Heredity

Sexual The production of genetically different offspring from two parents, each producing
Reproduction gametes (Sperm + Egg) which fuse together to create a zygote (Fertilisation)
 Requires two parents of a different gender.
 Undergoes meiosis.
 Fertilization can occur internally (Takes place inside the body of a female, involves
mate attraction, copulation (Sex)  More energy investment, care of young but
fewer eggs need to be produced for success) or externally (Occurs in aquatic
environments so the gametes don’t dry out, produced in large numbers).
 Dominant form of reproduction in many multicellular plants + animals.
 Animal Examples – Egg laying: Insects, reptiles, bird. Live placental births, pouch
raising in marsupials.
 Plant Examples: Production of flowers + cones (Plants rely on external agents to
carry gametes (pollen  bees, animals, wind, water etc…) from one parent to
another (Stigma  Style  Ovary), self-pollination and cross pollination can occur
during fertilisation).
Fertilisation Sperm travels through the oviducts (Fallopian tubes), which may contain an oocyte
(Egg) that has been released from the ovaries. The sperm penetrates the oocyte with
its head (That contains DNA (23 chromosomes) that release enzymes assisting the
penetration). This meeting of germ cells in considered fertilisation. The newly formed
zygote begins to form cells through mitosis, this ball of cells (blastocyte) continues to
multiply through the fallopian tube until it embeds itself into the uterus lining
(endometrium)  this embedding is called Implantation. After, gestation begins.
Ovarian Cycle Follicular Phase (Day 1-
14): Your ovaries prepare
eggs for ovulation. Eggs
develop in your ovaries
inside follicles. One follicle
develops into the
dominant follicle and
releases an egg.
Luteal Phase (Day 14-28):
Starts after ovulation and
prepares your uterus for a
possible pregnancy by
producing progesterone.

Hormones Hormaones are chemical relased into the blood stream that bind with protein
receptors. This binding activates a repsone from specific tissues or cells.
Progesterone Oestrogen and prgesterone levels regulate the ovarian and mestral cycles (Drop in
levels stimulates menstration) and create an ideal conditions for ovulation,
implantation and maintaing preganacy.
Hormone 1. GnRH stimulates anterior lobe cells to secerete FSH (Follicle-stimulating Hormone)
production (In and LH (Lutenising Hormone).
cycles) 2. FSH + LH promote follicle growth and oocyte muturation. It also promotes
oestrogen production wbhich primes the endometrium and initiates other reprodctive
events.
3. Blood levels of oestrogen rises, stimulating surge in LH secretion
4. Surge of LH triggers ovulation (egg pushed into fallopian tubes from follicle) and
formation of the corpus luteum
5. progesterone and small amounts of oestrogen secreted by the corpus luteum
 maintains the endometrium for pregnancy (If it occurs). If fertilisation doesn’t occur
the corpus luteum will begin to degenerate about 8-10 days after ovulation.
6. If pregnancy does not take place the increased progesteron and oestrogen will
inhibit FSH and LH secretion (beginning the cycle again)

Role of 1. Once the embryo implants into the endometrium, the corpus luteum continues to
hormones grow and secrete progesterone for the first three months. In the later six months once
during the placenta has formed and begins producing progesterone, the corpus luteum
Pregnancy shrinks and degenerates.
2. Progesterone maintains the pregnacy by; limiting uterine contractions which could
expell the growing embryo, whicle also reducing the mothers immune response to
foetal antigens (the baby being recognised as a foregin body and destroyed).
Maternal thyroxin: Occurs from gestation  12 weeks, low levels increase
detachment of the placenta and the embryo. Low levels also result in low birth weight
and immature lung development.
Insulin: promotes fetal development
hCG: Is secreted by the embryo and maintain the growth of the corpus luteum till the
placenta can take over progesterone production. It decreases once the placenta is
formed fully in th second trimester
IGF (Insuline-like growth factors): secreted by the uterine lining, it alters placental
transport of nutrients to the fetus’ demands  Pomoting fetal growth.
Oxytocine promotes contractions and crevical wideing for birth. Relaxin also aids in
the softening of the cervix.

Binary Fission Bacteria are a type of Prokaryote, producing asexually in a process called binary
 fission. Binary fission is a relatively simple process, compared to mitosis, because
binary fission does not involve reproducing organelles or complex chromosomes.

 The process starts with the replication of the DNA within the cell.
 The DNA is unravelled and separated into alternate ends of the single cell.
Sometimes, the prokaryote will carry small plasmids (small rings of DNA) that
carry extra genetic information.
 Both the DNA and plasmids duplicate, as the cell elongates in preparation for
division, the DNA molecules are pulled to different sides of the cell.
 A cleavage furrow appears in the cell membrane, as the cell wall and membrane
start to pinch off and create two new cells.
 Example: Amoeba

Budding An adult organism give rise to a small bud, which separates from the parent and
grows into a new individual. Example: Yeast + Hydras
Results in in outgrowth or uneven division.
Asexual The production of offspring that are genetically identical to the parent.
Reproduction  Processes include Binary Fission and or mitosis (cell division)
 Results in genetically identical offspring
 Dominant form of reproduction in unicellular, colonial, or simple multicellular
organism
 Examples: Spore production in fungi, budding and binary fission in bacteria or
protists. Plant: Production of bulbs, tubers, rhizomes, stolons, and corms.
Cell Cycle Interphase  DNA synthesises.
(Preparation G1: Cell growth Cellular Contents excluding chromosomes are duplicated.
for mitosis) Synthesis: Each of the 46 chromosomes are duplicated by the cell
G2: Proof reading The cell checks the duplicated chromosomes for errors, making
any needed repairs
Mitosis occurs.
Cytokinesis occurs (Division of cytoplasm  separating daughter cells)
Cycle repeats or ends (G0)
Mitosis A cellular reproductive process that occurs in Eukaryotic cells, mitosis refers to the
replication and division of the nucleus; it results in the production of 2 daughter cells.
IPMATC

Meiosis A cellular reproductive process that occurs in Eukaryotic cells: meiosis results in the
(Makes formation of gametes that contain half the normal chromosomes (23). 4 daughter
Gametes) cells

Genetic variation
Crossing Over of genetic information (Prophase 1)
Independent Assortment (Chromosomes align in various combinations)
• During metaphase I (Middle)
• The combination of mum and dad chromosome passed to the gamete are
independent of each other.
Random Segregation
• During Anaphase I (Away)
• The homologous chromosomes (pairs) will split into the daughter cells (and
gametes) randomly.

Somatic cells Normal Body cells (Excluding gametes)

Germ Cells Gametes
(Germline)
Homologous Chromosome pairs that carry the same genes in the same location, in somatic cells
Pairs one chromosome originated from the mother and the other chromosome from the
father (Humans have 46 chromosomes or 23 homologous pairs)

A chromosome consists of two chromatids (sister chromatids)

Haploid The number of homologous pairs.

Number (n)
Diploid The number of chromosomes in the somatic cells of an organism.
Number (2n)
Chromosomes DNA instructs the
and DNA formation of proteins
(Amino acid chains)

DNA DNA replication occurrs during the sythesis (S) phase of interphase.
Replication 1. Using ATP (Engery), helicase enzymes break the hydrogen bonds in DNA. Causing
 the DNA to unwind and separate (exposing the bases)
2. The separate DNA strands act as a template for the production of new DNA. A short
strand of RNA primer made by the enzyme primase attaches to the DNA.
3. The enzyme polymerase II inserts DNA nucleotides (floating in the nucleous) into
the opposite complemntary base pairs of the RNA primer. Nucleotides are added from
the three prime end otherwise known as the leading strand. The lagging strand is
replicated using okazaki fragments (chunks of nucleotides), these fragmentsa are
joined up by ligase enzymes into one continous strand.
4. DNA polymerase I (enzyme) ‘proof reads’ the strands and ‘edits’ it by replacing
incorrect base pairs. Once this is complete the two new strands are sealed by ligase.

Genetic Genetic continuity is a way of preserving gentic information across generations, It

Continuity relies on:
Consistant replication of genetic information (Parent  Daughter cells), allowing for
traits to be passed from parent to offspring. Random variations or mutations that
benefit a species may be selected and passed down through generations depending
on how advantagous they are.
Structures of Prokaryote: Singular chromosomes in a circular strand of DNA. The DNA floats freely
DNA in the cyptoplasm. Proharyotes can have additional non-chromosomal DNA
(Plasmids), these plasmids code for features not essential to the cells survival. The
DNA supercoils around histone (proteins) into what is called nucleiods.
Eukaryotes: The double helixed DNA is linear and located inside chromosomes, which
are found in the nucleus of cells. DNA binds around 8 histones (nucleosomes) but
doesn’t supercoil like prokaryotic DNA. Non-coding DNA makes up the majority of
DNA within the body. It is thought to control gene expression and spatial organisation
of genes. Examples of non-nuclear DNA is DNA within mitochondria’s (mtDNA) and
chloroplasts
The Central
Dogma

Protein Transcription is the DNA  RNA part of the central dogma.

Synthesis
1. RNA polymerase binds to a region of the gene needing to be copied (promoter) the
polymerase then connects the DNA’s complementary bases to the mRNA strand
(messenger RNA). This strand of mRNA then undergoes splicing  which removes
introns (Regions that do not code for proteins) from the mRNA strand. The remaining
mRNA consists only of regions that do code for proteins (exons). The mRNA also
undergoes editing  changing of incorrect bases. Once splicing and editing occurs the
mRNA strand exits the nucleus.
Translation is the RNA  Protein part of the central dogma.

1. In the cytoplasm tRNA (Transfer RNA) floats freely, the tRNA contains the amino
acids needed to make a protein (A chain of amino acids). The mRNA that has now
entered the ribosome, waits for the tRNA that contains three complementary bases
(anticodon). The anticodons on the tRNA join with the codons (three bases) on the
mRNA strand, this connection of complementary bases will transfer the amino acid on
the tRNA to the ribosome (contributing to the amino acid chain). Usually there will be
a start and stop codon.
The shape of a protein can
determine its function.
 Primary Structure: A
basic string of amino
acids
 Secondary Structure: 3D
structure that is as spiral
or pleated shape. The
Amino acid chains
become linked by
Hydrogen bonds.
 Tertiary structure: Has
more folds = More
complex
 Quaternary Structure:
has 2 or more
polypeptide chains and
is even more complex
than tertiary.
Proteins code for
characteristics.

Alleles HHI = (Heterozygous) HH (Homozygous)  Genotype

Phenotype  The physical train
Autosomal Any chromosome that is not a sex chromosome.
Autosomal If two alleles are present within a population one allele will be dominant (H) and the
Recessive + other recessive (h).
Dominant Homozygous Dominant  HH
(Mendel’s Homozygous Recessive  he (The recessive trait is present)
Method) Heterozygous  Hh
Ratio = 1:2:1 etc
Probability = 50% etc

Sex-Linked Sex chromosomes

Inheritance  Code for sexual characteristics
 Determine the sex of an organism.
Co-dominance

Both alleles are expressed. Example  Roan cow (Patched cow)

Incomplete Blending of features between the two alleles expressed  Red + White snapdragons
Dominance = a pink snapdragon.
Multiple Blood types
Alleles
Short Tandem There are two flanking regions of coding DNA and the STRs are in the non-coding
Repeat (STR) section between them.
Example, identify the flanking sequence below and the number of repeat units (GAAT)
CCACACAGGTAATGAATGAATGAATGAATGAATGCCTAAGTGCC
5 STR’s
STR’s are used in DNA Profiling…
The Difference between SNPs and STR’s”
 SNP’s – Single nucleotide polymorphisms. There is a difference in a single
base in an otherwise common DNA sequence. This difference occurs in
more than 1% of the population and can be used to determine certain
genetic risk patterns for people with or without this SNP.
 STR’s – Short Tandem Repeats are sections of repeating sequences in
non-coding DNA that are inherited and determine the “space” between
genes. These can also determine DNA fragment length when using Gel
Electrophoresis.
Technologies DNA Sequencing: The process used to determine the order of nucleotide bases in a
used to genome. This has improved out understanding of human evolution, inheritance of
investigate disorders or diseases and levels of genetic diversity within a species  Relevant to
inheritance conservation management. To sequence DNA, the DNA is amplified using PCR
patterns (Polymerase Chain Reaction). Gel electrophoresis is used to determine base patterns.
DNA Profiling: A process used to determine human identity and familial relationships
based on comparison. Short tandem repeats (STR) are used to identify individuals
through comparison and are often found in non-coding strands of DNA such as
mtDNA (Mitochondrial DNA)
• DNA profiling is the process where a specific DNA pattern, called a profile, is
obtained from a person or sample of bodily tissue. Even though we are all
unique, most of our DNA is actually identical to other people's DNA. However,
specific regions vary highly between people.
• DNA sequencing is the process of determining the exact base order in the
DNA sequence.
PCR + Gel Polymerase Chain Reactions are used to amplify the amount of DNA.
Electrophoresis Gel electrophoresis separates the segments according to length, smaller fragments
will move further in the gel while larger fragments will only move short distances.
Steps of PCR:
1. Denaturation – Heated to 95ºC. DNA is denatured and forms 2 single strands.
2. Annealing – Mixture is cooled to 55ºC, allowing the primers to anneal to the
template DNA.
3. Extension – Heated to 72ºC. DNA polymerase moves down the template
making new DNA.
4. Once it is all copied, mixture heated back to 95ºC so the whole process can be
repeated.

Gel Electrophoresis
1. DNA fragments are placed in the wells (the sections of the dotted line that
can be seen at the negative or let hand side of the gel). The phosphate groups
in DNA fragments are negatively charged and move through the gel towards
the positive terminal when an electric current is applied.

Sangar Method  In automated Sanger sequencing, ddNTPs (modified nucleotides)

are mixed in a single reaction, each of the four dNTPs having a unique fluorescent
label. This helps isolate the sequence wanting to be examined.

PCR VS Sangar Method

Sanger sequencing and PCR are used together.

When generating the starting material for a Sanger sequencing protocol. PCR can be
used to create many copies of the DNA that is to be sequenced.
 Having more than one template to work from makes the Sanger protocol more
efficient. If the target sequence is 1,000 nucleotides long and there is only one copy of
the template, it is going to take longer to generate the 1,000 tagged fragments.
However, if there are several copies of the template, in theory it will take less time to
generate all 1,000 of the tagged fragments.

Gene Pool The frequency of alleles found within a population.

 A large gene pool has extensive genomic diversity and is better able to
withstand environmental challenges. Inbreeding contributes to a smaller gene
pool, making populations or species less able to adapt and survive when faced
with environmental challenges.
Genetic Drift A mechanism of evolution that refers to random fluctuations in allele frequency from
generation to generation due to chance events i.e., natural selection.
Gene Flow Gene flow is the transfer of genetic material from one population to another. Gene
flow can take place between two populations of the same species through migration
and is mediated by reproduction and vertical gene transfer from parent to offspring.
Alternatively, gene flow can take place between two different species
through horizontal gene transfer (HGT, also known as lateral gene transfer), such as
gene transfer from bacteria or viruses to a higher organism, or gene transfer from
an endosymbiont to the host.
Increases genetic variation.
Population The study of genetic variation in a population + changes to allele frequency within a
Genetics population, the data gathered is used for:
 Conservation management  the koala
 Disease and genetic data  Enable scientists to study patterns of genetic
disease inheritance, improving treatment options.
 Human Evolution Studies: Out of Africa  Homo sapiens evolved in Africa and
then moved to different parts of the world (mtDNA evidence) + Multiregional
Hypothesis  Homo sapiens only evolved once leaving Africa and entering
various regions of the world. Suggests gene flow between populations (Fossil
evidence)

Genetic Change

Mutation Permanent changes to the nucleotide sequence (Incorrect bases) in DNA or

RNA. Mutations in the genome of an organism can harm cells  causing
 diseases such as cancer.
Mutagens Environmental agents that alter DNA sequences  causing a mutation. The
process of inducing a mutation is termed mutagenesis, the resulting mutation is
termed an induced mutation.
Carcinogenic Many mutagens are carcinogenic (Cancer causing). This is because some
(Cancer mutations occur in genes that cause changes in the cell cycle (promoting or
causing) supressing cell division with no differentiation) this results in masses of cells
otherwise known as tumours.
There are two types of genes, that when mutated commonly cause cancer:
 Proto-oncogenes
 Tumour suppressor genes
Electromagneti Electromagnetic Radiation refers to a range of photons (A photon carries energy
c Radiation (A proportional to the radiation frequency) that carry energy in the form of
type of electromagnetic fields through time and space.
Mutagen) Examples: Gamma Rays, X-Rays, ultraviolet or UV light (All of these are
Mutagens)
Electromagnetic radiation can damage DNA, ionising radiation such as gamma
rays and x-rays can break DNA molecules, damage bases and cause base
deletions. This damage can predominantly be fixed by DNA repair enzymes, but
through continued exposure there is an increased risk that the damage will be
to extensive to repair.
Cells exposed to electromagnetic radiation release reactive oxygen species
(ROS). This ROS is what directly damages the nuclear DNA, modifying bases or
deactivating repair.
Ultraviolet light above a certain wavelength is also absorbed by DNA bases. This
causes pyrimidine dimmers to form. These dimmers increase the possibility of
replication and transcription errors, while also stimulating mutations and
chromosomal rearrangement.
Chemical Chemical mutagens can cause changes to DNA bases and structure, it is also the
mutagens main type of mutagen associated with causing cancer. Due to this
chemotherapy is often a type of chemical mutagen, because cancer cells
multiply much faster than normal cells the chemical mutagens damage those
cells rather than normal body cells. However normal body cells can also be
destroyed during the process, which is why chemo takes such a toll on an
individual’s body (losing hair, sickness etc…).
Example of chemical mutagens:
 Alcohol
 Smoke (smoking)
 Carbon (charred foods)
 Nitrates (found in some food preservatives)
 Cleaning products
 Asbestos
 Coal tars (carbon)
 Pesticides
 Some hair dyes.
Chemicals that are mutagenic are usually structurally similar to normal bases
(purines and pyrimidines), so they may mistakenly become incorporated into
DNA during replication. Resulting in the insertion of incorrect nucleotides
(mispairing). The mispairing often results in the production of a non-functional
protein.
Naturally Naturally occurring mutations can physically or chemically promote mutations.
Occurring These mutagens also correlate strongly with cancer. These mutagens are often
Mutagens present in the environment, the likelihood of mutation is also increased with
length and frequency of exposure.
Non-biological mutagens:
 Metals (Mercury, Cadmium + metal compounds)
Biological mutations:
 End-products of metabolism (may be produced by fungi, plant or animal
cells). These mutagens tend to be discovered when sudden outbreaks
of cancer occur in organisms, due to their particular exposure to soils
and or new foods.  Nitrosamines are chemicals that form on the
stomach when certain foods or food ingredients are eaten in
combination.
 Microbes i.e., Viruses (Hepatitis B, HIV, rubella virus) and bacteria
(Helicobacter)  these microbes can directly alter genetic material in
cells. Inserting their own base sequence or plasmids that change the
function of genes, triggering cancer.
Physical Physical Mutagens:
Mutagens  Heat
 Ionising Radiation (shorter wavelengths = More damage): X-rays +
gamma rays, radioactive elements (emitting alpha, beta, or gamma rays
found in soil from nuclear spills etc…)
 Electromagnetic Radiation: Ultraviolet (UV  emitted by the sun)
DNA Repair DNA repair mechanisms operate in cells 
Mechanisms  Base Excision Repair: Nucleus enzymes remove damaged or incorrectly
paired bases and replace them.
 Mismatch Repair: Once DNA has replicated, the enzyme DNA
Polymerase I ‘proofreads’ the replication.
Polymerase I  Identifies the error and fills the gap with the correct DNA.
Nuclease (Nucleus enzyme)  Cuts out the Incorrect DNA bases or dimmers.
DNA Ligase  Seals the gap.
SNP’s Singular nucleotide polymorphisms occur when an incorrect nucleotide is
substituted into a DNA sequence. To be considered an SNP the altered DNA
sequence must be present in at least 1% of the population to be considered an
SNP’s can cause: Sickle cell anaemia, variations in response to drugs, curly hair,
increase risk of diabetes, obesity, hypertension, and some psychiatric disorders.
Point A substitution, insertion, or deletion of a single nucleotide in a DNA sequence
Mutations (small-scale gene mutation). Point mutations occur spontaneously, usually
during DNA replication, mitosis, and meiosis. The rate of mutations can increase
with the presence of mutagens.
Substitutions of a nitrogenous base in >1% of the population is considered a
SNP.
Substitution in less than 1% of the population can occur in coding and non-
coding DNA. The substitution can have observable or non-observable impacts
on phenotypic expression and gene expression.
Insertion and or deletion of a singular base often result in frameshift
mutations.
Frameshift mutations: Frameshift mutations shift the entire reading frame of
RNA during polypeptide synthesis. The shift means that the order of codons will
be incorrect, causing the incorrect anticodons to produce the incorrect amino
acids. This can often produce a non-functional protein. Frameshift mutations
can occur due to point mutations but can also occur when the bases inserted
 are not in codons (multiples of three).
Types of point mutations:
 Nonsense Mutations: Change of an amino acid codon to a stop codon.
This cuts the protein short, resulting in a non-functional protein which
can majorly impact phenotypic expression.
 Missense Mutations: Point mutations that result in an amino acid
change, this produces an incorrect protein and therefore results in less
functional. Sickle cell anaemia is a missense mutation.
 Silent Mutations: Changes in the DNA sequence that do not affect the
amino acid produced. This therefore has no impact on phenotypic
expression, as the protein itself is not affected.
 Neutral Mutations: Changes in the DNA sequence that result in a
change of amino acid, but of the same type as the original. Therefore,
the change has no impact on phenotypic expression, as the protein
itself is not affected.

Chromosomal A chromosomal mutation is larger scale mutation often occuring during cell
Mutations division (meiosis + mitosis). It can also occur as a result of chemical mutagens
and ionising radiation. Chromosomal mutations involves changes to a series of
bases within a chromosome  this can directly affect the structure and number
of chromosomes in a cell (Aneuploidy)  What causes down syndrome.
Chromosomal mutations in germline cells result in congenital (birth defect)
abnormalities, while chromosomal mutations in somatic cells may result in cell
death or loss/reduction of cell function  contributing to cancer.
Types of chromosomal mutations that affect chromosome structure:
 Chromosomal deletion: When a section of DNA is removed and not
 replaced  leads to a reduced number of genes in a chromosome.
Often caused by heat, viruses, or radiation.
 Chromosome duplication (Insertion): When a portion of DNA is
duplicated and inserted  increasing the number of genes in the
chromosome. It’s phenotypic affect depends on the size, location and
number of repeats (The greater the repeats the more affect). These
types of mutation lead to variations known as copy number variations.
Huntington’s chorea and fragile X syndrome seem to be linked to an
increased number of duplications.
 Chromosomal Inversions: When a section of DNA is removed, turned
back to front (Bases becoming reversed) and the reinserted into the
chromosome. Inversions again range in size and this affects the level of
phenotypic expression. Haemophilia is a chromosomal inversion
mutation.
 Chromosomal translocation: When a section of DNA is moved from one
chromosome to a non-homologous chromosome (chromosomes that
contain different genes at different loci). This rearrangement can lead
to gene fusion, the joining of the two normally separate genes.

Somatic (Body Occurs in somatic cells, often due to replication errors prior to mitosis
cells) Mutation (synthesis). Cancer is a common cause of mutation in somatic cells. During
mitosis the error will be replicated and passed onto cells, amplifying the error
within that tissue  sometime resulting in phenotypic differences but more
often resulting in physiological changes i.e., tumours, cystic fibrosis etc. Somatic
mutations occur after conception and can not be passed to offspring.
Germline These mutations occur in sexual reproductive cells that give rise to gametes.
(Gametes) When a gamete carrying the mutation fuses with another gamete  forming an
Mutations embryo. The cells will divide with this mutation from conception (all their cells
will be affected)  these mutations are passed onto offspring. Inherited
diseases and disorders are a result of this mutation. Germline mutations can
also change allele frequency in the gene pool.
Mutations Mutations can affect organisms on a cellular, individual and populational level.
effect on Cellular level: The type of cell determines its Influence, A mutation in a
organisms germline cell (gamete) will be passed on to every other gamete, affecting the
offspring. Somatic mutations have a localised affect i.e., a tumour and cannot
 be passed on.
Individual level: Mutations located in a gene can affect the production of
proteins. A change to this protein could benefit, harm or have no affect on an
individual’s physical (phenotypic), physiological and or behavioural expression.
Populational level: mutation that are inheritable (Germline) can introduce new
alleles and thus genetic variation into a population. If these new alleles are
expressed as differences in phenotype, natural selection can occur  causing
undesirable mutations to be removed and favourable ones to flourish (The
peppered moth). This in turn helps ensure the continuity of alleles that increase
the survival of organisms in a population.
Significance of ‘Coding’ sections of DNA contain the genes that act as templates for the
Mutations in formation of proteins during polypeptide synthesis. This can affect the type and
‘coding’ DNA function of proteins which can impact the phenotype of an individual. Errors in
DNA repair genes that can be found in coding DNA can also increase induced
and spontaneous mutations. Mutations in tumour suppression genes and
photo-oncogenes can also cause cancer.

Significance of ‘Non-coding’ DNA has a direct link to gene expression. Growing evidence also
Mutations in tells us that mutations in ‘non-coding’ genes are directly linked to
‘non-coding’ developmental and congenital abnormalities (birth defects)  signifying non-
DNA coding DNA’s importance in embryonic development. Mutations in ‘non-coding’
DNA have also been associated with increased susceptibility to contracting
infectious diseases (Hep C) and non-infectious diseases (diabetes, obesity and
cancer).
The Causes of
Genetic
Variation

The effect of
Mutation,
Gene Flow and
Genetic Grift
on the Gene
Pool

Biotechnology The use of living systems and organisms to make products, that help to solve
human probolems or satisfy needs and wants. A combination of gene
technology and living things.
Gene The methods, tools and skills used to study genetics, such as heredity, variation,
Technologies and DNA structure + function.
Examples:
 PCR
 RNA Interferance: A type of gene silencing involving the resitriction of
RNA produced during polypeptide synthesis in order to silence specific
genes.
  Marker Assisted Breeding: Detection of desirable genetic traits to make
selective breeding more efficent and directed.
 CRISPR-Cas9
 Gene Drives: A genetic system that builds on CRISPR  increasing the
chance of a linked gene being inherited.
Technologies  DNA Splicing: Restriction enzymes are used to cut out the DNA at a
Used to specific base sequence.
Manipulate  DNA Amplification: The copying of genes, done through PCR (Replicated
DNA DNA fragments before being inserted into the genome)
 Recombining DNA: DNA ligase enzyme is used to join pieces of DNA
together. Recombinant DNA  The cobination of DNA from more than
one species, these organisms are called genetically modified organisms
(GMO’s). If the organism can pass on their newly constructed genome
they considered a transgenic species.
Technology  Gel Electrophoresis: used to identify a ‘DNA fingerprint’ of an individual.
Used to  Gene Probes: A gene probe is a specific length of single stranded DNA
Analyse and that is complementary to a known DNA sequence from a specific gene.
Visualise DNA The probe can place fluorescent dye or radioactive atoms onto the
specific gene, allowing it to be visualised. Thousands of genes can be
tested using a micro-array.
 DNA sequencing: Used to determine the exact nucleotide sequence of
DNA or a gene. Done using  Gel electrophoresis ands or nanopores
 DNA profiling: Involves the amplification of short tandem repeats
(STR’s) by PCR, followed by Gel electrophoresis. It compares base
sequences of two or more individuals to determine their relatedness
based on the difference in the length of the repeats.
Application of Modern biotechnology predominatly involves genetic engineering (genetic
Modern engineering, the artificial manipulation, modification, and recombination
Biotechnology of DNA or other nucleic acid molecules in order to modify
an organism or population of organisms).

Industrial Applications:
 Pollution Prevention: The use of microorganims to clean up and redsuce
waste, enzymes used in washing powders to prevent stains etc…
 Biomaterial Production: Involves natural or synthetic substances, being
made to interact with biological systems. I.e., joint replacemnts,
artificial heart valves, stents and breast implants.
 Biofabrication: The automated production of tissues and organs using
the principals of 3D printing and materials such as cells, fibers and gels
to replace diseased or injured tissues/organs.
 Synthetic biology: The use of computer technology to construct
synthetic genomes that can function in a living cell.
Agricultral Applications: Include the improvement of plant and animal produce
by increasing:
 Yeild
 Nutritional value (Golden Rice)
 Use of pesticides (BT Cotton)
 Disease resistance
The main objective is to counter biotic and abiotic factors such as drought, pests
ect. Other uses of Biotechnology in agriculture include:
 Selective breeding (Which can increase milk production, beef quality,
 grain yeild from wheat, protein in food ect.
 Transgenics
Medical Applications:
Gene Therapy: Replacing faulty or non-functioning genes with normally functioning
genes  Prevention of genetic disorders.
IVF (In vitro fertilisation): Eggs and sperm are collected and fertilised in a petri dish. The
fertilised egg is then placed into the endometrium of the women  Solves problems
relating to infertility.

Past/Ancient + Ancient
Classical  The use of living cells for food production i.e., cheese, bread and wine
Biotechnology  Crop and animal domestication
 Aquaculture (The aboriginal people)
Classical
 Fermentation
 Selective breeding  Plants + Animals
 Antibiotics + insulin
 Agriculture
Social Implications: Evolution of antibiotic resistant pathogens from
inapropriate use of antibiotics, improvments in health and nutrition, increased
wealth or autonomy, varied response to GMO’s, ensurment of quality and
efficacy of pharmaceticals, treatments more safe and predictable, increased
confidence in medical diagnosis of certain diseases and infections.
Ethics Making Ethical decisions:
 Benefit with no harm
 Equity and justice
 Individual rights and autonomy
Ethical issues:
 Using animal parts and models (Xenotransplantation)
 Changing animals genomes  Altering the organism and bio diversity.
 Designer Babies (Playing God)
Selective The breeding of two individuals, with desired traits as a means of increasing the
Breeding frequency of those traits in a population. Both parents are different varieties of
the same species.
Advantages:
 Cows that produce more milk
Disadvantages
 The use of whole organisms is time consuming and costly 
transportation of the animals + not certain they will mate.
Artificial Involves the collection of sperm from a chosen male and the insertion of that
Insemination sperm into the females cervix.
Advantages:
 Transportation of the frozen sperm overcomes the problem of
transporting large animals. It is also cost effective and reduces
possibility of the animals not mating. The semen can be frozen
indefinitely, so if the animal were to die, they could still sire offspring.
 Artificial Insemination is also being used for conservation, to increase
numbers of endangered species.
Disadvantages:
 Artificial Insemination can be costly, due to the specialised medical
equipment needed, it is also time consuming and has the potential to
 injury the female if carried out incorrectly. The biggest concern is the
reduction of genetic variety.
Evaluation:
The advantages of Artificial Insemination outweigh he disadvantages  With
the use of selective breeding techniques (Artificial Insemination), humans can
alter the genetic composition of the breeding population. As a result of
combining traits the breeder considers advantageous, combinations of new
alleles are being added to the population. The increased frequency of alleles in
the gene pool not only aids in the survival and reproduction of the individual
but the animals is producing a product beneficial to humans.
In Vitro Gametes from both animals are collected, and the egg is fertilised outside the
Fertilisation female’s body (The difference from Artificial insemination). Once the resulting
(IVF) zygotes have progressed to an early stage of development, they are transferred
into the uterine lining of the biological or surrogate mother. Usually, MOET is
conducted along side IVF  It allows cows which normally give birth once a
year, to become stud breeders (multiple offspring) with the use of surrogate
mothers.
Advantages:
 Parents who are infertile can reproduce  Continuation of a species
Disadvantages:
 Genetic diversity is reduced due to the production of a large number of
offspring from a small selection of parent animals (often with
favourable traits)  Lowers the gene pool.
 The possibility of breeding infertility into a population arises  If
assisted reproduction continues there is no need for the cows to be
fertile.
 Sperm banks have the potential to alter the genetic composition of an
animal or human. People can choose the donor they prefer (based on
traits). The reduction or elimination of genes seen to be undesirable
could mean that other important alleles could be lost i.e., disease
resistance.
Artificial The process involves the removing of stamens (Which contain male gametes 
Pollination Pollen) from flowers, then dusting the pollen onto the stigma of the same
flower (Self-pollination) or another (Cross-pollination)  hybridisation. This
enables favourable traits to be passed onto offspring.
Advantages:
 Traits such as disease resistance  can produce greater crop yields.
 Conservational use
 The creation of hybridized species increases genetic diversity
Disadvantages
 Overuse of the technology can lead to genetically similar crops (all filled
with favourable traits)  The corn blight 1970 in America is an example
of a reduction in genetic diversity. Thus, causing increased susceptibility
to disease.
 Insect pollination (According to research) had larger fruit and greater
seed germination rates  Hence the creation of drone pollinators
which act like insects.
Gene Cloning Occurs as a cellular level and involves the production of identical genes.
Process:
1. The section of DNA (Gene) is cut from the organism using restriction
enzymes.
 2. The gene is placed into a vector DNA or plasmid by a process known as
ligation (ligase enzymes joining the Fragments DNA).
3. The plasmid containing the gene is them placed into the host cell in a
process known as transformation.
4. The host cell can now make copies of the vector DNA, as it makes
copies of its own DNA.
PCR is a form of in vitro DNA cloning (Carried out in a test tube rather than an
organism.
1. Denaturing 2. Annealing 3. Extension.

Whole Creating a genetically identical whole-organism  A form of asexual

Organism reproduction, it is also considered a form of reproductive technology.
cloning There are two ways a whole animal organism can be cloned:
1. Somatic cell nuclear transfer (SCNT)  SCNT involves three animals:
one that donates the cells, one that donates the egg nucleus and one
that is the surrogate mother.
2. Artificial Embryo Twinning
An example of SCNT is Dolly the sheep (1996)
3. Cells were taken from the udder of an ewe (1st animal cells). The cells
were starved to stop them from multiplying.
4. The nucleus from a healthy unfertilised egg was removed from another
sheep, in a process called enucleation. (2nd animal  Egg nucleus)
5. The udder cell taken from sheep 1 was injected into the enucleated egg
of sheep 2. The two cells were treated with electricity, causing them to
 fuse or blend together, forming a fertilised egg. The new zygote
undergoes early development until forming an embryo. The embryo is
then planted into the uterine lining of sheep 3 (3rd animals 
Surrogate).
6. The egg developed and was born as a genetically identical twin to sheep
1 (The sheep that donated a cell from its udder).

Artificial Embryo Twinning

 A short time after fertilisation, the embryo is split into two before the
cells become specialised. This is done in a laboratory, and then the
embryos are placed into a surrogate to develop. The embryos that
develop are genetically identical.
Plant propagation
 Involves the use of a cutting from an existing plant  growing it to form
a new genetically identical plant. This technique conserves variety and
is often faster than growing a plant from another seed.
 Plants tissues grown in nutrient agar broth until transplantation is also
another form of propagation. It is called micropropagation.

Ethical issues of cloning

 Concerns for animal welfare
 Moral, legal and religious concerns would be posed if this form of
cloning were to be used on humans.
 Religion  In cloning animals humans are acting as ‘God’.
 Unforeseen health risks to cloned animals.
 Expensive procedure  Limiting access to the wealthy which could
further divide the rich and poor.
Advantages
 Reduces the unknown element of selective breeding  The
characteristic breed can be controlled.
 It also allows desirable characteristics to be breed in a short period of
time  More efficient.
Disadvantages
  Cloning reduces biodiversity, as organisms are only being derived from
one parent. All organisms will have the same genetic makeup; therefore
clones will increase favourable allele frequency  The non-selected
traits will begin to disappear. This decreases the populations’ chance of
survival if exposed to sudden environmental change or foreign
pathogens.
Recombinant The insertion of a gene from one species into the genome of another.
DNA The Process:
Technologies 1. The required gene is isolated from a cell.
2. A plasmid (Circular DNA) is extracted from bacteria.
3. The two strands of DNA are cut using restriction enzymes  the
fragments two ends will have exposed bases (Sticky ends)
4. The bacterial plasmid is also cut at two points using the same restriction
enzymes.
5. The sticky ends of the double stranded DNA and the plasmid come
together (joining via base pairing otherwise known as annealing).
6. The DNA fragments are sealed by DNA ligase.
7. The plasmid is then inserted back into a bacterial cell, where multiple
copies of the gene can be produced.
8. Once the copies are produced the genes copies can be inserted into an
egg of another species. After fertilisation the gene will become part of a
newly formed organisms DNA.

Delivering the
Gene 4 main ways:
(Recombinant 1. Micro-injection: DNA is inserted directly into the nucleus of a single cell
DNA) (most likely egg cells)  This is done when creating transgenic species.
2. Biolistic: Firing (With a gene ‘gun’) DNA on microscopic particles under
high pressure or voltage into target tissues and cells
3. Electroporation: Increasing the membrane permeability by applying an
electrical current
4. Transduction: Using a viral vector (Bacterial Plasmid) to carry the DNA
into the cells. The vectors may be injected into the blood stream or
sprayed up the nose (Nasal spray).
Transgenics Transgenesis is the process of transferring a gene (Known as a Transgene) from
one organism into the genome of another Organism. It is considered a
 transgenic animal if the gene can be inherited through multiple generations.
This would require the genes insertion to be in germline cells or gametes.
An example of trasngenics is BT Cotton: BT cotton variety engineered to
produce a toxin through its leaves, killing pests. This modification limits use of
pesticides and loss of crops.
Process of creating BT cotton:
 Cotton plant embryos are grown using cotton seeds and hormones.
 Through genetic engineering the BT gene (Toxin) is cut from the
bacterium that produces it and transferred into the cotton embryos
using a second bacterial vector.
 The embryos are then grown and placed into a solid medium for
germination into small plants. These plants are transported to farms
and grow as normal.

Medical uses of transgenic organisms:

 Transgenic mice can be used to study how genes regulate specific
bodily functions and phenotype. They are also used to study diseases
such as; cancer, obesity, heart disease, Alzheimer’s. The mice are useful
due to their similar tissues and organs and therefore genes to humans.
 Vaccine research + recombinant DNA vaccines. Low risk of side effects
and are relatively cheap to produce  good option for developing
countries.
 Xenotransplantation: Transplantation of organs from other animals into
humans.
Benefits of Agricultural:
Using Genetic  Enhances plant nutrients e.g., golden rice (Vitamin filled rice)
Technologies  Greater yields = Farming economy increase

Industrial:
 Potential to produce environmentally friendly chemicals.
 Replacements of non-renewable resources.
Medical:
 Production of pharmaceuticals e.g., insulin for diabetes
 Production of cloned antibodies for cancer treatment
Effects of Social context:
Genetic  Specific needs of a society determine which biotechnolog9ies are
Technologies introduced.
Economic context:
 GMOs are often patented  More expensive.
 Unequal distribution of wealth  larger gap between the rich and the
 poor.
Cultural Context
 Values and beliefs influencing opinions on and about biotechnologies.
 Ethics
Impact on biodiversity: Can increase genetic diversity in the short term but
replace varieties of genes in the long term, therefore reducing biodiversity.
CRISPR-Cas9 CRISPR Is a gene editing tool. Cas9
is a type of nuclease enzyme that
can cut target DNA from a
sequence. The gene is targeted
using RNA. The RNA is
manufactured to have a
complementary sequence to the
target gene. Once put into the
nucleus of a cells the RNA will
automatically find and stick to the
target gene (which has its
complementary sequence). The
RNA will then signal the Cas9
enzyme to its location, where the
enzyme will cut the DNA. The DNA
then attempts to fix the break, this
can often lead to mistakes 
causing the gene to disable
(intentionally), other genes can also
be inserted.

Infectious Diseases

Infection An infection is the presence of a disease-causing organism (Pathogen) in or on

the body of a host.
Infectious Diseases cause by the invasion of a pathogen, such as viruses, bacteria, fungi, or
Diseases parasites. These pathogens can also be transmitted from one host to another.
The likelihood of an organism developing an infectious disease depends on the
hosts immune response and the pathogenicity of the pathogen.
Environmental and hereditary factors can influence:
 Whether a particular host becomes infected when exposed to the
pathogen.
 The virulence of the pathogen on the host; people who have weakened
 immune systems due to other diseases or accidents.
 The health of the host  The reaction
 The extent and rate of transmission of a disease (Infectivity)
Virulence The severity of the disease and or the pathogens’ ability to cause infection.
Similar to pathogenicity but not the same (Its more the number of molecules
required)
Virulence factors include  TOXINS + BIOLOGICAL and surface adhesion
molecules that effect the ability of the microorganism to invade and colonize a
host.
Infectivity The extent and rate of the diseases transmission.
Outbreaks Outbreak – Small, but unusual. A small increase in the number of cases of a
disease you would expect to see.
Endemic Endemic refers to a disease or condition that is regularly found and confined to
a particular area or group of people.
Epidemic Epidemic – Bigger and spreading. Infecting people over a larger geographical
area.
Transmission during an epidemic is usually rapid, factors that increase exposure
to pathogens and cause the spread of disease include:
 A continual source of the disease (Reservoir) i.e., bacteria-carrying rats
and fleas during the bubonic plague.
 Densely populated areas cause pathogens to spread more rapidly and
easily.
 Social and environmental factors: limited or contaminated water
supply, poor sanitation, inadequate health systems and lack of access to
vaccines.  Developing countries
 Shortage of healthcare supplies and personnel
 New strains can cause an increase in the amount of pathogens that can
be spread and cause a change in susceptibility of a population.
 Enhanced modes of transmission
 Globalisation  Trade, migration, and global travel.
Pandemic Pandemic – International and out of control. You are getting local transmissions
in geographically different places.
Signs + Signs: Observable/measurable factors, such as; increased body temperature
Symptoms (Fever), a rash, hypertension (increased blood pressure) etc.
Symptoms: Factors reported by the patient that are nor
observable/measurable, such as; nausea, pain, fatigue, headache etc.

Transmission The spread of a disease involves a wide range of interrelated factors:

Persistence of the pathogen within a host, the transmission mechanism, the

portion of the population immune or immunised and the mobility of individuals
within the affected population.

Transmission must occur for a disease/infection to spread, if a disease is to be

transmitted it must:

 Escape from its host or escape from where it normally lives.

 Replicate
 Survive transmission from one host to another  Some pathogens can
only be spread through direct contact because they cant survive outside
 a host.
 Enter a new host.
 Escape from the new host.
Individuals capable of transmitting a pathogen without showing any symptoms
are known as carriers. A passive carrier  Is contaminated by the pathogen
(Not infected), the pathogen can be mechanically transmitted. An active carrier
is an infected individual who can transmit the disease to others.

Direct Transmission: Physical contact between a host and a non-infected

organisms. Contact between a parents and an offspring is known as vertical
transmission. Contact between organisms with no relation is known as
horizontal transmission. Examples of direct contact are touching, kissing, sexual
contact, contact with nasal or oral secretions, direct contact of blood or bodily
fluids, perinatal (around the time of birth), prenatal (before birth) and droplet
transmission.

Indirect Transmission: Transmission by indirect contact occurs when the host

and another organisms has no direct contact. Infection occurs from
contaminated objects (Fomites), vectors, airborne particles, contaminated food,
water etc. Airborne diseases are the most infectious and are difficult to control
if an outbreak occurs.

Vector Transmission: Transfer of a pathogen via another organisms

(macroorganisms).

Pathogenicity The ability of an organism to cause disease  The number of pathogens needed
to cause disease.
Classifying Non-cellular  Non-living.
Pathogens  Prions
 Viruses
Cellular > Living
 Bacteria (prokaryote)
 Fungi
 Protozoans

Prions Prions consist only of protein; they have no nucleic acid and are therefore
referred to as non-living. They are able to induce abnormal folding of specific
cellular proteins known as prion proteins.
The abnormal folding of the prion protein (most abundant in the brain) spreads
when prions in the blood stream interact with normal version of the protein
(Cellular prion proteins), passing on the deformation. Prions diseases are usually
rapidly progressive and always fatal.
Prion diseases are also called transmissible spongiform (Large holes in the brain
where cells have been destroyed  discovered post-mortem) encephalopathies
(TSEs). They are rare neurodegenerative disorders that affects both humans and
animals.
Symptoms:
  Spongiform changes loss of neurons = Brain damage
 The bodies inability to produce inflammatory responses.
Examples of Prions Diseases:
 Animals  Mad cow disease (Bovine spongiform encephalopathy BSE),
Chronic wasting disease in sheep, feline spongiform encephalopathy.
 Humans  prion diseases are both infectious and hereditary in
humans. Examples include: Creutzfeldt-Jakob disease (vCJD)  Human
variant is believed to be zoonotic (Diseases that can be transmitted
from animals to humans) and caused by the BSE agent (Mad cow
disease). It is transmitted through food
exposed to the BSE prion.

PrPc  non-Infected prion

PrPsc  Diseased prion

Zoonotic Diseases that can be transmitted from animals to humans

Viruses Viruses are microscopic
pathogens. A typical virus is a
small piece of genetic material
(DNA or RNA) encased in a shell
called a capsid. Viruses are also
referred to as non-cellular/non-
living pathogens. Viruses
become dangerous when they
enter a living cell, in that cell
they begin to multiply through
replication and cause disease.
Due to their possession of
genetic material, they can also
mutate and evolve.
Viruses can infect all types of living
things; animals, plants,
microorganisms (Bacteria).
Viruses that can infect bacteria are
called bacteriophages.
Viruses that contain RNA are
known as retroviruses.

Examples of diseases caused by Viruses:

  Ebola Virus (EVD)  Direct Transmission: Blood, bodily fluids, tissues of
infected animals or humans, sexual contact.
 Zika virus (Especially severe during pregnancy  causing birth defects
and or microcephaly (Smaller brains) in babies. Transmitted through a
vector  A mosquito.
 Dengue Fever  Vector: mosquitos
 Human Immunodeficiency Virus (HIV)  Spread through direct sexual
contact.

Bacteria Bacteria is prokaryotic (unicellular microorganism). Their DNA is contained in a

single loop, some bacteria also contain additional circles of DNA known as
Plasmids.
Not all bacteria cause disease, some are beneficial: Only about 1% is disease
causing. Bacteria are also used to create vaccines and antibiotics.
Transmission of a bacterial disease may occur directly (Close contact) or
indirectly through contact with objects contaminated by the bacteria.
Bacteria are classified according to shape; Spherical (cocci), rod (bacilli), spiral
(spirilla), comma (vibrios) and corkscrew (spirochaetes).

Bacteria is aerobic (survive and grow in the presence of oxygen) and anaerobic
(Does not need oxygen to live).
Bacteria can cause disease by:
 Secreting toxins (Chemical change)
 Invading cells (Physical change)
 Forming bacteria colonies that disrupt normal cell function.
Example:
 Salmonella typhi (Bacteria name) causes typhoid  Indirect
Transmission: Through contaminated water.
 Bubonic Plague  Vector (Transmitted by infected fleas)
 Whooping Cough  direct transmission: Spread through infected water
droplets.

Protozoans Eukaryotic microorganisms, larger than bacteria. Protozoans are protists. Similar
to bacteria not all protozoans cause disease.
 Parasitic protozoans: Parasitic protozoans are single-celled organisms that have
adapted to live in the tissues and cells of other organisms. For example: Malaria
is transmitted by mosquitos. If a mosquito infected with the pathogen bites a
human, the protozoan passes into the human bloodstream. If the human is
infected, they can infect uninfected mosquitoes.

Examples of Protozoan diseases:

 Sporozoan protozoan (Plasmodium Falciparum)  Malaria. Transmitted
through mosquitos (Vector)
 Entamoeba (An amoeba)  Amoebic dysentery (Destroys the olfactory
region and other parts of the brain)  indirect: Contaminated water
(Faecal-oral route)
Fungi Fungi are eukaryotic organisms. They include yeasts and moulds, like bacteria
they also play a largely beneficial role  being natural decomposers in
ecosystems and fermentation processes. Fungi are heterotrophic (They do not
contain chloroplasts) and therefore can not produce their own nutrients.
Usually, the live on dead plant and animal material, eating their bodies as a
form of nutrients (decomposers).
Most fungal infections are opportunistic, infected people with weakened
immune systems or concurrent diseases (Fungal infections are the leading cause
of death for people with AIDS)
Examples:
 Ringworm (Direct and indirect contact),
 Fungal Meningitis (Indirect contact  inhalation).
Macroparasites Macroorganisms that cause disease, including roundworms, flatworms, flukes +
Arthropods like tics, mites, lice. Macroorgansims can cause disease directly,
indirectly or act as vectors for the disease. Endoparasites live in the body and
ectoparasites live on the
outside of the body.
Helminths are worm-like
organisms that often
infect/inhabit the
gastrointestinal system, they
live on nutrients ingested
form the hosts. Helminths
have complex life cycles that
often involve several stages
and several hosts.

Helminths place an economic burden on agricultural enterprises through animal

illness and reduced meat, milk, and wool yields in infected livestock.
  Direct  Ticks (Causing paralysis in dogs  it releases a toxin through
its saliva)
 Vectors  Lyme disease is caused by ticks, that carry the viruses’
bacteria.
Examples
 Tapeworms  impact the digestive system (Infection of the digestive
tract) tapeworm is caused by eating undercooked meat, food or water
that is contaminated with tape worm larvae or eggs.
 Trematodes (the blood fluke or Schistosoma)  Schistosoma causes a
disease in humans that weakens the body, making it more susceptible
to other diseases.
Summary Cellular pathogens:
 Bacteria, Fungi, Protozoa and Macroorganisms
Non-cellular pathogens:
 Prions and Viruses
Bacteria are prokaryotic, unicellular organisms that are mostly harmless.
Pathogenic bacteria destroy tissue and or secrete toxins.
Fungi may be unicellular or multicellular and are the common causes of skin and
lung diseases in humans and animals.
Protozoa are unicellular eukaryotes that inhabit a wide range of ecosystems;
some are pathogens.
Macro-organisms such as worms (Helminths) and arthropods (flies, mosquitos,
ticks, fleas, lice, and mites) can be pathogens or can act as vectors for other
pathogens.
Viruses contain DNA or RNA in a protein coat, viruses are also obligate
parasites.
 Obligate parasites are parasites that entirely depend on a host for their
survival and reproduction.
 They die in the absence of a host as they don't possess the metabolic
machinery to generate energy for themselves.
 Some obligate parasites spend their entire life cycle in an external host
by evading their immune system.
 They cause damage to the host and even lead to death.
Viruses use the contents of the hosts cells to replicate their genetic material and
create new virions.
Prions consist of abnormally folded proteins; normal prions are found
throughout the brain and spinal cord. Disease causing prions induce abnormal
folding patterns when they come into contact with normal prions proteins.
Prions have a long incubation period, so when clinical signs appear the disease
is inevitably fatal.
Identifying Microbes such as fungi and bacteria cluster (colonies) together when given
Microbes (A suitable conditions for reproduction and growth. The colonies can be seen by a
Microorganism microscope.
s) in Food and These conditions are provided by nutrient rich agar plates and an incubation
Water temperature of 30 degrees Celsius.
Features of a colony can help identify a specific pathogen, some of these
features include Colour, Margin, Shape (form), Surface features (Smooth,
wrinkled, furry) and Elevation.

Louis Pasteur In the 1850s the research of Louis Pasteur and Robert Koch provided evidence
and Robert that many diseases are caused by microorganisms. Increasing our
Koch understanding of the nature of infectious diseases.
Pasteur’s experiments on microbial contamination:
Pasteur discovered that microbes such as bacteria and moulds could cause
contamination and disease, Pasteur’s swan-neck flask experiment
demonstrated that microbes could not generate spontaneously. This directly
opposed the original belief that living matter could generate spontaneously
from non-living matter.
Pasteur discovered that microbes were responsible for the preservation of
alcohol and developed the process called pasteurisation (The heating of wine
for preservation purposes). Pasteur’s work also led to the development of
vaccines for fowl cholera, anthrax, and rabies.
Koch’s Postulates: identifying the microbe causing the disease.
Koch showed that bacteria was the cause of diseases such as Anthrax and
Tuberculosis. He did this by designing a four-rule procedure (To show that a
particular microbe was the cause of a
disease)
1. The microbe believed to be
the cause of the disease
must be present in every
infected organism.
2. The microorganism
(microbe) must be isolated
and grown in a culture; that
is a culture only containing
the microbe.
3. The microbe produce from
the culture must be injected
into a healthy organism and
produce the disease.
4. The microbe extracted from
the infected individual and
the original culture must be
identical.
Causes and Animal and plant pests and diseases pose a major threat to Australia’s
Effects of agricultural industry. Australia relies heavily on the export of our produce 
Disease in The countries disease-free status (Due to our geographical isolation) is a
Agricultural primary selling point for our produce. If this is threatened it would affect our
Production. national and local economy (Farming families and communities).
Some effects of disease in farm animals include:
 Death of the affected animal (Anthrax)
 Loss of appetite and weight over a short or extended period
 Economic loss to the farmer, with negative affects on profitability and
production due to reduced meat, wool and milk yields.
 Loss of international trading opportunities id Australia’s disease-free
status is threatened. (Foot and mouth disease endemic)
 Human illness and disease (Zoonotic diseases  Q-fever + leptospirosis)
 Low growth rates in young animals (Internal parasites)
 Loss of fertility in females through embryonic death or stillbirths
(leptospirosis)
 Loss of economic value of individual animals due to blemishes or
ectoparasites or limited quality of products. (Warts in beef cattle)
 Examples of Diseases in Animals
Disease: Foot-and-Mouth disease
Cause: A virus with seven serotypes (distinct variation within a species of
pathogen) and over 60 strains.
Effect: In 2001 the outbreak caused losses of 19 billion to the agricultural
industry, the disease does not occur in Australia but its major threat has
promoted strong quarantine regulations; including the support of neighbouring
countries to reduce chances of entry into Australia.
Disease: Sheep Lice
Causes: Insect  Bovicola Ovis (Lice)
Effect: Sheep lice costs producers in NSW over 100 million annually in lost
production and treatment costs.
Sheep with live produce 10% less wool, the wool also contains broken fibres,
making the fleece 10% less valuable due to its matting and felted texture;
Infected sheep are also stressed due to the discomfort they are experiencing 
this impacts their feed intake and makes them more susceptible to flystrike.
The effects of plant diseases include:
 Reduced yields.
 Loss of trading opportunities (nationally and internationally).
 Economic loss for the farmers, resulting in financial hardship and stress
for the family and local community.
Australian economy relies heavily on the export of crops to overseas markets
due to our country’s physical isolation introduction of exotic plan diseases could
be detrimental to the national economy.
Examples of Diseases in Plants
Disease: Potato Blight
Cause: Fungi  Phytophthora infestans
Effect: Caused one million deaths from starvation and over one million people
to migrate from Ireland in the mid-1800s.
Disease: Golden potato cyst nematode
Cause: Globodera rostochiensis  Worm species
Effects: The microscopic plant pests feed on the roots of the potato plants
impacting root development and plant growth, thus reducing yield. Crop
damage may appear as patches of poorly growing plants but can extend to
complete crop death.
This decrease in potato quality means economic losses, not only through
exportation but losses to farming communities and families whose income
relies on a large and quality yield.
Pathogenesis Pathogenesis is the process by which a disease or disorder develops. In order
for a disease to infect a host, four steps must occur:
1. Exposure (The host must be exposed the pathogen  Transmission)
2. Adhesion  Molecules (either proteins or carbohydrates) called
adhesins are found on the surface of certain pathogens and bind to
specific receptors (glycoproteins) on host cells.
3. Invasion  Pathogens may produce toxins, which serve as virulence
factors that allow them to colonize and damage host tissues as they
spread deeper into the body. Pathogens may also produce virulence
factors that protect them against immune system defences. A
pathogen’s specific virulence factors determine the degree of tissue
damage that occurs.
4. Infection  The successful multiplication/replication of the pathogen.
Intra and Extracellular Pathogens can grow and reproduce in tissues or outside the hosts
Extracellular cells.
Pathogens. Intracellular Pathogens grow and reproduce inside the cells of a host  All
viruses are intracellular.
Pathogen Pathogens have adaptations to facilitate or maximise their entry into host cells
Adaptations and tissues. For an infection to occur, a pathogen must be transferred
(Transmitted) to the host  adhere to the host  and then invade the host.
Most pathogen adaptations with maximise these traits.
Virulence factors help a pathogen gain entry to a host and be transmitted.
Adaptations of pathogens that facilitate adhesion and invasion of a host:
Viruses (pathogen)
Virulence Factors:
Adhesion  Virus surface proteins adhere to the uninfected T cell surface
receptors. This is important adaptation because viruses must enter the nucleus
of the host cell in order to replicate (Or infect).
Invasion  Enveloped viruses are enclosed within an envelope formed from
the host cells membrane as they move into the cell (Endocytosis)  The virus
appears to be a membrane bound vesicle to the cell.
Non-enveloped viruses (e.g., Polio virus) form a pore in the host cells
membrane, delivering the viral genome for replication through the pore. Some
other cells use the cells normal membrane-forming processes  going through
the endoplasmic reticulum and Golgi body to enter the host cell.
Prions (Pathogen)
Virulence Factors:
B lymphocytes (that play a role in tumour necrosis) enable prions to invade
dendritic cells in lymphoid tissue. From the lymphoid tissue the prion invades
the nervous system through autonomic nerves, that lead directly to the brain.
Prions may use other proteins (Ferritin – Abundant in meat) to facilitate
movement through the gut.
Bacteria (Pathogen)
Virulence Factors:

Adhesion  Pili and Fimbria structures one the outside of bacteria correlate
with the host cell’s glycoprotein receptors, making adhesion easier.
Adhesions on the bacteria’s cell surface also allow Pathogens to bind more to
the host tissue resisting physical barriers (coughing and sneezing).
Bacterial cells can form a sticky substance called a biofilm, this will allow for
easier adhesion and difficult removal of the pathogen.
Invasion  Enzymes contained in the bacteria can break down the host cell
contents.
Capsules can resist phagocytosis by host cells, the capsule allows the bacteria to
go undetected by glycoprotein receptors on the phagocytes.
Bacteria have also developed chemical strategies to destroy immune defences
(IgA Protease + leucocidin).
Toxins secreted by the bacteria can kill or damage the host cell (endotoxins and
exotoxins).
If phagocytosed certain bacteria can secrete a protein (haemolysin) which
selectively destroy the phagosome membrane but not the bacterial membrane.
Protozoan (Pathogen)
Virulence Factors:
In receptor-mediated adhesion the protozoan recruits’ lysosomes to fuse with
the cell membrane. The pathogen then enters the vacuole which is made of
lysosomal membrane  then deactivating the lysosomal enzymes (Chagas
Disease.
Fungi (Pathogen)
Virulence Factors:
Adhesion  Capsule molecules or the cell wall assist the fungus adhesion to the
host cell.
Invasion Thermotolerance (heat shock proteins are synthesised in the fungus
to cope with high body temperatures).
Cell wall and capsule molecules also protect the fungi from host attacks.

Macroparasites (pathogen)
Virulence factors:
Hookworms can secrete proteins that reduce the host cells immune response
 teeth in the buccal capsule anchor the worm to gut lining after entering
through the hair follicles.
Ticks have highly specialised mouths which when inserted into the hosts skin
attach the tick to the host. Biologically active molecules secreted by the saliva
prevents the hots blood from clotting or prevents their inflammatory response,
facilitating the transfer of the pathogen.

Adaptations that facilitate transmission of Pathogens

Transmission route: Airborne on dust and respiratory secretions (Water
droplets)
Adaptations:
 The pathogen can remain suspended in the air for long periods of time
whilst resisting drying out.
 Pathogen causes sneezing and coughing, which causes ejection of water
droplets and transmission to another host.
 Aero-tolerant adaptation allows the pathogen to tolerate a wide range
of oxygen concentrations.
Transmission route: Waterborne
Adaptations:
 Pathogens are able to colonise and proliferate in water, so an
environmental reservoir is present  increasing transmission rates.
 Modified surface structures such as fimbria and flagella allow
independent movement.
 Resistance to high temperatures (boiling water) and to water
treatments.
Transmission route: Vector-borne
 Adaptations:
 The pathogens can produce surface proteins that allow attachment to
the vector tissue. (Malaria)
 The lifecycle of the pathogen is synchronised with the feeding habits of
the host.
 Vector is not affected by pathogen.
 The pathogens can form reservoirs in the digestive tract or salivary
glands of the vector for easier transmission.
Transmission route: Faeco-oral
Adaptations:
 Pathogens can increase vomiting and diarrhoea in the host to increase
transmission. E coli + Salmonella

Transmission route: Soil-borne

Adaptations:
 Form endospores to resists desiccation.
 Stable in the environment under a range of conditions (Fungi)
 Grow mainly in the root zone (Nematodes)

Transmission route: Sexual

Adaptations:
 Pathogens have become capable of transmission across the placenta
(infecting offspring) and uterine invasion. (Contagious abortion in cattle)
 Unprotected sexual activity facilitates the transmission.
 Pathogens can survive in the placenta  consumption from another
animal will transmit the disease.
 The pathogen can be present ibn the air on small particles after birth.
Transmission route: Bloodborne
Adaptations:
 The pathogen can take advantage of altered features in the red blood
cells to facilitate growth and development (Malaria + Sickle cell
anaemia).
Plants Immune They have two main responses: Passive and Active
Response Passive responses involves physical barriers such as the cell wall, thick cuticles,
small stomata, bark and hanging leaves (to stop the accumulation of a
reservoir).
Chemical barriers include chemical compounds (glucosides and saponins) in the
tissues of the plant that reduce fungal and bacterial growth + ward off vectors
 of viruses, Enzymes that break down pathogen derived toxins, and chemical
receptors to detect pathogens.
The Active response involves pathogen recognition; the plants can recognise
the pathogen through its chemical and physical signals. After detecting a
pathogen the plant will signal a rapid active response (minutes to hours) 
This causes changes in plant including; lowered permeability of the cell
membrane and reinforcement of the cell wall (making it difficult for pathogens
to invade), activation of gene expression (genes that regulate the plants
response)  Activating the release of Hydrogen peroxide which can kill the
microbes directly and finally programmed cell death  which causes a cluster
of plant cells to surround the pathogen, secreting antimicrobial compounds to
kill it. Finally, a delayed active response (days) which repairs wounds in the
bark, released of antimicrobial chemicals and systematic required resistance 
a signalling agent of infection (usually salicylic acid) that plays a role in the
plant’s memory of a particular pathogen.

Cells of the
Immune
System (2nd
Line)
1st and 2nd Line of Defence
Responses to Innate Immune Response: Non-specific defence and response mechanisms.
Pathogens  Present at birth and genetically determined, includes Physical and Chemical
Immune barriers (1st Line) + Cellular Responses (2nd Line)
Response +
Lines of Adaptive Immune Response: Specific response to the pathogen  Specialized
Defence cells that act if the pathogen persists. Involves cells remembering the pathogen
once its destroyed – immunity (3rd line of defense).

The lymphatic system with the help of lymph fluid, lymph nodes, lymph vessels,
thymus, spleen, tonsils and adenoids forms a one way drainage system from all
parts of the body. The vessels in particular will drain the cleansed lymph fluid
back into the blood via the thoracic duct.
During infections pathogens and their products may enter the lymphatic system
into the lymph fluid. The fluid is transported to the local lymph nodes where
substances including microbes, cellular debris and cancer cells are filtered out of
the fluid. One way an infection may be detected is by changes in size, shape,
and texture of lymph nodes. These changes can help to pinpoint the site of the
infection and are a good indicator of your bodies third line of defense.
The Lines of The first line is a part of the bodies innate responses to pathogens, it involves 
Defence (1st physical and chemical barriers.
Line) Physical barriers
1. Physical Prevent the pathogen from entering the body. Physical barriers make it difficult
barriers for pathogens to adhere to cells or penetrate tissues, stopping its pathogenesis.
2. Chemical These physical barriers include:
barriers  Skin (Epithelial Tissue)  The skin has three layers (The epidermis, the
dermis, and the hypodermis). The skin is well supplied with blood
vessels  this contributes to its effectiveness as a barrier to disease by
providing early and direct access for white blood cells (Leukocytes), red
blood cells and platelets.
(Which fight infection and
heal wounds) As skin cells
die and flake off, the also
take pathogens with them.
When sealing a wound (to
prevent pathogen entry)
the body has a special

 Mucous membranes
 (Epithelial tissue that lines the internal cavities)  Have the following
features that restrict pathogen entry; Cell junctions  anchor epithelial
cells more effectively, restricting pathogen access. Cila  The epithelial
cells are lines with hair like structures (Cila), which wave a certain
direction to expel foreign substances from the respiratory system
(muco-ciliary escalator). They membrane is also composed of sheets of
constantly growing cells, these sheets will move upwards to replace
surface cells loss due to a pathogen attack. Finally, mucous membranes
secrete protective substances such as mucus, lysozyme, and
immunoglobulins  antibodies)
 Tight Junctions  Endothelial cells line the outside of blood vessels.
These cells have a special way of adhering tightly together (tight
Junctions), this helps prevents a pathogens entry into the blood stream.
 Mucus  Is a slippery substance
secreted by cells that line the
mucous membranes. Mucus traps
foreign substances like pathogens,
an increased production of mucus
can often signify an immune
response.
 Peristalsis  Stasis (Lack of
movement) of the intestines can
lead to intestinal bacterial
overgrowth, the bacteria being
given an opportunity to reproduce
in the throat.

 Sphincters  Sphincters
are a circular muscle that
maintains the constriction
of natural body passages.
Sphincters help to
physically seal off
compartments in the
body, reducing the
likelihood of pathogen
invasion.

Physical response to a pathogens involve;

 Vomiting and diarrhoea  which remove potential pathogens and their
toxins quickly from the gut.
 Urination  cleanses the urinary tract and removes debris or
pathogens that may have entered.
 Wound healing  which reseals the physical barriers against infection.
The process to seal a wound as quickly as possible, involves; the
stopping of bleeding, confrontation of pathogens to prevent infection
 and re-establishing of the barrier. Re-establishing of the barrier includes
Inflammation, proliferation (new cells multiply to seal the would) and
maturation (the cells mature to complete the new barrier).
Chemical barriers
Chemicals are secreted by epithelial tissue to further prevent pathogens from
entering the body. These chemicals can be found in; mucus, saliva, tears, urine,
stomach acid, and natural antimicrobial substances such as body fluid.
 Urine  Urine contains antimicrobial peptides (AMPs) secreted by the
cells lining the urinary tract, the peptides prevent the binding of
bacteria to epithelial cells and break down bacteria.
 Sebum and sweat  Sebum waterproofs and lubricates the skin
allowing pathogens to not stick as easily. Lysosomes secreted when
sweating also break down bacterial cell walls.
 Saliva  Saliva is produced from the salivary glands and contains a
mixture of substances, importantly it contains antimicrobial substances
such as lysozyme and immunoglobulin A (IgA) which flush away
pathogens/microbes.
 Tears  Tears are produced from the lacrimal glands; tears contain a
sebum-like substance which has antimicrobial properties. When
lacrimation occurs (the production of tears) a tear film containing (many
forms of antimicrobial) is distributed buy mucus, across the eye. As the
tear falls and removes foreign substances the film protects the eye and
kills the remaining foreign particles.
 Gastric Secretions  Parietal cells that line the stomach secrete
hydrochloric acid. This creates a highly acidic environment, that when
paired with the enzyme pepsin (Antimicrobial properties) discourages
microbe survival and growth. However certain diseases such as E Coli
and Salmonella have adapted to those harsh environment.

The Immune DAMPS  Are Molecules that are released when tissue is damaged, the
System (The 2nd molecules send a signal to the surrounding tissue to initiate an inflammatory
Line of response.
Defence)
1. Inflammation  Inflammation is a chemical response that helps wound repair
Inflammation and leads to pathogen destruction. When cells are challenged by pathogens,
2. Phagocytes they send out a chemical alarm, these chemicals cause the capillaries to dilate,
3. Fever leading to inflammation. The chemicals of inflammation make the blood vessels
4. The permeable. This allows white blood cells to move into the tissues, from the
Complement blood vessels, and attack the pathogen invaders.
System

Chemicals involved in inflammation include:

 Bradykinin – Causes smooth muscle to contract and blood vessels to
dilate. Prostaglandin – dilates blood vessels and inhibits platelet
aggregation (clotting) Histamines – Trigger increase vascular
permeability so white blood cells can attack.
There are five cardinal signs of inflammation.
 Pain (Due to the release of chemical mediators of inflammation)
 Heat (Due to increase in microcirculation – Increased circulation in the
 capillaries)
 Redness (Associated with increased microcirculation)
 Swelling (As fluids move in the blood cells and out of the blood cells)
 Loss of function (Due to pain and swelling)

Phagocytes:
Phagocytosis (A response to chemical signalling)  Phagocytes are specialised
white blood cells, Phagocytes include Neutrophils, Macrophages, Dendritic cells,
and Natural Killer ells (NKC). Phagocytosis is the process by which phagocytes
change their shape to enclose a pathogen. Once the pathogen is enclosed
lysosomes in the phagocyte release destructive enzymes, destroying the
pathogen.
Neutrophils  Are the most abundant leukocyte. They are short acting and are
used to fight acute and sever infections, an increased circulation of neutrophils
in the blood means there is an active site of inflammation in the body. They will
expel chemicals or engulf pathogens in order to kill them.
Monocytes  Also circulate in the blood until attracted to inflamed tissue.
Inside the site of inflammation they undergo a transformation into
macrophages and dendritic cells.
Macrophages  Are long lasting phagocytes and are used to fight chronic (long
lasting) infections. They are the first to show up at a site of infection.
Macrophages kill pathogens by undergoing phagocytosis once the pathogen is
killed parts of the antigens (found on the pathogen) will be displayed on the
surface of the macrophage (Antigen presentation).
Dendrites  Presents antigens on its surface to helper T cells initiating the
adaptive immune response.

The Complement System

The complement system is a group of over 30 proteins that assists other
defence mechanisms in destroying pathogens. They stimulate phagocytes to
make them more active, attract phagocytes to the site of infection and punch
holes in the membranes of pathogens causing the cell contents to leak out.
These proteins circulate freely in the blood and are apart of the initial response
to infection. During the third line of defence pathogens will begin to bind to
proteins in the blood called antibodies. Complement proteins are attracted to
 this antibody and pathogen binding, binding with them as well. As more
complement proteins bind to the pathogen and antibody complex, they begin
to signal phagocytes and B cells to destroy the pathogen (opsonisation).
Fever
The body may react to pathogens by altering our body temperature. The body
does this by releasing ‘fever-causing’ chemicals known as pyrogens. The rise in
temperature limits the growth of pathogens while enhancing the activity of
white blood cells.
Antigens Antigens are molecules made up of proteins that stimulate an immune
response. Antigens are found on the surface of cell membranes or protein coats
(Viruses + Prions) of foreign organisms.
Antigens have regions called epitopes, particular lymphocytes can recognise the
specific chemistry of the epitopes and target the antigen according to that
epitope. B and T lymphocytes have complementary antigen binding sites known
as antigen receptors on their cell membranes. Epitopes may bind with the
lymphocyte’s antigen receptors or with free floating antibodies in the fluid
outside of the cells.
B lymphocyte antigen receptors only bind with specific pathogen antigens
(similar to antibodies). When these two bind, the B lymphocyte cell will
transform into a plasma cell. This plasma cell will begin producing antibodies for
the specific antigen its has bonded to.
Antibodies An antibody (Ab), also known as
an immunoglobulin (Ig), is a large, Y-
shaped protein used by the immune system to
identify and neutralize foreign objects such
as pathogenic bacteria and viruses. The
antibody recognizes a unique molecule of the
pathogen, called an antigen. An antibody has
two binding sites on each of its "Y" structures.
Each of the two Y structures contain two
different paratopes that is specific for one
particular epitope on an antigen (meaning that
on each antibody will have two different
antigens in its bind ng sites). When an antibody
binds to an antigen, it can tag a microbe or an
infected cell for attack by other parts of the
immune system, or can neutralize it directly (for example, by blocking a part of
a virus that is essential for its invasion).
 There are 5 classes of
antibodies  Amelia
Meets Excited Guard
Dogs
 IgA
 IgE
 IgG
 IgM
 IgD

These antibodies have two common strategies when neutralising pathogens

and two other strategies that are unique to specific classes of antibodies.

1. Neutralisation
(Common)
2. Agglutination
(Common)
3. Activation of
the
complement
System
4. Opsonisation

The Immune When the innate immune system fails to clear the pathogen from the body the
System (The 3rd adaptive Immune system (The 3rd line of defence) takes over.
Line of There are two arms of the 3rd line of defence:
Defence) 1. The cell mediated Response (Effective against pathogens inside cells)
2. The humoral Response (Effective against pathogens in bodily fluids)
The cells responsible for generating the adaptive immune response are T and B
cells lymphocytes (Leukocytes). T and B cells have thousands of antigen
receptors on their membranes. On one B or T cell those thousands of receptors
will only recognise one of the million types of antigens. However, each B and T
cell is different and will recognise a different antigen meaning that your body
when you are born already contains and is ready to respond to millions of
different antigens it has not seen yet or may never see.
The clonal selection theory states that all the B cells for all the possible antigens
are already present in the immune system at birth. When are antigen is present
in the body, the B cell specific for that antigen is activated (By dendrites that
carry the antigen from the site of the infection into the lymph nodes where the
B cells reside). One that cell is activates it will begin to clone itself into either an
antibody producing plasma cell or a memory B cell. When the antigen is finally
destroyed these memory B cells (The many more cloned) will be prepared to
deal with this same antigen again. (Your body had ‘adapted’  Adaptive
immunity).
Primary Immune Response
When the adaptive immune response is first exposed to an antigen the
response by the B and T cells is referred to as the primary response. The B cells
will turn into plasma cells and the T cells will transform into cytotoxin T cells
These ‘killer’ T cells and antibodies produced by the plasma cells will work to
clear the infection. Alongside the cloned plasma B cells and the killer T cells,
memory B and T cells will be produced. The body will store these memory cells
in greater amounts until they are activated again  The person will now
possibly be immune to the infection by this particular antigen (The immunity
has been acquired or adapted).

The Secondary Immune response

After the first primary response, if
the body is exposed to the same
pathogen again the response will
be faster and more of the
antibodies will be produced due to
more B and T cells that recognise
this antigen being in the body.

The Humoral Response  targets pathogens outside cells (In the bodily fluids).
When a protein-containing antigen is present is the body, specific T cells called
helper T cells are activated. These helper T cells will begin to secrete cytokines
that activate the B cells. After this primary exposure the two adaptive
responses led by B lymphocytes begin.
1. The B cells begin to multiply, making copies of itself with the same
specific antibody recipe as the first B cell.
2. These B cell differentiate into two possible cell types: Plasma cells -
short-lives antibody factories and or Memory B cells  Long-lived and
stores in lymph nodes for later infection recognition by the same
pathogen.
B cells develop and mature in bone marrow until maturation when they are
stored in the lymph nodes and circulate in the blood.
The Cell-mediated response  Targets pathogens located inside host cells
because antibodies do not have access into the cells. T lymphocytes are
responsible for targeting and destroying infected host cells (They control cell-
mediated immunity). Protozoa, viruses and bacteria often inhabit host cells but
T cells can also kill macroparasites such as fungi + worm and cancer + foreign
transplanted tissue cells. T cells can only recognise fragments of antigens,
these fragments may have been partially digested by macrophages or antigens
partly digested by invaded host cells. The partly digested antigens in host cells
are displayed on the surface of the cells membrane by special protein molecules
called major histocompatibility complex molecules (MHCs). These molecules
(Coded for by genes) have binding sites for specific antigens. There are two
classes of MCH.
1. MCHI  In nucleus containing cells including platelets.
2. MCHII  In antigen presenting cells like macrophages, dendritic cells
and activated B cells.
T lymphocytes are produced in the primary lymphoid tissue of the bone marrow
and mature in the thymus gland. After they mature the T cells are released into
the blood and migrate to different areas of the lymphatic system, including the
lymph nodes.
There are 4 main types of T cells:

The helper T cells are the bridge between the humoral and cell-mediated
responses. Its cytokines activating the B cells in the humoral response and other
T cells in the cell-mediated response.
Cytotoxic T cells are activated by T helper cells and produce many clones of its
self that move to the site of infection. These T cells bind with infected cells
MCHI and releasing cytokines that kill the entire cell.
Suppressor T Cells stop the adaptive response when the infection is defeated.
Memory T cells create clones of themselves that will remain in the body for
secondary immune response.

Interaction of B and T cells

 An antigen presenting macrophage will give the antigen to the helper T cell. The
helper T cell can also be activated by B cells  When a B cell encounters the
antigen that corresponds to its particular surface antibodies its binds the
antigen and the antibody together. The antigen is then processed by the B cell
and attached to its surface molecules; the B cell can now present this antigen to
the helper T cells that have the matching T cell receptors. The helper cells then
secrete cytokines that activate more helper T cells and also macrophages.

Case Studies on
Immunity
Prevention, The interrelationship between prevention, treatment, and control.
Treatment and Control  early detection, hygiene practices, isolation, or quarantine (limit
Control of spread).
Infectious Treatment  Antiviral therapy, bed rest, pain relief, drinking plenty of water.
Diseases. Prevention  Vaccination.
Antivirals are manufactured drugs that either inhibit a viruses ability to replicate
or strengthen the hosts immune response.
Limiting Local, regional, and global transmission.

Procedures that can be employed to stop the spread.

 Effective hygiene practices prevent and control the spread of disease
by reducing the contamination of food and fomites which decreased
infectivity rates/transmission. Effective hygiene practices include:
washing hands with soap and water frequently, staying home if sick,
cough in arm, single-use tissues, don’t tough eyes/nose/mouth, don’t
share food utensils, food preparation, training of hygienic practices for
healthcare workers in highly infectious environments like prisons and
ages care homes.
 Quarantine  At a regional or global level the inhibiting of travel (travel
restrictions which include surveillance, monitoring, screening and
clearance procedures at airports). The closing of boarders according to
each state.
 Vaccination (Passive and active immunity)  Active immunity results
from exposure to a disease (vaccination), passive immunity is when a
large number of people around an individual are actively immune.
Effective vaccination (why there is the importance of immunisation
programs) protect an individual against specific infectious diseases
(some vaccines require boosters to maintain protection while others
like Hep B you will only ever need once). With a vaccine your B cells are
able to remember the pathogen and react quickly when secondary
infection happens. Vaccines reduce the need for antivirals and
antibiotics which in term helps pathogens not gain antibiotic resistance.
Vaccinations are present in the prevention and control of diseases.
Vaccines can not only protect an individual, but they can also create
herd immunity (when a significant portion of individuals are
vaccinated). If herd immunity is high enough, the small amount of
people unable to get a vaccine can also be protected.
 Public health campaigns  Are focused on the prevention and control
of infectious diseases. They can encourage immunisation, effective
hygiene procedures, educate or stop behavioural risk factors (I.e.,
sexual transmission in HIV  Wear a condom).
 Pesticides  Used to prevent and control plant disease vectors,
pesticides can effectively prevent and control many diseases (i.e.,
malaria in the 1940s). However, in addition to pesticides impacting
human health, resistance to pesticides is one of our greatest problems.
Alternative approaches to pesticides include integrated crop protection
and pest management, such as understanding vector lifecycles, better
farm sanitation, using resistant plant varieties, testing for soil-borne
 diseases and biological controls like the removal of vector breeding
sites, use of window screen or netting to protect the plants or genetic
engineering.
 Genetic engineering  genetic engineering can; create disease
resistant plants, silencing of viral genes will gene-silencing spray,
altering vectors genes so it can not spread the pathogen, improve
pathogen identification through genome sequencing in areas with
emerging disease, CRISPR can disarm the genetic code of viruses or
force genetic traits into a population that are resistant to a disease.
However, there are ethical question and biological long-term impacts
(REFER TO BIOTECHNOLOGY SECTION)
The Reductions in the incidence of infectious disease infectivity and mortality (The
Effectiveness of number of deaths in a population) has been achieved through the use of
Pharmaceutical pharmaceuticals, immunisations and access to better health care, improved
Treatment hygiene, and sanitation.
Strategies for Antivirals are used to treat viral infections and are difficult to develop because
the Control of they can damage host cells. They are also only able to treat a narrow range of
Infectious viruses. Antivirals are also used as drugs for the treatment of influenza, HIV,
Diseases. Hep B and Hep C.
A type of antibiotic named penicillin was discovered in the 1940s. Antibiotics
are used to treat bacterial infections  they are made to target bacterial
pathogens but also other kinds of pathogens excluding viruses.
Antivirals and antibiotics are quite effective at reducing symptoms and saving
lives, when used together in the correct way.
Factors that challenge the effectiveness of antivirals and antibiotics
(Pharmaceuticals) include.
 They can cause in increase in antibiotic-resistant bacteria (i.e.,
Streptococcus pneumonia)
 Antibiotics can also have side effects when taken  they kill friendly
and non-friendly bacteria.
 They can lead to the emergence and evolution of new infectious
diseases (particularly zoonotic viral infections).
 There may be unregulated access to and inappropriate use of the
pharmaceuticals in the global market.
 Ethical issues; only available in well-resources settings/areas, not
available in sufficient quantities, high costs and pharmaceutical
company mistrust, the holding of patents (that give control over the
drugs cost and availability to the company that created the drug). The
development of these pharmaceuticals can also take years and come at
a high cost  which is why the developing of the drugs must be quick in
order for prevention and control of the disease. Cost must also be un-
liked from the selling price to increase accessibility.
Incidence and Incidence  A measurement of the number of cases globally taken over a
prevalence of period of time.
Infectious Prevalence  A measurement of the number of cases in a population over a
Diseases in a period of time.
population. The incidence and prevalence of an infectious diseases relies on the mobility of
individuals (The movement of individuals; travel, trade, migration etc) and the
proportion of the population immune or immunised against the disease.
Analysis of these factors can enable prediction of the potential for an outbreak
of an epidemic or pandemic as well as evaluation of different strategies to
 control the spread.
Increased mobility in a population can increase prevalence and incidence as it
increases direct, indirect and vector contact (i.e., tourism and migration). New
arrivals, refugees and displaced populations can also bring vectors and different
strains into areas they were not present. Malaria and HIV are examples of
increased incidence and prevalence due to increased mobility.
The proportion of the population immunised decreases prevalence and
incidence. In the 1980s smallpox was eradicated due to immunisation.
Evaluation of
Global
Epidemic
Intelligence,
Surveillance,
Prediction, and
Reporting
Systems.

Infectious Ebola
Disease case 1. Outbreak – 2014-16
Studies 2. Extremely contagious
3. Rapid Death
4. Single Stranded RNA (ssRNA)
Spreads by close direct contact with body fluids and mucous membranes, also
spread indirectly by contaminated items. Can be spread after patient has died.
Wild animals (Fruit Bats) are reservoirs for the virus, but it may also be found in
the meat and fluids of Apes, Antelopes and Porcupines.
It is believed that patient 0 for this outbreak was a 2-year-old child in Guinea.
Burial rituals involving direct contact with deceased believed to be a mode of
transmission
Symptoms:
Incubation 2-21 days
Starts as a fever and tiredness
Headache and a sore throat
Progresses to vomiting, diarrhea, severe rash, and oozing of blood from mucous membranes and stools
Liver damage means you cant clot your blood.
Controls:
• Supportive treatment
 • IV fluids to maintain circulating volume
• Antibiotics to prevent secondary infections
• Fever and pain medication
Case fatality rate was 50%
Whilst watching this video make a list of all the environmental and quarantine
measures that are put in place to limit the spread of Ebola in this community
https://www.youtube.com/watch?v=XCrOde-JYs0&feature=youtu.be

Non-Infectious Diseases

Homeostasis The maintenance of a relatively constant internal environmental state. The range
of homeostasis is maintained within tolerance limits (the upper and lower limits
that the body can tolerate), this allows the enzymes to function at their best (the
correct temperature (the higher the faster the reaction), Ph and substrate
concentration all enhance enzyme performance).
The ideal temperature is called the set point.
Body’s normal temperature is between 36.5°C and 37.2° Celsius
Negative A response initiated to counteract a stimulus (Cold Temp, PH change etc) and
Feedback return homeostasis to the set point.
Loops Two Stages: Detecting Changes  Receptors detect a stimulus. This could be a
temp or PH change. Counteracting Change  A response (i.e., sweating) is
initiated and acts on the effectors to reverse the change.
Temperature
Blood Sugar

Control The region of the brain that maintains homeostasis by receiving messages from
Centre the receptors and sending instructions to the effectors that respond.
It maintains the fluctuations of the set point.
Once the set point is reached again, the receptors send a signal to the control
centre that we are back to normal, and the control centre tells the effectors to
stop working  This prevents the depletion of energy/Overheating of the body.
Hypothalamu Acts as a link between the endocrine system and nervous system, it sends
s messages to the effectors to carry out the response needed to maintain
homeostasis.
Temperature Thermoreceptors detect the change in temperature in your body.
Homeostasis  Some are in the skin.
 Some in the hypothalamus and detect temperature change in the blood.
Cooling The Body
Receptors (thermoreceptors) detect an increase in temperature.
Messages are sent to the hypothalamus (Control Centre)
Messages are then sent via the nervous system to the effectors.
The body then undergoes processes to lose heat and cool the body.
How? /Results
Vasodilation – Brings blood closer to the surface of the skin which allows heat to
escape.
Sweat glands begin to sweat, removing heat from the body when it evaporates.
Thyroid gland activated to lower the rate of metabolism in the cells, and lower
the amount of heat produced
Warming The Body
Thermoreceptors detect a decrease in body temperature.
 Messages sent to the hypothalamus.
Messages sent to the effectors via the nervous system.
Body acts to conserve heat
How?
Vasoconstriction – Blood vessels constrict to remove blood from surface of the
skin and conserve heat.
Hair stands on the end which traps a layer of warm air around the body.
Release of TSH (Thyroid stimulating hormone), which leads to thyroxin being
produced and increasing the body’s metabolism.
Negative Feedback Loop
The Negative Feedback loop applies
to all types of homeostasis.
VERY IMPORTANT

Glucose High Blood Sugar

Homeostasis 1. Stimulus: The stimulus is an increase in blood glucose levels after
consuming a meal rich in carbohydrates.
2. Receptor: The pancreas serves as the receptor in this feedback loop. It
detects the high blood glucose concentration through specialized cells
called beta cells in the islets of Langerhans.
3. Control Centre: The control centre in this loop is also the pancreas, more
specifically the beta cells within it. These cells assess the elevated blood
glucose levels and initiate the appropriate response.
4. Effector: The effector is the hormone insulin (Makes blood sugar lower),
which is produced and secreted by the beta cells of the pancreas.
5. Response: Insulin is released into the bloodstream as a response to the
high blood glucose levels. It acts on various body cells, such as muscle and
adipose (fat) cells and promotes the uptake of glucose by the body cells.
It may also be stored as glycogen in the liver and muscles.
6. Result: As glucose enters the cells, its concentration in the blood
decreases, returning to a stable and normal range. This decrease in blood
glucose levels is the desired outcome of the negative feedback loop.
Low Blood Sugar
1. Stimulus: The stimulus is a decrease in blood glucose levels, which can
 occur between meals or during physical activity.
2. Receptor: Once again, the pancreas functions as the receptor, detecting
the low blood glucose levels.
3. Control Centre: The control centre remains the pancreas, particularly the
alpha cells in the islets of Langerhans.
4. Effector: The effector, in this case, is the hormone glucagon, produced
and secreted by the alpha cells of the pancreas.
5. Response: Glucagon is released into the bloodstream as a response to
low blood glucose levels. Glucagon (Makes blood sugar higher) signals the
liver to break down glycogen into glucose and release it into the
bloodstream.
6. Result: The release of glucose into the blood raises its concentration back
to a stable level, completing the negative feedback loop for glucose
homeostasis.
Insulin and glucagon create the negative feedback loop.

Type One Diabetes  Affects the insulin producing cells (Beta Cells + Pancreas)
 Causes higher blood sugar which can damage organs and lead to organ failure.
Type Two Diabetes  The cells in muscles etc… that respond to insulin become
less effective.

The Nervous Types of Neurones

Systems • Sensory – carry impulses from the sensory cells. Body to Brain
Involvement • Motor Neurons – Transfer messages from CNS to effectors, such as
in muscles or glands. Brain to Body
Homeostasis. • Interneuron – Located in the CNS – the link between sensory and motor.
The Hypothalamus – The Link
• Control center for much of homeostasis
• Directs effectors to carry out a response either by sending messages
along the nervous system or by secreting hormones.
• Also directs the pituitary gland to secrete hormones to stimulate other
glands to secrete hormones.
The Spinal Cord
• Link the Brain and the peripheral nervous system.
• Send receptor information up.
• Send response information down.
• Coordinates reflexes – Hand on hot plate
Nerves and Homeostasis
• The stimulus is received  Sensory Neuron
• The Control Centre acts on the stimulus and sends out an action message
 Interneuron.
• The message from the control center coordinates the effector and
response  Motoneuron.
The Action Potential
• This is what is responsible for sending the impulse along the axon
• Temporary change
• It’s a change in the concentration of the ions either side of the cell
membrane.

• Only activated if the stimulus is strong enough to reach the potential

threshold value of -55mv
• If this threshold is not reached, the ion channels don’t open, no stimulus
is produced, and no nerve impulse is generated
• All or nothing

The The Endocrine System

Endocrine • Hormones
System • Hormones are chemical messengers.
• Transported in blood stream to specific organs.
• They act on the organs in a specific way that will help to maintain
homeostasis.
• Target Cells – possess receptors for specific hormones.
Hormone Secretion
• Glands are stimulated to release hormones by
• The nervous system
• Other hormones
• Receptors in a particular gland
Pituitary Gland
• Releases hormones to affect other glands.
• Anterior – hormones from hypothalamus
• Posterior – controlled by nerve impulse.
Anterior
Secretes Human Growth Hormone
Other secreted hormones act on Thyroid, Adrenal Gland, and Gonads
Posterior
ADH – regulates water in blood stream.
Increase ADH = Retain water. Decrease ADH = more wee
Thyroid
• Thyroxine – Metabolism
• Anterior pituitary secretes TSH which influences secretion of thyroxine.
• Hypothalamus detects a drop in temp. It acts on the Anterior pituitary to
secrete thyroid stimulating hormone (TSH).
• TSH is the messenger to the cells in the body to increase metabolism
which raises body temperature.
Parathyroid
• Small, embedded glands in the Thyroid
• Role in maintaining Ca in the blood.
• Ca is needed for nerve impulses and muscle contraction.
• When the Parathyroid detects a drop ion Ca, it secretes parathyroid
hormone (PTH)
• PTH causes bones to release Ca into blood, absorb more Ca from food in
the Small Intestine and Reabsorb more Ca in the urine.
Adrenal Glands
• Adrenal Cortex is on the outside and Adrenal medulla is the inside.
• Both are regulated by hypothalamus.
• Cortex – Hormones
• Medulla – Nerve impulses
Adrenal Glands and Stress
• Cortisol and Corticosterone are produced and secreted by the adrenal
cortex.
• Cortisol regulates how the body deals with stress and how it converts
protein, fats and sugars into energy.
• Cortisol and Corticosterone regulate immune reactions and suppress
inflammation.
• Aldosterone – Regulates Na and K in the blood. Increase Aldosterone to
increase Na and decrease K
Pancreas
• Produces Insulin and Glucagon
 • These hormones are produced in the islets of Langerhans – alpha and
beta cells.
Detecting Blood Sugar
Beta Cells
• Chemoreceptors detect high blood glucose.
• Stimulate secretion of insulin
• Removes glucose from blood and stores it as glycogen (liver) or fat.
Alpha Cells
• Low levels of blood glucose were detected.
• Breaks down glycogen and fat stores.
What is An No pathogen
Infectious Non-contagious
Disease? Many are considered preventable
Cause and Genetic Disease
effect of Non- Causes by mutation of a gene or a chromosome.
infectious Single Cell Anomalies
Diseases  Autosomal/Sex-linked
Page 354-358  Cystic Fibrosis
 Sickle Cell Anaemia
 Albinism
 Huntington’s disease
Chromosomal Abnormalities  Too many or not enough: Chromosomal
deletion, non-disjunction (Doesn’t fully separate into chromatids or doesn’t
separate at all), trisomy (Extra one), monosomy (Missing one)
Environmental exposure
 Lifestyle diseases – Direct result of how we live our lives, E.g., Tabacco,
unhealthy diet, and alcohol. Atherosclerosis (Can be genetic) hardening
of the arteries, caused by smoking, drinking, diet and stress – Can lead to
cardiovascular events and strokes.
 Physical Factors – Exposure to physical factors in the environment that
can alter your genetic material – UV + Radiation (Mutagens)
 Chemical Factors – Toxins in the environment around us – Pollution +
Asbestos (Chemical Mutagens). Mesothelioma  Caused by exposure to
Asbestos, small or single dose causes cancer, not obvious till many years
later.
Nutritional Disease – Malnutrition is an imbalance in the diet (Under and Over).
Undernutrition + Lack of Vitamins (Rickets VD + Scurvy VC) + Overnutrition.
Cancer
Syndrome A group of characteristics that occur together to characterize a disease. E.g.
Down (Trisomy 21), Jacob (XYY), Turner (Monosomy X – X0)
Epidemiology The study of the determinants of health-related states or events (including
disease) and the application of this study to the control of disease and other
health problems. For Example (Non-Disease Related): Smoking, Alcohol, and sun
exposure. In terms of disease, it means: What is it? (determinants), Where is it?
(distribution), How to we treat or stop it? (control), Can be used to study
infectious and non-infectious diseases, suicides, car-accidents, work-related
accidents and can inform policy and health programs.

Studies play a major role in identifying patterns in the incidence, distribution,

mortality, and prevalence rates of disease. Identify risk factors and at-risk groups.
From this, we can work on effective strategies to control the disease in the
 population.

Key Terms:
 Incidence – number of new cases in a specific reported time, usually
monthly or yearly.
 Prevalence – Total number of people diagnosed with the disease and still
alive at the end of the given time period.
 Mortality Rate – Number of deaths from a disease in a specific time
frame.
 Incidence and Mortality usually expressed as a number per 100,000.
 Determinants – The causes and other factors that influence the
occurrence of disease. Examples are age, sex, HIV status, genes such as
BRCA 1 and BRCA 2
 Distribution – variations of disease frequency among populations and
geographical locations. Malaria  more in African and Asian countries.
 Control – A group without the disease in question that can be used as a
comparison with the disease group.
Third World Countries – More people die of infectious diseases, because they
lack medical access  Less vaccinations etc.
First World Countries – More people die of non-infectious diseases, because our
medicine is the most up to date and access is easier.
Males + Male life expectancy is 81 years and women is 85 years in Australia.
Females Women live longer and are more likely to experience dementia as a result.
Men Don’t do health checks as regularly as women  That why there is an
increased level of lung cancer in men.\\\\\\\\\\\\\\\\\\
Diabetes Type 1 – Genetic autoimmune disease
Case Study –  The immune system attacks the pancreas.
Recall Blood  Onset is usually in children but can start in adulthood.
Glucose  The body destroys the insulin producing beta cells in the pancreas.
Homeostasis. Type 2 – Genetic and Lifestyle factors
 85-90% of cases are type 2.
 Occurs in adults.
 Managed by diet and exercise.

Type 1:
 Not exactly sure what starts the process off
 There is believed to be some link to several types of common childhood
 viruses.
 No insulin means no glucose converted to glycogen in the liver.
 Dangerously high levels of glucose in the blood

Symptoms of Type 1:
Insulin deficiency results in hyperglycemia (high blood glucose levels) and
accelerates the breakdown of fat. Symptoms of the disease include:
 glucose in the urine
 increased urine production
 excessive thirst
 excessive hunger
 Ketosis
 weight loss
 fatigue
 blurred vision.
 irritability
 muscle cramps
 skin infections
 delayed wound healing.
 tingling or numbness in the feet

Treatment + Control:
 Regular insulin injections
 Healthy diet
  Blood glucose levels are calculated during the day.
 High tech options include insulin pumps under the skin, constant
monitoring of blood with Bluetooth connection to phone and remote
monitoring.
Recall gene cloning. We can use this to produce insulin commercially. HSC Tip –
This might be a way they can link module 6 and 8 together in the one question.
Melanoma Melanoma is:
Uncontrolled cell division in the skin (Cancer)
Melanocytes – Contain Melanin
Can occur anywhere  Men – Head, neck, and torso is more common, Women –
Legs and arms… Body parts most likely to be exposed to the sun.
Things that cause melanoma:
 UV light – UV Light causes a Thymine Dimer 
The T’s next to each other bond instead of the A’s
on the apposing strand.
 Fair complexion with blue or green eyes
 Blonde or Red Hair
 Freckles or skin that burns easily.
 Blistering sunburn as a child
 Prior history of skin cancer
 Moles, especially irregular looking ones
 Family history of melanoma
 Exposure to radiation or organic solvents
 Older age – Had longer exposure
 Males > Women

Progression Of a Malignant Melanoma

 Tumor initially confined to one area.
 Grows in thickness and spreads to the underneath layers of skin.
 Further spread within the lymphatic system to the brain, bones, lungs,
and liver
Other Types of Melanoma
Basal Cell Carcinoma
 Most common and least dangerous
 Slow growing
 Pale, red or pearly in color
Squamous Cell Carcinoma
 Can spread, like melanoma, but not as dangerous.
 Grows over some months on areas of skin most exposed to the sun.

Four Types of Melanomas

Rarer Types of Cancer
Amelanotic and desmoplastic melanomas
 Lacks pigment so harder to spot.
 More aggressive type of melanoma
Ocular Melanoma
 In the eyes
 Part of the eye that gives it color.
Treatment
Stage 1 and 2 can be biopsied off the skin.
Stage 3 and 4
 Melanoma has spread.
 Widespread excision of tissue and lymph nodes
 Radiation and Chemotherapy
 Immunotherapy drugs
Vaccines – BCG Vaccine

Survival Rates
5-year survival rates
 99% for localized Melanoma
 66.3% for regional spread
 27.3% for distant metastasis
 83% of cases diagnosed in the local stage.
If Left Untreated
 It is likely to spread to other areas of the body.
 These secondary sites are likely to impair the normal functioning of the
body.
 Lungs – trouble with oxygen exchange
 Brain – Neurocognitive problems
 Liver – Inability to detoxify body.
Age-Standardized Incidence Rate – Considering the population to be equal  a
more like to like analysis.
 The number of cases per 100,000 is influenced by the number of people
in each age cohort.
 Differences in the age distribution of the population can be accounted for
by Age-standardized incidence rates.
 The age distribution is weighted to give a more accurate number for
incidence.
Treatment + Management of Melanoma
Evaluate the effectiveness of health programs and advertising against the
incidence of melanoma’s  Popular HSC Question.
 Slip Slop Slap (Started 1980) – How Successful is Slip Slop Slap? More
Incidence since the add was released  possibly because more people
are getting checked. Tele Health + the Pandemic has led to a 20% drop in
people attending appointments (Treatment) increasing risk of a
melanoma.
Treatment of Non-infectious diseases
 Nutritional disease may need only the right type of diet. Example – Scurvy
and Vit C
 Cancer is much more complex.
 Many genetic diseases have limited treatments available, so screening
and early diagnosis and management of symptoms is best practice.
Stages of Melanoma

Melanoma Treatment
 Early: Surgery to remove the melanoma from the area
 Late: Radiation - Normal cells repair after X-Ray exposure more easily
than cancer cells the radiation kills the cancer cells by damaging the DNA
 Chemotherapy - Slows the growth of cancer cells, not particularly
effective against Melanoma.
 Targeted Therapies - Drugs that target the growth of cancer cells.
Interrupts the uncontrolled cell division and helps to prevent the spread
of cancer, e.g., Gene Therapy, (CRISPR, Personalized Medicine Future
Methods)
 Immunotherapy - Cause the body’s own immune system to fight the
 melanoma. Checkpoint inhibiters cause the immune system to recognize
and destroy the cancer cells. Vaccinations that use the melanoma cell to
produce an antigen to target the immune system.

Vaccine
Trial

Prevention strategies
Genetic Engineering  the manipulations of genes (CRISPR, Transgenics (Golden
Rice), Vaccines, pre-implantation genetic testing)
Ethics of gene manipulation (Genetic Engineering)
 Should we be able to choose specific genotypes?
 Is it ok to screen for disease and destroy embryo’s?
 Is it ok to screen for other traits?
Genetic Screening for Disease Susceptibility  Human Genome Study – BRCA1
OR BRCA2.
Pre-Implantation Genetic Testing  Choosing the genotype of your baby to avoid
medical conditions.

Vaccines  Human Papilloma Virus (HPV) was found to be linked to cervical

cancer, so a vaccine was created using genetic engineering. It was found to be
100% effective before sexual activity and found to also prevent oral and throat
cancers as well as other.
Melanoma Case Study – Booklet
Define Cancer  Cancer is the uncontrolled growth of abnormal cells in the body.
Cancer develops when the body’s normal control mechanism stops working. Old
cells do not die and instead grow out of control, forming new, abnormal cells.
These extra cells may form a mass of tissue, called a tumour. Some cancers, such
as leukemia, do not form tumours.

What is the role of the following genes in the process of cell division?

DNA Repair Genes – The Mechanic: The Person who Repairs the Car  DNA
repair genes code for proteins that correct errors during DNA replication (Prior to
cell division). DNA repair genes are active throughout the cell cycle, but
particularly during G2 after DNA replication (S Phase – DNA Synthesis or
Replication) and before chromosomes divide (Mitosis). Mutations in DNA repair
genes can lead to a failure in repair, which in turn allows subsequent mutations to
accumulate. If the rate of DNA damage exceeds the capacity of the cell to repair
it, the accumulation of errors can overwhelm the cell and result in cancer.
Examples of DNA repair genes include BRCA1 + BRCA2.
Proto-oncogenes  A proto-oncogene is a healthy gene found in the cell. There
are many proto-oncogenes. Each one is responsible for making a protein involved
in cell growth, division, the inhibiting of cell differentiation (When cells change
their function) and the prevention of unnecessary cell death (apoptosis). These
proto-oncogenes are active throughout the entire cell-cycle and can move
through checkpoints.

Oncogenes – The Gas Pedal  An oncogene is a proto-oncogene that has

mutated to signal uncontrolled growth of abnormal cells - i.e., cancer. Oncogenes
are ‘gain of function’ genes, that gain the ability to drive non-stop growth.
Oncogenes tell the cell to continue through all checkpoints in the cell cycle
without stopping, causing excessive cell growth and division. A single mutated
oncogenes usually isnt enough to cause cancer all by its self due to tumour-
suppressor genes which are activley preventing the cells uncontrolled growth.

Tumor Suppressor Genes (TSG) – The Brake Pedal  Tumour suppressor

genes are normal genes that slow down cell division or tell cells to die at the right
time (a process known as apoptosis or programmed cell death) – Suppression of
the cell cycle and promotion of apoptosis – When tumour suppressor genes don't
work properly, cells can grow out of control, which can lead to cancer. A tumour
suppressor gene is like the brake pedal on a car. It normally helps keep the cell
from dividing too quickly, just as a brake keeps a car from going too fast. The
ABSENCE of a TSG or – removal of the brake – can lead to uncontrolled growth
i.e., Cancer.

Cancer Causing Mutations:

The PRESENCE of Oncogenes (Caused

by a mutation of a proto-oncogene)
The ABSENCE/inactivation of Tumor
suppressor genes

Assess the role of BRCA1 in the development of Breast Cancer  The BRCA1
gene provides the instructions for a protein that acts as a tumor suppressor,
preventing the cells from growing and dividing rapidly in an uncontrolled way, it
has also been found to play a role in transcription. However, the leading role of
the protein is the repairing of double-strand breaks in DNA.

BRCA 1 interacts with several other proteins to mend breaks in DNA – preventing
the likelihood of mutations which can cause tumor growth. Each of your cells
contain two copies of BRCA1 and BRCA2 genes (One copy each from your mother
and one copy from your father). BRCA gene mutations are autosomal dominant,
meaning that having one copy of the abnormal genes impairs their normal anti-
cancer effect. A BRCA gene mutation can be inherited or acquired as a result of
DNA damage related to the environment, lifestyle factors (like smoking), or even
normal metabolic processes in cells. Having a BRCA mutation gives you a genetic
predisposition to cancer, but it does not mean that you will definitely develop
cancer.

A mutated BRCA1 gene usually makes a protein that does not function properly.
Researchers believe that the defective BRCA1 protein is unable to help fix DNA
damage leading to mutations in other genes. These mutations can accumulate
and may allow cells to grow and divide uncontrollably to form a tumour. Thus,
BRCA1 inactivating mutations lead to a predisposition for cancer. Cancer is not
guaranteed unless BRCA genes are inactive in a cell, meaning that even if a
person inherits a BRCA1 or BRCA2 mutation from one parent, they still have the
normal copy of the BRCA1 or BRCA2 gene from the other parent. The cancer can
only occur when both BRCA genes are compromised.

The lifetime risk of breast cancers in carriers of a BRCA1 mutation is up to 70%

compared to around 12% in non-carriers. By contrast, 55%–72% of women who
inherit a harmful BRCA1 variant and 45%–69% of women who inherit a
harmful BRCA2 variant will develop breast cancer by 70–80 years of age. It is still
unknown the direct correlation between harmful or mutated BRCA1 genes and
breast cancer, research so far has ruled out breast tissue specificity of the
protein, another hypothesis is the BRAC1 genes interaction with sex-hormones
such as progesterone and estrogen but there isn’t enough evidence to suggest
this is the reason why people with a mutated BRCA1 gene are more likely to have
breast cancer.

Distinguish between benign and malignant tumours.  Benign tumours refer to

non-cancerous growths in the body. The main difference between benign and
malignant tumours is that the former are usually harmless while the latter are
usually harmful. In contrast to cancerous tumours, benign tumours do not spread
from origin to other parts of the body. Malignant tumours refer to cancerous
growths in the body. In contrast to benign tumours, these tumours can spread to
other parts of the body from the point of origin. Furthermore, a cell of a
malignant tumour can destroy adjacent tissue.

Metastasis  The spread of cancer from one location (primary tumour) to

another, forming a second tumour. Secondary tumours are made up of the same
type of cells as the primary tumour – this can affect the treatment required e.g., if
breast cancer spreads to the liver, the patient has a secondary breast cancer of
the liver and will need to be treated with breast cancer medication.

Vascularization - As
tumours grow, they
stimulate angiogenesis
or new blood vessel
growth into them to
sustain their growth.
Benign Tumours
 Non-cancerous
 Cannot spread to other parts or organs of the body or metastasize.
 Slow growth rate
 They do not invade nearby or adjacent tissue.
 The shape, chromosomes, and DNA of cells have a normal appearance
when examined under a pathologist’s microscope.
 These tumours do not secrete hormones and other substances.
 They mostly don’t require treatment because they are usually harmless
and non-threatening.

Malignant Tumours
 Cancerous
 Cells of a malignant tumour can spread to other organs and parts of the
body.
 Malignant tumours have a fairly rapid growth rate.
 They often invade the basal membrane that surrounds an adjacent or
nearby healthy tissue.
 Malignant tumours can spread through the lymphatic system or
bloodstream. Furthermore, they may also spread by extending ‘fingers’
into the adjacent tissue, this is known as metastasizing.
 Cells of the malignant tumours have abnormal chromosomes and DNA.
Moreover, their characterization is large and dark nuclei that may have
an abnormal shape.
 These tumours may recur after their removal. Furthermore, they may
also recur in regions other than the original site.
 Malignant tumours can secrete certain substances that result in weight
loss and fatigue.
 They may require treatment and even aggressive treatment including
chemotherapy, surgery, radiation, and other medications.
Mutagens play a role in cancer development by changing the genetic material of
an organism. This may be a direct action on the DNA, or effect the way that DNA
replicates. Mutagens can be physical, chemical, or biological.
Physical Mutagens:
 Heat
 Ionising Radiation (shorter wavelengths = More damage): X-rays + gamma
rays, radioactive elements (emitting alpha, beta, or gamma rays found in
soil from nuclear spills etc…)
 Electromagnetic Radiation: Ultraviolet (UV  emitted by the sun)
Chemical mutagens:
 Alcohol
 Smoke (smoking)
 Carbon (charred foods)
 Nitrates (found in some food
preservatives)
Biological Mutagens:
 End-products of metabolism (may be produced by fungi, plant or animal
cells). These mutagens tend to be discovered when sudden outbreaks of
cancer occur in organisms, due to their particular exposure to soils and or
new foods.  Nitrosamines are chemicals that form on the stomach
when certain foods or food ingredients are eaten in combination.
 Microbes i.e., Viruses (Hepatitis B, HIV, rubella virus) and bacteria
(Helicobacter)  these microbes can directly alter genetic material in
cells. Inserting their own base sequence or plasmids that change the
function of genes, triggering cancer.
In most cases it is not just a single risk factor i.e., smoking, but combinations of
different factors that influence your chance of developing cancer.

Evaluate the risk of someone developing cancer is they began smoking in their
teens as opposed to beginning smoking in their 50s.
An individual who began smoking in their teens would be more at risk for
developing cancer compared to someone who began smoking in their 50s. The
risk of developing lung cancer according to cancer Australia increases with
duration of smoking. Smokers who began smoking in their teens due to their
prolonged exposure to the chemical mutagens or carcinogens within cigarettes
have an increased risk of developing cancer. The increased exposure allows for
more damage and thus mutations to occur in DNA, this build up in damage has
been found to increase the possibility of cancer developing.

Melanoma
What is a melanoma? A Melanoma is a type of skin cancer that develops in
the skin cells called melanocytes (The cells that produce melanin – the pigment
that gives skin its colour) and usually occurs on the parts of the body that have
been overexposed to the sun.
What are some possible causes of melanomas?  Melanoma risk is increased
for people who have:
 Unprotected UV radiation exposure (UV Radiation is a known physical
mutagen) + A history of childhood tanning and sunburn (Ultraviolet (UV)
rays from the sun or tanning beds damage DNA in your skin cells. Your
immune system repairs some of this damage but not all. Over time, the
remaining DNA damage can lead to mutations that cause skin cancer).
 A family history of melanoma in a first degree relative increases your
chance of developing a melanoma by 50%
 Fair skin, a tendency to burn rather than tan, freckles, light eye colour
(blue or green), light or red hair colour.
 Having had a previous melanoma or non-melanoma skin cancer.
 Moles - The more moles you have on your body, the higher your risk for
melanoma. Also, having large moles (larger than a tip of a pencil eraser),
or any atypical moles, increases the risk for melanoma.
 A weakened Immune system

Signs of a Melanoma:
 A large brownish spot with darker speckles
 A mole that changes in colour, size or feel or that bleeds
 A small lesion with an irregular border and portions that appear red, pink,
white, blue or blue-black
 A painful lesion that itches or burns
 Dark lesions on your palms,
soles, fingertips, or toes, or
on mucous membranes.

The affects of an untreated

melanoma:
When left untreated, skin cancer can
permanently damage surrounding
cells, or metastasize throughout the
body, becoming fatal.
What are current treatments and how successful are they?  Treatment of a
melanoma can vary depending on what stage it has been identified in. If you have
been diagnosed with Stage III or IV (advanced) melanoma you may be
recommended to have a combination of different treatments including surgery,
drug therapy, and radiation.
 Surgery  Surgery is the standard treatment for early-stage melanoma
skin cancer. Thin, early-stage melanomas can be removed by minor
surgery (under local anaesthetic) that excises the tumour and some
normal skin tissue around it. A wide margin of healthy skin around the
edge of the tumour is removed to ensure that no cancer cells were left
behind. This is called wide local excision. The thicker the tumour, the
wider the margin required. The 5-year survival rates for Melanomas
removed via surgery are: 94% for all stages of melanoma combined,
more than 99% for early-stage melanoma that has not spread, 71% for
melanoma that has spread to regional areas, such as nearby lymph
nodes.
 Removal of Lymph Nodes  If the melanoma has spread to nearby
lymph nodes (Stage III Melanoma) these lymph nodes are usually
removed by surgery under general anaesthetic. This is called lymph node
dissection. It will not necessarily cure the cancer, but it might prolong
survival and avoid the pain resulting from the cancer growing in the
lymph nodes. This can cause side effects, including a build-up of fluid in
the limbs or neck – 20% to 30% risk of lymphoedema. “Once the
definitive trials were done, we learned that CLND wasn't helping, it wasn't
improving survival. Subsequent trials demonstrated that immunotherapy
can improve survival in metastatic melanoma." – Martin McCarter,
professor of surgical oncology, CU School of Medicine.
 Chemotherapy  Along with surgery, some people may
receive chemotherapy. Chemotherapy may be less effective for
melanoma than for some other types of cancer. For this
reason, immunotherapy and targeted therapy may be preferred.
However, chemotherapy may be used to prolong survival or relieve
symptoms.

 Radiation  Along with surgery, some people may receive radiation

therapy. Radiation therapy is not usually used to treat the original
melanoma in the skin. It may be used to treat melanoma that has come
back (recurred) or to kill any cancer cells remaining after surgery. In
patients with metastatic melanoma, radiation therapy is primarily used to
palliate or lessen symptoms. Although radiation cannot cure advanced
melanoma, it can frequently shrink tumours that cause discomfort.

 Targeted therapy  refers to treatment with medicines that are

designed to specifically attack cancer cells without harming normal cells.
These types of medicines affect the way that cancer cells grow, divide,
repair themselves or interact with other cells.
  Immunotherapy  uses medicines to stimulate the immune system to
attack cancer cells. Immunotherapy may be used after surgery to attack
remaining cancer cells, or it may be used to treat tumours that can’t be
removed by surgery.

What are the survival rates for melanoma?  According to: The National Cancer
Institute’s Surveillance, Epidemiology, and End Results (SEER)