Professional Documents
Culture Documents
Genesx CH02 026 041
Genesx CH02 026 041
22
Reprinted from Cell, vol. 136, F. Brandt, et al., The Native 3D Organization of
Bacterial Polysomes, pp. 261–271, Copyright (2009), with permission from
Elsevier [http://www.sciencedirect.com/science/journal/00928674]. Photo
courtesy of Wolfgang Baumeister, Max-Planck-Institute of Biochemistry.
CHAPTER OUTLINE
2.1 Introduction • Testing whether a gene is essential requires a null mu-
tation (one that completely eliminates its function).
2.2 A Gene Codes for a Single Polypeptide • Silent mutations have no effect, either because the
• The one gene: one enzyme hypothesis summarizes base change does not change the sequence or amount
the basis of modern genetics: that a gene is a stretch of protein, or because the change in protein sequence
of DNA coding for one or more isoforms of a single has no effect.
polypeptide.
2.5 A Locus May Have Many Different Mutant Alleles
• Some genes do not encode polypeptides, but encode
structural or regulatory RNAs. • The existence of multiple alleles allows heterozygotes
that represent any pairwise combination of alleles
• Most mutations damage gene function and are reces-
to exist.
sive to the wild-type allele.
2.6 A Locus May Have More Than One Wild-type Allele
2.3 Mutations in the Same Gene Cannot Complement
• A locus may have a polymorphic distribution of alleles
• A mutation in a gene affects only the product (protein
with no individual allele that can be considered to be
or RNA) coded by the mutant copy of the gene and
the sole wild-type.
does not affect the product coded by any other allele.
• Failure of two mutations to complement (produce wild 2.7 Recombination Occurs by Physical Exchange of DNA
phenotype) when they are present in trans configura- • Recombination is the result of crossing-over that
tion in a heterozygote means that they are part of the occurs at chiasmata and involves two of the four
same gene. chromatids.
2.4 Mutations May Cause Loss-of-Function • Recombination occurs by a breakage and reunion
or Gain-of-Function that proceeds via an intermediate of hybrid DNA that
depends on the complementarity of the two strands
• Recessive mutations are due to loss-of-function by the of DNA.
protein product.
• Dominant mutations result from a gain-of-function.
26
• The frequency of recombination between two genes is 2.11 Several Processes Are Required to Express the
proportional to their physical distance; recombination Protein Product of a Gene
between genes that are very closely linked is rare.
• A prokaryotic gene is expressed by transcription into
• For genes that are very far apart on a single chro-
mRNA and then translation of the mRNA into protein.
mosome, the frequency of recombination is not
proportional to their physical distance because recom- • In eukaryotes, a gene may contain internal regions
bination happens so frequently. that are not represented in protein.
2.8 • Internal regions are removed from the mRNA transcript
The Genetic Code Is Triplet
by RNA splicing to give an mRNA that is colinear with
• The genetic code is read in triplet nucleotides called the protein product.
codons. • Each mRNA consists of an untranslated 5 region, a
• The triplets are nonoverlapping and are read from a coding region, and an untranslated 3 trailer.
fixed starting point.
2.12 Proteins Are trans-acting, but Sites on DNA Are
• Mutations that insert or delete individual bases cause a
shift in the triplet sets after the site of mutation. cis-acting
• Combinations of mutations that together insert or de- • All gene products (RNA or proteins) are trans-acting.
lete three bases (or multiples of three) insert or delete They can act on any copy of a gene in the cell.
amino acids, but do not change the reading of the • cis-acting mutations identify sequences of DNA that
triplets beyond the last site of mutation. are targets for recognition by trans-acting products.
2.9 They are not expressed as RNA or protein and affect
Every Sequence Has Three Possible Reading Frames
only the contiguous stretch of DNA.
• In general, only one reading frame is translated, and
2.13 Summary
the other two are blocked by frequent termination
signals.
2.10 Prokaryotic Genes Are Colinear with Their Proteins
• A prokaryotic gene consists of a continuous length of
3N nucleotides that encodes N amino acids.
• The gene, mRNA, and protein are all colinear.
2.1 Introduction 27
A chromosome is a very long molecule of DNA The first systematic attempt to associate genes
with enzymes, carried out by Beadle and Tatum
in the 1940s, showed that each stage in a meta-
bolic pathway is catalyzed by a single enzyme
and can be blocked by mutation in a different
gene. This led to the one gene : one enzyme
hypothesis. Each metabolic step is catalyzed
by a particular enzyme, whose production is
The chromosome
contains many genes
the responsibility of a single gene. A mutation
in the gene alters the activity of the protein for
which it is responsible.
A modification in the hypothesis is needed
Each gene is
part of a continuous to accommodate proteins that consist of more
sequence of DNA than one subunit. If the subunits are all the
same, the protein is a homomultimer and is
represented by a single gene. If the subunits are
Start of gene End of gene different, the protein is a heteromultimer.
Stated as a more general rule applicable to any
heteromultimeric protein, the one gene: one
CATATAAGGTGAGGTAGGATCAGTTGCTCCTCACAATGC enzyme hypothesis becomes more precisely
GTATATTCCACTCCATCCTAGTCAACGAGGAGTGTTACG
expressed as the one gene : one polypeptide
FIGURE 2.1 Each chromosome has a single long mol- hypothesis. Even this general rule needs to be
ecule of DNA within which are the sequences of individual refined because many genes encode multiple,
genes.
related polypeptides through alternative splic-
were previously deduced for recombination ing of the mRNA (see Chapter 21, RNA Splicing
between genes. and Processing).
Mutations within a gene can be arranged Identifying which protein represents a
into a linear order, showing that the gene itself particular gene can be a protracted task. The
has the same linear construction as the array mutation responsible for Mendel’s wrinkled-
of genes on a chromosome. Thus the genetic pea mutant was identified only in 1990 as an
map is linear within as well as between loci: it alteration that inactivates the gene for a starch-
consists of an unbroken sequence within which branching enzyme!
the genes reside. This conclusion leads naturally It is important to remember that a gene
into the modern view summarized in FIGURE 2.1 does not directly generate a polypeptide. As
that the genetic material of a chromosome con- shown previously in Figure 1.2, a gene codes
sists of an uninterrupted length of DNA repre- for an RNA, which may in turn code for a poly-
senting many genes. Having defined the gene peptide. Many genes code for polypeptides, but
as an uninterrupted length of DNA, it should some genes code for RNAs that do not give rise
be noted that in eukaryotes many genes are to polypeptides. These RNAs may be structural
interrupted by sequences in the DNA that are components of the apparatus responsible for
then excised from the mRNA (see Chapter 4, synthesizing proteins or, as has become evident
The Interrupted Gene). in recent years, have roles in regulating gene
expression (see Chapter 30, Regulatory RNA).
The basic principle is that the gene is a sequence
2.2 A Gene Codes for a Single of DNA that specifies the sequence of an inde-
pendent product. The process of gene expres-
Polypeptide sion may terminate in a product that is either
Key concepts RNA or polypeptide.
• The one gene: one enzyme hypothesis summarizes A mutation is a random event with regard
the basis of modern genetics: that a gene is a to the structure of the gene, so the greatest
stretch of DNA coding for one or more isoforms of probability is that it will damage or even abolish
a single polypeptide. gene function. Most mutations that affect gene
• Some genes do not encode polypeptides, but en- function are recessive: they represent an absence
code structural or regulatory RNAs. of function, because the mutant gene has been pre-
• Most mutations damage gene function and are vented from producing its usual product. FIGURE 2.2
recessive to the wild-type allele. illustrates the relationship between recessive
Wild-type Wild-type/mutant Mutant teins are involved in the same function. The
homozygote heterozygote homozygote complementation test is used to determine
whether two mutations lie in the same gene or
Both alleles One (dominant) Neither allele in different genes. The test consists of making a
produce allele produces produces protein
active protein active protein heterozygote for the two mutations.
If the mutations lie in the same gene, the
parental genotypes can be represented as:
m1 m
and 2
wild type wild type mutant m1 m2
wild type mutant mutant
The first parent provides an m1 mutant allele
and the second parent provides an m2 allele,
so that the heterozygote has the constitution:
m1
Wild Wild Mutant m2
phenotype phenotype phenotype
No wild-type gene is present, so the heterozy-
FIGURE 2.2 Genes code for proteins; dominance is gote has mutant phenotype and the alleles fail
explained by the properties of mutant proteins. A reces-
sive allele does not contribute to the phenotype in the to complement. If the mutations lie in differ-
wild-type/mutant heterozygote because it produces ent genes, the parental genotypes can be rep-
no protein (or protein that is nonfunctional). If both resented as:
alleles are the recessive mutant allele, no active protein
is produced. m1 + +m2
and
m1 + +m2
and wild-type alleles. When a heterozygote Each chromosome has a wild-type copy of
contains one wild-type allele and one mutant one gene (represented by the plus sign) and a
allele, the wild-type allele is able to direct pro- mutant copy of the other. Then the heterozy-
duction of the normal gene product. The wild- gote has the constitution:
type allele is therefore dominant. (This assumes
m1 +
that an adequate amount of product is made
by the single wild-type allele. When this is not +m2
true, the smaller amount made by one allele as in which the two parents between them have
compared to two alleles results in the interme- provided a wild-type copy of each gene. The
diate phenotype of a partially dominant allele heterozygote has wild phenotype, and thus the
in a heterozygote.) two genes are said to complement.
The complementation test is shown in more
2.3 Mutations in the Same detail in FIGURE 2.3. The basic test consists of the
comparison shown in the top part of the figure.
Gene Cannot Complement If two mutations lie in the same gene, we see a
Key concepts difference in the phenotypes of the trans configu-
• A mutation in a gene affects only the product ration and the cis configuration. The trans config-
(protein or RNA) coded by the mutant copy of the uration is mutant because each allele has a (dif-
gene and does not affect the product coded by any ferent) mutation, whereas the cis co nfiguration
other allele. is wild-type because one allele has two mutations
• Failure of two mutations to complement (produce and the other allele has no mutations. The lower
wild phenotype) when they are present in trans
part of the figure shows that if the two mutations
configuration in a heterozygote means that they
are part of the same gene. lie in different genes, we always see a wild phe-
notype. There is always one wild-type and one
mutant allele of each gene, and the configuration
How do we determine whether two mutations is irrelevant. Failure to complement means that
that cause a similar phenotype lie in the same two mutations are part of the same genetic unit.
gene? If they map close together, they may be Mutations that do not complement one another
alleles. They could, however, also represent are said to comprise part of the same complemen-
mutations in two different genes whose pro- tation group. Another term used to describe the
Chiasma A B
is caused by A b
crossing-over between a B
a b Recombination intermediate
2 of the nonsister chromatids
FIGURE 2.9 Genes on different chromosomes segregate inde- Genes on different chromosomes show 50% recombination
pendently so that all possible combinations of alleles are pro- Dominant allele
duced in equal proportions. Recombination occurs so frequently Recessive allele
between genes that are far apart on the same chromosome Chromosome 1 Independent
that they effectively segregate independently. Recombination assortment
is reduced, however, when genes are closer together, and for gives gametes
adjacent genes may hardly ever occur. with all four
possible
Chromosome 2
combinations
Allelic
chromosomes
OR
Recombination event
occurs anywhere along Parental and recombinant
chromosome between classes equally represented
genes in gametes
of 50% parental types and 50% recombinant tions present on a chromosome can be changed
types during meiosis. When genes are suffi- by recombination. We can now ask, “what is
ciently far apart on the same chromosome, the relationship between the sequence of a gene
the probability of one or more recombination and the sequence of the polypeptide chain it
events in the region between them becomes represents?”
so high that they behave in the same way as
genes on different chromosomes and show
50% recombination.
2.8 The Genetic Code
When genes are close together, though, the Is Triplet
probability of a recombination event between Key concepts
them is reduced, and occurs only in some pro-
• The genetic code is read in triplet nucleotides
portion of meioses. For example, if it occurs called codons.
in one quarter of the meioses, the overall rate • The triplets are nonoverlapping and are read from
of recombination is 12.5% (because a single a fixed starting point.
recombination event produces 50% recom- • Mutations that insert or delete individual bases
bination, and this occurs in 25% of meioses). cause a shift in the triplet sets after the site of
When genes are very close together, as shown mutation.
in the bottom panel of Figure 2.9, recombina- • Combinations of mutations that together insert or
tion between them may never be observed in delete three bases (or multiples of three) insert or
phenotypes of higher eukaryotes. delete amino acids, but do not change the reading
of the triplets beyond the last site of mutation.
This leads us to the view that a chromo-
some contains an array of many genes. Each
protein-coding gene is an independent unit of Each gene represents a particular polypeptide
expression, and is represented in one or more chain. The concept that each protein con-
polypeptide chains. The properties of a gene can sists of a particular series of amino acids dates
be changed by mutation. The allelic combina- from Sanger’s characterization of insulin in
the 1950s. The discovery that a gene consists • The use of a fixed starting point means
of DNA presents us with the issue of how a that assembly of a protein must start at
sequence of nucleotides in DNA represents a one end and work to the other, so that
sequence of amino acids in protein. different parts of the coding sequence
The sequence of nucleotides in DNA is cannot be read independently.
important not because of its structure per se, but The nature of the code predicts that two
because it codes for the sequence of amino acids types of mutations, base substitution and base
that constitutes the corresponding polypeptide. insertion/deletion, will have different effects.
The relationship between a sequence of DNA If a particular sequence is read sequentially,
and the sequence of the corresponding protein such as:
is called the genetic code. UUU AAA GGG CCC (codons)
The structure and/or enzymatic activity of
aa1 aa2 aa3 aa4 (amino acids)
each protein follows from its primary sequence
then a base substitution, or point mutation, will
of amino acids and its overall conformation,
affect only one amino acid. For example, the
which is determined by interactions between
substitution of an A by some other base (X)
the amino acids. By determining the sequence
causes aa2 to be replaced by aa5:
of amino acids in each protein, the gene is able
to carry all the information needed to specify an UUU AAX GGG CCC
active polypeptide chain. In this way, a single aa1 aa5 aa3 aa4
type of structure—the gene—is able to repre- because only the second codon has been
sent itself in innumerable polypeptide forms. changed.
Together the various protein products of A mutation that inserts or deletes a single base,
a cell undertake the catalytic and structural though, will change the triplet sets for the entire sub-
activities that are responsible for establishing its sequent sequence. A change of this sort is called a
phenotype. Of course, in addition to sequences frameshift. An insertion might take the form:
that code for proteins, DNA also contains cer- UUU AAX AGG GCC C
tain sequences whose function is to be recog- aa1 aa5 aa6 aa7
nized by regulator molecules, usually proteins. The new sequence of triplets is completely dif-
Here the function of the DNA is determined by ferent from the old one, and as a result the
its sequence directly, not via any intermediary entire amino acid sequence of the protein
code. Both types of region—genes expressed as is altered beyond the site of mutation. Thus
proteins and sequences recognized as such— the function of the protein is likely to be lost
constitute genetic information. completely.
The genetic code is deciphered by a com- Frameshift mutations are induced by the
plex apparatus that interprets the nucleic acid acridines. The acridines are compounds that
sequence. This apparatus is essential if the bind to DNA and distort the structure of the
information carried in DNA is to have mean- double helix, causing additional bases to be
ing. In any given region, only one of the two incorporated or omitted during replication.
strands of DNA codes for protein, so we write Each mutagenic event sponsored by an acridine
the genetic code as a sequence of bases (rather results in the addition or removal of a single
than base pairs). base pair.
The genetic code is read in groups of If an acridine mutant is produced by, say,
three nucleotides, each group representing addition of a nucleotide, it should revert to
one amino acid. Each trinucleotide sequence wild-type by deletion of the nucleotide. Rever-
is called a codon. A gene includes a series of sion also can be caused by deletion of a different
codons that is read sequentially from a starting base, though, at a site close to the first. Combi-
point at one end to a termination point at the nations of such mutations provided revealing
other end. Written in the conventional 5 to 3 evidence about the nature of the genetic code.
direction, the nucleotide sequence of the DNA FIGURE 2.10 illustrates the properties of
strand that codes for protein corresponds to the frameshift mutations. An insertion or deletion
amino acid sequence of the protein written in changes the entire protein sequence following
the direction from N-terminus to C-terminus. the site of mutation. The combination of an
The genetic code is read in nonoverlapping insertion and a deletion, though, causes the
triplets from a fixed starting point: code to be read incorrectly only between the
Triple mutant A A A
If the genetic code is read in nonoverlapping
GCU GCA UGC UGC AUG CAU GCU GCU
triplets, there are three possible ways of trans-
Ala Ala Cys Cys Met His Ala Ala lating any nucleotide sequence into protein,
Wild-type sequence Mutant sequence depending on the starting point. These are
FIGURE 2.10 Frameshift mutations show that the genetic called reading frames. For the sequence
code is read in triplets from a fixed starting point. ACGACGACGACGACGACG
the three possible reading frames are
ACG ACG ACG ACG ACG ACG ACG
two sites of mutation; correct reading resumes
after the second site. CGA CGA CGA CGA CGA CGA CGA
In 1961, genetic analysis of acridine muta- GAC GAC GAC GAC GAC GAC GAC
tions in the rII region of the phage T4 showed A reading frame that consists exclusively
that all the mutations could be classified into of triplets representing amino acids is called an
one of two sets, described as (+) and (–). Either open reading frame or ORF. A sequence that
type of mutation by itself causes a frameshift: is translated into protein has a reading frame
the (+) type by virtue of a base addition, and that starts with a special initiation codon
the (–) type by virtue of a base deletion. Double (AUG) and then extends through a series of
mutant combinations of the types (+ +) and (– –) triplets representing amino acids until it ends at
continue to show mutant behavior. Combina- one of three types of termination codon (see
tions of the types (+ –) or (– +), however, sup- Chapter 25, Using the Genetic Code).
press one another, giving rise to a description A reading frame that cannot be read into
in which one mutation is described as a frame- protein because termination codons occur
shift suppressor of the other. (In the context of frequently is said to be closed or blocked.
this work, “suppressor” is used in an unusual If a sequence is blocked in all three reading
sense because the second mutation is in the frames, it cannot have the function of coding
same gene as the first.) for protein.
These results show that the genetic code When the sequence of a DNA region of
must be read as a sequence that is fixed by the unknown function is obtained, each possible
starting point. Thus additions or deletions com- reading frame is analyzed to determine whether
pensate for each other, whereas double addi- it is open or blocked. Usually no more than one
tions or double deletions remain mutant. This of the three possible frames of reading is open
does not, however, reveal how many nucleo- in any single stretch of DNA. FIGURE 2.11 shows
tides make up each codon. an example of a sequence that can be read in
When triple mutants are constructed, only one reading frame because the alternative
only (+ + +) and (– – –) combinations show the reading frames are blocked by frequent termi-
wild phenotype, whereas other combinations nation codons. A long open reading frame is
remain mutant. If we take three additions or unlikely to exist by chance; if it were not trans-
three deletions to correspond respectively to the lated into protein, there would have been no
2.11 Several Processes Are scription, when an mRNA copy of one strand
of the DNA is produced. The second stage is
Required to Express the translation of the mRNA into protein. This is
Protein Product of the process by which the sequence of an mRNA
is read in triplets to give the series of amino
a Gene acids that make the corresponding protein.
An mRNA includes a sequence of nucleo-
Key concepts tides that corresponds with the sequence of
• A prokaryotic gene is expressed by transcription amino acids in the protein. This part of the
into mRNA and then translation of the mRNA into nucleic acid is called the coding region. Note,
protein.
however, that the mRNA includes additional
• In eukaryotes, a gene may contain internal re-
gions that are not represented in protein. sequences on either end; these sequences
do not directly encode polypeptide. The 5
• Internal regions are removed from the mRNA
transcript by RNA splicing to give an mRNA that is untranslated region is called the leader or 5ⴕ
colinear with the protein product. UTR, and the 3 untranslated region is called
• Each mRNA consists of an untranslated 5 region, the trailer or 3ⴕ UTR.
a coding region, and an untranslated 3 trailer. The gene includes the entire sequence rep-
resented in messenger RNA. Sometimes muta-
tions impeding gene function are found in the
In comparing gene and protein, we are
additional, noncoding regions, confirming the
restricted to dealing with the sequence of DNA
view that these comprise a legitimate part of
stretching between the points corresponding to
the genetic unit.
the ends of the protein. A gene is not directly
FIGURE 2.14 illustrates this situation, in
translated into protein, though, but instead is
which the gene is considered to comprise a
expressed via the production of a messenger
continuous stretch of DNA that is needed to
RNA (abbreviated to mRNA), a nucleic acid
produce a particular protein. It includes the
intermediate actually used to synthesize a pro-
sequence coding for that protein, but also
tein (as we see in detail in Chapter 22, mRNA
includes sequences on either side of the cod-
Stability and Localization).
ing region.
Messenger RNA is synthesized by the same
A bacterium consists of only a single com-
process of complementary base pairing used to
partment, so transcription and translation occur
replicate DNA, with the important difference
in the same place, as illustrated in FIGURE 2.15.
that it corresponds to only one strand of the
In eukaryotes transcription occurs in the
DNA double helix. FIGURE 2.13 shows that the
nucleus, but the mRNA product must be trans-
sequence of mRNA is complementary with
ported to the cytoplasm in order to be translated.
the sequence of one strand of DNA and is iden-
For the simplest eukaryotic genes (just like in
tical (apart from the replacement of T with U)
bacteria) the translated RNA is in fact the tran-
with the other strand of DNA. The convention
scribed copy of the gene. For more complex
for writing DNA sequences is that the top strand
genes, however, the immediate transcript of
runs 5→3, with the sequence that is the same
the gene is a pre-mRNA that requires RNA
as RNA.
processing to generate the mature mRNA. The
The process by which a gene gives rise to a
basic stages of gene expression in a eukaryote
protein is called gene expression. In bacteria,
are outlined in FIGURE 2.16. This results in a spa-
it consists of two stages. The first stage is tran-
5 AUGCCGUUAGACCGUUAGCGGACCUGAC 3 N C Protein
RNA has same sequence as DNA top strand;
is complementary to DNA bottom strand Protein defines coding region
FIGURE 2.13 RNA is synthesized by using one strand FIGURE 2.14 The gene may be longer than the sequence
of DNA as a template for complementary base pairing. coding for protein.
INTRON Splicing
Protein
A crucial step in the definition of the gene
FIGURE 2.16 Gene expression is a multistage process.
was the realization that all its parts must be
present on one contiguous stretch of DNA. In
genetic terminology, sites that are located on
tial separation between transcription (in the the same DNA are said to be in cis. Sites that are
nucleus) and translation (in the cytoplasm). located on two different molecules of DNA are
The most important stage in processing described as being in trans. So two mutations
is splicing. Many genes in eukaryotes (and may be in cis (on the same DNA) or in trans
a majority in multicellular eukaryotes) con- (on different DNAs). The complementation test
tain internal regions called introns that do uses this concept to determine whether two
RNA
absence of regulator protein would prevent both A gene may have multiple alleles. Recessive
alleles from being expressed. A mutation of this alleles are caused by loss-of-function mutations
sort is said to be in a trans-acting sequence. that interfere with the function of the protein. A
Reversing the argument, if a mutation is null allele has total loss-of-function. Dominant
trans-acting, we know that its effects must be alleles are caused by gain-of-function muta-
exerted through some diffusible product (either tions that create a new property in the protein.
a protein or a regulatory RNA) that acts on mul-
tiple targets within a cell. If a mutation is cis-
acting, though, it must function via affecting References
directly the properties of the contiguous DNA,
2.8 The Genetic Code Is Triplet
which means that it is not expressed in the form
of RNA or protein. Review
Roth, J. R. (1974). Frameshift mutations. Annu.
Rev. Genet. 8, 319–346.
2.13 Summary
A chromosome consists of an uninterrupted Research
length of duplex DNA that contains many Benzer, S. and Champe, S. P. (1961). Ambivalent
rII mutants of phage T4. Proc. Natl. Acad. Sci.
genes. Each gene (or cistron) is transcribed
USA 47, 403–416.
into an RNA product, which in turn is trans- Crick, F. H. C., Barnett, L., Brenner, S., and
lated into a polypeptide sequence if the gene Watts-Tobin, R. J. (1961). General nature
codes for protein. An RNA or protein product of the genetic code for proteins. Nature 192,
of a gene is said to be trans-acting. A gene is 1227–1232.
defined as a unit of a single stretch of DNA by
the complementation test. A site on DNA that
2.10 Prokaryotic Genes Are Colinear with
regulates the activity of an adjacent gene is said
Their Proteins
to be cis-acting.
When a gene codes for protein, the rela- Research
tionship between the sequence of DNA and Yanofsky, C., Drapeau, G. R., Guest, J. R., and
sequence of the protein is given by the genetic Carlton, B. C. (1967). The complete amino
code. Only one of the two strands of DNA acid sequence of the tryptophan synthetase A
codes for protein. A codon consists of three protein (µ subunit) and its colinear relation-
nucleotides that represent a single amino acid. ship with the genetic map of the A gene. Proc.
Natl. Acad. Sci. USA 57, 2966–2968.
A coding sequence of DNA consists of a series
Yanofsky, C. et al. (1964). On the colinearity of
of codons, read from a fixed starting point gene structure and protein structure. Proc.
and nonoverlapping. Usually one of the three Natl. Acad. Sci. USA, 51, 266–272.
possible reading frames can be translated into
protein.
References 41