatory response and
steroidogenic shift coincide with the LHb mRNA expression, sug-
gesting a direct involvement in these ovarian events. The relatively
late expression of FSHb mRNA expression suggests that FSH may
not be involved in FOM and ovulation but may be related to the
control of post-ovulatory processes in the ovary. The FSHb qPCR
assay is useful till a reliable FSH hormone assay is developed for
studying FSH physiology in catfishes.
Acknowledgments
The research work was supported by a grant of Department
of Science and Technology, New Delhi (grant No. SA/SO/
AS-43/2009) awarded to KPJ and RC. The first author is grateful
to the Council of Scientific and Industrial Research, New Delhi for
Junior and Senior Research Fellowships.
References
Acharjee, A., Chaube, R., Joy, K.P., 2015. Molecular cloning and characterization of
the gonadotropin subunits GPa, FSHb, and LHb genes in the stinging catfish
Heteropneustes fossilis: phylogeny, seasonal expression and pituitary
localization. J. Exp. Zool. Part A: Ecol. Genet. Physiol. 323, 567–585.
Aizen, J., Kasuto, H., Golan, M., Zakay, H., Levavi-Sivan, B., 2007. Expression
and characterization of biologically active recombinant tilapia FSH:
immunohistochemistry, stimulation by GnRH and effect on steroid secretion.
Biol. Reprod. 76, 692–700.
Chang, J.P., Peter, R.E., 1984. Effects of pimozide and des Gly10,[D-Ala6] lutenising
hormone-releasing hormone ethylamide on serum gonadotropin
concentrations, germinal vesicle migration and ovulation in female goldfish,
Carassius auratus. Gen. Comp. Endocrinol. 52, 30–37.
Chaube, R., Joy, K.P., Acharjee, A., 2015. Catfish gonadotrophins: cellular origin,
structural properties and physiology. J. Neuroendocrinol. 27, 536–543.
Chong, K.L., Koh, M., Melamed, P., Sherwood, N., 2005. Molecular regulation of
gonadotropin gene expression in teleosts. In: Melamed, P., Sherwood., N. (Eds.),
Hormones and Their Receptors in Fish Reproduction, World Scientific
Publishing, Singapore. pp. 76–104.
De Leeuw, R., Goos, H.J.Th., Van Oordt, P.G.W.J., 1987. The regulation of
gonadotropin release by neurohormones and gonadal steroids in the African
catfish, Clarias gariepinus. Aquaculture 63, 43–58.
 A. Acharjee et al. / General and Comparative Endocrinology 251 (2017) 66–73
Dufour, S., Weltzien, F.A., Sebert, M.E., Le Belle, N., Vidal, B., Vernier, P., Pasqualini,
C., 2005. Dopaminergic inhibition of reproduction in teleost fishes:
ecophysiological and evolutionary implications. Ann. N. Y. Acad. Sci. 1040, 9–21.
Golan, M., Biran, J., Levavi-Sivan, B., 2014. A novel model for development,
organization, and function of gonadotropes in fish pituitary. Front. Endocrinol.
5, 182. http://dx.doi.org/10.3389/fendo. 2014. 00182.
Golan, M., Zelinger, E., Zohar, Y., Levavi-Sivan, B., 2015. Architecture of GnRH-
gonadotrope-vasculature reveals a dual mode of gonadotropin regulation in
fish. Endocrinology 156, 4163–4173.
Goos, H.J.Th., Joy, K.P., de Leeuw, R., van Oordt, P.G.W.J., van Delft, A.L.M., Gielen, J.
Th., 1987. The effect of lutenizing hormone-releasing hormone analogue
(LHRHa) in combination with different drugs with anti-dopamine and anti-
serotonin properties on gonadotropin release and ovulation in the African
catfish, Clarias gariepinus. Aquaculture 63, 143–156.
Halder, S., Sen, S., Bhattacharya, S., Ray, A.K., Ghosh, A., Jhingran, A.G., 1991. Induced
spawning of Indian major carps and maturation of a perch and a catfish by
murrel gonadotropin releasing hormone, pimozide and calcium. Aquaculture
97, 373–382.
Haraldsson, H., Sveinsson, T., Skulason, S., 1993. Effects of LHRHa treatments upon
the timing of ovulation and upon egg and offspring quality in Arctic charr,
Salvelinus alpinus (L.). Aquat. Res. 24, 145–150.
Hassin, S., Gothilf, Y., Blaise, O., Zohar, Y., 1998. Gonadotropin-I and-II subunit gene
expression of male striped bass (Morone saxatilis) after gonadotropin-releasing
hormone analogue injection: quantitation using an optimized ribonuclease
protection assay. Biol. Reprod. 58, 1233–1240.
Hill, J.E., Kilgore, K.H., Pouder, D.B., 2009. Survey of ovaprim use as a spawning aid in
ornamental fishes in the United States as administered through the University
of Florida tropical aquaculture laboratory. North Am. J. Aquaculture 71, 206–
209.
Hodne, K., Strandabø, R.A., von Krogh, K., Nourizadeh-Lillabadi, R., Sand, O.,
Weltzien, F.A., Haug, T.M., 2013. Electrophysiological differences between
FSHb- and LHb-expressing gonadotropes in primary culture. Endocrinology 154,
3319–3330.
Kahkesh, F.B., Feshalami, M.Y., Amiri, F., Nickpey, M., 2010. Effect of ovaprim,
ovatide, HCG, LHRH-A2, LHRH-A2 + CPE and carp pituitary in benni (Barbus
sharpeyi) artificial breeding. Global Veterinaria 5, 209–214.
Kandel-Kfir, M., Gur, G., Melamed, P., Zilberstein, Y., Cohen, Y., Zmora, N., Kobayashi,
M., Elizur, A., Yaron, Z., 2002. Gonadotropin response to GnRH during sexual
ontogeny in the common carp, Cyprinus carpio. Comp. Biochem. Physiol. B:
Biochem. Mol. Biol. 132, 17–26.
Kitahashi, T., Alok, D., Ando, H., Kaeriyama, M., Zohar, Y., Ueda, H., Urano, A., 1998.
GnRH analog stimulates gonadotropin II gene expression in maturing sockeye
salmon. Zool. Sci. 15, 761–765.
Klausen, C., Chang, J.P., Habibi, H.R., 2001. The effect of gonadotropin-releasing
hormone on growth hormone and gonadotropin subunit gene expression in the
pituitary of goldfish, Carassius auratus. Comp. Biochem. Physiol. B: Biochem.
Mol. Biol. 129, 511–516.
Lau, M.T., Lin, S.W., Ge, W., 2012. Identification of Smad response elements in the
promoter of goldfish FSH beta gene and evidence for their mediation of activin
and GnRH stimulation of FSH beta expression. Front. Endocrinol. 3, 47. http://
dx.doi.org/10.3389/fendo.2012.00047.
Lin, H.R., Peng, C., Van Der Kraak, G., Peter, R.E., Breton, B., 1986. Effects of [D-Ala6,
Pro9-NEt]-LHRH and catecholaminergic drugs on gonadotropin secretion and
ovulation in the Chinese loach (Paramisgurnus dabryanus). Gen. Comp.
Endocrinol. 64, 389–395.
73
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2DDCt method. Methods 25, 402–408.
Manickam, P., Joy, K.P., 1989. Induction of maturation and ovulation by pimozide-
LHRH analogue treatment and resulting high quality egg production in the
Asian catfish, Clarias batrachus L. Aquaculture 83, 193–199.
Melamed, P., Koh, M., Preklathan, P., Bei, L., Hew, C., 2002. Multiple mechanisms for
Pitx-1 transactivation of a luteinizing hormone b subunit gene. J. Biol. Chem.
277, 26200–26207.
Melamed, P., Zhu, Y.H., Tan, S.H., Xie, M., Koh, M., 2006. Gonadotropin-releasing
hormone activation of c-jun, but not early growth response factor-1, stimulates
transcription of a luteinizing hormone b-subunit gene. Endocrinology 147,
3598–3605.
Mishra, A., Joy, K.P., 2004. Ovarian monosaccharides (glucose and fructose):
hormonal effects and their role in final oocyte maturation and egg quality in
catfish Heteropneustes fossilis. Bloch. Indian J. Exp. Biol. 42, 1084–1090.
Mishra, A., Joy, K.P., 2006. Effects of gonadotrophin in vivo and 2-hydroxyoestradiol-
17b in vitro on follicular steroid hormone profile associated with oocyte
maturation in the catfish Heteropneustes fossilis. J. Endocrinol. 189, 341–353.
Mylonas, C.C., Magnus, Y., Gissis, A., Klebanov, Y., Zohar, Y., 1996. Application of
controlled-release, GnRHa-delivery systems in commercial production of white
bass
striped bass hybrids (sunshine bass), using captive broodstocks.
Aquaculture 140, 265–280.
Nagahama, Y., 1997. 17a, 20b-Dihydroxy-4-pregnen-3-one, a maturation-inducing
hormone in fish oocytes: mechanisms of synthesis and action. Steroids 62, 190–
196.
Ohta, H., Kagawa, H., Tanaka, H., Okuzawa, K., Hirose, K., 1996. Changes in
fertilization and hatching rates with time after ovulation induced by 17,20b-
dihydroxy-4-pregnen-3-one in the Japanese eel, Anguilla japonica. Aquaculture
139, 291–301.
Peter, R.E., Yu, K.L., 1997. Neuroendocrine regulation of ovulation in fishes: Basic
and applied aspects. Rev. Fish Biol. Fish. 7, 173–197.
Peter, R.E., Lin, H.R., Van Der Kraak, G., 1988. Induced ovulation and spawning of
cultured fish in China: advances in application of GnRH analogues and
dopamine antagonists. Aquaculture 74, 1–10.
Sahoo, S.K., Giri, S.S., Chandra, S., Sahu, A.K., 2007. Effect of ovaprim doses and
latency periods on induced spawning of Clarias batrachus: observation on larval
deformity. Indian J. Exp. Biol. 45, 920–922.
Sosnowski, R., Mellon, P.L., Lawson, M.A., 2000. Activation of translation in pituitary
gonadotrope cells by gonadotropin-releasing hormone. Mol. Endocrinol. 14,
1811–1819.
Tharakan, B., Joy, K.P., 1996. Effect of mammalian gonadotropin - releasing hormone
analogue, pimozide, and the combination on plasma gonadotropin levels in
different seasons and induction of ovulation in female catfish. J. Fish Biol. 48,
623–632.
Van Der Kraak, G., Suzuki, K., Peter, R.E., Itoh, H., Kawauchi, H., 1992. Properties of
common carp gonadotropin I and gonadotropin II. Gen. Comp. Endocrinol. 85,
217–229.
Weltzien, F.A., Andersson, E., Andersen, O., Shalchian-Tabrizi, K., Norberg, B., 2004.
The brain–pituitary–gonad axis in male teleosts, with special emphasis on
flatfish (Pleuronectiformes). Comp. Biochem. Physiol. A Mol. Int. Physiol. 137,
447–477.
Yaron, Z., Gur, G., Melamed, P., Rosenfeld, H., Elizur, A., Levavi-Sivan, B., 2003.
Regulation of fish gonadotropins. Int. Rev. Cytol. 225, 131–185.
Zohar, Y., Muñoz-Cueto, J.A., Elizur, A., Kah, O., 2010. Neuroendocrinology of
reproduction in teleost fish. Gen. Comp. Endocrinol. 165, 438–455.