Received: 23 October 2018 | Revised: 17 April 2019 | Accepted: 14 May 2019

DOI: 10.1111/jai.13927

ORIGINAL ARTICLE

Tissue expression and bioinformatics analysis of the

vitellogenin gene of Asian arowana (Scleropages formosus)

Xianhui Pan1,2,3 | Yi Liu1 | Kangqi Zhou1,2,3 | Xidong Mu1 | Shuming Zheng3 |

Chao Liu1 | Yinchang Hu1

1
Key Laboratory of Recreational Fisheries,
Ministry of Agriculture, Guangdong Modern Abstract
Leisure Fisheries Engineering Technology The RACE technique was used to clone the full‐length vitellogenin (VTG) cDNA
Center, Pearl River Fisheries Research
Institute, CAFS, Guangzhou, China sequence of Asian arowana (Scleropages formosus). The full‐length sequence was
2
Guangxi Key Laboratory of Aquatic Genetic 5,550 bp with an open reading frame of 5,238 bp, encoding 1,745 amino acids, and
Breeding and Healthy Aquaculture, Guangxi
5′ and 3′ UTRs (untranslated regions) of 45 bp and 267 bp, respectively. Phylogenetic
Institute of Fisheries, Nanning, China
3
China Southwest University, Chongqing,
analysis showed that S. formosus and silver arowana (Osteoglossum bicirrhosum) share
China a close evolutionary relationship (bootstrap 100%). The quantitative real‐time PCR

Correspondence
results showed that vtg expression was significantly higher in liver and gonads of male
Yinchang Hu, Pearl River Fisheries Research and female fish compared with its expression in the other tissues tested (p < 0.01).
Institute, Chinese Academy of Fishery
Sciences, 1 Xingyu Road, Liwan District,
The relative expression levels of vtg in liver, gland, kidney, heart, head kidney, and
Guangzhou City, Guangdong Province, brain of female fish were significantly higher than in the corresponding tissues of
China.
Email: huyc22@163.com
male fish (p < 0.05).

Funding information KEYWORDS

Special Scientific Research Funds for cloning, Scleropages formosus, tissue expression, vitellogenin
Central Non‐profit Institutes, Chinese
Academy of Fishery Sciences, Grant/
Award Number: 2016HY-ZC0402; National
Aquatic Germplasm Resources Platform,
Grant/Award Number: 2018DKA30470;
Guangzhou Science and Technology
Plan Project, Grant/Award Number:
201707010309; Specialization for fishing
port construction and fishery industry
development, Grant/Award Number:
A201701A07

1 | I NTRO D U C TI O N
Asian arowana (Scleropages formosus) belongings to
Osteoglossidae, genus Scleropages (also known as Osteoglossum).
S. formosus originated in lakes and rivers in Malaysia, Indonesia,
and Sumatra, and are one of the seven existing species in family
Osteoglossidae (Alex, 2014). It is an extremely valuable tropical or‐
namental fish in Asia, and is one of the Convention on International
Trade in Endangered Species of Wild Fauna and Flora (CITES) pro‐
tected ornamental fish varieties. Due to the long period required
to reach sexual maturity (3–6 years), male and female biological
characteristics are not obvious, and field sampling has been limited.
Further, because they are not easy to rear, few studies of S. formo-
sus have been reported. At present, research on S. formosus has fo‐
family cused mainly on interspecific genetic variations, evolutionary status,
and karyotype (Austin, Tan, Croft, Hammer, & Gan, 2015; Bian et
al., 2016; Mohdshamsudin et al., 2011; Mu et al., 2012; Rahman,
Zakariaismail, Tang, & Muniandy, 2008; Tian, Mu, Wang, Gu, & Hu,
2013). So far, a method to effectively identify the sex of S. formosus
has not been discovered.
Vitellogenin (VTG) is a precursor of the yolk protein. It is a
high molecular weight lipoprotein phosphate that is species spe‐
cific (Utarabhand & Bunlipatanon, 1996). VTG is not only the main
nutrient source necessary for embryonic and larval development,

970 | © 2019 Blackwell Verlag GmbH wileyonlinelibrary.com/journal/jai J Appl Ichthyol. 2019;35:970–977.

PAN et al. | 971

TA B L E 1 Synthetic primers in experiments 2 | M ATE R I A L S A N D M E TH O DS

Primer code Primer sequence (5′–3′)
2.1 | Experimental materials and cDNA synthesis
J‐vtg‐F5 GTTGTTCTTGCACTGACTTTGGCCC
J‐vtg‐R5 CCCTTGGCAAAATAGTGGCAGCATC We obtained six healthy S. formosus, three female (weight 2,300–
2,500 g, body length 52–57 cm) and three male (weight 1,800–
J‐vtg‐F6 TCAACGATGCTGCCACTATTTTGCC
2,000 g, body length 52–55 cm), from the Pearl River Fisheries
J‐vtg‐R6 ATCTTGGCCATGACTTTGTGCATGC
Research Institute ornamental fish base. The fish were cultured in
J‐vtg‐F12 CAATACTGATAAGGGCAATCGTGG
the laboratory under the following conditions: general hardness of
J‐vtg‐R12 CACTGGCATCACGACAACTTTCA
the water 1–8 dGH, pH 5.5–7, dissolved oxygen >5 mg/L, salinity
J‐vtg‐F14 CTATGAAGGTCCTCGGAAATGC
0%–0.5%, and temperature 26–32℃.
J‐vtg‐R14 GCCTGTAACTGAATGTCGGTGT We harvested the following tissue samples from the six S. for-
J‐vtg‐3’n GAGGATTGAAGTGGAAGACTGGAT mosus: gonads, gill, liver, spleen, kidney, muscle, heart, head kidney,
J‐vtg‐3’w GACTGGAGTGCTGATGACAACG and brain. Total RNA was extracted from the tissue samples using an
J‐vtg‐5’n GATCCAGCCTCCTGCAACTCATAT EZNA™ Tissue RNA kit (OMEGA, Guangzhou, China). The total RNA
J‐vtg‐5’w CTGGGCCTCAACAAACGTCAT concentration and integrity were determined using a multimode mi‐
J‐vtg‐RT‐F ATGTGAAGCCTGTTTCCGATGA croplate reader (Bio Tek Synergy™ NEO HTS, Vermont, USA) and gel
J‐vtg‐RT‐R CTTGAGGAACTGCGATTCTGAC electrophoresis, respectively. Then, 1.2 μl total RNA was used to syn‐

J‐GAPDH‐RT‐F CAGGAGCGCAGTATGTGGTG
thesize the first‐strand cDNA using a PrimeScript RT reagent kit with
gDNA Eraser (Takara, Beijing, China).
J‐GAPDH‐RT‐R ATGGTCATGCTGGAAGGGTC
J‐vtg‐orf‐F ATGAAGGCAGTTGTTCTTGCAC
J‐vtg‐orf‐R CTAAGCACAGTTTTCCGTACATCTA
2.2 | cDNA characterization,
UPM CTAATACGACTCACTATAGGGCAAGCAGT cloning, and sequencing
GGTATCAACGCAGAGT
NUP CTAATACGACTCACTATAGGGC The vtg transcriptome sequence of S. formosus was identified by align‐
ing the obtained cDNA sequences with the complete coding vtg se‐
Abbreviations: NUP, universal primer short; UPM, universal primer A
mix. quence of O. bicirrhosum (GenBank: MF075285). Primers J‐vtg‐F5/
R5, J‐vtg‐F6/R6, J‐vtg‐F12/R12, and J‐vtg‐F14/R14 (Table 1) were
designed using the conserved domains of vtg. PCRs were performed in
but also has the function of transporting lipids and is involved
buffer (25 µl total volume) containing 18.9 µl ddH2o, 5 µl 10 × Buffer,
in phagocytosis (Idler & Campbell, 1980; Turner, Dickhoff, &
4 µl of 2.5 mmol/L dNTPs, 0.8 µl of 10 μmol/L of each of the prim‐
Gorbman, 1981). VTG was originally found in the plasma of mature
ers, 1.2 µl cDNA, and 0.4 µl rTaq. The PCR reaction conditions were
oviparous females, and initially was considered to be a sex‐specific
as follows: pre‐denaturation at 95°C for 4 min, followed by 30 cycles
vitellin precursor that existed only in female animals. The feasi‐
of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, exten‐
bility of using the difference in VTG content between male and
sion at 72°C for 90 s, with a final extension at 72°C for 10 min. The
female fish to identify the sex of fish has been studied. Ceapa,
PCR products were purified using a TIANgel Midi Purification Kit
Williot, Menn, and Davail‐Cuisset (2002). found that the VTG
(Tiangen), connected to the pMD19‐T vector (TaKaRa), transformed
content in female stellate sturgeon (Acipenser stellatus Pallas) was
into Escherichia coli DH5α competent cells, and then sequenced by the
significantly higher than in the male fish, and the VTG content
Aiji Biotechnology Company (Guangzhou, China).
in female fish was positively correlated with the gonadal index.
The resultant sequences were spliced using Vector NTI (Zhou
Pottinger, Pulman, Carrick, and Scott (2005) found that in the
et al., 2018) to obtain the core fragment of S. formosus vtg. For
December breeding season, the error rate for identifying the sex
amplification, primers were designed for the 3′ and 5′ ends of
of Atlantic salmon (Salmo salar) and sea trout (Salmo trutta) by mea‐
the fragment, namely J‐vtg‐3′w/UPM, J‐vtg‐3′n/NUP, J‐vtg‐5′w/
suring the concentration of VTG was only 1%–8%. Kohn, Lokman,
UPM, and J‐vtg‐5′n/NUP (Table 1). First strand cDNA for 3′‐ or
Kilimnik, and Symonds (2013) identified the sex of captive hapuku
5′‐RACE (rapid amplification of cDNA ends) was synthesized using
(Polyprion oxygeneios) with an accuracy of 92% by detecting the
SMARTer Race 5′/3′ Kit Components (TaKaRa) with liver RNA as
amount of VTG. No study on the vtg gene of S. formosus has been
the template.
reported so far. In this study, the structure and expression pattern
of vtg in S. formosus were investigated, and differences in the ex‐
pression of vtg mRNA in male and female fish were also explored.
2.3 | Bioinformatics analysis of the predicted
The aim is to provide basic data for VTG to help to establish an
VTG protein
effective, accurate, and rapid method for identifying the sex of
S. formosus, which will contribute to the development of artificial The open reading frame (ORF) finder (www.ncbi.nlm.nih.gov/orffi​
breeding techniques for S. formosus. nder/) was used to predict the ORF of the complete vtg nucleic
972 | PAN et al.
acid sequence. The physical and chemical properties of the trans‐
lated protein sequence were obtained using ProtParam (http://web.
expasy.org/protp​aram/). SignalP (www.cbs.dtu.dk/servi​ces/SignalP)
was used to predict a signal peptide and TMHMM (www.cbs.dtu.dk/
servi​ces/TMHMM-2.0/) was used to predict transmembrane regions.
Hydrophobicity was determined using ProtScale (http://web.expasy.
org/prots​cale/). Phosphorylation sites and glycosylation sites were
predicted using the NetPhos 2.0 (www.cbs.dtu.dk/servi​ces/NetPh​os-
2.0/) and NetNGlyc 1.0 (www.cbs.dtu.dk/servi​ces/NetNG​lyc/) serv‐
ers. The Conserved Domain Database (CDD) (www.ncbi.nlm.nih.gov/
cdd) was used to predict structural domains. PredictProtein (www.
predi​ctpro​tein.org/) and SWISS‐MODEL (https​://swiss​model.expasy.
org/) were used to predict the secondary and three‐dimensional
(3D) structures of the protein. ClustalX v1.83 (Wang et al., 2016) and
Clustal Omega (www.ebi.ac.uk/Tools/​msa/Clust​alo/) were used for
multiple sequence alignment of related amino acid sequences. A phy‐
logenetic tree was constructed using MEGA 5.2 (Zhou et al., 2018).
2.4 | Qualitative analysis of vtg expression
A primer pair, J‐vtg‐RT‐F and J‐vtg‐RT‐R (Table 1), was designed for
the S. formosus vtg gene for quantitative real‐time (qRT‐PCR). The
S. formosus GAPDH gene was used as an internal reference, and a
primer pair (J‐GAPDH‐RT‐F and J‐GAPDH‐RT‐R, Table 1) was de‐
signed based on the conserved regions of the GAPDH sequences
from the S. formosus transcriptome. The qRT‐PCR products were
extracted on gels and ligated into the pMD19‐T vector (TaRaKa),
then transformed into E. coli DH5α competent cells. After sequenc‐
ing and sequence alignment, the positive clones were expanded and
extracted with a TIANprep Mini Plasmid Kit (Tiangen).
The qRT‐PCRs were carried out in 20 µl reaction volumes containing
10 µl SYBR Green Master Mix (TaRaKa), 1 µl cDNA, 0.5 µl of each of
the primers, and 8 µl of ddH2O. The PCR reaction conditions were as
follows: preheating at 95°C for 2 min, denaturation for 5 min at 95°C, fol‐
lowed by 40 cycles of 95°C for 15 s, 55°C for 30 s, and 72°C for 30 s, and
finally 95°C for 15 s, 60°C for 2 min, and 95°C for 15 s. Each sample was
repeated three times. QuantStudio™ Real‐Time PCR software v1.2 was
used to calculate the number of copies of the gene of interest and the
reference gene amplification for each sample (quantity, Qty), where Qty
is the relative quantity ratio of the target gene value (Wang et al., 2016).
Single‐factor one‐way analysis of variance (ANOVA) using the SPSS 20
software (Liu et al., 2011) and Duncan's multiple comparison test were
used to determine significant differences (p < 0.05) using Excel mapping.
3 | R E S U LT S
3.1 | Bioinformatics analysis of the vtg and
translated VTG sequences
The full‐length vtg cDNA sequence is 5,550 bp long (GenBank:
MF198438), with a 5′ untranslated region (UTR) of 45 bp and a 3′
UTR of 267 bp. The predicted ORF was from nucleotide 45 to 5,283
and encoded a 1,745 amino acid sequence (Figure 1). The 3′ end has
the typical AATAAA motif and poly (A) tail. The molecular weight of
the encoded VTG protein was about 190,35 kD and the theoreti‐
cal isoelectric point was 9.52. The grand average of hydropathicity
(GRAVY) was −0.202, which indicates the S. formosus VTG may be
hydrophilic.
The CDD analysis predicted the translated VTG amino acid se‐
quence contained a lipoprotein N‐terminal region (vitellogenin‐N
region) at positions 24–592 and a Von Willebrand factor type D
domain (VWD region) at positions 1469–1633. The vitellogenin‐N
domain contains two structures of the lipovitellin (LV1n) chain. The
sequence also contains two unknown functional domains (DUFs)
that are composed of multiple β‐sheets, DUF1943 at positions 626–
901 and DUF1944 at positions 1282–1447 (Figure 1). The S. formo-
sus VTG amino acid sequence was aligned with VTG sequences from
conger eel (Conger myriaster, GeneBank BAD93275) and Japanese
eel (Anguilla japonica, GeneBank AAV48826), which revealed the S.
formosus sequence contained a lipovitellin heavy chain (positions
16–1098), an internal phosvitin chain (positions 1099–1305), a lipo‐
vitellin light chain (positions 1306–1480), a β′‐component (positions
1481–1745), and a C‐terminal coding region (positions 1481–1745).
A polyserine region was present in the phosvitin domain (Figure 1).
The VTG amino acid sequence contained a total of 159 potential
phosphorylation sites, namely 130 serine, 18 threonine, and 11 ty‐
rosine residues. In addition, two glycosylation sites were predicted
at positions 967 and 1,109 (Figure 1). The VTG sequence had a signal
peptide of 15 amino acids at the N‐terminal end, indicating it may be
a secreted protein (Figure 1).
The secondary structure prediction results indicate that the
VTG sequence was 18.97% β‐sheet, 20% α‐helix, and 61.03% irreg‐
ular curl. The α‐helices were mainly in the vitellogenin‐N domain,
whereas the β‐sheets were distributed mainly in the DUF1943,
DUF1944, and VWD regions. No transmembrane region or disulfide
bond were detected in the sequence. SWISS‐MODEL identified the
molecular structure of silver lamprey (Ichthyomyzon unicuspis) lipo‐
vitellin (PDB ID: 1LSH 1.A) as the template for homology modelling
of the S. formosus VTG because they shared 37.06% sequence simi‐
larity, the highest among the available structures. The predicted 3D
model of S. formosus VTG (Figure 2) contained β‐sheets, α‐helices,
and irregular curls in regions similar to those predicted for the sec‐
ondary structure.
3.2 | Homology alignment and phylogenetic
analysis of VTG sequences
The deduced VTG amino acid sequence of S. formosus was aligned
with other teleost VTG sequences. It shared the highest se‐
quence similarity (82.24%) with the O. bicirrhosum sequence, and
63.52%–63.85%, 29.53%–56.35%, 32.10%, 29.04%–50.61%, and
30.41%–56.35% similarity with VTG sequences of Anguilliformes,
Cypriniformes, Salmoniformes, Cyprinodontiformes, and
Percomorpha, respectively.
Phylogenetic analysis of the S. formosus VTG sequence and the
VTG sequences of 38 related species collected from GeneBank was
PAN et al. | 973

F I G U R E 1 Schematic illustration of Scleropages formosus lipovitellin (vtg) cDNA (top) and encoded amino acid sequence (below). The
Conserved Domain Database analysis detected four conserved domains in the translated VTG sequence: a lipoprotein N‐terminal domain
(vitellogenin‐N), two unknown function domains (DUF1943 and DUF1944), and a von Willebrand factor type D domain (VWD). Comparison
with other teleost VTG sequences revealed the deduced VTG sequence of S. formosus contained five intact domains: lipovitellin heavy
(LvH), phosvitin (Pv), lipovitellin light (LvL), β′‐component (β′‐C), and C‐terminal coding region (C‐t). Square arrows represent two potential
glycosylation sites. The dotted box shows the polyserine region in Pv with potential serine phosphorylation sites underlined. UTR,
untranslated region; ORF, open reading frame; Sp, signal peptide

conducted using the neighbor‐joining (NJ) method in MEGA 5.2 Relative expression levels in the female gonad, kidney, heart, kid‐
(Figure 3). The results show that four forms of VTG, VtgAa, VtgAb, ney, brain tissues were significantly higher than in the correspond‐
VtgAe, and VtgAo, grouped together, the exception was the VtgC ing male tissues (p < 0.05), whereas the relative levels in the male
form, which formed a separate clade. The nomenclature and linear
domains of the teleost VTGs (VtgAa, VtgAb, VtgAe, VtgAo, and
VtgC) are according to Finn and Kristoffersen (2007), and Reading
et al. (2009). Furthermore, S. formosus and O. bicirrhosum are grouped
together (bootstrap 100%), which suggesting that they had a close
evolutionary relationship. This result is consistent with that of the
traditional classification method, which showed they both belonged
to order Osteoglossiformes. S. formosus VTG also was closely related
to the VTGs of C. myriaster and A. japonica (bootstrap 97%), but
distant to the VTGs of Cypriniformes, Cyprinodontiformes, and
Percomorpha (Figure 3).

3.3 | Expression of vtg in different tissues and

sexes of S. formosus
The relative expression levels of vtg mRNA in eight S. formosus
tissues were determined by qRT‐PCR. The results showed that
vtg was expressed in all eight tissues tested, and was highest in
male and female liver, followed by ovary and testis (Figure 4).
The relative expression of vtg mRNA in male and female liver was
significantly higher than in the gills, spleen, kidney, heart, head
kidney, and brain (p < 0.01), and the relative expression level in F I G U R E 2 Predicted 3D structure of vitellogenin from
female liver was significantly higher than in male liver (p < 0.01). S. formosus. S, β‐sheet; H, α‐helix; L, irregular curl
974 | PAN et al.

F I G U R E 3 Phylogenetic analysis of the VTG amino acid sequences from S. formosus and 38 related species. The tree was constructed
based on a ClustalX multiple alignment of VTG amino acid sequences using the neighbor‐joining method in MEGA 5.2. The numbers on the
nodes are the bootstrap confidence values based on 1,000 replicates. Nomenclature of the teleost VTGs (VtgAa, VtgAb, VtgAe, VtgAo,
and VtgC) is according to Finn and Kristoffersen (2007). The fish symbol indicates the S. formosus sequence; □ indicates VtgAo2; ○ indicates
VtgAo1. Schematic illustration of the linear domains of the different forms of VTG are deduced from the coding gene to the right (Reading et
al., 2009). VtgAa, VtgAb, VtgAe, and VtgAo2 are complete forms containing the five major VTG domains: lipovitellin heavy (LvH), phosvitin
(Pv), lipovitellin light (LvL), β′‐component (β′‐C), and C‐terminal coding region (C‐t). The sizes of the Pv domains in VtgAe and VtgAo2 are
different from those in VtgAa and VtgAb. VtgAo1 and VtgC are both incomplete; in VtgAo1 the C‐t region is missing, and VtgC has no Pv
and C‐t regions

and female gill and spleen tissues were not significantly different
(p > 0.05).
4 | D I S CU S S I O N
4.1 | Sequence analysis of vtg of S. formosus
The translated VTG sequence of S. formosus obtained in this study
shared 29.04%–82.24% similarity with the VTG sequences of 38
fish species in GenBank. The predicted protein sequence contains
all the conserved domains of the VTG family (Figure 1), indicating
the full‐length vtg cDNA sequence of S. formosus belongs to the
vitellogenin gene family. The encoded protein sequence contained
a conserved vitellogenin‐N domain, consistent with the results of
Brown, Carne, and Chambers (1997) who found that the N‐termi‐
nal sequence of vitellogenin was highly conserved among chordates.
Further, the sequence analysis showed that the vitellogenin‐N do‐
main was an area of lipoprotein, which contains two structures of
the LV1n chain. The domain also contain egg yolk, triglyceride trans‐
porters, and apolipoprotein b‐100, all of which are involved in lipid
transport. This is consistent with the findings of Babin, Bogerd,
Kooiman, Marrewijk, and Horst (1999) who suggested VTG belongs
PAN et al.
F I G U R E 4 Relative expression levels
of vtg in eight tissues of S formosus.
Different capital and lowercase letters
indicate significant differences in the
female and male tissues, respectively.
**p < 0.01; *p < 0.05
to an ancient superfamily of lipid transport proteins. Studies of vtg
genes in oriental weatherfish (Misgurnus anguillicaudatus) and green
swordtail (Xiphophorus hellerii) found they encoded a similar lipovi‐
tellin (Lv) structure (Liu et al., 2010; Wu, Xi, Ping, & Zheng, 2014),
2+
which can bind lipids and vitamins, and transport metal ions (Cu ,
Zn2+, Fe2+, and Fe3+). Therefore, the VTG of S. formosus is presumed
to encode a lipid transport protein that plays an important role in the
energy and nutrient supply of fish.
In addition, the encoded protein contains a VWD domain in the
C‐terminal region. Pauling, Corey, and Branson (1951) showed that
this region was rich in cysteine residues that formed disulfide bonds,
which affected the oligomer polymerization process, and was an im‐
portant region not only for the presence of the Von Willebrand factor
and hemagglutinating factor VIII, but also necessary for normal po‐
lymerization. In rosy barb (Puntius conchonius) and Branchiostoma, the
VWD domain of VTG was found to be involved in the clotting of red
blood cells, indicating S. formosus VTG may play an important role in
blood agglutination (Shi, 2004; Zhang, Sun, Pang, & Shi, 2005). The
deduced VTG sequence of S. formosus also contained two unknown
functional domains (DUFs), both of which contained β‐sheets that may
help to stabilize the protein structure. Polyclonal antibodies prepared
using zebrafish (Daniorerio) vtg revealed that VTG had an inhibitory
effect on E. coli and Staphylococcus aureus (Li, 2009). A similar function
for VTG has been reported in Florida lancelet (Branchiostoma floridae)
and P. conchonius (Shi, 2004; Zhang et al., 2005). Therefore, we con‐
sider the two DUFs in S. formosus VTG may be related to the immune
function of fish, although this needs further verification.
A complete vtg gene encodes a protein with five major domains
in the following order: N‐terminal lipovitellin heavy (LvH), phosvitin
(Pv), lipovitellin light (LvL), β′‐component (β′‐C), and C‐terminal coding
region (C‐t) (Babin, Carnevali, Lubzens, & Schneider, 2007; Hiramatsu,
Cheek, Sullivan, Matsubara, & Hara, 2005; Hiramatsu, Matsubara,
Fujita, Sullivan, & Hara, 2006). In advanced teleosts, complete VTG
proteins have been classified as VtgAa or VtgAb according to their
structure and function (Finn & Kristoffersen, 2007). Wang, Yan, Tan,
| 975
and Gong (2000) found that D. rerio vtg3 did not code a Pv domain,
and the resultant protein was named Pv‐less VTG or VtgC. The VtgAa,
VtgAb, VtgC forms were found in red sea bream (Pagrus major), west‐
ern mosquitofish (Gambusia affinis), and white perch (Morone ameri-
cana). Reading et al. (2009) found three other VTGs (VtgAe, VtgAo1,
and VtgAo2) by homology with VTGs from cyprinids, salmonids, and
aguillids. VtgAe and VtgAo2 contain all five domains, but the number
of amino acids in their Pv domain is different from that in the Pv do‐
main of VtgAa and VtgAb. VtgAo1 does not contain the β′‐C and C‐t
domains (Figure 3). By comparison with other teleost VTGs, we found
that the S. formosus VTG contained the five complete major domains.
The polyserine region in the Pv domain of S. formosus VTG had more
amino acids than the polyserine regions of other fish, except for anguil‐
lids. The polyserine region is produced by continuous amplification of
amino acid codons, and it has evolved faster than most genes, so there
are large differences in the number of amino acids in this region of
fish VTGs (Chen & Tang, 2001). The VTGs have a highly divergent ser‐
ine‐rich region with a fast evolution rate as well as a highly conserved
sequence structure; therefore, the vtg coding sequence shows a large
degree of divergence between species, and also shows good resolu‐
tion between the advanced classification orders. So vtg can be used
as a molecular marker for phylogenetic studies of species with a close
evolutionary relationship as well as distant species (Liu et al., 2010).
Phylogenetic analysis of VTG sequences showed that S. formosus and
O. bicirrhosum were closely related, which is consistent with the tradi‐
tional classification that they belong to order Osteoglossiformes. The
S. formosus VTG clustered with VtgAe sequences; however, to fully
categorize S. formosus VTG, further studies at the protein level are re‐
quired. The VtgC proteins formed a separate cluster, suggesting they
are distantly related to the other VTG forms. VtgC proteins are con‐
sidered as primitive VTG proteins that probably were encoded by the
original vtg gene, so the VtgC form may exist in all fish (Hiramatsu et
al., 2006; Matsubara et al., 2003; Wang et al., 2000). Furthermore, the
VtgC encoding gene may a derived gene rather than an ancestral gene,
because the vtgC gene of evolved teleost species (Acanthopterygii)
976 | PAN et al.
appeared to be an orthologue of a complete form of the vtgI gene in
chicken (Babin, 2008). The evolutionary process tends to proceed from
simple to complex, so the evolution of a gene also will tend to proceed
from simple to complex. The domain composition of VtgC proteins is
much simpler than that of the other VTGs, so we assumed that the
vtgC gene may be a primitive gene from which the other vtg genes
evolved. This conjecture needs to be confirmed by further research.
4.2 | Expression of vtg in eight tissues of S. formosus
VTG biosynthesis can be endogenous or exogenous. In most fishes,
it is exogenous; that is, it is synthesized in the ovary, or in other or‐
gans and transported through the blood circulation to the ovary.
VTG is absorbed by oocytes to provide nutrition for embryonic de‐
velopment. Currently, liver is considered to be the main organ of fish
for VTG synthesis. In this study, vtg expression detected by qRT‐PCR
was highest in liver tissue of male and female S. formosus, followed by
ovary and testis, with micro‐expression in gill, spleen, kidney, heart,
head kidney, and brain. These results indicate that, in S. formosus,
VTG synthesis may be exogenous and liver is the main synthesis site.
This result is similar to the findings in X. hellerii, yellowstripe goby
(Mugilogobius chulae), Japanese medaka (Oryziaslatipes), and D. rerio
(Liu et al., 2011; Tong et al., 2004; Yu et al., 2016). A large number
of studies on the vtg gene have shown that both male and juvenile
fish contained the gene but it was expressed only in female fish.
However, we found that the vtg gene was expressed in the testis
of male S. formosus; the reason for this is unclear. A previous study
from our laboratory detected vtg expression in the testis of male
O. bicirrhosum, and found that its expression was highest in testis de‐
velopment at stage III (Pan et al., 2018). Unuma, Suzuki, Kurokawa,
Yamamoto, and Akiyama (1998) found that vtg was expressed in
the gonads of the male and female sea urchin (Pseudocentrotus de-
pressus) and its expression decreased gradually in testis as the male
matured. They speculated that the encoded VTG may provide nutri‐
ents for sperm development. Akasaka, Harada, and Sawada (2010),
Akasaka, Kato, Kitajima, and Sawada (2013) found that in the VTG
of Halocynthia roretzi, the C‐terminal VWD and Ct domains may be
located on the yolk quilt and can bind two enzymes (proacrosin and
spermosin) in the sperm to participate in the sperm fertilization pro‐
cess. The role of vtg expression detected in the testis of S. formosus
needs further study.
In conclusion, we cloned S. formosus VTG cDNA and analyzed its
gene expression differences in male and female individuals, which
indicate that VTG provides a theoretical basis for gender identifica‐
tion of S. formosus. On this basis, we will further explore its function
and role in ovarian development from the protein level by artificially
synthesizing VTG fusion protein.
AC K N OW L E D G E M E N T S
This research was a part of the project funded by the Special Scientific
Research Funds for Central Non‐profit Institutes, Chine​se Acade​
my of Fishe​r y Sciences (2016HY‐ZC0402); the Guangzhou Science
and Technology Plan Project (201707010309); the Specialization
for Fishing Port Construction and Fishery Industry Development
(A201701A07); and the National Aquatic Germplasm Resources
Platform (2018DKA30470).
C O N FL I C T O F I N T E R E S T
The authors do not have any conflicts of interest to declare.
ORCID
Xianhui Pan https://orcid.org/0000-0002-8281-0327
Xidong Mu https://orcid.org/0000-0002-0259-8873
Yinchang Hu https://orcid.org/0000-0002-5735-8949
REFERENCES
Akasaka, M., Harada, Y., & Sawada, H. (2010). Vitellogenin C‐terminal
fragments participate in fertilization as egg‐coat binding partners
of sperm trypsin‐like proteases in the ascidian Halocynthia roretzi.
Biochemical & Biophysical Research Communications, 392, 479–484.
https​://doi.org/10.1016/j.bbrc.2010.01.006
Akasaka, M., Kato, K. H., Kitajima, K., & Sawada, H. (2013). Identification
of novel isoforms of vitellogenin expressed in ascidian eggs. Journal
of Experimental Zoology Part B: Molecular & Developmental Evolution,
320, 118–128. https​://doi.org/10.1002/jez.b.22488​
Alex. (2014). Biological classification of Osteoglossidea. Aquarium, 47–49.
Austin, C. M., Tan, M. H., Croft, L. J., Hammer, M. P., & Gan, H. M. (2015).
Whole genome sequencing of the asian arowana (Scleropages formo-
sus) provides insights into the evolution of ray‐finned fishes. Genome
Biology & Evolution, 7, 2885–2895. https​ ://doi.org/10.1093/gbe/
evv186
Babin, P. J. (2008). Conservation of a vitellogenin gene cluster in oviparous
vertebrates and identification of its traces in the platypus genome.
Gene, 413, 76–82. https​://doi.org/10.1016/j.gene.2008.02.001
Babin, P. J., Bogerd, J., Kooiman, F. P., Marrewijk, W. J. A. V., & Horst,
D. J. V. D. (1999). Apolipophorin II/I, apolipoprotein B, vitellogenin,
and microsomal triglyceride transfer protein genes are derived from
a common ancestor. Journal of Molecular Evolution, 49, 150. https​://
doi.org/10.1007/PL000​06528​
Babin, P. J., Carnevali, O., Lubzens, E., & Schneider, W. J. (2007). Molecular
aspects of oocyte vitellogenesis in fish. In P. J. Babin, J. Cerdà, & E.
Lubzens (Eds.), The fish oocyte: From basic studies to biotechnological
applications (pp. 39–76). New York, NY: Springer.
Bian, C., Hu, Y., Ravi, V., Kuznetsova, I. S., Shen, X., Mu, X., … Shi, Q.
(2016). The Asian arowana (Scleropages formosus) genome pro‐
vides new insights into the evolution of an early lineage of teleosts.
Scientific Reports, 6. https​://doi.org/10.1038/srep2​4501
Brown, M. A., Carne, A., & Chambers, G. K. (1997). Purification, partial
characterization and peptide sequences of vitellogenin from a rep‐
tile, the tuatara (Sphenodon punctatus). Comparative Biochemistry &
Physiology Part B: Biochemistry & Molecular Biology, 117, 159–168.
https​://doi.org/10.1016/S0305-0491(96)00317-3
Ceapa, C., Williot, P., Menn, F. L., & Davail‐Cuisset, B. (2002). Plasma
sex steroids and vitellogenin levels in stellate sturgeon (Acipenser
stellatus Pallas) during spawning migration in the Danube
River. Journal of Applied Ichthyology, 18, 391–396. https​ ://doi.
org/10.1046/j.1439-0426.2002.00370.x
Chen, J. A., & Tang, Z. H. (2001). Insect Molecular Science [M]. Beijing,
Science Press, 45–55.
PAN et al.
Finn, R. N., & Kristoffersen, B. A. (2007). Vertebrate vitellogenin gene
duplication in relation to the “3R hypothesis”: Correlation to the pe‐
lagic egg and the oceanic radiation of teleosts. PLoS ONE, 2(1), e169.
https​://doi.org/10.1371/journ​al.pone.0000169
Hiramatsu, N., Cheek, A. O., Sullivan, C. V., Matsubara, T., & Hara, A.
(2005). Vitellogenesis and endocrine disruption. In T. P. Mommsen,
& T. W. Moon (Eds.), Biochemistry and molecular biology of fishes:
Environmental toxicology (Vol. 6, pp. 431–471). Amsterdam: Elsevier.
Hiramatsu, N., Matsubara, T., Fujita, T., Sullivan, C. V., & Hara, A. (2006).
Multiple piscine vitellogenins: Biomarkers of fish exposure to estro‐
genic endocrine disruptors in aquatic environments. Marine Biology,
149, 35–47.
Idler, D. R., & Campbell, C. M. (1980). Gonadotropin stimulation of es‐
trogen and yolk precursor synthesis in juvenile rainbow trout.
General & Comparative Endocrinology, 41, 384–391. https​ ://doi.
org/10.1016/0016-6480(80)90083-0
Kohn, Y. Y., Lokman, P. M., Kilimnik, A., & Symonds, J. E. (2013). Sex identi‐
fication in captive hapuku (Polyprion oxygeneios) using ultrasound imag‐
ery and plasma levels of vitellogenin and sex steroids. Aquaculture, 384,
87–93. https​://doi.org/10.1016/j.aquac​ulture.2012.12.020
Li, L. (2009). Study on the immune function of zebrafish (Danio Rerio)
vitellogenin. Ocean University of China, 3–89.
Liu, C., Li, K. L., Geng, D. Y., Nie, X. P., Wang, F., & Wu, S. Q. (2010).
Cloning and characterization of vitellogenin gene from swordtail fish
Xiphophorus helleri. Journal of Fishery Sciences of China, 17, 31–43.
Liu, C., Li, K. L., Wang, F., Wang, Q., Nie, X. P., Wang, Y. Y., & Wu, S. Q.
(2011). The full length cDNA cloning and expression profile of vitel‐
logenin C (VgC) gene from swordtail fish Xiphophorus helleri. Journal
of Fisheries of China, 35, 1441–1449.
Matsubara, T., Nagae, M., Ohkubo, N., Andoh, T., Sawaguchi, S.,
Hiramatsu, N., … Hara, A. (2003). Multiple vitellogenins and their
unique roles in marine teleosts. Fish Physiology and Biochemistry, 28,
295–299. https​://doi.org/10.1023/B:FISH.00000​3 0559.71954.37
Mohdshamsudin, M. I., Fard, M. Z., Mather, P. B., Suleiman, Z., Hassan,
R., Othman, R. Y., & Bhassu, S. (2011). Molecular characteri‐
zation of relatedness among colour variants of Asian Arowana
(Scleropages formosus). Gene, 490, 47–53. https​://doi.org/10.1016/j.
gene.2011.08.025
Mu, X. D., Song, H. M., Wang, X. J., Yang, Y. X., Luo, D., Gu, D. E., … Hu, Y.
C. (2012). Genetic variability of the Asian arowana, Scleropages for-
mosus, based on mitochondrial DNA genes. Biochemical Systematics
& Ecology, 44, 141–148. https​://doi.org/10.1016/j.bse.2012.04.017
Pan, X. H., Liu, Y., Zhou, K. Q., Hu, Y. C., Zheng, S. M., Song, H. M., … Yang,
Y. X. (2018). Molecular cloning, expression pattern and prokaryotic
expression of vitellogenin gene (vtg) from Osteoglossum bicirrhosum.
Chinese Journal of Zoology, 2018(53), 597–614.
Pauling, L., Corey, R. B., & Branson, H. R. (1951). The structure of proteins:
Two hydrogen‐bonded helical configurations of the polypeptide
chain. Proceedings of the National Academy of Sciences of the United
States of America, 37, 205. https​://doi.org/10.1073/pnas.37.4.205
Pottinger, T. G., Pulman, K. G. T., Carrick, T. R., & Scott, A. P. (2005). Evaluation
of biochemical methods for the non‐destructive identification of sex in
upstream migrating salmon and sea trout. Journal of Fish Biology, 67,
1514–1533. https​://doi.org/10.1111/j.1095-8649.2005.00853.x
Rahman, S., Zakariaismail, M., Tang, P. Y., & Muniandy, S. (2008).
Microsatellite analysis of wild and captive populations of asian arow‐
ana (Scleropages formosus) in peninsular Malaysia. Journal of Biological
Sciences, 8, 517–525. https​://doi.org/10.3923/jbs.2008.517.525
| 977
Reading, B. J., Hiramatsu, N., Sawaguchi, S., Matsubara, T., Hara, A.,
Lively, M. O., & Sullivan, C. V. (2009). Conserved and variant molecu‐
lar and functional features of multiple egg yolk precursor proteins (vi‐
tellogenins) in White Perch (Morone americana) and other teleosts[J].
Marine Biotechnology, 11(2), 169–187. https​ ://doi.org/10.1007/
s10126-008-9133-6
Shi, X. D. (2004). Purifieation, charaeterization, immunoassay and function
study of vitellogenin and lipovitellin from rosybarb (Punitus concho‐
nius). Ocean University of China.
Tian, Y., Mu, X. D., Wang, X. J., Gu, D. E., & Hu, Y. C. (2013). Karyotype
analysis of Scleropages formosus. Chinese Journal of Zoology, 48,
569–573.
Tong, Y., Shan, T., Poh, Y. K., Yan, T., Wang, H., Lam, S. H., & Gong, Z.
(2004). Molecular cloning of zebrafish and medaka vitellogenin
genes and comparison of their expression in response to 17β‐estra‐
diol. Gene, 328, 25–36. https​://doi.org/10.1016/j.gene.2003.12.001
Turner, R. T., Dickhoff, W. W., & Gorbman, A. (1981). Estrogen
binding to hepatic nuclei of Pacific hagfish, Eptatretus stouti.
General & Comparative Endocrinology, 45, 26–29. https​ ://doi.
org/10.1016/0016-6480(81)90164-7
Unuma, T., Suzuki, T., Kurokawa, T., Yamamoto, T., & Akiyama, T. (1998). A
protein identical to the yolk protein is stored in the testis in male red
sea urchin, pseudocentrotus depressus. The Biological Bulletin, 194,
92–97. https​://doi.org/10.2307/1542517
Utarabhand, P., & Bunlipatanon, P. (1996). Plasma vitellogenin of
grouper (Epinephelus malabaricus): Isolation and properties.
Comparative Biochemistry & Physiology Part C: Pharmacology
Toxicology & Endocrinology, 115, 101–110. https​://doi.org/10.1016/
S0742-8413(96)00055-2
Wang, H., Yan, T., Tan, J. T., & Gong, Z. (2000). A zebrafish vitellogenin gene
(vg3) encodes a novel vitellogenin without a phosvitin domain and may
represent a primitive vertebrate vitellogenin gene. Gene, 256, 303–
310. https​://doi.org/10.1016/S0378-1119(00)00376-0
Wang, Q. L., Liu, Y., Song, H. M., Wang, X. J., Liu, C., Mu, X. D., … Luo,
J. R. (2016). Molecular cloning, expression pattern and prokaryotic
expression of anti‐Müllerian hormone (amh) gene in Osteoglossum bi-
cirrostum. Journal of Fisheries of China, 40, 1801–1812.
Wu, M. Q., Xi, G. G., Ping, S. S. Z., & Zheng, S. Y. Q. (2014). Molecular
characterization and immunochemical studies of vitellogenins in
loach (Misgurnus anguillicaudatus). China Society of Fisheries, 58–62.
Yu, L. J., Cai, L., Li, K., Chen, X. Q., Chen, L., & Li, J. J. (2016). Full‐length
cDNA cloning and expression analysis of vitellogenin gene in
Mugilogobius chulae. Ocean Science, 40, 23–31.
Zhang, S., Sun, Y., Pang, Q., & Shi, X. (2005). Hemagglutinating and an‐
tibacterial activities of vitellogenin. Fish & Shellfish Immunology, 19,
93–95. https​://doi.org/10.1016/j.fsi.2004.10.008
Zhou, K. Q., Pan, X. H., Liu, Y., Mu, X. D., Zheng, S. M., Hu, Y. C., … Yang,
Y. X. (2018). The tissue expression and bioinformatics analysis for vi‐
tellogenin receptor gene (vtgr) of Osteoglossum bicirrhosum. Fishwater
Fisheries, 48, 30–38.
How to cite this article: Pan X, Liu Y, Zhou K, et al. Tissue
expression and bioinformatics analysis of the vitellogenin
gene of Asian arowana (Scleropages formosus). J Appl Ichthyol.
2019;35:970–977. https​://doi.org/10.1111/jai.13927​