Food Research International 105 (2018) 743–751

Contents lists available at ScienceDirect

Food Research International

journal homepage: www.elsevier.com/locate/foodres

Genetic relatedness, antimicrobial resistance and biofilm formation of T

Salmonella isolated from naturally contaminated poultry and their
processing environment in northern Malaysia
Li-Oon Chuaha, Ahamed-Kamal Shamila Syuhadaa, Ismail Mohamad Suhaimib,
⁎
Tajudin Farah Hanimb, Gulam Rusula,
a
Food Technology Division, School of Industrial Technology, Universiti Sains Malaysia, 11800 Minden, Penang, Malaysia
b
Food Safety and Quality Control Laboratory, Km 1, Jalan Abi Tok Hashim, 01000 Kangar, Perlis, Malaysia

A R T I C L E I N F O A B S T R A C T

Keywords: We investigated the genetic relatedness, antibiotic resistance and biofilm-producing ability of 114 strains of
Salmonella enterica Salmonella, belonged to three serotypes (Corvallis, Brancaster and Albany), isolated from naturally contaminated
Persistent poultry and their environment in wet markets and smale-scale processing plant from northern Malaysia. Pulsed-
Multidrug resistance (MDR) field gel electrophoresis revealed that Salmonella strains isolated from various wet markets were clonally related,
Integron
suggesting the widespread dissemination of these three serotypes in northern Malaysia. All except one strain of
Chicken
Wet market
Salmonella were resistant to more than two classes of antibiotics, hence regarded as multidrug resistant (MDR).
Resistance to sulphonamide (96.5%), ampicillin (89.5%), tetracycline (85.1%), chloramphenicol (75.4%), tri-
methoprim (68.4%), trimethoprim-sulfamethoxazole (67.5%), streptomycin (58.8%) and nalidixic acid (44.4%)
were observed. Resistance determinants, floR, cmlA, tetA, tetB, tetG, temB, blaPSE-1, sul1, sul2, qnrA, qnrS, strA and
aadA were detected by PCR among MDR Salmonella strains. Seventy-six strains (66.7%) harboured class-I in-
tegrons. The gene cassettes identified were dfrA1, dfrA12, aadA2 and an open reading frame orfC with unknown
function. All Salmonella strains produced biofilm and 69.3% of them were strong biofilm-producers. Our findings
suggested that most likely, persistent Salmonella colonises various sites in the processing environment by pro-
ducing biofilm, which leads to their widespread dissemination in wet markets located in northern Malaysia.

1. Introduction
Wet markets are very common and popular in Asian countries. A
variety of fresh produce, animal products (live or slaughtered poultry,
beef, and pork) and seafoods are available in wet markets which are
sold at ambient temperature and exposed to the environment. Despite
the ban on the slaughtering of live birds in wet markets by the National
Council of Malaysian government (Anonymous, 2013), slaughtering of
live birds in wet market is a common practise in Malaysia (MyCC,
2014), as consumer prefer freshly slaughtered chicken rather than
frozen or chill. Various studies have reported on high prevalence of
Salmonella in poultry samples obtained from wet markets, indicating
that both poultry and the wet market environment are consistently
contaminated with Salmonella (Adzitey, Rusul, & Huda, 2012;
Arumugaswamy, Rusul, Abdul Hamid, & Cheah, 1995; Rusul, Khair,
Radu, Cheah, & Yassin, 1996; Shafini, Son, Mahyudin, Rukayadi, &
Tuan Zainazor, 2017; Van, Moutafis, Istivan, Tran, & Coloe, 2007). Our
previous study suggested that Salmonella thrives in the poultry pro-
cessing environment in wet markets and small-scale processing plant
(SCPP) in northern Malaysia (Nidaullah et al., 2017).
High humidity or moisture content in the environment of wet
markets and poultry processing plants favours the formation of bac-
terial biofilm. Biofilms may harbour pathogenic bacteria and being
hydrophobic in nature are resistant to the action of detergents or sa-
nitizing agents (Marin, Hernandiz, & Lainez, 2009). Salmonella spp. are
able to form biofilms on plastic, cement and stainless steel (Joseph,
Otta, Karunasagar, & Karunasagar, 2001; Steenackers, Hermans,
Vanderleyden, & De Keersmaecker, 2012). Various researchers have
reported the presence of biofilm-forming Salmonella serotypes on the
surfaces of equipment, and plants where food animals are slaughtered
and processed (Marin et al., 2009), these serotypes are also known to
have colonised surfaces and equipment in food processing premises
(Finn et al., 2013; Shi & Zhu, 2009). Biofilm formation is considered as
an environmental adaptation strategy by microorganism, as it provides

⁎
Corresponding author.
E-mail addresses: nateliechuah@gmail.com (L.-O. Chuah), shamila_syuhada@yahoo.com (A.-K. Shamila Syuhada), msi77@moh.gov.my (I. Mohamad Suhaimi),
farahhanim@moh.gov.my (T. Farah Hanim), gulam@usm.my (G. Rusul).

https://doi.org/10.1016/j.foodres.2017.11.066
Received 24 August 2017; Received in revised form 22 November 2017; Accepted 25 November 2017
Available online 27 November 2017
0963-9969/ © 2017 Elsevier Ltd. All rights reserved.
L.-O. Chuah et al.
protection to the bacterial cells against various environmental chal-
lenges such as desiccation (Spector & Kenyon, 2012; Vestby, Møretrø,
Ballance, Langsrud, & Nesse, 2009), pH and osmotic changes (Giaouris,
Chorianopoulos, & Nychas, 2005), disinfectants (Marin et al., 2009),
antimicrobial agents (Tabak, Scher, Chikindas, & Yaron, 2009) and UV
light radiation (El-Azizi & Khardori, 2016).
Another major food safety and health concern is the emergence of
multidrug-resistant (MDR) foodborne pathogens (Benacer, Thong,
Watanabe, & Puthucheary, 2010; Thong & Modarressi, 2011; Turki,
Ouzari, Mehri, Ben Aissa, & Hassen, 2012; Wasyl & Hoszowski, 2012).
Antibiotics are extensively used in poultry farming as prophylaxis,
therapeutics and growth promoters. In developing countries, the reg-
ulation and enforcement in the application of antibiotics as growth
promoters is lacking and increase in antimicrobial resistance among
Enterobacteriaceae over the years is evident (Nhung, Cuong, Thwaites,
& Carrique-Mas, 2016). Since poultry is a major source of Salmonella
spp., the rampant utilisation of antibiotics in poultry farming may
contribute to the emergence and widespread distribution of MDR Sal-
monella (Landers, Cohen, Wittum, & Larson, 2012). The horizontal
transfer and acquisition of antibiotic resistance determinants in Sal-
monella isolated from poultry has been reported worldwide and in
Malaysia (Fricke et al., 2009; Gunell et al., 2009; Łukasz Mąka, 2016;
Van et al., 2007). This is of great concern as antibiotic resistance in
Salmonella render antibiotics used for treatment of salmonellosis in-
effective (Collard et al., 2007).
Researchers have highlighted that poultry sold in Malaysia is fre-
quently contaminated with Salmonella, however, these studies often
focused on the prevalence at the retail level (Ong, Muniandy, How, Yip,
& Lim, 2014). Longitudinal studies investigating the pathways for the
dissemination of Salmonella, their antibiotic resistance profiles and
biofilm-forming ability are lacking or seldom performed. So in this
study, the genetic relatedness of Salmonella strains isolated from poultry
samples and environment of wet markets and SCPP in northern states of
Malaysia (Penang and Perlis) were undertaken to investigate the dis-
semination and origin or source of these Salmonella strains. In addition,
the antibiotic resistance profiles and the genetic determinants in these
Salmonella strains were also determined. Also, the ability of various
Salmonella serotypes to colonise the contact surfaces of wet markets and
SCPP were determined by examining their ability to form biofilms.
2. Materials and methods
2.1. Salmonella strains
Salmonella enterica subsp. enterica strains used in this study were
previously isolated from a total of 182 poultry and environmental
samples collected from wet markets and SCPP located in Penang and
Perlis, the northern states of Malaysia. Seventeen different Salmonella
serotypes were isolated and the predominant serotypes were S. ser.
Albany, S. ser. Brancaster and S. ser. Corvallis (Nidaullah et al., 2017).
In this study, 114 representative strains of these three predominant
serotypes, S. Albany (n = 53), S. Brancaster (n = 35) and S. Corvallis
(n = 26), were randomly selected for the following studies described
below. Twenty-four and 90 Salmonella strains were isolated from
poultry and environment samples, respectively. Sixty-nine and 45 Sal-
monella strains were obtained from wet markets in Penang and Perlis,
respectively.
2.2. Determination of genetic relatedness using pulsed-field gel
electrophoresis
Pulsed-field gel electrophoresis (PFGE) was conducted according to
the standard operating protocol described by PulseNet, CDC (2017).
DNA of Salmonella strains were digested with 50 U of restriction en-
zyme XbaI (Vivantis, Malaysia), at 37 °C for 2 h. DNA electrophoresis
was performed on 1% (w/v) agarose gel in a CHEF Mapper system
744
Food Research International 105 (2018) 743–751
(BioRad, Hercules, CA) with 0.5 × Tris-Borate EDTA buffer. The gel
was run for 20 h at 14 °C using a linear ramp of 2.16–63.8 s at 6 V/cm.
XbaI-digested Salmonella Braenderup H9812 was used as the DNA size
marker. PFGE gel were stained with GelRed™ Nucleic acid gel stain
(Biotium, USA) and viewed using Gel Doc XR+ System (Bio-Rad, USA).
PFGE data were processed using Bionumerics software version 7.0
(Applied Maths, Kortrijk, Belgium), with the extent of variability de-
termined by the DICE coefficient. Clustering of the fingerprints was
based on the unweighted pair-group method using arithmetic averages
clustering system (UPGMA) with a position tolerance of 1.0%. Simi-
larity coefficient of 0.80 was selected as cut-off values for strain clus-
tering as previously described (Ngoi, Lindstedt, Watanabe, & Thong,
2013).
2.3. Antibiotic resistance profiling
2.3.1. Agar disk diffusion assay
The antibiotic resistance was determined by performing the agar
disk diffusion assay using commercially available antibiotic disks
(Oxoid, Basingstoke, UK) on Mueller-Hinton agar (Oxoid, Basingstoke,
UK) according to the guidelines of the CLSI (2013). Escherichia coli
ATCC 25922 was employed as a positive control. Thirteen antibiotics
(β-lactams: ampicillin 10 μg, ampicillin-sulbactam 10/10 μg, cepha-
lothin 30 μg and ceftriaxone 30 μg; aminoglycosides: gentamicin 10 μg
and streptomycin 10 μg; tetracyclines: tetracycline 30 μg; fluor-
oquinolones: ciprofloxacin 5 μg; quinolones: nalidixic acid 30 μg; folate
pathway inhibitors: sulphamethoxazole/trimethoprim 1.25/23.75 μg,
sulphonamide 300 μg and trimethoprim 5 μg; phenicols: chlor-
amphenicol 30 μg) were selected. The diameter of inhibition zones was
measured and interpreted as resistant by referring to breakpoints sug-
gested by CLSI (2013). Multiple antibiotics resistance (MAR) index was
calculated and interpreted as described by Krumperman (1983). Sal-
monella strains classified as intermediate susceptible on the basis of
inhibition zone were considered as sensitive for MAR as well as re-
sistance spectrum. Strain that was resistant to more than two types of
antibiotic was regarded as multidrug resistant (MDR) (Abia, Ubomba-
Jaswa, & Momba, 2015). Strains having a MAR index of (≤ 0.2) in-
dicates that strains were rarely or never exposed to antibiotics and vice
versa.
2.3.2. Detection of antibiotic resistance genes and integrons using PCR
Genomic DNA was prepared by using phenol-chloroform extraction
method, adapted from dos Santos et al. (2001) with modifications.
Briefly, 1 mL of 18 h culture of each Salmonella strain was centrifuged
and the cell pellets were resuspended in 200 μL of TE buffer (25 mM
Tris-HCl, 10 mM EDTA, pH 8.0) containing 10 mg/mL of lysozyme
(Vivantis, Malaysia). After lysis, 100 μL of 15% (w/v) sodium dodecyl
sulphate was added and incubated at 55 °C for 5–10 min. Subsequently,
100 μL of ice-cooled 3 M sodium acetate (pH 5.2) was added and the
mixture was centrifuged at 13,000 ×g for 10 min at 4 °C. DNA ex-
traction was performed by deproteinising the DNA-containing super-
natant using an equal volume of phenol/chloroform/isoamyl alcohol
solution (25:24:1), and precipitating the DNA using two volumes of ice-
cooled absolute ethanol. The DNA pellets were dried and suspended in
100 μL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Plasmid
DNA was extracted using the Wizard® Plus SV Minipreps DNA Pur-
ification System (Promega, Madison, USA) according to manufacturer's
instructions.
PCR reaction mixtures were prepared as described by Benacer et al.
(2010) and amplification was performed using a TProfessional Standard
Gradient96 Thermocyler (Biometra, Germany). The presence of anti-
biotic resistance genes conferring to resistance against β-lactams, ami-
noglycosides, tetracyclines, quinolones, sulphonamides and chlor-
amphenicol, was detected using primers previously reported (Table 1).
The presence of intl1, intl2 and intl3 genes in those multidrug-resistant
(MDR) Salmonella strains were also performed as previously described
L.-O. Chuah et al. Food Research International 105 (2018) 743–751

Table 1
Primer sequences and PCR amplification conditions for detection of different antibiotic resistant genes.

Genes Primer sequence (5′-3′) PCR conditions Size (bp) Reference

temAa F: ATGAGTATTCAACATTTCCG
R: CTGACAGTTACCAATGCTTA
temBb F: TTTTCGTGTCGCCCTTATTCC
R: CGTTCATCCATAGTTGCCTGACTC
blaPSE-1 F: TGCTTCGCAACTATGACTAC
R: AGCCTGTGTTTGAGCTAGAT
blaOXA-1 F: ACACAATACATATCAACTTCGC
R: AGTGTGTTTAGAATGGTGATC
blaCTX-1 F: ATGTGCAGYACCAGTAARGT
R: TGGGTRAARTARGTSACCAGA
blaSHV-1 F: TTATCTCCCTGTTAGCCACC
R: GATTTGCTGATTTCGCTCGG
blaCMY-2 F: GCACTTAGCCACCTATACGGCAG
R: GCTTTTCAAGAATGCGCCAGG
blaTEMc F: ATGAGTATTCAACATTTCCG
R: ACCAATGCTTAATCAGTGAG
strAc F: CCAATCGCAGATAGAAGGC
R: CTTGGTGATAACGGCAATTC
strB F: ATCGTCAAGGGATTGAAACC
R: GGATCGTAGAACATATTGGC
b
aadA F: ATCCTTCGGCGCGATTTTG
R: GCAGCGCAATGACATTCTTG
tetAb F: GTAATTCTGAGCACTGTCGC
R: CTGCCTGGACAACATTGCTT
tetBb F: CTCAGTATTCCAAGCCTTTG
R: ACTCCCCTGAGCTTGAGGGG
a
tetC F: GGTTGAAGGCTCTCAAGGGC
R: CCTCTTGCGGGAATCGTCC
tetGa F: GCAGCGAAAGCGTATTTGCG
R: TCCGAAAGCTGTCCAAGCAT
qnrAd F: ATTTCTCACGCCAGGATTTG
R: GATCGGCAAAGGTTAGGTCA
d
qnrB F: GATCGTGAAAGCCAGAAAGG
R: ACGATGCCTGGTAGTTGTCC
d
qnrS F: ACGACATTCGTCAACTGCAA
R: TAAATTGGCACCCTGTAGGC
sul1c F: CTTCGATGAGAGCCGGCGGC
R: GCAAGGCGGAAACCCGCGCC
sul2c F: GCGCTCAAGGCAGATGGCATT
R: GCGTTTGATACCGGCACCCGT
cat1 F: CTTGTCGCCTTGCGTATAAT
R: ATCCCAATGGCATCGTAAAG
cat2 F: AACGGCATGATGAACCTGAA
R: ATCCCAATGGCATCGTAAAG
cmlA F: CGCCACGGTGTTGTTGTTAT
R: GCGACCTGCGTAAATGTCAC
floR F: CTGAGGGTGTCGTCATCTAC
R: GCTCCGACAATGCTGACTAT
Intl1 F: GGTCAAGGATCTGGATTTGG
R: ACATGCGTGTAAATCATCGTC
Intl2 F: CACGGATATGCGACAAAAAGGT
R: GTAGCAAACGAGTGACGAAATG
Intl3 F: AGTGGGTGGCGAATGAGTG
R: TGTTCTTGTATCGGCAGGTG
5′CS 3′CS F: GGCATCCAAGCAGCAAG
R: AAGCAGACTTGACCTGA
94 °C (3 min); 30 cycles of 94 °C (30 s), 62 °C (30 s) and 72 °C 867 Benacer et al. (2010)
(1 min); 72 °C (7 min)
79
95 °C (10 min); 30 cycles of 95 °C (30 s), 55 °C (1 min) and 72 °C 438 Chen et al. (2004)
(1 min); 72 °C (7 min)
94 °C (5 min); 35 cycles of 94 °C (1 min), 58 °C (1 min) and 72 °C 813 Yao, Qian, Chen, Wang, and Huang (2007)
(1 min); 72 °C (10 min)
94 °C (7 min); 35 cycles of 94 °C (50 s), 50 °C (40 s) and 72 °C 593 Pagani et al. (2003)
(1 min); 72 °C (8 min)
94 °C (10 min); 35 cycles of 94 °C (30 s), 50 °C (30 s) and 72 °C 795 Weill et al. (2004)
(1 min); 72 °C (10 min)
94 °C (5 min); 25 cycles of 94 °C (45 s), 58 °C (45 s) and 72 °C 758 Archambault et al. (2006)
(1 min); 72 °C (10 min)
94 °C (3 min); 30 cycles of 94 °C (30 s), 53 °C (30 s) and 72 °C 859 Benacer et al. (2010)
(1 min); 72 °C (7 min)
548
95 °C (5 min); 40 cycles of 95 °C (1 min), 53 °C (30 s) and 72 °C 509 Gebreyes and Altier (2002)
(1 min); 72 °C (10 min)
94 °C (3 min); 30 cycles of 94 °C (30 s), 62 °C (30 s) and 72 °C 282 Benacer et al. (2010)
(1 min); 72 °C (7 min)
956
414
505
662
94 °C (4 min); 32 cycles of 94 °C (45 s), 53 °C (45 s) and 72 °C 516 Gay et al. (2006)
(60 s); 72 °C (7 min)
469
417
94 °C (3 min); 30 cycles of 94 °C (30 s), 53 °C (30 s) and 72 °C 435 Benacer et al. (2010)
(1 min); 72 °C (7 min)
293
95 °C (10 min); 30 cycles of 95 °C (30 s), 55 °C (1 min) and 72 °C 508 Chen et al. (2004)
(1 min); 72 °C (7 min)
547
394
673
94 °C (12 min); 30 cycles of 94 °C (30 s), 62 °C (30 s) and 72 °C 443 Machado et al. (2005); Thong and
(1 min); 72 °C (8 min) Modarressi (2011)
747
94 °C (12 min); 30 cycles of 94 °C (30 s), 60 °C (30 s) and 72 °C 563
(1 min); 72 °C (8 min)
94 °C (10 min); 35 cycles of 94 °C (1 min), 55 °C (1 min) and 72 °C variable Levesque et al. (1995)
(5 min); 72 °C (5 min)

a
Multiplex PCR I.
b
Multiplex PCR II.
c
Multiplex PCR III.
d
Multiplex PCR IV.

(Machado et al., 2005; Thong & Modarressi, 2011), using primers listed
in Table 1. The PCR products were subjected to 1.5% (w/v) agarose gel
electrophoresis and 100 bp molecular ladders (Promega, Madison, USA)
was used to estimate the size of PCR products. The PCR products were
stained with EZ-Vision® One DNA dye (Amresco, USA) for direct vi-
sualization after electrophoresis.
Detection of the class 1 integrons on both the total genomic DNA
and plasmid DNA was conducted among all intl1-positive strains by
using 5′CS/3′CS primers (Table 1), as previously described (Levesque,
Piche, Larose, & Roy, 1995). The 16S rRNA primers were included in
PCR amplification when plasmid DNA were used as template, to show
that choromosomal DNA contamination did not occur during the
plasmid DNA extraction. The PCR amplicons (variable sizes) were
purified by Wizard® SV Gel and PCR Clean-Up System (Promega, Ma-
dison, WI, USA) according to the manufacturer's instructions. Sequen-
cing of the purified fragments were performed by a commercial la-
boratory (1st BASE laboratories, Selangor, Malaysia) using the same
primer set and processed using BioEdit software. The identity was de-
termined by comparing the sequences to those in GenBank using
BLASTN (Johnson et al., 2008) available at the National Center for

745
L.-O. Chuah et al.
Biotechnology Information (NCBI, Bethesda, MD, USA).
2.4. Biofilm-forming ability of Salmonella strains
2.4.1. Determination of biofilm morphotypes
The biofilm morphotype for all strains of three Salmonella serotypes
were determined by observing the morphological colony characteristics
of each isolate on Congo red agar plates as previously described
(Karaca, Akcelik, & Akcelik, 2013; Malcova, Hradecka, Karpiskova, &
Rychlik, 2008), with minor modification. Briefly, 10 μL of overnight
culture were placed onto Luria Bertani (LB) agar plate without NaCl
(yeast extract 5 g/L, bacteriological tryptone 10 g/L, bacteriological
agar 15 g/L; Merck, Darmstadt, Germany) containing 80 mg/L Congo
Red (Sigma-Aldrich, USA). The agar plates were incubated at 28 °C and
the colony morphology was observed after 48–96 h of incubation. The
experiment was performed in duplicate.
2.4.2. Quantification of biofilm formation
The ability of Salmonella strains to form biofilms on polystyrene was
determined by crystal violet binding assay as previously described
(Karaca et al., 2013), with minor modifications. Briefly, overnight
culture of Salmonella strains were diluted 100 fold in Tryptic Soy Broth
(TSB). Salmonella enterica subsp. enterica serovar Typhimurium ATCC
13311 and Staphylococcus aureus ATCC 6538P were employed as posi-
tive controls. TSB without cells served as negative control. A hundred
microlitre of each suspension was transferred to polystyrene 96 well
plates and incubated statically for 48 h at 28 °C. After incubation, the
unbound or loosely bound cells were removed. The plates were gently
washed once with sterile distilled water and dried. Cell fixation was
performed by adding 130 μL of ice-cooled 100% methanol to each well,
incubated for 10 min at − 20 °C and aspirated. Then, 130 μL of 1% (w/
v) cystral violet (Merck, Darmstadt, Germany) was added to each well
and incubated for 30 min. The staining liquid was discarded and the
plates were gently washed with sterile distilled water for three times.
The dye bound to the adherent cells was solubilised by adding 130 μL of
ethanol: acetone (80:20; v:v) to each well. The optical density at
595 nm (OD595) was measured by using Multiskan GO Microplate
Spectrophotometer (Thermo Scientific, USA). The experiment was
performed in triplicate. The biofilm-forming abilities of the Salmonella
strains were categorised into different categories by comparing the OD
values of the tested strains and the negative control (ODc). No biofilm
producer: OD ≤ ODc; weak biofilm producer: ODc <
OD ≤ (2 × ODc); moderate biofilm producer: (2 × ODc) <
OD ≤ (4 × ODc); strong biofilm producer: (4 × ODc) < OD.
3. Results and discussion
3.1. Genetic relatedness of Salmonella strains
Ten Salmonella strains were untypable using PFGE. Dendrogram
obtained from PFGE typing and cluster analysis of 104 Salmonella
strains based on the 80% similarity coefficient is shown in Fig. 1. In this
study, Salmonella strains were clustered according to serotypes, at si-
milarity coefficient of 0.71, 0.72 and 0.68 for S. Corvallis, S. Brancaster
and S. Albany, respectively. Salmonella Corvallis and S. Brancaster
strains were both grouped into three clusters with no singleton while S.
Albany strains were grouped into two clusters and four singletons.
PFGE typing demonstrated highly homogenous profiles among Salmo-
nella serotypes isolated from poultry sold in wet markets and their
processing environments in northern Malaysia.
In this study, high genetic relatedness was observed among
Salmonella strains from various sampling point at the same market in-
dicating the prevalence of these clones in the environment. For in-
stance, S. Albany isolated from chicken cuts, food contact surfaces
(knife, drum and cutting board) and environmental samples (apron,
bench wash water, drain water, drain swab and floor) obtained from
746
Food Research International 105 (2018) 743–751
Mata Ayer wet market which is located in Perlis were grouped together
in Cluster 2. Our previous study suggested the dissemination of
Salmonella serotypes in wet market and processing plants occur due to
cross contamination between poultry and its processing environment,
as Salmonella was detected in whole and cut chicken, utensils and
equipment used along the processing line, as well as drain water and
floor around the wet markets and SCPP (Nidaullah et al., 2017). In this
study, the results obtained from PFGE clustering further support the
observation that cross-contamination between poultry sold in the wet
markets and their processing environment occurs and the contamina-
tion was due to the same Salmonella serotypes.
Furthermore, we also reported that S. Corvallis, S. Brancaster and S.
Albany have probably spread clonally in northern Malaysia as
Salmonella strains of the serotypes isolated from different wet markets
in these states were genetically related. Ngoi et al. (2013) reported that
S. Typhimurium isolated from zoonotic, food and clinical sources from
various states in Malaysia were clonally related. Baggesen, Sandvang,
and Aarestrup (2000) also reported that based on PFGE clustering, 136
strains of zoonotic and clinical strains S. Typhimurium DT104 isolated
from Denmark, Germany, United Kingdom, Spain, and Italy were
clonally related, suggesting the widespread dissemination of this clone
in different parts of the world.
The poultry supply chain in Peninsula Malaysia involves farming of
broilers (integrator-operated and independent broiler farmers), and
marketing/supply of life birds to large- or small-scale processing plants
and wet markets. In local wet markets, the sellers obtained live or
slaughtered birds from independent wholesalers, which normally
supply poultry locally and to a lesser extent, between cities (MyCC,
2014). According to the Malaysian Ministry of Domestic Trade, Co-
operatives and Consumerism, there is no licensed poultry wholesaler in
Perlis but there are 36 wholesalers in Penang (as of September 2013)
(MyCC, 2014). The high genetic relatedness among Salmonella strains
from various wet markets in northern states in Peninsula Malaysia may
be due to the sourcing of poultry from the same farm, as well as cross-
contamination occurring during transportation which leads to the dis-
semination of Salmonella from farm to market. A comprehensive survey
sampling broiler farms will provide concrete evidence on the dis-
semination of Salmonella.
3.2. Antibiotic resistance profiling
In this study, all Salmonella strains except for one strain of S.
Corvallis (99.1%) were multidrug resistant [Table 1 in (Chuah, Shamila
Syuhada, Mohamad Suhaimi, Farah Hanim, & Rusul, 2017]. Salmonella
Corvallis strains were resistant to 2–7 antibiotics (MAR index = 0.33),
while S. Brancaster and S. Albany were resistant to 3–8 (MAR
index = 0.44) and 3–10 (MAR index = 0.57), respectively (Table 2).
Resistance to sulphonamide (96.5%), ampicillin (89.5%), tetracycline
(85.1%), chloramphenicol (75.4%), trimethoprim (68.4%), trimetho-
prim-sulfamethoxazole (67.5%), streptomycin (58.8%) and nalidixic
acid (44.4%) were observed (Table 2). Similar observations have also
been made by other researchers (Ngoi et al., 2013; Soomro et al., 2010).
According to the National Pharmaceutical Control Bureau of Malaysia,
antibiotics approved and generally used in animal husbandry includes
β-lactams (ampicillin, amoxycillin), tetracycline, sulphonamides (sul-
famethazine, sulfadiazine), aminoglycoside (gentamicin, neomycin),
macrolide, fluoroquinolones and cephalosporins (Hamid, 2012); among
these some of the antibiotics are regarded as critically important for
human health and their use in veterinary industry should be restricted
(FAO/WHO/OIE, 2008). Even though chloramphenicol was banned in
veterinary sector in Malaysia (Hamid, 2012), in this study, high per-
centage of chloramphenicol-resistant Salmonella strains were isolated
from poultry (70.8%) and its processing environments (76.7%). The
high chloramphenicol resistance among Salmonella serotypes isolated
from chicken is most probably due to long term and frequent use of
chloramphenicol in poultry farming in Malaysia.
L.-O. Chuah et al. Food Research International 105 (2018) 743–751

Fig. 1. Genetic relatedness and antibiotic resistance in the predominant Salmonella strains isolated from naturally contaminated poultry and their processing environment. Grouping of
PFGE fingerprints were performed by the unweighted pair group method using arithmetric averages clustering algorithm (UPGMA), with a position tolerance of 1.0%. Dotted line
represents the similarity coefficient of 0.80. Strains showing similarity coefficient ≥ 0.80 were grouped together and considered as not significantly different. PFGE clusters of S.
Corvallis, S. Brancaster and S. Albany were presented in capital Roman alphabets, Roman numerals and numbers. Abbreviations: CN, gentamicin 10 μg; S, streptomycin 10 μg; AMP,
ampicillin 10 μg; CRO, ceftriaxone 30 μg; KF, cephalothin 30 μg; SAM, ampicillin-sulbactam 10/10 μg; CIP, ciprofloxacin 5 μg; NA, nalidixic acid 30 μg; C, chloramphenicol 30 μg; SXT,
sulphamethoxazole/trimethoprim 1.25/23.75 μg; W, trimethoprim 5 μg; S3, sulphonamide 300 μg; TE, tetracycline 30 μg.

Different antibiotic resistance profiles were observed among the chloramphenicol-trimethoprim, sulfamethoxazole-trimethoprim-sul-
three predominant serotypes [Fig. 1 and Table 1 in (Chuah et al., 2017]. phonamide-tetracycline and ampicillin-nalidixic acid-chloramphenicol-
The most common antibiogram among S. Corvallis strains was strep- trimethoprim, sulfamethoxazole-trimethoprim-sulphonamide-tetra-
tomycin-ampicillin-sulphonamide-tetracycline, while ampicillin- cycline among S. Brancaster and S. Albany strains, respectively [Table 1

747
L.-O. Chuah et al. Food Research International 105 (2018) 743–751

Table 2 114 Salmonella strains harboured one to nine antibiotic resistance genes
Number (%) of antibiotic-resistant strains of S. Corvallis, S. Brancaster and S. Albany [Table S1 in (Chuah et al., 2017]. Recently, a draft genome sequence of
isolated from naturally contaminated poultry and their processing environment in
MDR S. Brancaster, isolated from chicken meat obtained in a wet
northern Malaysia against members of six different classes of antibiotics.
market in Malaysia showed that this strain harboured genes conferring
Antibiotics Number (%) of resistant strains resistance to phenicols, sulphonamides, tetracyclines, aminoglycosides,
fluoroquinolones, macrolides and trimethoprim (Chin, Yu, Ang, Yin, &
S. Corvallis S. Brancaster S. Albany Total Chan, 2017). Similar findings were reported in this study. Our results
(n = 26) (n = 35) (n = 53) (n = 114)
showed the presence of resistance genes conferring phenotypic re-
β-lactams sistance against chloramphenicol (floR and cmlA), tetracycline (tetA,
Ampicillin 16 (61.5) 35 (100.0) 51 (96.2) 102 (89.5) tetB and tetG), sulphonamides (sul1 and sul2), ampicillin (temB), β-lac-
Ampicillin-sulbactam 2 (7.7) 3 (8.6) 9 (17.0) 14 (9.7) tamase (blaPSE-1) and aminoglycosides (strA and aadA), which corre-
Cephalothin 1 (3.8) 0 (0.0) 11 (20.8) 12 (10.5)
sponds to the phenotypic resistance observed in this study (Table 3).
Ceftriaxone 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)
Antibiotic resistance genes detected in this study are potentially
Aminoglycosides
transferrable such as blaPSE-1, sul1, floR, aadA and tetG, which are often
Gentamicin 0 (0.0) 1 (2.9) 6 (11.3) 7 (6.1)
Streptomycin 22 (84.6) 17 (48.6) 28 (52.8) 67 (58.8) located on the Salmonella Genomic Island 1, while floR, strA, aadA, sul1,
Tetracycline 25 (96.2) 31 (88.6) 41 (77.4) 97 (85.1) sul2, tetA and qnr genes are usually found on plasmids (Glenn et al.,
Quinolones 2011; Jacoby, Strahilevitz, & Hooper, 2014).
Ciprofloxacin 1 (3.8) 0 (0.0) 3 (5.7) 4 (3.5) Discrepancy between phenotypic and genotypic resistance, how-
Nalidixic acid 2 (7.7) 1 (2.9) 49 (92.5) 52 (45.6) ever, was observed in nalidixic acid (Fig. 1 and Table 3). The presence
Folate pathway inhibitors of qnrS and qnrA were reported in 23/26 and 10/26 strains of S. Cor-
Sulphamethoxazole/ 4 (15.4) 26 (74.3) 47 (88.7) 77 (67.5) vallis, respectively, while phenotypic resistance to nalidixic acid was
trimethoprim observed in only two strains of S. Corvallis. As for S. Brancaster, 34/35
Trimethoprim 4 (15.4) 26 (74.3) 48 (90.6) 78 (68.4)
strains harboured qnrS while phenotypic resistance to nalidixic acid
Sulphonamide 26 (100.0) 31 (88.6) 53 (100.0) 110 (96.5)
Chloramphenicol 8 (30.8) 30 (85.7) 48 (90.6) 86 (75.4) was observed in only one strain. The presence of these plasmid-medi-
MAR 0.33 0.44 0.57 ated genes in nalidixic acid-sensitive strains of S. Corvallis and S.
Brancaster were mainly due to qnr genes which confers low level re-
sistance to quinolone leading to decrease in susceptibility, which does
in (Chuah et al., 2017]. Resistance to trimethoprim-sulfamethoxazole, not exceed the CLSI breakpoint (Xu et al., 2007). These genes none-
trimethoprim and chloramphenicol was detected in most of S. Albany theless assist in the selection of higher-level resistance against quino-
and S. Brancaster strains, while most of S. Corvallis strains were sus- lones (Gunell et al., 2009; Jacoby et al., 2014) and their presence in
ceptible to these antibiotics. Most of S. Albany strains (n = 49) were pathogens further complicates treatment. Most S. Albany strains
resistant to nalidixic acid, while S. Brancaster and S. Corvallis strains (92.5%) were phenotypically resistant to nalidixic acid, but only 14/53
were susceptible to this antibiotic (Table 2). The high prevalence of (26.4%) of the strains harboured qnrA and/or qnrS. The discrepancy
MDR Salmonella isolated from poultry sold in wet markets is alarming between phenotypic and genotypic resistance might be attributed to the
as various studies have reported on the transmission of mobile genetic presence of other genes responsible for phenotypic resistance, which
determinants (such as plasmids, transposons and gene cassettes in in- were not being detected in this study (Jacoby et al., 2014).
tegrons) and resistant pathogens from poultry to human (Economou & Our findings showed that certain genes conferring phenotypic an-
Gousia, 2015; Thong et al., 2002; van den Bogaard, London, Driessen, & tibiotic resistance were serovar-specific (Table 3). For examples, high
Stobberingh, 2001). percentage of resistance to sulphonamides was detected in all three
In order to investigate the potential dissemination of antibiotic re- Salmonella serotypes, however most of the S. Corvallis strains har-
sistance determinants in poultry and its processing environments in boured sul2, whereas S. Albany strains harboured sul1. Similarly, all
northern Malaysia, antibiotic resistance genes harboured by Salmonella tetracycline-resistant S. Corvallis and S. Brancaster strains harboured
strains and the presence of integrons were determined (Table 3). All only tetA, whereas both tetG and tetA conferred phenotypic resistance in

Table 3
Determination of antibiotic resistance determinant harboured by S. Corvallis, S. Brancaster and S. Albany strains isolated from naturally contaminated poultry and processing en-
vironment in northern Malaysia.

Antibiotic class Resistance gene S. Corvallis (n = 26) S. Brancaster (n = 35) S. Albany (n = 53) Total (n = 114)

β-Lactamase blaPSE-1 7 10 39 56
Ampicillin temB 7 30 26 63
Streptomycin strA 17 7 20 44
aadA 1 6 16 23
strA + aadA 1 3 11 15
Sulphonamide sul1 5 6 46 57
sul2 20 11 9 40
sul1 + sul2 3 4 8 15
Nalidixic acid qnrA 10 0 2 12
qnrS 23 34 13 70
qnrA + qnrS 9 0 1 10
Tetracycline tetA 22 32 17 71
tetB 1 0 0 1
tetG 0 0 21 21
tetA + tetB 1 0 0 1
Chloramphenicol floR 16 33 51 100
cmlA 11 7 42 60
floR + cmlA 11 7 41 59
Integrase intl-1 6 25 45 76

748
L.-O. Chuah et al. Food Research International 105 (2018) 743–751

S. Albany. Interestingly, antibiotic resistance gene specific to certain Table 5

PFGE cluster was also observed [Table S1 in (Chuah et al., 2017]. Our Biofilm morphotypes and biofilm forming ability of the predominant Salmonella serovars.
results showed that most of the ampicillin-resistant S. Albany strains
Salmonella serovars No. of CRA morphotypea Biofilm forming ability
grouped in Cluster 1, harboured temB but not blaPSE-1, whereas most of isolate (no. of isolate) (%)b
those grouped in Cluster 2 harboured blaPSE-1 but not temB. Similarly, S.
Albany strains grouped in Cluster 1 harboured only tetA, while tetG was Strong Moderate
only detected in S. Albany strains grouped in Cluster 2. Moreover, aadA
S. Corvallis (poultry) 4 rdar (4) 3 (75.0) 1 (25.0)
was detected in S. Albany strains grouped in Cluster 1, but not in S. Corvallis 22 rdar (20), srad (2) 14 8 (36.4)
Cluster 2. (environment) (63.6)
Our results suggest the acquisition and horizontal transfer of anti- S. Brancaster 11 rdar (11) 7 (63.6) 4 (36.4)
biotic resistance genes in Salmonella isolated from poultry and its pro- (poultry)
S. Brancaster 24 rdar (23), srad (1) 14 10 (41.7)
cessing environment are mediated via integrons. Table 3 shows that the
(environment) (58.3)
integrase gene was detected in 76/114 Salmonella strains. All Salmonella S. Albany (poultry) 9 rdar (9) 8 (88.9) 1 (11.1)
strains positive for integrase gene harboured intl-1. None of the Sal- S. Albany 44 rdar (44) 33 11 (25.0)
monella strains carried intl-2 or intl-3. High prevalence of intl-1 was (environment) (75.0)
Total 114 rdar (111), srad (3) 79 35 (30.7)
observed in both S. Albany (84.9%) and S. Brancaster (71.4%)strains,
(69.3)
but not among S. Corvallis (23.1%) strains. These results agree with
antibiotic resistance profiles exhibited by Salmonella serotypes with a
Congo Red Agar (CRA) morphotypes (i) rdar (red, dry and rough): produced both
highest MAR index as observed in S. Albany and compared to S. Cor- curli fimbriae and cellulose; (ii) bdar (brown, dry and rough): produced only curli fim-
vallis which had the lowest MAR. Among the 76 intl1-positive strains, briae; (iii) srad (smooth, red and dry): inverse production of curli fimbriae and cellulose;
class 1 integrons with variable regions (size ranging from 0.8 to 1.9 kb) (iv) sbam (smooth, brown and mucoid): not produced neither cellulose nor curli fimbriae
but overproduced capsular polysaccharide; (v) saw (smooth and wet): not produced
were detected in 63 strains, while the rest of the serotypes did not
neither fimbriae nor cellulose.
harbour gene cassette (Table 4). Three integron profiles (IP) were b
No biofilm producer: OD ≤ ODc; weak biofilm producer: ODc < OD ≤ (2 × ODc);
identified and designated as IP-I (1.2 kb), IP-II (1.9 kb) and IP-III moderate biofilm producer: (2 × ODc) < OD ≤ (4 × ODc); strong biofilm producer:
(1.2 + 0.8 kb), respectively. IP-I was the most prevalent (60/63 strains) (4 × ODc) < OD.
and was observed in S. Corvallis, S. Brancaster and S. Albany. IP-II was
detected in one strain of S. Brancaster, while IP-III was detected in one production of extracellular matrices such as curli fimbriae and cellulose
strain each of S. Corvallis and S. Brancaster, respectively (Table 4). DNA (Anriany, Sahu, Wessels, McCann, & Joseph, 2006; Malcova et al.,
sequencing of the PCR amplicons revealed the variable regions for the 2008; Turki et al., 2012).
gene cassettes encoding dfrA1 and dfrA12 conferred resistance to tri- In this study, two biofilm morphotypes were detected on Congo red
methoprim, aadA2 conferred resistance to streptomycin, and an open agar, 111/114 strains exhibited rdar morphotype, while three were srad
reading frame (ORF) orfC encodes membrane protein. A 200 bp frag- morphotypes (Table 5). Other researchers have reported that for Sal-
ment which contained an ORF segment of the purG gene which encoded monella, the rdar colony morphotype were highly resistant to desicca-
for phosphoribosylformylglycinamide synthetase, was also detected in tion attributed to their ability to produce both curli fimbriae and cel-
two intl1-positive Salmonella strains. Amplification of plasmid DNA lulose (White, Gibson, Kim, Kay, & Surette, 2006). The biofilm-forming
using 16S rRNA primers produced no band for all intl1-positive strains, ability of these Salmonella strains was further supported by the crystal
indicating that all integrons in this study were located on plasmids binding assay which showed that 79/114 strains (69.3%) were strong
(results not shown). biofilm producers while the rest were medium biofilm producers
(Table 5). Highest ability to form biofilm was observed among S. Al-
3.3. Biofilm-forming ability of Salmonella strains bany strains (77.4%), followed by S. Corvallis (65.4%) and S. Bran-
caster (60.0%).
Our study also reports on the possible occurrence of persistent Nair et al. (2015) reported moderate biofilm-producing ability in
Salmonella in wet markets and SCPP in northern Malaysia, as reflected Salmonella isolated from poultry and environmental samples obtained
by the high genetic relatedness among Salmonella strains from wet from various parts of India. Similarly, Zadernowska and Chajęcka-
markets located in Penang and Perlis. Various researchers have also Wierzchowska (2017) reported that none of the Salmonella isolated
reported on the occurrence of persistent pathogens in food processing from meats sold in local wet markets in Poland was strong biofilm
premises (Dominguez et al., 2009; Sheth et al., 2011; Thong et al., producer, seven strains each demonstrated moderate or low ability, and
2002). The occurrence of persistent pathogens can be attributed to the 2/16 strains were unable to form biofilm. It is alarming to note that in
formation of biofilms which provide a heaven for the survival of these this study, most of 24 Salmonella strains from chicken samples were
pathogens. Experiments were performed to determine the ability of strong biofilm producers. Salmonella enterica is reported to be able to
Salmonella serotypes to form biofilms. Biofilm-forming Salmonella were form biofilms on material commonly encountered in food-processing
grouped into four distinct morphotypes (namely rdar, bdar, srad and premises, such as plastic, stainless steel and cement (Joseph et al.,
sbam) based on their biofilm-forming ability and the extracellular 2001). Cells in biofilm are more resistant and can be a source of con-
structures contributing to biofilm formation. Strong biofilm formation tinuous contamination. Our findings showed that the formation of
in Salmonella is usually associated with rugose (rdar) phenotype and the biofilm on food contact surfaces or food processing equipment leads to
adaptation and is a long-term survival strategy adopted by MDR Sal-
Table 4 monella at various sites in wet markets and poultry processing plants in
Distribution of class 1 integron in multidrug-resistant Salmonella serovars. northern Malaysia.

Integron Size (kb) Genes No. of isolates Percentage

cassettes (n = 63) profile
Profile (IP) 4. Conclusion

IP-I 1.2 dfrA1, orfC 60 95.2 The results obtained in this study demonstrated that clonally-related
IP-II 1.9 dfrA12-orf- 1 1.7
Salmonella serotypes which were resistant to multiple antibiotics were
aadA2
IP-III 1.2 + 0.8 dfrA1, orfC 2 3.3 frequently present in poultry meats and their processing environments
in northern Malaysia. Our findings suggested that likely the persistent

749
L.-O. Chuah et al.
Salmonella colonises various sites in the processing environment by
producing biofilm, leading to widespread dissemination of these MDR
Salmonella in North Malaysia. The presence of MDR Salmonella strains
in poultry meat is of great concern, considering their extremely re-
sistant phenotypes and various transferable determinants (plasmid-
mediated antibiotic resistance genes and integrons) they harbour. Our
results highlight the need for strict hygiene and sanitation standards to
reduce the incidence of Salmonella in poultry and their processing en-
vironments, as well as the judicious use of antibiotics in poultry farming
to curtail the emergence of MDR in zoonotic foodborne pathogenic
bacteria. In addition, a national surveillance program focusing on
monitoring the antibiotic resistance profiles and DNA fingerprinting of
foodborne Salmonella in poultry meats and their processing environ-
ment (in particular, wet market and SCPP) should be established.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgements
The authors would like to thank Kangar Food Safety and Quality
Control Laboratory for the use of PFGE facilities. This work was sup-
ported by Research University Grant Scheme (1001/PTEKIND/811289)
of Ministry of Higher Education, Malaysia.
References
Abia, A. L. K., Ubomba-Jaswa, E., & Momba, M. N. B. (2015). High prevalence of mul-
tiple-antibiotic-resistant (MAR) Escherichia coli in river bed sediments of the Apies
River, South Africa. Environmental Monitoring and Assessment, 187, 652. http://dx.doi.
org/10.1007/s10661-015-4879-6.
Adzitey, F., Rusul, G., & Huda, N. (2012). Prevalence and antibiotic resistance of
Salmonella serovars in ducks, duck rearing and processing environments in Penang,
Malaysia. Food Research International, 45(2), 947–952. http://dx.doi.org/10.1016/j.
foodres.2011.02.051.
Anonymous (2013). Poultry slaughtering banned in wet markets to curb river pollution, spread
of infectious diseases. The Star. Retrieved from http://www.thestar.com.my/news/
nation/2013/09/03/poultry-slaughter-ban-markets/.
Anriany, Y., Sahu, S. N., Wessels, K. R., McCann, L. M., & Joseph, S. W. (2006). Alteration
of the rugose phenotype in waaG and ddhC mutants of Salmonella enterica serovar
typhimurium DT104 is associated with inverse production of curli and cellulose.
Applied and Environmental Microbiology, 72(7), 5002–5012. http://dx.doi.org/10.
1128/aem.02868-05.
Archambault, M., Petrov, P., Hendriksen, R. S., Asseva, G., Bangtrakulnonth, A., Hasman,
H., & Aarestrup, F. M. (2006). Molecular characterization and occurrence of ex-
tended-spectrum beta-lactamase resistance genes among Salmonella enterica serovar
Corvallis from Thailand, Bulgaria, and Denmark. Microbial Drug Resistance, 12(3),
192–198. http://dx.doi.org/10.1089/mdr.2006.12.192.
Arumugaswamy, R. K., Rusul, G., Abdul Hamid, S. N., & Cheah, C. T. (1995). Prevalence
of Salmonella in raw and cooked foods in Malaysia. Food Microbiology, 12, 3–8. http://
dx.doi.org/10.1016/S0740-0020(95)80072-7.
Baggesen, D. L., Sandvang, D., & Aarestrup, F. M. (2000). Characterization of Salmonella
enterica serovar typhimurium DT104 isolated from Denmark and comparison with
isolates from Europe and the United States. Journal of Clinical Microbiology, 38(4),
1581–1586.
Benacer, D., Thong, K. L., Watanabe, H., & Puthucheary, S. D. (2010). Characterization of
drug resistant Salmonella enterica serotype typhimurium by antibiograms, plasmids,
integrons, resistance genes and PFGE. Journal of Microbiology and Biotechnology,
20(6), 1042–1052.
van den Bogaard, A. E., London, N., Driessen, C., & Stobberingh, E. E. (2001). Antibiotic
resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaugh-
terers. Journal of Antimicrobial Chemotherapy, 47(6), 763–771. http://dx.doi.org/10.
1093/jac/47.6.763.
CDC (2017). Standard operating procedure for PulseNet PFGE of Escherichia coli O157:H7,
Escherichia coli non-O157 (STEC), Salmonella serotypes, Shigella sonnei and Shigella
flexneri (pp. 13). Atlanta, GA, USA: Centers for Disease Control and Prevention.
Chen, S., Zhao, S., White, D. G., Schroeder, C. M., Lu, R., Yang, H., ... Meng, J. (2004).
Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from
retail meats. Applied and Environmental Microbiology, 70(1), 1–7.
Chin, P. S., Yu, C. Y., Ang, G. Y., Yin, W.-F., & Chan, K.-G. (2017). Draft genome sequence
of multidrug-resistant Salmonella enterica serovar Brancaster strain PS01 isolated
from chicken meat, Malaysia. Journal of Global Antimicrobial Resistance, 9, 41–42.
http://dx.doi.org/10.1016/j.jgar.2016.12.017.
Chuah, L.-O., Shamila Syuhada, A. K., Mohamad Suhaimi, I., Farah Hanim, T., & Rusul, G.
(2017). Data on antibiogram and resistance genes harboured by Salmonella strains
and their pulsed-field gel electrophoresis clusters. Data in Brief submitted.
750
Food Research International 105 (2018) 743–751
CLSI (2013). Performance standards for antimicrobial susceptibility testing; twenty-third in-
formational supplement (M100-S23). Pennsylvania, USA: Clinical and Laboratory
Standards Institute72–81.
Collard, J.-M., Place, S., Denis, O., Rodriguez-Villalobos, H., Vrints, M., Weill, F.-X., ...
Bertrand, S. (2007). Travel-acquired salmonellosis due to Salmonella Kentucky re-
sistant to ciprofloxacin, ceftriaxone and co-trimoxazole and associated with treat-
ment failure. Journal of Antimicrobial Chemotherapy, 60(1), 190–192. http://dx.doi.
org/10.1093/jac/dkm114.
Dominguez, M., Jourdan-Da Silva, N., Vaillant, V., Pihier, N., Kermin, C., Weill, F. X., ...
de Valk, H. (2009). Outbreak of Salmonella enterica serotype Montevideo infections
in France linked to consumption of cheese made from raw milk. Foodborne Pathogens
and Disease, 6(1), 121–128. http://dx.doi.org/10.1089/fpd.2008.0086.
Economou, V., & Gousia, P. (2015). Agriculture and food animals as a source of anti-
microbial-resistant bacteria. Infection and Drug Resistance, 8, 49–61. http://dx.doi.
org/10.2147/IDR.S55778.
El-Azizi, M., & Khardori, N. (2016). Efficacy of ultraviolet C light at sublethal dose in
combination with antistaphylococcal antibiotics to disinfect catheter biofilms of
methicillin-susceptible and methicillin-resistant Staphylococcus aureus and
Staphylococcus epidermidis in vitro. Infection and Drug Resistance, 9, 181–189. http://
dx.doi.org/10.2147/IDR.S109343.
FAO/WHO/OIE (2008). Joint FAO/WHO/OIE expert meeting on critically important anti-
microbials. Report of a meeting held in FAO, Rome, Italy, 26–30 November 2007 FAO,
Rome, Italy, and WHO, Geneva, Switzerland.
Finn, S., Hinton, J. C., McClure, P., Amezquita, A., Martins, M., & Fanning, S. (2013).
Phenotypic characterization of Salmonella isolated from food production environ-
ments associated with low-water activity foods. Journal of Food Protection, 76(9),
1488–1499. http://dx.doi.org/10.4315/0362-028x.jfp-13-088.
Fricke, W. F., McDermott, P. F., Mammel, M. K., Zhao, S., Johnson, T. J., Rasko, D. A., ...
Ravel, J. (2009). Antimicrobial resistance-conferring plasmids with similarity to
virulence plasmids from avian pathogenic Escherichia coli strains in Salmonella en-
terica Serovar Kentucky isolates from poultry. Applied and Environmental Microbiology,
75(18), 5963–5971. http://dx.doi.org/10.1128/aem.00786-09.
Gay, K., Robicsek, A., Strahilevitz, J., Park, C. H., Jacoby, G., Barrett, T. J., ... Hooper, D.
C. (2006). Plasmid-mediated quinolone resistance in non-typhi serotypes of
Salmonella enterica. Clinical Infectious Diseases, 43(3), 297–304. http://dx.doi.org/10.
1086/505397.
Gebreyes, W. A., & Altier, C. (2002). Molecular characterization of multidrug-resistant
Salmonella enterica subsp. enterica serovar typhimurium isolates from swine. Journal
of Clinical Microbiology, 40(8), 2813–2822.
Giaouris, E., Chorianopoulos, N., & Nychas, G. J. (2005). Effect of temperature, pH, and
water activity on biofilm formation by Salmonella enterica enteritidis PT4 on stainless
steel surfaces as indicated by the bead vortexing method and conductance mea-
surements. Journal of Food Protection, 68(10), 2149–2154.
Glenn, L. M., Lindsey, R. L., Frank, J. F., Meinersmann, R. J., Englen, M. D., Fedorka-Cray,
P. J., & Frye, J. G. (2011). Analysis of antimicrobial resistance genes detected in
multidrug-resistant Salmonella enterica serovar typhimurium isolated from food ani-
mals. Microbial Drug Resistance, 17(3), 407–418. http://dx.doi.org/10.1089/mdr.
2010.0189.
Gunell, M., Webber, M. A., Kotilainen, P., Lilly, A. J., Caddick, J. M., Jalava, J., ...
Piddock, L. J. V. (2009). Mechanisms of resistance in nontyphoidal Salmonella en-
terica strains exhibiting a nonclassical quinolone resistance phenotype. Antimicrobial
Agents and Chemotherapy, 53(9), 3832–3836. http://dx.doi.org/10.1128/aac.
00121-09.
Hamid, A. N. (2012). Country report: Malaysia, presented at FAO international workshop
on the use of antimicrobials in livestock production and antimicrobials resistance in
the Asia Pacific region, 22–23 October 2012, Negombo, Sri Lanka. Retrieved from
http://cdn.dairyasia.org/APHCA/dmdocuments/Events/36th_APHCA_Session/
Papers/Country%20Report_Malaysia%20F.pdf.
Jacoby, G. A., Strahilevitz, J., & Hooper, D. C. (2014). Plasmid-mediated quinolone re-
sistance. Microbiology Spectrum, 2(2), http://dx.doi.org/10.1128/microbiolspec.
PLAS-0006-2013.
Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., & Madden, T. L.
(2008). NCBI BLAST: A better web interface. Nucleic Acids Research, 36, W5–9.
http://dx.doi.org/10.1093/nar/gkn201.
Joseph, B., Otta, S. K., Karunasagar, I., & Karunasagar, I. (2001). Biofilm formation by
Salmonella spp. on food contact surfaces and their sensitivity to sanitizers.
International Journal of Food Microbiology, 64(3), 367–372. http://dx.doi.org/10.
1016/S0168-1605(00)00466-9.
Karaca, B., Akcelik, N., & Akcelik, M. (2013). Biofilm-producing abilities of Salmonella
strains isolated from Turkey. Biologia, 68(1), 1–10. http://dx.doi.org/10.2478/
s11756-012-0138-2.
Krumperman, P. H. (1983). Multiple antibiotic resistance indexing of Escherichia coli to
identify high-risk sources of fecal contamination of foods. Applied and Environmental
Microbiology, 46, 165–170.
Landers, T. F., Cohen, B., Wittum, T. E., & Larson, E. L. (2012). A review of antibiotic use
in food animals: Perspective, policy, and potential. Public Health Reports, 127(1),
4–22.
Levesque, C., Piche, L., Larose, C., & Roy, P. H. (1995). PCR mapping of integrons reveals
several novel combinations of resistance genes. Antimicrobial Agents and
Chemotherapy, 39(1), 185–191.
Łukasz Mąka, M. P. (2016). Antimicrobial resistance of Salmonella spp. isolated from food.
Roczniki Państwowego Zakładu Higieny, 67(4), 343–358.
Machado, E., Cantón, R., Baquero, F., Galán, J.-C., Rollán, A., Peixe, L., & Coque, T. M.
(2005). Integron content of extended-spectrum-β-lactamase-producing Escherichia
coli strains over 12 years in a single hospital in Madrid, Spain. Antimicrobial Agents
and Chemotherapy, 49(5), 1823–1829. http://dx.doi.org/10.1128/AAC.49.5.1823-
L.-O. Chuah et al.
1829.2005.
Malcova, M., Hradecka, H., Karpiskova, R., & Rychlik, I. (2008). Biofilm formation in field
strains of Salmonella enterica serovar typhimurium: Identification of a new colony
morphology type and the role of SGI1 in biofilm formation. Veterinary Microbiology,
129(3–4), 360–366. http://dx.doi.org/10.1016/j.vetmic.2007.12.006.
Marin, C., Hernandiz, A., & Lainez, M. (2009). Biofilm development capacity of
Salmonella strains isolated in poultry risk factors and their resistance against disin-
fectants. Poultry Science, 88(2), 424–431. http://dx.doi.org/10.3382/ps.2008-00241.
MyCC (2014). Review of domestic broiler market: Final report. Retrieved from Malaysia
http://www.mycc.gov.my/sites/default/files/media-review/Broiler-Market-Review-
FINAL.pdf.
Nair, A., Rawool, D. B., Doijad, S., Poharkar, K., Mohan, V., Barbuddhe, S. B., ...
Balasaravanan, T. (2015). Biofilm formation and genetic diversity of Salmonella iso-
lates recovered from clinical, food, poultry and environmental sources. Infection,
Genetics and Evolution, 36, 424–433. http://dx.doi.org/10.1016/j.meegid.2015.08.
012.
Ngoi, S. T., Lindstedt, B. A., Watanabe, H., & Thong, K. L. (2013). Molecular character-
ization of Salmonella enterica serovar typhimurium isolated from human, food, and
animal sources in Malaysia. Japanese Journal of Infectious Diseases, 66(3), 180–188.
http://dx.doi.org/10.7883/yoken.66.180.
Nhung, N., Cuong, N., Thwaites, G., & Carrique-Mas, J. (2016). Antimicrobial usage and
antimicrobial resistance in animal production in Southeast Asia: A review. Antibiotics,
5(4), 37.
Nidaullah, H., Abirami, N., Shamila-Syuhada, A., Chuah, L., Nurul, H., Tan, T., ... Rusul,
G. (2017). Prevalence of Salmonella in poultry processing environments in wet
markets in Penang and Perlis, Malaysia. Veterinary World, 10(3), 286–292.
Ong, L. P., Muniandy, K., How, S. P., Yip, L. S., & Lim, B. K. (2014). Salmonella isolation
from poultry farms in Malaysia from 2011 to 2013. Malaysian Journal of Veterinary
Research, 5(1), 180–181.
Pagani, L., Dell'Amico, E., Migliavacca, R., D'Andrea, M. M., Giacobone, E., Amicosante,
G., ... Rossolini, G. M. (2003). Multiple CTX-M-type extended-spectrum β-lactamases
in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. Journal
of Clinical Microbiology, 41(9), 4264–4269. http://dx.doi.org/10.1128/JCM.41.9.
4264-4269.2003.
Rusul, G., Khair, J., Radu, S., Cheah, C. T., & Yassin, R. M. (1996). Prevalence of
Salmonella in broilers at retail outlets, processing plants and farms in Malaysia.
International Journal of Food Microbiology, 33(2), 183–194. http://dx.doi.org/10.
1016/0168-1605(96)01125-7.
dos Santos, L. R. D., do Nascimento, V. P., de Oliveira, S. D., Flores, M. L., Pontes, A. P.,
Ribeiro, A. R., ... Lopes, R. F. F. (2001). Polymerase chain reaction (PCR) for the
detection of Salmonella in artificially inoculated chicken meat. Revista do Instituto de
Medicina Tropical de São Paulo, 43, 247–250.
Shafini, A. B., Son, R., Mahyudin, N. A., Rukayadi, Y., & Tuan Zainazor, T. C. (2017).
Prevalence of Salmonella spp. in chicken and beef from retail outlets in Malaysia.
International Food Research Journal, 24(1), 437–449.
Sheth, A. N., Hoekstra, M., Patel, N., Ewald, G., Lord, C., Clarke, C., ... Lynch, M. (2011).
A national outbreak of Salmonella serotype Tennessee infections from contaminated
peanut butter: A new food vehicle for salmonellosis in the United States. Clinical
Infectious Diseases, 53(4), 356–362. http://dx.doi.org/10.1093/cid/cir407.
Shi, X., & Zhu, X. (2009). Biofilm formation and food safety in food industries. Trends in
Food Science & Technology, 20(9), 407–413. http://dx.doi.org/10.1016/j.tifs.2009.01.
054.
Soomro, A. H., Khaskheli, M., Bhutto, M. B., Shah, G., Memon, A., & Dewani, P. (2010).
Prevalence and antimicrobial resistance of Salmonella serovars isolated from poultry
751
Food Research International 105 (2018) 743–751
meat in Hyderabad, Pakistan. Turkish Journal of Veterinary and Animal Sciences, 34(5),
455–460.
Spector, M. P., & Kenyon, W. J. (2012). Resistance and survival strategies of Salmonella
enterica to environmental stresses. Food Research International, 45(2), 455–481.
http://dx.doi.org/10.1016/j.foodres.2011.06.056.
Steenackers, H., Hermans, K., Vanderleyden, J., & De Keersmaecker, S. C. J. (2012).
Salmonella biofilms: An overview on occurrence, structure, regulation and eradica-
tion. Food Research International, 45(2), 502–531. http://dx.doi.org/10.1016/j.
foodres.2011.01.038.
Tabak, M., Scher, K., Chikindas, M. L., & Yaron, S. (2009). The synergistic activity of
triclosan and ciprofloxacin on biofilms of Salmonella typhimurium. FEMS Microbiology
Letters, 301(1), 69–76. http://dx.doi.org/10.1111/j.1574-6968.2009.01804.x.
Thong, K. L., Goh, Y. L., Radu, S., Noorzaleha, S., Yasin, R., Koh, Y. T., ... Puthucheary, S.
D. (2002). Genetic diversity of clinical and environmental strains of Salmonella en-
terica serotype Weltevreden isolated in Malaysia. Journal of Clinical Microbiology,
40(7), 2498–2503. http://dx.doi.org/10.1128/jcm.40.7.2498-2503.2002.
Thong, K. L., & Modarressi, S. (2011). Antimicrobial resistant genes associated with
Salmonella from retail meats and street foods. Food Research International, 44(9),
2641–2646. http://dx.doi.org/10.1016/j.foodres.2011.05.013.
Turki, Y., Ouzari, H., Mehri, I., Ben Aissa, R., & Hassen, A. (2012). Biofilm formation,
virulence gene and multi-drug resistance in Salmonella Kentucky isolated in Tunisia.
Food Research International, 45(2), 940–946. http://dx.doi.org/10.1016/j.foodres.
2011.05.031.
Van, T. T. H., Moutafis, G., Istivan, T., Tran, L. T., & Coloe, P. J. (2007). Detection of
Salmonella spp. in retail raw food samples from Vietnam and characterization of their
antibiotic resistance. Applied and Environmental Microbiology, 73(21), 6885–6890.
http://dx.doi.org/10.1128/aem.00972-07.
Vestby, L. K., Møretrø, T., Ballance, S., Langsrud, S., & Nesse, L. L. (2009). Survival po-
tential of wild type cellulose deficient Salmonella from the feed industry. BMC
Veterinary Research, 5(1), 43. http://dx.doi.org/10.1186/1746-6148-5-43.
Wasyl, D., & Hoszowski, A. (2012). First isolation of ESBL-producing Salmonella and
emergence of multiresistant Salmonella Kentucky in turkey in Poland. Food Research
International, 45(2), 958–961. http://dx.doi.org/10.1016/j.foodres.2011.07.024.
Weill, F. X., Demartin, M., Tande, D., Espie, E., Rakotoarivony, I., & Grimont, P. A.
(2004). SHV-12-like extended-spectrum-beta-lactamase-producing strains of
Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among
infants adopted from Mali. Journal of Clinical Microbiology, 42(6), 2432–2437. http://
dx.doi.org/10.1128/jcm.42.6.2432-2437.2004.
White, A. P., Gibson, D. L., Kim, W., Kay, W. W., & Surette, M. G. (2006). Thin aggregative
fimbriae and cellulose enhance long-term survival and persistence of Salmonella.
Journal of Bacteriology, 188(9), 3219–3227. http://dx.doi.org/10.1128/jb.188.9.
3219-3227.2006.
Xu, X., Wu, S., Ye, X., Liu, Y., Shi, W., Zhang, Y., & Wang, M. (2007). Prevalence and
expression of the plasmid-mediated quinolone resistance determinant qnrA1.
Antimicrobial Agents and Chemotherapy, 51(11), 4105–4110. http://dx.doi.org/10.
1128/AAC.00616-07.
Yao, F., Qian, Y., Chen, S., Wang, P., & Huang, Y. (2007). Incidence of extended-spectrum
beta-lactamases and characterization of integrons in extended-spectrum beta-lacta-
mase-producing Klebsiella pneumoniae isolated in Shantou, China. Acta Biochimica et
Biophysica Sinica Shanghai, 39(7), 527–532.
Zadernowska, A., & Chajęcka-Wierzchowska, W. (2017). Prevalence, biofilm formation
and virulence markers of Salmonella sp. and Yersinia enterocolitica in food of animal
origin in Poland. LWT - Food Science and Technology, 75, 552–556. http://dx.doi.org/
10.1016/j.lwt.2016.10.007.