30084.

qxd 9/16/04 1:41 PM Page 1209

J Periodontol • September 2004

Relative Proportions of T-Cell

Subpopulations and Cytokines That
Mediate and Regulate the Adaptive
Immune Response in Patients With
Aggressive Periodontitis
Lina J. Suárez,* Ana M. Ocampo,* Ricardo E. Dueñas,* and Adriana Rodríguez*

Background: Both the virulence factors of periodontopathic bac-

teria and the immune response against them have been involved in
tissue destruction observed in periodontal disease. Considering the
regulatory role of cytokines produced by T cells, the purpose of this
study was to compare the CD3+, CD4+, and CD8+ subpopulations

P
eriodontal diseases are a group of het-
of T cells, and to characterize the mRNA of cytokines involved in erogeneous conditions caused by
the adaptive immune response in a group of healthy/gingivitis 1 bacterial infection and affecting sup-
(HI/G1) individuals and aggressive periodontitis (AgP) patients. porting tissues of the teeth, which can lead
Methods: The percentages of T-cell subpopulations were ana- to loss of bone and periodontal ligament.
lyzed in 10 gingival samples of HI/G1 individuals and 10 gingival They can be divided into two groups
samples of AgP patients by immunohistochemistry. The presence (chronic and aggressive) according to the
of interleukin (IL)-2, interferon (IFN)-γ, IL-4, IL-5, IL-10, IL-13, and progression of lesions and other factors.
transforming growth factor (TGF)-β was measured by reverse All periodontal diseases in which a bacte-
transcription polymerase chain reaction (RT-PCR) of mRNA rial biofilm plays a main etiological role
extracted from complete gingival biopsies. have two factors associated with the clin-
Results: Significant differences were found in CD3+ and CD4+ ical advancement of the condition. The
cell counts between both groups. The parameters were lower in first is the microbiological factor that causes
the gingival biopsies from AgP patients while CD8+ counts were direct damage by bacterial products and
similar in both groups. The cytokine mRNA analysis showed con- the second is the host response as a con-
stant expression of IL-2 and IFN-γ in all cases. The mRNA of IL-5 sequence of immune activation to defend
and IL-10 was present in the majority of HI/G1 (N = 10, N = 9, tissues from infection. Therefore, immuno-
respectively) but was not in the AgP group (N = 2, N = 1). IL-13 logical factors seem to be related to tis-
and TGF-β were only detected in HI/G1 (N = 2, N = 3) and IL-4 sue destruction in periodontitis.1
was not detected in any of the individuals. Diverse models related to periodontal
Conclusions: These results indicate that the role of the CD8+ disease pathogenesis have been pub-
subpopulation in aggressive periodontitis lesions is limited. On lished.2-4 In 1976, one of the most impor-
the other hand, cytokines IL-2 and IFN-γ may not be relevant in tant reports established a histological
the progression of aggressive periodontitis. J Periodontol 2004;75: approximation to the cellular mechanisms
1209-1215. involved in the damage.2 This study placed
a great deal of attention on acquired cel-
KEY WORDS
lular immunity due to the presence of T
Cell count; clinical trials; cytokines; growth factors, and B cells in all stages (especially estab-
transforming; immune response; interferon; interleukin-1; lished and advanced lesions) of gingival
periodontitis, aggressive; RNA, messenger; T lymphocytes. and periodontal disease progression.2 A
direct relation between cytokine produc-
* Pontificia Universidad Javeriana, School of Dentistry, Center for Dental Research, Bogotá, tion and the existence of a stable or pro-
Colombia. gressive lesion has been established.5 The
stable periodontal lesion was character-
ized by cells that express T1 cytokines
and the progressive one by cells that
express T2-type cytokines.5

1209
30084.qxd 9/16/04 1:41 PM Page 1210
T Cells and Cytokines in Aggressive Periodontitis
The functions of T1 and T2 cells correlate with their
distinctive cytokines. T1 cells secrete IFN-γ, lymphotoxin
(LT or TNF-β), and IL-2 and predominate in cell-mediated
inflammatory reactions.6 T2 cells secrete IL-4, IL-5, IL-10,
IL-13, and TGF-β, which help antibody production and
play a prominent role in anti-helminth and allergic re-
sponses.6 It is now accepted that T cells and their effector
phase are responsible for tissue damage in periodontal
disease.7 However, the division of cytokine profiles is not
clear and the characteristics of T-cell response may coin-
cide with a T0 profile.8 Furthermore, evidence is limited
to periodontally healthy individuals and chronic periodon-
titis patients, while reports related to immunological char-
acteristics of aggressive periodontitis (AgP) are few and
contradictory.
The purpose of this research was to compare the
total (CD3+), helper (CD4+), and cytotoxic (CD8+) T
cells and to characterize the mRNA of cytokines in-
volved in the adaptive immune response, expressed by
cells present at the periodontal level. Complete biopsies
of healthy individuals and AgP patients were used to
establish differences that could explain the role of the
immunocompetent cells and cytokines in the disease
progression.
MATERIALS AND METHODS
Study Population
Twenty (20) individuals, who voluntarily participated in
the trial, were divided into two groups. The experimental
group consisted of 10 patients undergoing treatment at
the Javeriana University Dental School in Bogotá,
Colombia who had been diagnosed with AgP accord-
ing to the criteria established in 1999.9 The common
features of localized and generalized forms of AgP are:
except for the presence of periodontitis, patients are
otherwise clinically healthy; rapid attachment loss and
bone destruction; and familial aggregation.10 The con-
trol group consisted of 10 patients diagnosed either as
periodontally healthy individuals or as individuals with
a gingival index of 1 (HI/G1).11 Patients who were under-
going antibiotic therapy or had periodontal treatment
during the previous 6 months were excluded from the
study.
Informed consent was obtained from each patient
according to the Helsinki Declaration. The protocols
were reviewed and approved by the Ethics and Inves-
tigation Committee of the Javeriana University Den-
tal School. Gingival tissue biopsies were taken from
all patients. In the AgP group, the biopsies were har-
vested during open flap scaling and root planing
procedures or during extractions of teeth with a poor
periodontal prognosis. All biopsies were taken from
sites with bleeding on probing and depths >6 mm.
The control group biopsies were collected during
crown lengthening procedures or during extractions
for orthodontic purposes. The biopsies contained oral
1210
Volume 75 • Number 9
epithelium, gingival connective tissue, and sulcular/
junctional epithelium.
Tissues for immunohistochemistry were washed with
saline solution and fixed in 10% neutral buffered forma-
lin prior to the paraffin embedding procedure. For
RT-PCR, the biopsies were placed immediately in liquid
nitrogen until they were processed. In all cases the biop-
sies were processed 1 to 12 hours after removal from
the oral cavity.
Immunohistochemistry
Thin (6 µm) serial sections were obtained from each
specimen block and immunohistochemistry was per-
formed using a three-step immunoperoxidase procedure.
First, the tissue was deparaffinized, rehydrated, and
immersed in citrate buffer for conditioning. The endoge-
nous peroxidase was blocked and the detection of CD3+,
CD4+, and CD8+ T cells was performed using a com-
mercially available kit.† The sections were incubated
with normal horse serum and the primary antibodies
were added (anti-CD3,† anti-CD4,† and anti-CD8†). After
washing twice, the secondary antibody (mouse anti-IgG
biotin-conjugated)† was added. Following the addition
of streptavidin a-peroxidase,† the reaction was devel-
oped with 3,3′-diaminobenzidine (DAB),† counterstained
with hematoxylin, and washed and mounted in glycergel.
The sections were then examined under a microscope‡
at ×10. Negative controls excluded the primary anti-
bodies and positive controls were performed on a human
tonsil biopsy.
Statistical Analysis
The immunohistochemistry was analyzed using the
mean ± standard deviation of positive cell percentage
for each marker in relation to the total number of cells
with mononuclear morphology. The association between
variables was made in pairs (health versus disease)
using the Mann-Whitney U test; statistically significant
values were set at P ≤0.05.
Primers and Positive Controls
The primers and positive controls for IL-2, IL-4, IL-10,
and TGF-β were purchased.§ Positive controls for IL-5,
IL-13, IFN-γ, and β-actin were obtained by activation of
peripheral blood mononuclear cells (PBMC) separated
by density gradients on Ficoll-hypaque
with concanavalin
A (Con-A)¶ at a final concentration of 20 µg/ml in
24-well culture plates containing 2 × 106 cells/ml for
24 hours. Primer sequences for these cytokines were
reviewed in the literature12,13 and synthesized.# The
sequences are:
†
‡
Novocastra Laboratories Ltd., Newcastle, U.K.
Eclipse E-400, Nikon Inc., Instrument Group, Melville, NY.
§ R & D Systems Inc., Minneapolis, MN.

Ficoll-Paque Plus, Amersham Pharmacia Biotech, Piscataway, NJ.
¶ Sigma-Aldrich Fine Chemicals, St. Louis, MO.
# Invitrogen Life Technologies, Carlsbad, CA.
30084.qxd 9/16/04 1:41 PM Page 1211
J Periodontol • September 2004
β-actin: 5′CCTTCCTGGGCATGGAGTCCTG 3′
(202 bp) 3′GGAGCAATGATCTTGATCTTC 5′
IL-5: 5′ATGAGGATGCTTCTGCATT 3′
(193-203 bp) 3′TTCAGTGCACAGTTGGTG 5′
IL-13: 5′TCATTGAGGAGCTGGTCAACATC 3′
(664 bp) 3′TTGCCTGTGTGTGAAGTGGGTC 3′
IFN-γ: 5′AATGCAGGTCATTCAGATG 3′
(270 bp) 3′TTGGACATTCAAGTCAGTT 5′
mRNA Extraction and Reverse Transcription
The mRNA extraction was made using a commercially
available kit.** Once the whole biopsy was homoge-
nized by cryofracture under liquid nitrogen, it was pre-
pared following the manufacturer’s instructions. The
tissues were lysed in buffer with β-mercaptoethanol,
precipitated with 95% ethanol and treated with DNAse.
The elution of mRNA was made in RNAse-free water
and the RNA was kept at −85°C until used. From the
extracted mRNA, 8 µl were reverse transcripted using
a cDNA synthesis kit in a final volume of 15 µl. The
aliquot of mRNA was preheated at 65°C for 10 min-
utes and then the mix containing the reverse trans-
criptase,# 2′-deoxynucleoside 5′-triphosphates, aqueous
solution of dithiothreitol 200 mM, and the random pri-
mer PD(N)6 (aquose solution 0.2 µg/µl) was added.
The reaction was incubated at 37°C for 1 hour and
was stopped by increasing the temperature to 95°C
for 5 minutes. The cDNA was kept at 4°C or immedi-
ately amplified.
Polymerase Chain Reaction
After standardization, 10 µl of 1:3 dilution of the cDNA
was used for product amplification. The master mix con-
tained 5 µl of buffer Taq 10×, 3 µl of MgCl2 (15 mM),
0.5 µl of Taq polymerase,†† and 0.5 µl of each primer
(1 µM), in a final volume of 50 µl. The reaction was
amplified in a thermocycler.‡‡ The primers were designed
exclusively for the recognition of RNA sequences. Ad-
ditionally, the contamination with genomic DNA was
controlled by adding mRNA instead of cDNA to the reac-
tion. cDNA was replaced with sterile water as a negative
control.
PCR Product Analysis
The products were separated by electrophoresis in
agarose gels 1.5%¶ in TBE pH 8.3 (Tris Borate 0.0445 M,
EDTA 0.001 M¶) and stained with 3% ethidium bro-
mide.§§ Each well contained 8 µl of the product and 3 µl
of loading buffer 6x.¶ The gels were observed with ultra-
violet light

and photographed.

The qualitative analy-
sis of bands corresponding to the cytokine products was
performed visually and the lanes were scored as present
or absent for all cytokines in each patient. The results
are presented as absolute frequencies. Differences
between groups were analyzed by chi-square test
(P ≤0.05).
Suárez, Ocampo, Dueñas, Rodríguez
RESULTS
T-Cell Populations
All biopsies of healthy individuals showed chronic inflam-
matory infiltrate that resembled signs of sub-clinical
gingivitis. The percentages of CD3+ cells, CD3+/CD4+,
and CD3+/CD8+ in the connective tissue were signifi-
cantly different in both groups. The percentage of CD3+
in relation to the total amount of mononuclear cells was
lower in patients diagnosed with AgP (33% versus
61.1%; P <0.05). Similarly, the CD3+/CD4+ expression
was lower in the biopsies of this group (8.5% versus
29.2%; P <0.05). The CD4+/CD8+ ratio was reduced in
patients with AgP when compared to HI/G1 group (0.4
versus 0.92; P <0.01). The difference in CD8+ cells was
not significant.
Cytokine Expression
All samples analyzed were positive for β-actin (Fig. 1A).
Two profiles of cytokines were observed in HI/G1 biop-
sies, three samples were positive for IL-2, IFN-γ, IL-5,
IL-10, and TGF-β1 and four samples were positive for
IL-2, IFN-γ, IL-5, and IL-10 (Figs. 1A and 1B).
Transcripts for IL-13 and TGF-β were found in two
and three samples of HI/G1 group, respectively, but were
absent in diseased tissue. These differences lacked sta-
tistical significance. IL-2 and IFN-γ were found in equal
proportions in HI/G1 and AgP, indicating a lack of rele-
vance of these cytokines in the pathogenesis of the dis-
ease (Figs. 1A and 1B).
IL-5 and IL-10 were not observed in the diseased tis-
sue, but were present in the biopsies of HI/G1 group.
The differences in these cytokines’ mRNA expression
were statistically significant (P = 0.00026 for IL-5 and
P = 0.00035 for IL-10). No IL-4 mRNA was detected
in the samples studied, but the positive control showed
the expected pattern of expression (Fig. 1B).
DISCUSSION
The presence of T cells and their activation products act-
ing as guides of the periodontal disease process are impor-
tant constituents of progression models.11 Several
studies2,7,14-20 explore the nature of the inflammatory
response in chronic periodontal lesions as well as in healthy
and chronic periodontitis tissues; however, findings are
contradictory and not conclusive. This is probably due to
the diversity of methods used and to the continuous devel-
opment of antibodies with high specificity used to deter-
mine cell subtypes infiltrating the connective tissue.
Previous studies in chronic periodontitis using
immunohistochemistry and immunofluorescence sup-
port the classic concept that T lymphocytes dominate
the cellular infiltrate in healthy/gingivitis lesions, while
** SV Total RNA, Promega, Madison, WI.
†† First Strand, Amersham Pharmacia Biotech.
‡‡ MJ Research, Inc., Watertown, MA.
§§ MERCK, Darmstadt, Germany.


Bio-Rad Laboratories, Inc., Hercules, CA.
1211
30084.qxd 9/16/04 1:41 PM Page 1212
T Cells and Cytokines in Aggressive Periodontitis
periodontitis lesions are associated with high numbers
of B cells in the infiltrate.2,14,15 However, this concept
is not clear for aggressive periodontitis, due to the low
volume of published works.
In this study, T cells were evaluated in relation to the
total number of cells possessing a lymphoid phenotype.
The results confirmed a low number of T cells (CD3+)
in aggressive periodontitis biopsies compared to HI/G1.
This reduction of CD3+ could indicate that other lym-
phocytic cells like B lymphocytes may play an impor-
tant role in the immune response that mediates dam-
age in AgP; however, this would have to be confirmed
with additional research. This could also imply that T
cells in the advanced stage of the disease development
at which the biopsies are taken are not the most rele-
vant cells associated with tissue destruction.
The analysis of T-cell subpopulations revealed that
the decrease of total CD3+ in AgP is caused by a reduc-
tion in CD4+ T cells. At the same time, the CD8+ sub-
population remains stable in both study groups. These
results indicate that CD8+ might not have an impor-
tant role in aggressive periodontal disease pathogen-
esis. Taking into account that the principal role of CD8+
T cells is to respond against intracellular microorgan-
isms, the results of this study could indicate that even
when the response is activated in periodontal lesions
of AgP, it is not directed against the extracellular bac-
teria that cause periodontal disease.
1212
Volume 75 • Number 9
B
Figure 1.
A) Amplified products of cytokine message from whole gingival
tissues. Lane 1, molecular weight marker (Hae III-digested φX
174 replicate form DNA); lane 2, positive control; lane 3, negative
control; lanes 4 through 13, healthy samples; and lanes 14 through
23, aggressive periodontitis samples. B) Graphic analysis of
cytokine messages in aggressive periodontitis and healthy tissues.
On the contrary, studies by Lappin et al.16 comparing
inflammatory cells contained in the mononuclear infil-
trate in gingival biopsies from patients with chronic
periodontitis (CP) and aggressive periodontitis indi-
cated that percentages of CD3+ are higher in the AgP
group than in the CP group due to an increase in CD4+
subpopulations and that the CD4+/CD8+ ratios are sim-
ilar in both cases. Even if differences exist between
the groups, it is not possible to establish comparisons
with healthy tissues.
The present study also found that CD4+/CD8+ ratios
were significantly diminished in patients with AgP (0.4)
compared with the HI/G1 group (1.0) (P = 0.003). This
reduction in the CD4+/CD8+ ratios in AgP was caused
by a lower number of CD4+ cells, while the HI/G1 group
exhibited balance in the different T-cell subpopulations.
The CD4+/CD8+ ratios reported in the literature are
diverse with values lying between 1 and 1.97 in CP and
healthy tissues, but the phenotypes of cells affecting
the ratios are not reported.17-20
The CD4+ function over other cell types can be dual
according to the cytokines produced.6 Therefore,
mRNA detection of the induced cytokines involved in
the immune response was observed and the relevant
evaluation was made.
Cytokines are cellular regulators greatly influencing
the generation and activation of immune responses. They
act in the initiation of the effector phase and regulate
30084.qxd 9/16/04 1:41 PM Page 1213

J Periodontol • September 2004 Suárez, Ocampo, Dueñas, Rodríguez

the length and extent of the response, Initially, cytokines protective.37 The results of the present study do not
were believed to be exclusively produced by CD4+21 support the previously proposed models, nor the IL-10
T cells, but now it is clear that the arrangements of cyto- hypothesis. Based on our results, we suggest that the
kines produced by cells is a result of their function and T2 cytokine loss in AgP, rather than the presence of
not of their phenotype.22 Furthermore, cytokine produc- T1 cytokines, is responsible for damage progression.
tion is related to the cells differentiation stage and to IL-10 and IL-4 are both inhibitors of T1 effector’s
transitory phases of their response.22 function, downregulating the proinflammatory cyto-
After decades of studies and dozens of published kines (IL-1, TNF-α, IL-6) as well as the nitrogen and
reports,5,15,23-31 analysis of results related to cytokine pro- oxygen reactive metabolite production.38-40 The coex-
duction in periodontal disease is confusing due to the ex- istence of T1 and T2 cytokines in healthy tissues could
tended range of experimental models and methods used. indicate that, in these individuals, IL-10 exerts anti-
Regarding the expression of cytokines in cells and inflammatory functions keeping innate and acquired
tissues extracted from patients with periodontal dis- immune response homeostasis. The increase in IL-1ra
ease, studies have found different cytokine profiles, produced by IL-1038 leads to an equilibrated response
such as depressed T1 responses23 with diminished IL-2 that could be important in maintaining healthy peri-
expression, augmented T2 responses5,24-28 character- odontal tissues (Fig. 2).
ized by high expression of IL-4, T1 responses domina- Another important function of IL-10, which can also
ting T2 responses,28 and T0 responses.15,29-31 be carried out by IL-2, is the induction of B-cell prolifer-
In AgP research, reports are few, methodologies are ation. The fact that B lymphocytes are present, even in
diverse, and T-cell subpopulations analyzed32-36 vary. the absence of CD4+ cells, could imply that B-cell acti-
None of the works reviewed used a similar methodology vation by T-independent antigens identified on periodon-
for detection of mRNA in gingival tissue in AgP patients. topathogens could be present in AgP advanced lesions.
Therefore, comparisons between studies are difficult. On the other hand, the presence of IFN-γ could prob-
The present study found equal expression of IL-2 ably be due to the autocrine function of this cytokine
and IFN-γ mRNA in healthy individuals and AgP pa- and the constant presence of CD8+ cells in healthy and
tients, while IL-5 and IL-10 transcripts were present only diseased individuals. There is no consensus in the lit-
in HI/G1 tissues. The rest of the cytokines studied did erature regarding the presence of macrophages and the
not show significant differences.
Diverse hypotheses have been
constructed to explain the role of
host response in periodontal tissue
damage related to T-cell function.
One of the accepted theories pro-
poses a protective role of T1 in
conjunction with functional specific
antibodies in stable lesions and
destructive T2 profiles leading to B
cell expansion with production of
non-protector antibodies and poor
innate immune response in pro-
gressive lesions.5 On the contrary,
a protective role has been attrib-
uted to T2, especially to IL-4, which
leads to reductions in cytokines
and proinflammatory factors pro-
duced by macrophages. However,
lower T2 responses causing dereg-
ulation of monocytic response with
high production of IL-1 have also
been described as the cause of tis-
sue loss.28,36
Furthermore, IL-10 has been
proposed as a damage regulator.
The presence of high levels of this Figure 2.
cytokine are considered destruc- Hypothetical model of periodontal maintenance and possible mechanisms by which immune cells
and cytokines might participate in aggressive periodontitis.
tive and low levels are considered

1213
30084.qxd 9/16/04 1:41 PM Page 1214
T Cells and Cytokines in Aggressive Periodontitis
function of IFN-γ as an important activator of this cell
in periodontal lesions.41-43
The absence of TGF-β in this study could be related
to the low number or absence of macrophages observed
in the biopsies (data not shown); however, it is neces-
sary to identify the monocytic cell presence in perio-
dontal lesions in AgP patients.
Finally, in advanced stages of periodontal lesions,
host immune response is inappropriate and is not
directed against chronic extracellular bacterial infection,
which is the main etiological factor of periodontitis.
In conclusion, the present results indicate that the
role of the CD8+ subpopulation in AgP lesions is lim-
ited, while the significant reduction of CD4+ cells could
have an important function in the immunopathogene-
sis of this kind of disease. Additionally, cytokines IL-2
and IFN-γ may not be important factors in the damage
progression of AgP, but the loss of regulation mediated
by IL-5 and IL-10 could be involved in the degeneration
of periodontal structures observed in these patients.
ACKNOWLEDGMENTS
This investigation was supported by grant 268-98 from
The Colombian Institute for the Development of Science
and Technology, Francisco José de Caldas, “Colciencias.”
The authors thank Dr. Camilo Duran, Pontificia Univer-
sidad Javeriana; Dr. James Gutmann, Baylor College
of Dentistry; and Mrs. Natalia Pineda for review of the
manuscript and Yaneth Osorio, International Center for
Training and Medical Research, CIDEIM, Colombia, for
expert technical assistance.
REFERENCES
1. Page RC, Kornman K. The pathogenesis of human peri-
odontitis: An introduction. Periodontol 2000 1997;14:9-11.
2. Page RC, Schroeder HE. Pathogenesis of chronic inflam-
matory periodontal disease: A summary of current work.
Lab Invest 1976;33:235-249.
3. Page RC. Gingivitis. J Clin Periodontol 1986;13:345-355.
4. Kornman K, Page RC, Tonetti MS. The host response to
the microbial challenge in periodontitis: Assembling the
players. Periodontol 2000 1997;14:33-53.
5. Seymour GJ, Gemmell E, Reinhardt RA, Eastcott J,
Taubman MA. Immunopathogenesis of chronic inflam-
matory periodontal disease: Cellular and molecular mech-
anisms. J Periodontal Res 1993;28:478-486.
6. Romagnani S. The Th1/Th2 paradigm. Immunol Today
1997;18:263-267.
7. Gemmell E, Yamazaki K, Seymour GJ. Destructive peri-
odontitis lesions are determined by the nature of the lym-
phocytic response. Crit Rev Oral Biol Med 2002;13:17-34.
8. Wassenaar A, Reinhardus C, Thepen T, Abraham-Inpijn
L, Kievits F. Cloning, characterization, and antigen speci-
ficity of T-lymphocyte subsets extracted from gingival tis-
sue of chronic adult periodontitis patients. Infect Immun
1995;63:2147-2153.
9. Armitage GC. Development of a classification system for
periodontal diseases and conditions. Ann Periodontol
1999;4:1-6.
10. Lang N, Bartold PM, Cullinan M, et al. Consensus report:
Aggressive periodontitis. Ann Periodontol 1999;4:53.
1214
Volume 75 • Number 9
11. Silness J, Löe H. Periodontal disease in pregnancy. II.
Correlation between oral hygiene and periodontal con-
dition. Acta Odontol Scand 1964;22:121-135.
12. Takeichi O, Haber J, Kawai T, Smith DJ, Moro I, Taubman
MA. Cytokine profiles of T lymphocytes from gingival tis-
sues with pathological pocketing. J Dent Res 2000;79:
1548-1555.
13. Roberts FA, McCaffery KA, Michalek SM. Profile of cytokine
mRNA expression in chronic adult periodontitis. J Dent
Res 1997;76:833-839.
14. Seymour GJ, Greenspan JS. The phenotypic characteri-
zation of lymphocyte subpopulations in established human
periodontal disease. J Periodontal Res 1979;14:39-46.
15. Berglund T, Liljenberg B, Lindhe J. Some cytokine pro-
files of T-helper cells in lesions of advanced periodontitis.
J Clin Periodontol 2002;29:705-709.
16. Lappin DF, Koulouri O, Radvar M, Hodge P, Kinane DF.
Relative proportions of mononuclear cell types in peri-
odontal lesions analyzed by immunohistochemistry. J Clin
Periodontol 1999;26:183-189.
17. Taubman MA, Stoufi ED, Ebersole JL, Smith DJ. Phe-
notypic studies of cells from periodontal disease tissues.
J Periodontal Res 1984;19:587-590.
18. Johannessen AC, Nilsen R, Knudsen GE, Kristoffersen T.
In situ characterization of mononuclear cells in human
chronic marginal periodontitis using monoclonal antibod-
ies. J Periodontal Res 1986;21:113-127.
19. Cole KL, Seymour GJ, Powell RN. Phenotypic and func-
tional analysis of T cells extracted from chronically
inflamed human periodontal tissues. J Periodontol 1987;58:
569-573.
20. Heumader E, Albini M, Moschen I, Wick G, Wolf H. T sub-
sets and disturbed immunoregulation in patients with peri-
odontal disease. Adv Exp Med Biol 1995;371B:1123-1125.
21. Abbas AK, Murphy KM, Sherr A. Functional diversity of
helper T lymphocytes. Nature 1996;383:787-793.
22. O’Garra A. Cytokines induced the development of func-
tionally heterogeneous T helper cell subsets. Immunity
1998;8:275-283.
23. Gemmell E, Seymour GJ. Modulation of immune responses
to periodontal bacteria. Curr Opin Periodontol 1994;94:
28-38.
24. Fujihashi K, Kono Y, Beagley KW, et al. Cytokines and
periodontal disease: Immunopathological role of inter-
leukins for B cell responses in chronic inflamed gingival
tissues. J Periodontol 1993;64:400-406.
25. Yamazaki K, Nakahima T, Gemmell E, Seymour GJ, Hara
KJ. IL-4 and IL-6 producing cells in human periodontal
disease tissue. J Oral Pathol Med 1994;23:347-353.
26. Tokoro Y, Matsuki Y, Yamamoto T, Suzuki T, Hara KJ.
Relevance of local TH2 cytokine mRNA expression in
immunocompetent infiltrates in inflamed gingival tissue to
periodontal disease. Clin Exp Immunol 1997;107:166-174.
27. Bickell M, Axtelius B, Solioz C, Attstrom R. Cytokine
gene expression in chronic periodontitis. J Clin Peri-
odontol 2001;28:840-847.
28. Ebersole JL, Taubman MA. The protective nature of host
responses in periodontal diseases. Periodontol 2000
1994;5:112-141.
29. Fujihashi K, Yamamoto H, Hiroi T, Bamberg TV, McGhee
JR, Kiyono H. Selected Th1 and Th2 cytokine mRNA
expression by CD4+ cells isolated from inflamed human
gingival tissues. Clin Exp Immunol 1996;103:422-428.
30. Yamazaki K, Nakahima T, Kubota Y, Gemmell E, Seymour
GJ, Hara K. Cytokine messenger RNA expression in
chronic inflammatory periodontal disease. Oral Microbiol
Immunol 1997;12:281-287.
30084.qxd 9/16/04 1:41 PM Page 1215

J Periodontol • September 2004 Suárez, Ocampo, Dueñas, Rodríguez

31. Yamamoto M, Fujihashi K, Hiroi T, McGhee JR, Van Dyke 41. Chapple CC, Srivastava M, Hunter N. Failure of macrophage
TE, Kiyono H. Molecular and cellular mechanisms for peri- activation in destructive periodontal disease. J Pathol 1998;
odontal diseases: Role of Th1 and Th2 type cytokines in 186:281-286.
induction of mucosal inflammation. J Periodontal Res 1997; 42. Barbour SE, Ishihara Y, Fakher M, et al. Monocyte dif-
32:115-119. ferentiation in localized periodontitis is skewed toward the
32. Sigusch B, Klinger G, Glockman E, Simon HU. Early- dendritic cell phenotype. Infect Immun 2002;70:2780-
onset and adult periodontitis associated with abnormal 2786.
cytokine production by activated T lymphocytes. J Peri- 43. Gemmell E, Carter CL, Hart DN, Drysdale KE, Seymour
odontol 1998;69:1098-1104. GJ. Antigen-presenting cells in human periodontal dis-
33. Bartova J, Kratka-Opatma Z, Prochazkova J, et al. Th1 ease tissues. Oral Microbiol Immunol 2002;17:388-393.
and Th2 cytokine profile in patients with early onset
periodontitis and their healthy siblings. Mediators Inflamm Correspondence: Dr. Adriana Rodríguez, Center for Dental
2000;9:115-120. Research, School of Dentistry, Pontificia Universidad Javeriana,
34. Lappin DF, MacLeod CP, Kerr A, Mitchell T, Kinane DF. Anti- Carrera 7 #40-62, Bogotá, Colombia.
inflammatory cytokine IL-10 and T cell cytokine profile in
periodontitis granulation tissue. Clin Exp Immunol 2001; Accepted for publication January 8, 2004.
123:294-300.
35. Salvi GE, Brown CE, Fujihashi K, et al. Inflammatory
mediators of the terminal dentition in adult and early
onset periodontitis. J Periodontal Res 1998;33:212-225.
36. Dennison DK, Van Dyke TE. The acute inflammatory
response and the role of phagocytic cells in periodontal
health and disease. Periodontol 2000 1997;14:54-78.
37. Gemmell E, Marshall RI, Seymour GJ. Cytokines and
prostaglandins in immune homeostasis and tissue destruc-
tion in periodontal disease. Periodontol 2000 1997;14:
112-143.
38. Howard M, O’Garra A. Biological properties of interleukin-
10. Immunol Today 1992;13:198-200.
39. Powrie F, Coffman RL. Cytokine regulation of T-cell func-
tion: Potential for therapeutic intervention. Immunol Today
1993;14:270-274.
40. Estaquier J, Ameisen JC. A role for T-helper type-1 and
type-2 cytokines in the regulation of human monocyte
apoptosis. Blood 1997;90:1618-1625.

1215