The Role of Apolipoprotein E in Alzheimer Disease - From Therapy T

Washington University in St.
Louis
Washington University Open Scholarship
Arts & Sciences Electronic Theses and Arts & Sciences

Dissertations
Spring 5-15-2020
The Role of Apolipoprotein E in Alzheimer Disease: From Therapy

to Mechanism
Tien-Phat Vuong Huynh
Washington University in St. Louis
Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds
Part of the Biology Commons, Medicine and Health Sciences Commons, and the Neuroscience and
Neurobiology Commons
Recommended Citation
Huynh, Tien-Phat Vuong, "The Role of Apolipoprotein E in Alzheimer Disease: From Therapy to
Mechanism" (2020). Arts & Sciences Electronic Theses and Dissertations. 2202.
https://openscholarship.wustl.edu/art_sci_etds/2202
This Dissertation is brought to you for free and open access by the Arts & Sciences at Washington University Open
Scholarship. It has been accepted for inclusion in Arts & Sciences Electronic Theses and Dissertations by an
authorized administrator of Washington University Open Scholarship. For more information, please contact
digital@wumail.wustl.edu.
WASHINGTON UNIVERSITY IN ST. LOUIS
Division of Biology and Biomedical Sciences

Neurosciences
Dissertation Examination Committee:

David M. Holtzman, Chair
Marco Colonna
Joseph M. Dougherty
Celeste M. Karch
Timothy M. Miller
Andrew Yoo
The Role of Apolipoprotein E in Alzheimer Disease: From Therapy to Mechanism

by
A dissertation presented to
The Graduate School
of Washington University in
partial fulfillment of the
requirements for the degree
of Doctor of Philosophy
May 2020
Saint Louis, Missouri
© 2020, Tien-Phat Vuong Huynh
Table of Contents
List of Figures ................................................................................................................................ vi
List of Tables ............................................................................................................................... viii
Acknowledgments.......................................................................................................................... ix
Abstract ......................................................................................................................................... xv
Chapter 1 ......................................................................................................................................... 1
Alzheimer disease and the apolipoprotein E ................................................................................... 1
1.1 Alzheimer disease ............................................................................................................ 2
1.2 The amyloid cascade hypothesis ...................................................................................... 2
1.2.1 Efforts to purify the “β protein” ............................................................................................ 2
1.2.2 The breakthrough .................................................................................................................. 3
1.2.3 Additional insights from Down syndrome ............................................................................ 4
1.2.4 The amyloid cascade hypothesis, circa 1992 ........................................................................ 5
1.2.5 The amyloid cascade hypothesis, circa 2018 ........................................................................ 6
1.3 Apolipoprotein E: physiologic functions and risk factor for Alzheimer disease ............. 7
1.3.1 Physiologic functions of apolipoprotein E (apoE) ................................................................ 7
1.3.2 Apolipoprotein E as a risk factor for Alzheimer disease ...................................................... 8
1.4 The Interaction between APOE and the β-amyloid protein (Aβ) .................................... 9
1.4.1 APOE and Aβ production ................................................................................................... 10
1.4.2 Direct APOE-Aβ interaction ............................................................................................... 11
1.4.3 APOE and Aβ aggregation .................................................................................................. 13
1.4.4 APOE and Aβ clearance...................................................................................................... 16
1.5 APOE and other amyloidogenic proteins ....................................................................... 21
1.5.1 APOE and tau ...................................................................................................................... 21
1.5.2 APOE and alpha-synuclein (α-syn) ..................................................................................... 23
1.6 References ...................................................................................................................... 26
1.7 Figures and tables ........................................................................................................... 46
Figure 1.1 In Search of an Identity for Amyloid Plaques .......................................................... 46
Figure 1.2 Pathways by which apoE and Aβ interact in the brain ............................................. 47
Chapter 2 ....................................................................................................................................... 48
ii
Age-dependent effects of apoE reduction using antisense oligonucleotides in a model of β-
amyloidosis ................................................................................................................................... 48
2.1 Summary ........................................................................................................................ 49
2.2 Introduction .................................................................................................................... 50
2.3 Results ............................................................................................................................ 51
2.4 Discussion ...................................................................................................................... 61
2.5 Experimental Procedures................................................................................................ 66
2.6 Acknowledgements ........................................................................................................ 71
2.7 References ...................................................................................................................... 73
Figure 2.1 ASO Treatment reduces apoE mRNA and protein levels in APP/PS1-21/ε4 mice . 80
Figure 2.2 ASO treatment at P0 significantly reduces Aβ plaque pathology in APP/PS1-21/ε4
mice 82
Figure 2.3 Reduction of apoE expression starting at 6 weeks of age did not significantly alter
total Aβ levels in APP/PS1-21/ε4 mice .............................................................................................. 84
Figure 2.4 ASO treatment alters plaque size distribution in APP/PS1-21/ε4 mice ................... 86
Figure 2.5 Related to Figure 2.1. ASO Treatment effectively reduces expression of apoE3 and
apoE4 in mice 87
Figure 2.6 Related to Figure 2.2. ASO treatment at P0 significantly reduces insoluble Aβ in
APP/PS1-21/ε3 mice ........................................................................................................................... 90
Figure 2.7 Related to Figure 2.3. Reduction of apoE expression starting at 6 weeks of age did
not significantly alter total Aβ levels in APP/PS1-21/ε3 mice ........................................................... 92
Figure 2.8 Related to Figure 2.4. ASO treatment significantly alters plaque distribution in
APP/PS1-21/ε4 mice ........................................................................................................................... 94
Table 2.1 Key resources .................................................................................................................. 95
Chapter 3: ...................................................................................................................................... 99
Differential effects of human APOE isoforms on Aβ amyloidogenic seeds ................................ 99
3.1 Summary ...................................................................................................................... 100
3.2 Introduction .................................................................................................................. 101
3.3 Results .......................................................................................................................... 103
3.4 Discussion .................................................................................................................... 111
3.5 Experimental procedures .............................................................................................. 116
3.6 Acknowledgements ...................................................................................................... 120
3.7 References .................................................................................................................... 121
iii
3.8 Figures and tables ......................................................................................................... 125
Figure 3.1 Characterization of Seed Extracts from aged donor brains .................................... 126
Figure 3.2 Isoform-dependent effect of APOE on induced Aβ seeding pattern in APP23 hosts
128
Figure 3.3 Characterization of induced Aβ lesions in APP23 hosts ........................................ 129
Figure 3.4 Seed extracts derived from different APP models produce different seeding patterns
in APP NLF-KI hosts ........................................................................................................................ 131
Figure 3.5 Aβ seeding in APP23/EKO hosts ........................................................................... 132
Figure 3.6 Proposed model of how APOE isoforms differentially modulate Aβ aggregation
properties 133
Table 3.1 Post-inoculation mortality rates in APP23 hosts ........................................................... 134
Table 3.2 Post-inoculation mortality rates in APP NLF-KI hosts................................................. 134
Chapter 4 ..................................................................................................................................... 135
Lack of hepatic apoE does not influence early Aβ deposition: Observations from a new APOE
knock-in model ........................................................................................................................... 135
4.1 Summary ...................................................................................................................... 136
4.2 Introduction .................................................................................................................. 138
4.3 Results .......................................................................................................................... 140
4.4 Discussion .................................................................................................................... 152
4.5 Experimental Procedures.............................................................................................. 159
4.6 Acknowledgements ...................................................................................................... 167
4.7 References .................................................................................................................... 168
Figure 4.1 Replacement of the mouse Apoe gene with the human APOE gene in APOE-KI
mice 179
Figure 4.2 Human APOE is expressed in astrocytes in APOE-KI mice .................................. 180
Figure 4.3 Microglial APOE expression in APP/PS1/EKI mice ............................................. 181
Figure 4.4 Qualitative assessment of microglia and astrocyte-derived apoE particles............ 182
Figure 4.5 ApoE isoforms differentially influence Aβ plaque deposition in APP/PS1/EKI mice
184
Figure 4.6 APOE isoforms differentially influence Aβ accumulation in APP/PS1/EKI mice 186
Figure 4.7 Plasma lipid alterations in APP/PS1/EKI mice lacking liver-derived apoE .......... 188
Figure 4.8 Liver-derived apoE does not influence Aβ accumulation in the brain ................... 191
iv
mice 196
Figure 4.11 ApoE isoforms differentially influence Aβ plaque deposition in APP/PS1/APOE-
TR mice 198
Chapter 5 ..................................................................................................................................... 199
Conclusions and future directions ............................................................................................... 199
5.1 Delineating the effects of apoE on amyloid plaques versus the innate immune response
200
5.2 Current and future challenges to Alzheimer disease research ...................................... 201
5.3 References .................................................................................................................... 205
Figure 5.1 Delineating the effects of apoE on amyloid plaques versus the innate immune
response 207
Curriculum Vitae ........................................................................................................................ 208
v
List of Figures
Chapter 1 ......................................................................................................................................... 1
Alzheimer disease and the apolipoprotein E ................................................................................... 1
Figure 1.1 In Search of an Identity for Amyloid Plaques .......................................................... 46
Figure 1.2 Pathways by which apoE and Aβ interact in the brain ............................................. 47
Chapter 2 ....................................................................................................................................... 48
amyloidosis ................................................................................................................................... 48
Figure 2.1 ASO Treatment reduces apoE mRNA and protein levels in APP/PS1-21/ε4 mice . 80
Figure 2.2 ASO treatment at P0 significantly reduces Aβ plaque pathology in APP/PS1-21/ε4
mice 82
Figure 2.3 Reduction of apoE expression starting at 6 weeks of age did not significantly alter
total Aβ levels in APP/PS1-21/ε4 mice .............................................................................................. 84
Figure 2.4 ASO treatment alters plaque size distribution in APP/PS1-21/ε4 mice ................... 86
Figure 2.5 Related to Figure 2.1. ASO Treatment effectively reduces expression of apoE3 and
apoE4 in mice 87
Figure 2.6 Related to Figure 2.2. ASO treatment at P0 significantly reduces insoluble Aβ in
APP/PS1-21/ε3 mice ........................................................................................................................... 90
Figure 2.7 Related to Figure 2.3. Reduction of apoE expression starting at 6 weeks of age did
not significantly alter total Aβ levels in APP/PS1-21/ε3 mice ........................................................... 92
Figure 2.8 Related to Figure 2.4. ASO treatment significantly alters plaque distribution in
APP/PS1-21/ε4 mice ........................................................................................................................... 94
Table 2.1 Key resources .................................................................................................................. 95
Chapter 3: ...................................................................................................................................... 99
Figure 3.1 Characterization of Seed Extracts from aged donor brains .................................... 126
Figure 3.2 Isoform-dependent effect of APOE on induced Aβ seeding pattern in APP23 hosts
128
Figure 3.3 Characterization of induced Aβ lesions in APP23 hosts ........................................ 129
vi
Figure 3.4 Seed extracts derived from different APP models produce different seeding patterns
in APP NLF-KI hosts ........................................................................................................................ 131
Figure 3.5 Aβ seeding in APP23/EKO hosts ........................................................................... 132
Figure 3.6 Proposed model of how APOE isoforms differentially modulate Aβ aggregation
properties 133
Table 3.1 Post-inoculation mortality rates in APP23 hosts ........................................................... 134
Table 3.2 Post-inoculation mortality rates in APP NLF-KI hosts................................................. 134
Chapter 4 ..................................................................................................................................... 135
Lack of hepatic apoE does not influence early Aβ deposition: Observations from a new APOE
knock-in model ........................................................................................................................... 135
mice 179
Figure 4.2 Human APOE is expressed in astrocytes in APOE-KI mice .................................. 180
Figure 4.3 Microglial APOE expression in APP/PS1/EKI mice ............................................. 181
Figure 4.4 Qualitative assessment of microglia and astrocyte-derived apoE particles............ 182
Figure 4.5 ApoE isoforms differentially influence Aβ plaque deposition in APP/PS1/EKI mice
184
Figure 4.6 APOE isoforms differentially influence Aβ accumulation in APP/PS1/EKI mice 186
Figure 4.7 Plasma lipid alterations in APP/PS1/EKI mice lacking liver-derived apoE .......... 188
Figure 4.8 Liver-derived apoE does not influence Aβ accumulation in the brain ................... 191
mice 196
Figure 4.11 ApoE isoforms differentially influence Aβ plaque deposition in APP/PS1/APOE-
TR mice 198
Chapter 5 ..................................................................................................................................... 199
Conclusions and future directions ............................................................................................... 199
Figure 5.1 Delineating the effects of apoE on amyloid plaques versus the innate immune
response 207
vii
List of Tables
Chapter 2 ....................................................................................................................................... 48
amyloidosis ................................................................................................................................... 48
Table 2.1 Key resources .......................................................................................................... 95
Chapter 3: ...................................................................................................................................... 99
Table 3.1 Post-inoculation mortality rates in APP23 hosts .................................................. 134
Table 3.2 Post-inoculation mortality rates in APP NLF-KI hosts ........................................ 134
viii
Acknowledgments
It is really an understatement to say that my time in Saint Louis had been transformative in
many ways. I have met so many incredible people, many of whom were very influential to my
development not only as a scientist, but also as a person. I would like to take this opportunity to
acknowledge by undergraduate mentors at the University of California, Los Angeles (UCLA),
whose dedication and support have steered me into this scientific path. I owe a proper
acknowledgement in person to each and every person along the way, but I will mention as many
as I can here.
First and foremost, I want to thank my thesis committee for all that they have done for my
education and career (listed in alphabetical order): Dr. Marco Colonna, Dr. Joseph Dougherty, Dr.
David Holtzman, Dr. Celeste Karch, Dr. Timothy Miller, and Dr. Andrew Yoo. All of you have
done more for me than any student could ask for in their thesis committee: attending meetings,
meeting me one-on-one, offering scientific and professional guidance, and listening to me freaking
out about taking on too many projects and not meeting deadlines.
Next, I would like to acknowledge the rest of my St. Louis family. The first person I would
like to thank is my mentor, Dr. David Holtzman (or Dave), for all the support and mentorship over
the past six years. I first met Dave during “second look” weekend and was immediately intrigued
by the rigor and depth of his scientific work. I was also struck by his kindness and enthusiasm, and
the Holtzman lab became one of the major reasons why I chose to attend Washington University.
Over the years, I have learned many things from Dave in many settings, but my favorite ones are
our one-on-one meetings in his clinical office, or our dinners during the conferences that we
attended. His expertise and advice allowed me to grow both scientifically and professionally. I
ix
would like to also thank all of my colleagues in the Holtzman lab, past and present, whom I’ve
had an opportunity to work with during my time here. I owe so much to Dr. Fan Liao for teaching
me many things and being very patient with me when I was starting out in the lab. I would like to
thank Cindy Lawrence, Mary Beth, Floy Stewart, Qing Fu, and Melissa Manis for keeping the lab
running and for being patient with my inability to read emails or follow the rules. I would like to
thank every person who had helped me harvest tissues: Hong Jiang, Grace Robinson, Joseph Roh,
Javier Remolina Serrano, Nathan Scott, and Rosa Hoyle. I also would like to acknowledge
everyone who had shared a bay with me over the years for being great, dependable neighbors:
Jerrah Holth, Fan Liao, Sarah Fritschi, Chao Wang, and Monica Xiong. I would like to thank the
surgery core (Ron Perez and Ernie Gonzalez) for their technical and emotional support during
those late-night surgeries. I would like to thank all the technicians involved in the care of my mouse
colony, from Lori Logan and Loli.
I especially want to thank my “cheering squad” on the 9th floor (some of whom were not
in the Holtzman lab), who were not only my colleagues but also my friends, all of whom were
there for me during difficult times and somehow put a smile on my face: Simon Hsu, Marianne
“Banks” Greenberg, Rebecca Weiner, Floy Stewart, Sarah Fritschi, and Brian Lananna. You guys
are truly amazing, and I will always cherish our friendships.
One of the most incredible things about being a scientist is when a student like me has the
opportunity to become the teacher. Over the past 1.5 years, I have had the opportunity to work
with two incredibly smart, talented, and hard-working undergraduates: Caroline Francis (since Fall
2016) and Ainsley Tran (since Spring 2018). Being a mentor to them is a real privilege that I am
very thankful for, and it pushes me to work even harder to be deserving of that title (because I also
x
push them hard). Thank you for all your hard work and dedication. I know you both will go on and
do great things, let it be in the clinics or in the laboratory. Additionally, I’ve also had the
opportunity to work with two very talented rotational students: Lorenzo Lones and Travis Tabor.
Thanks for bearing with me and working very hard during your limited time in the Hotlzman lab.
To the rest of my St. Louis family: thank you! A huge shout out to my entire MSTP class
for going through this journey with me, through the highs and lows. I am closer to some of you
than others, but I appreciate each and every one of you. To the people who are always there when
I need them: Dan Verbaro, Jose Grajales, Britt Andersen, Shahriyar Majidi, Kelly Hill, Charise
Garber, Annelise Mah, and Lena Dang. I could not have picked a better squad to go alongside me
on this journey.
I would not have embarked on this scientific journey if it wasn’t for the tremendous support
and encouragement from my undergraduate mentors, Dr. David Teplow, Dr. Ghiam Yamin, Dr.
Robin Roychaudhuri, and Dr. Eric Hayden. As an undergraduate who transferred to UCLA during
my third year, I could not have joined a better lab that allowed me to learn things at my own pace,
be in charge of my own project, and develope a love for scientific discovery. In addition, other
mentors outside of the Teplow Lab from my UCLA family also played a pivotal role in nurturing
my scientific pursuits and encouraged me to pursue the combined MD-PhD programs. This
includes Dr. Tama Hasson and Dr. Sonia Zarate from the undergraduate research center (URC),
Dr. Ira Clark and Dr. Rafael Romero from the biomedical research minor, as well as Ms. Connie
Firestone, my counselor for the molecular, cell, and developmental biology (MCDB) major. In my
view, the support for undergraduate research at UCLA is probably second to none. I was
xi
surrounded by so many good peers, dedicated people, in a supportive environment, all of which
made my time at UCLA memorable.
Next, I would like to thank another family that I became a part of while at UCLA, but had
continued to play a supportive role throughout my graduate school career: my HHMI (Howard
Hughes Medical Institute) family. Becoming an EXROP intern, and subsequently a Gilliam fellow
was one of the best things that ever happened to my professional career. Aside from the financial
support, I got to interact with so many bright, talented peers, all of whom share a love for scientific
research. Many thanks to Dr. David Asai, Christy Schultz, Andrew Quon, and Megan (Lassig)
Katz for being the best at what they do, and making this an incredible part of my career.
Of course, none of this could have happened without the financial support. I was very
fortunate to have received several sources of funding to support my graduate education, the
majority of which was through the Gilliam fellowship for advanced studies from the Howard
Hughes Medical Institute. Other sources of funding include the various grants that supported the
Holtzman laboratory from the national institutes of health (NIH), the Cure Alzheimer’s Fund,
and the JPB foundation.
Last, and definitely not least, I would like to thank my family from all around the world,
particularly those still in Vietnam and my immediate family in California: my parents, my brother,
my grandma, and my uncle. Thank you for always believing in me and supporting me
unconditionally. My parents left behind a relatively comfortable life in Vietnam and moved to the
United States in their 40s with little money, support, or understanding of the native culture or
language. However, they brought with them a dream, a relentless self-determination to build a
better future for their children, and they made sure that dream came true through incredible work
xii
ethics, the same ones that they taught me and my brother. I owe everything I’ve accomplished to
them and their unconditional love. My brother had been my best friend for most of my life. We
fight quite a lot, but my life would have been very different for the worse without him. I always
appreciate his humor and am humbled to have him as my brother. My uncle was our sponsor for
the visa that allowed my family to move to America. He is an intelligent and courageous person
who risked his life three times to escape a war-torn Vietnam in the 1980s on a little boat, all in
search for freedom and a better life. He was influential to me during a critical time, when I was a
teenager newly arrived in America, He made me believe that everything is possible in this land
with hard work and determination. My grandma had always been supportive of my educational
pursuit. Unfortunately, she has been showing early signs of dementia, which fuel me with more
motivation to work harder towards a cure for dementia and neurodegenerative diseases. I owe
everything I have accomplished to my family, and would be nowhere without them.
Washington University in St. Louis
May 2020
xiii
Dedicated to my family
xiv
ABSTRACT OF THE DISSERTATION
The Role of Apolipoprotein E in Alzheimer disease: From Therapy to Mechanism
by
Doctor of Philosophy in Biology and Biomedical Sciences
Neurosciences
Washington University in St. Louis, 2020
Professor David M. Holtzman, Chair
*************
Alzheimer’s disease (AD) is a neurodegenerative disorder associated with irreversible
damage to the brain, which manifests in cognitive dysfunction, memory loss, and eventual death.
The pathological hallmarks of AD are amyloid plaques, which are cerebral aggregates consisting
of fibrils of the amyloid β-protein (Aβ), and filamentous lesions of the microtubule-associated
protein tau known as neurofibrillary tangles. In the early 1990s, the apolipoprotein E (apoE) was
found to co-localize with amyloid plaques. The ε4 allele of the APOE gene was sequentially
identified as the strongest genetic risk factor for AD, increasing the risk by 4 – 12-fold, whereas
the ε2 allele is protective relative to the prevalent ε3 allele. Since then, multiple lines of evidence
suggest that the major mechanism by which apoE influences AD pathology is via its effects on Aβ
metabolism, particularly aggregation and clearance.
An ongoing debate in the field is whether the ε4 allele impose a loss of protective function
or a gain of toxic function. In support of the latter hypothesis, our colleagues previously
demonstrated that APP/PS1-21 mice with only one copy of human apoE3 or apoE4 have
significantly less amyloid plaque deposition and microglial activation compared to their
xv
homozygous littermates. However, the effect of apoE reduction during the post-natal period or
adulthood is unknown. To address this gap in knowledge, we utilized an apoE antisense
oligonucleotide (ASO) to reduce apoE expression in the adult APP/PS1-21 mice homozygous for
the human ε4 allele of APOE. Despite achieving reduction of apoE expression by more than 50%
starting at the onset of amyloid deposition, no reduction of Aβ pathology was detected when mice
were assessed at 4 months of age. Though there was not an overall reduction in amyloid deposition,
there was a clear effect of reducing apoE4 on Aβ plaque morphology. Interestingly, ASO treatment
starting after birth led to a strong and significant decrease in Aβ pathology when mice were
assessed at 4 months of age. These results suggest that apoE levels can strongly affect the initiation
of Aβ pathology in vivo but that once Aβ plaque pathology is present, reducing apoE does not
have a strong effect on further amyloid deposition. This previously unknown age-dependent effect
of apoE in the early stages of Aβ plaque formation suggest the important implication that
decreasing brain apoE levels would be useful for primary prevention of amyloid deposition but
not for decreasing or removing amyloid plaques once they have begun depositing. Strikingly, we
observed a marked decrease in neuritic dystrophy around the plaques in APP/PS1-21/ε4 mice
treated with ASO under either treatment paradigm, independent of plaque size or plaque load. This
suggests a general role of apoE4 in modulating the brain’s response to neurotoxic insults (such as
Aβ plaques), independent of its effects on Aβ metabolism.
The aggregation of Aβ into higher-order species follow nucleation-dependent kinetics in
vitro. Our work suggested apoE affects the earliest stages of plaque formation (the nucleation
phase), but it remains unclear whether apoE isoforms exert differential effects. We utilize an
established in vivo seeding protocol to investigate the possibility that apoE can influence the
formation and/or potency of the Aβ seeds in an isoform-dependent manner. We inoculated PBS-
xvi
soluble brain extracts (containing Aβ seeds) isolated from aged APP/PS1-21 donor brains
expressing different human APOE alleles (ε2/ε2, ε3/ε3, ε4/ε4) in the hippocampus of an APP-
expressing host. Following a defined incubation period, we analyzed the seeding patterns and
found that brain extracts from APP/PS1 donors with different APOE backgrounds induce Aβ
seeding patterns that are distinct from each other. Specifically, seeded Aβ species from ε2 donors
have a diffuse pattern with minimal fibrillar content, while those from ε4 donors appear more
punctate-like and are mostly fibrillar. Brain extracts from ε3 mice produced plaques with an
intermediate phenotype. These results suggest that human APOE isoforms may differentially affect
the properties of Aβ seeds, thus creating different strains of Aβ with distinct structural features and
seeding capabilities. This isoform-dependent effect of apoE on Aβ may contribute to the overall
AD risk associated with the different APOE isoforms. Further studies are needed to investigate the
consequences of this isoform-specific difference in plaque morphology.
As apoE is produced both inside and outside of the central nervous system (astrocytes and
microglia in the brain, and hepatocytes in the periphery), the specific contributions of different
apoE pools to AD pathogenesis remain unknown. To address some aspects of this question, we
generated new lines of APOE knock-in (APOE-KI) mice (ε2/ε2, ε3/ε3, and ε4/ε4) where the exons
in the coding region of APOE are flanked by loxP sites, allowing for cell type-specific
manipulation of gene expression. We assessed these mice both alone as well as after crossing
them with mice with and without amyloid deposition in the brain as well as after removing apoE
expression from hepatocytes using biochemical and histological methods. Consistent with prior
studies, our analyses demonstrated apoE protein was present predominantly in astrocytes in the
brain under basal conditions and was also detected in reactive microglia surrounding amyloid
plaques. Primary cultured astrocytes and microglia from the APOE KI mice secreted apoE in
xvii
lipoprotein particles of distinct size distribution upon native gel analysis with microglia particles
being substantially smaller than the HDL-like particles secreted by astrocytes. Crossing of
APP/PS1 transgenic mice to the different APOE-KI mice recapitulated the previously described
isoform-specific effect (ε4 > ε3) on amyloid plaque and Aβ accumulation. Deletion of APOE in
hepatocytes did not alter brain apoE levels but did lead to a marked decrease in plasma apoE levels
and changes in plasma lipid profile. Despite these changes in peripheral apoE and on plasma
lipids, cerebral accumulation of amyloid plaques in APP/PS1 mice was not affected. Altogether,
our new APOE knock-in strains offer a novel and dynamic tool to study the role of APOE in AD
pathogenesis in a spatially and temporally controlled manner.
xviii
Chapter 1
Alzheimer disease and the apolipoprotein E
1
1.1 Alzheimer disease
In 1907, the German psychiatrist Alois Alzheimer published a case report “On an unusual
illness of the cerebral cortex,” in which he described what we now know as Alzheimer disease
(AD)8. More than a century after this landmark discovery, AD is now recognized as the most
common cause of late-life dementia. AD is rapidly becoming the most important malady affecting
the adult population in the United States, with current prevalence of 5.7 million, rising ~123%
between 2000 and 2015 7. AD pathology is characterized by the cerebral accumulation of amyloid
plaques and neurofibrillary tangles, both of which consist predominantly of specific insoluble
protein aggregates.
1.2 The amyloid cascade hypothesis

1.2.1 Efforts to purify the “β protein”
From as early as the late 1800s, the presence of amyloid plaques (then described as ‘miliary
foci’) was documented in the brain of elderly patients suffering from dementia. In 1906 (see Figure
1), Alois Alzheimer reported the presence of a “peculiar substance” in the brain of the late Auguste
Deter, but the identity of the substance was to remain a mystery for nearly eight decades.
In the late 1960s, the pathological accumulation of proteinaceous deposits of β-sheet-
containing (amyloid) fibrils was described in the context of various clinical conditions, including
systemic forms of amyloidosis (e.g., AL amyloid), Down syndrome (DS) and AD. Though
researchers suspected some of these conditions might share certain pathologic entities, the
limitations of biochemical techniques at the time, specifically those required to produce a
homogeneous protein preparation, prevented the identification of the protein species involved. In
1983, Allsop and colleagues described a method for isolating dense core neuritic plaques from
post-mortem AD brains, and found the amino acid composition of the isolated species to be unique
2
compared to any previously described amyloid protein 5. However, possible contaminants in the
preparation (as noted by the authors) impeded a definitive identification of the amino acid
composition, and in addition, no amino acid sequence was provided. Long-time researchers in the
field of amyloidosis, George Glenner and Caine Wong applied a slightly different approach. By
focusing on cerebrovascular amyloidosis, they made the observation that the latter was “seen only
in Alzheimer’s disease [and] adult Down’s syndrome individuals.” Thus, the authors hypothesized
that the isolation and identification of “the cerebrovascular amyloid fibril protein in Alzheimer’s
disease” would lead to the discovery of a unique fibril precursor protein in the serum of these
patients, which in turn could lead to a specific diagnostic serum test for AD. While their suspicion
on the serum origin of the precursor protein turned out to be incorrect, Glenner and Wong were
successful in their quest to identify the precursor protein (Aβ), sequencing its first N-terminal 24
amino acids, as reported in their seminal 1984 paper in Biochemical and Biophysical Research
Communications 68.
1.2.2 The breakthrough

Convinced of the vascular nature of the so-called amyloid precursor, the authors decided
to enrich for amyloid-bearing meningeal vessels by dissecting out the meninges of autopsy-
confirmed AD brains (6) and those from age-matched controls (3). The AD brains were selected
for their extensive cerebrovascular amyloidosis based on histological staining for amyloid.
Following sequential homogenization steps in sodium chloride and Tris-hydrochloride (0.05 M),
the amyloid-enriched material (monitored by polarization microscopy after Congo red staining)
was further purified through treatment with collagenase, which removed a primary contaminant.
Subsequent solubilization in the chaotropic salt guanidine hydrochloride (6M), followed by
chromatographic enrichment for the amyloid subunit, yielded a 4.2 kDa band on SDS-urea PAGE
3
gels. Interestingly, HPLC analysis identified two peaks, which were found to have identical amino
acid sequence up to residue 24 (most likely corresponding to Aβ1-40 and Aβ1-42) based on amino-
terminal sequencing. Of note, their report of a glutamine (instead of a glutamate) at position 11
was later corrected in their subsequent sequencing of amyloid isolated from DS
meningiovasculature (see below). Upon confirming the uniqueness of the peptide, Glenner et al.
concluded that the novel protein “appears to be a biologic marker for the cerebrovascular amyloid
fibril component of Alzheimer’s disease”. This latter prediction held true, for the most part, as low
levels of Aβ1-42 levels in the cerebrospinal fluid (CSF), reflective of sequestration into amyloid
fibrils in the brain, now serve as a biomarker for the presence of amyloid plaque presence in the
brain.
1.2.3 Additional insights from Down syndrome

In the context of this discussion, it is important to mention another paper from Glenner and
Wong that was published in the same journal just three months after their initial report of the “β
protein” from AD blood vessels 67. Pathologic similarities between adult DS and AD brains had
been observed as early as the 1920s, and George Glenner discussed his suspicion for a “chemical
connection” as early as 1979 in an article in Medical Hypotheses 66. However, establishing such
connections was not possible until the key pathologic entity was defined. Using a similar approach
to their prior work, Glenner et al. successfully isolated another “β protein”, this time from the
meningiovasculature of two adult DS patients. Strikingly, the identical amino acid sequence
between this peptide and those isolated from AD patients confirmed Glenner’s prior suspicion
about a connection between these two seemingly distinct entities. These results were confirmed
and extended just a year later by Masters, Beyreuther, and colleagues who employed a variety of
144
different techniques to isolate dense core plaques from the brain of AD and DS patients .
4
Importantly, upon these findings, Glenner made several predictions, many of which have since
proved remarkably prescient. Glenner and Wong noted, for instance:
‘It suggests that Down’s syndrome may be a predictable model for Alzheimer’s disease.
Assuming the beta protein is a human gene product, it also suggests that the genetic defect in
Alzheimer’s disease is localized on chromosome 21’ 67.
Among their many ramifications, the findings and predictions by Glenner and colleagues
have been considered by many as foundational in leading eventually to the amyloid cascade
hypothesis.
1.2.4 The amyloid cascade hypothesis, circa 1992

In the ensuing race to clone the gene encoding the Aβ sequence, Aβ was found to be, in
fact, the cleavage product of a much larger precursor protein (β-amyloid precursor protein – APP),
which was, indeed, localized to chromosome 21 110,193. Genetic mutations in the APP locus (near
the Aβ sequence) were subsequently found in some families with an autosomal-dominant pattern
of AD incidence 69. The accumulating evidence (Figure 1) led to the formal proposal of the amyloid
cascade hypothesis (or the amyloid hypothesis) by John Hardy and Gerald Higgins in 1992, who
postulated: “[The] deposition of amyloid β protein (AβP), the main component of the plaques, is
the causative agent of Alzheimer’s pathology and that the neurofibrillary tangles, cell loss, vascular
damage, and dementia follow as a direct result of this deposition” 78

. Around the same time, it
became apparent to researchers that APP mutations were not found in all families, suggesting a
185
genetically heterogeneous nature of dominantly inherited AD and by extension, pointing at
possible heterogeneity in the underlying causes. Apart from the APP mutations, some AD-linked
mutations were identified in genes outside chromosome 21, for instance those in the PSEN1 and
PSEN2 loci on chromosome 14, which on the surface may seem to question the idea of an Aβ-
5
centric component of the disease. But in fact, the PSEN1 and PSEN2 loci are components of the
proteolytic complex that cleaves APP, and mutations in them were later shown to alter APP
processing and enhance the production of Aβ42, so altogether, these mutations do seem to provide
further support for (or at least be consistent with) an Aβ-centric cause of AD 181.
1.2.5 The amyloid cascade hypothesis, circa 2018

As noted by Hardy later on, the amyloid hypothesis “was intended to generate ideas and
act as a framework for a research agenda, not to be a definitive statement”76. In line with this idea,
the amyloid hypothesis had been at the forefront of AD research efforts for the past 26 years, where
parts of it were validated, and others revised or supplemented 152. While most in the field believe
that Aβ appears necessary but not sufficient for the ultimate development of dementia due to AD,
some researchers have also expressed more basic reservations on the causative role of Aβ in the
disease’s pathology, or on whether the amyloid cascade hypothesis provides a useful overarching
conceptualization of the pathophysiology. Doubts around the overall validity of the hypothesis
have been argued by some to be validated by the initial failure of some therapeutic compounds
that target APP metabolism or Aβ itself in clinical trials in dementia due to AD. While the details
of pathways driving the disease are still being worked on, the failure of some of the clinical trials
targeting Aβ/APP– does not necessarily conflict with a causal component of Aβ accumulation.
One crucial aspect to consider is the timing of treatment and the progression profile of the disease.
In fact, Aβ accumulation in the brains of AD patients often precedes clinical symptoms by several
decades, during a period known as “preclinical” AD 100

. By the time people are diagnosed with
dementia due to AD, Aβ accumulation in the brain has already been evolving for an extended
period, often around 20 years or so, and the tau phase of the disease is already taking over. With
that in mind, it is conceivable that Aβ accumulation is indeed the initiator (or one of the initiators)
6
of AD pathogenesis, but by the time an AD patient becomes symptomatic, some irreversible
neuronal loss has already occurred, rendering amyloid-targeting therapies less likely to be effective
when given at the symptomatic stage of disease. Would targeting amyloid during the preclinical
phase prevent or mitigate AD? An ongoing international study (Dominantly Inherited Alzheimer
Network – DIAN) is designed to answer this question, at least in some contexts, by following
families that carry known mutations that cause AD 17. In addition to collecting longitudinal data
on key biomarkers (i.e., Aβ, tau), the patients are also treated with amyloid-targeting compounds
in hope of delaying (or preventing) the development of AD. This study is not only critical in
assessing the validity of the amyloid hypothesis, but will also provide invaluable information on
the temporal progression of the disease, which regardless of the specific outcome, will help
constrain models of the disease’s progression and advance clarifying the underlying causes.
Ultimately, this progress in understanding the disease will hopefully provide concrete guidance
for future interventions or preventative measures.
1.3 Apolipoprotein E: physiologic functions and risk factor

for Alzheimer disease
1.3.1 Physiologic functions of apolipoprotein E (apoE)
Like other apolipoproteins, apoE primarily functions to maintain the structure of specific
lipoprotein particles, as well as to direct lipoproteins to specific cell surface receptors. apoE is
found in a class of high-density lipoprotein (HDL)-like lipoprotein in the cerebral spinal fluid
(CSF) and interstitial fluid (ISF) of the brain123,199. In the periphery, apoE is associated with many
different classes of lipoproteins, including very low-density lipoproteins (VLDLs), intermediate
density lipoproteins, chylomicron remnants, and a subclass of HDL136. Mice220 and humans138
lacking apoE suffer from marked peripheral hypercholesterolemia. In the CNS, in vitro
7
experiments have suggested that apoE supports synaptogenesis147 and the maintenance of synaptic
connections164, by virtue of the cholesterol species it carries. However, there is not strong evidence
it has this function in vivo. Furthermore, both in vitro87,156 and in vivo143,166 evidence support a
role of apoE in neuronal sprouting after injury. Perhaps unexpectedly, in the absence of injury,
brain function appears to be grossly normal in the absence of apoE, as observed in both murine9,55
and human138.
1.3.2 Apolipoprotein E as a risk factor for Alzheimer disease

The majority of AD cases are sporadic and have a relatively late onset, predominantly after
the age of 65. This form of AD is known as late-onset AD (LOAD), in contrast to early-onset AD
(EOAD), which has a strong genetic component, is often autosomal dominant, and accounts for
less than 1% of AD cases16. While most genetic risk factors for LOAD identified in the past two
decades have a relatively small impact on AD risk, extensive epidemiological, clinical, and
pathological studies have established the Apolipoprotein E (APOE) gene on chromosome 19 as
the most important genetic risk factor for developing LOAD42,43,187. This locus encodes a 299-
amino acid glycoprotein (apoE) that is expressed in several cell types, with highest expression
levels found in the liver and the brain, where it is expressed predominantly by astrocytes136, and
microglia to a lesser extent165 72

. The human APOE gene contains several single-nucleotide
polymorphisms (SNPs) that result in changes to the coding region of the apoE protein. The three
most common variants of apoE are apoE2 (cys112, cys158), apoE3 (cys112, arg158), and apoE4
(arg112, arg158). Although the three most common isoforms differ by only one or two amino
acids, they have distinct structure and function, which may explain the differential effects they
exert on AD risks. Relative to the prevalent ε3/ε3 genotype, carriers with one copy of the ε4 allele
have an ~ 3.7-fold increase, while those with two copies have a 12-fold increase in risks for
8
developing AD. The ε2 allele appears to be protective (odds ratio = 0.4) relative to the ε3/ε3
genotype6,57,173.
It remains unclear whether the increased risk of ε4 is due to a loss of protective function or
a gain of toxic function. However, numerous studies have suggested that one major mechanism by
which apoE affects AD pathology is through its influence on the accumulation of amyloid plaques
in the brain and cerebrovasculature.
1.4 The Interaction between APOE and the β-amyloid

protein (Aβ)
Amyloid plaques are one of the pathological hallmarks of AD and consist mostly of
aggregated fibrils of Aβ. Aβ peptides are 38 – 43 amino acids in length, although the most common
species found in AD brains by far are Aβ1-40 (Aβ40) and Aβ1-42 (Aβ42). Aβ is generated by
sequential cleavage of the β-amyloid precursor protein (APP) by β- and γ-secretases. The precise
location and the number of cleavages determine the ultimate length of peptide. Autosomal
dominantly-inherited missense mutations in APP or components of the human γ-secretase complex
such as presenilin-1 (PS1) or presenilin-2 (PS2)77 appear to cause EOAD by increasing Aβ
production or by increasing the ratio of Aβ42 relative to Aβ40191. In vitro kinetic studies indicate
that Aβ42 is more prone to aggregation, and that specifically Aβ peptides ending at amino acid 42
(e.g. Aβ1-42 or Aβ3-42) play a critical role in determining the rate of amyloid formation103.
The link between apoE and AD, and apoE and Aβ particularly, was first suggested in the
early 1990s, when apoE was found to co-localize with amyloid plaques154,210. Subsequently, the
ε4 allele of apoE was identified as a strong genetic risk factor for AD26,179,187. Histopathologic
examination of post-mortem brains from AD patients found a positive correlation between senile
9
plaque density and dosage of the APOE-ε4 allele169,179. While some studies did not reproduce the
aforementioned findings24,81, a more recent study that examined a large (n = 296) cohort of
autopsied AD brains found a significant correlation between the APOE-ε4 allele and neuritic
plaques196. Remarkably, the isoform-dependent effect of APOE isoforms on the accumulation of
Aβ plaques can also be found in cognitively normal individuals, with age as an independent (and
significant) risk factor 102. The development116 and clinical utilization115 of Pittsburgh Compound-
B (PiB) as a Positron Emission Topography (PET) tracer for amyloid deposits revolutionized how
AD is diagnosed and monitored. A ThT derivative, radioisotope-labeled PiB readily crosses the
BBB145 and provides a quantitative in vivo detection of amyloid plaques. Early clinical studies
utilizing PiB in cognitively normal middle-aged and older people found APOE-ε4 gene dosage to
be associated with fibrillar Aβ burden150,170, along with low CSF Aβ42150,190. Consistent with prior
epidemiological observations, APOE-ε2 carriers rarely develop fibrillar Aβ that is detected by
PiB150. Altogether, data from human studies make a strong case for apoE genotype as a strong
susceptibility factor for cerebral amyloid plaque accumulation and eventual development of AD.
Aside from clinical investigations, a significant amount of basic research effort in the field
has focused on understanding the effects of apoE on the accumulation of amyloid plaques and
cerebral amyloid angiopathy (CAA) in the brain. Deposition of Aβ into insoluble plaques depend
on several factors, including the rate of production, clearance from the brain ISF (where amyloid
plaques are found), and the rate of fibrillization, all of which may be influenced by apoE. We
discuss the current state of knowledge on each aspect of the process below.
1.4.1 APOE and Aβ production

Among the multitude of factors that have been hypothesized to affect Aβ deposition,
studies on apoE’s role in Aβ production are probably the most controversial. In vitro studies from
10
one group using rat neuroblastoma B103 cells that express human APP suggested that lipid-poor
apoE4 enhanced Aβ production compared to lipid-poor apoE3, and that this effect was mediated
through the LRP pathway215. A very recent study shows that recombinant and HEK cell derived
apoE can increase Aβ synthesis in human embryonic stem cell-derived neurons in vitro in an
isoform-dependent fashion (apoE4 > apoE3 > apoE2)93. The observed phenomenon was driven by
differences in the isoforms’ ability to bind and activate surface apoE receptors, which ultimately
activate cFos-containing AP-1 transcription factors and increase APP transcription. Of note, APP
transcription was maximally activated when human neurons were co-cultured with glial cells
(which secrete several glial derived factors), and the isoform-specific effects were abolished under
such conditions. However, other in vitro and in vivo studies found no apparent apoE isoform effect
on APP processing and Aβ production29,36,95. In agreement with the latter findings, in vivo data
from APP transgenic (Tg) mice found no changes in amyloidogenic processing of APP nor Aβ
synthesis rates according to human apoE isoforms35. These conflicting findings might be explained
by their different experimental conditions such as: the lipidation state of apoE and the experimental
model system used to generate Aβ. Harmonizing the disparate in vitro and in vivo findings on the
role of APOE on Aβ production will require additional studies. Future work assessing Aβ synthesis
in the presence of different apoE isoforms in vivo in animal models that have the endogenous APP
promoter as well as in humans provide insight into this important question.
1.4.2 Direct APOE-Aβ interaction

Early studies that focused on the direct interaction between apoE and Aβ yielded
contradictory findings. ApoE was first proposed to be an Aβ binding partner in 1992210. Various
studies showed that synthetic Aβ avidly forms a complex with apoE purified either from human
CSF187, plasma188, or from conditioned media of apoE-expressing HEK cells122. However, the
11
affinity of different apoE isoforms for Aβ appears to be highly dependent on the preparation
condition of apoE, the species of Aβ involved (soluble versus fibrillar), as well as pH level. Allan
Roses’ group found apoE4 to bind synthetic Aβ more rapidly than apoE3178,188, while Ladu and
colleagues found lipidated apoE3 to be a much more efficient binding partner of Aβ (20 fold) than
apoE4122. These differences might be explained by the lipidation state of the apoE species being
used, as several other groups confirmed that the efficiency of complex formation between lipidated
apoE and Aβ follows the order of apoE2 > apoE3 >> apoE43,197,214. However, one study noted that
the observed apoE-Aβ complex represents only a small proportion of the incubated apoE, despite
a large molar excess of Aβ122. In support of this notion, a previous study from our group provided
both in vitro and in vivo evidence that more than 95% of soluble Aβ (sAβ) detected is not associated
with apoE-containing lipoproteins202. sAβ is defined as any Aβ species that is soluble in phosphate-
buffered saline, including monomeric and oligomeric Aβ. Using various techniques including
density-gradient centrifugation, size-exclusion chromatography (SEC), and fluorescence
correlation spectroscopy (FCS), the aforementioned study provided multiple lines of evidence that
sAβ is a very poor binding partner of apoE-containing lipoproteins. The metastable nature of Aβ
oligomers had made it difficult to study in the past, but it is important for future studies to further
dissect out the potentially different role of monomeric versus oligomeric Aβ in the context of apoE
interactions. Indeed, a study using an ELISA assay specific for Aβ oligomers found the latter
species to be rapidly sequestered away from the ISF and CSF in J20 hAPP tg mice89. From these
results, if oligomeric Aβ is present in the ISF, it could be the predominant species that interacts
with apoE in the ISF prior to binding to other cell surface molecules such as receptors, thus leaving
monomeric Aβ to be the predominant species to be detected in the fluid phase. A recently
developed method for isolating and characterizing the different oligomeric Aβ species may
12
facilitate more rigorous studies on the relative contribution of monomeric and oligomeric Aβ to
the APOE-mediated effects on amyloid pathology progression52. This is an important question to
address, considering the substantial body of literature supporting the role of Aβ oligomers in
facilitating neurotoxicity23.
Upon examining functional consequences of the apoE/Aβ interaction, Tamamizu-Kato et
al. found that Aβ binding to apoE compromises its lipid-binding function in vitro192. Thus, it is
possible that apoE interacts with Aβ directly through the carboxy terminal domain that also
overlaps with the lipid-binding region. Furthermore, some studies suggest that Aβ peptides
modulate the binding of apoE isoforms differently to apoE receptors18,88. These in vitro data
suggests that Aβ peptides can modulate or interfere with the normal function of apoE.
1.4.3 APOE and Aβ aggregation

The aggregation of Aβ into higher-order species follows a nucleation-dependent kinetics
with a typical 3-phase sigmoidal curve when assessed in vitro. While the initial “lag phase” is slow
and requires random collision of Aβ monomers103,174. It has been suggested that, upon formation
of a sufficient amount of nucleating higher-order species of Aβ (termed “nuclei” or “seeds”),
perhaps consisting mostly of Aβ oligomers, the incorporation of additional monomers (growth
phase) occurs at a much faster rate. The rate of fibril growth slows down (plateau phase) when it
is outcompeted by newly formed nuclei or, possibly, depletion of the local pool of monomer. Thus,
apoE could potentially exert pro-amyloidogenic effects by influencing either the formation of Aβ
“seeds” or the subsequent elongation of fibrils.
All three isoforms of apoE have been previously shown to promote the fibrillization of Aβ
in vitro, and the potency follows the order of apoE4 > apoE3> apoE2135,178,209. On the contrary,
13
other studies suggest that apoE isoforms can also inhibit Aβ aggregation, with apoE4 being least
effective20,53,65,212. These seemingly contradicting findings may be explained by the variable
experimental conditions such as the species and source of Aβ used112 (Aβ40 versus Aβ42,
recombinant versus synthetic), and especially the preparation and the (resulting) lipidation state of
apoE. Some studies utilized poorly lipidated apoE, while the most abundant and biologically active
species of apoE found in vivo are lipidated. Indeed, in vivo studies had shown that alteration of
apoE lipidation state in the brain can exert a profound impact on Aβ fibrillization. Nascent apoE
peptides in the brain are normally lipidated by the ATP-binding cassette transporter A1 (ABCA1).
Interestingly, APP Tg mice crossed onto an Abca1-/- background exhibit a marked increase in
amyloid deposition, along with a decrease in apoE lipidation82,83,118,203,204. Conversely,
overexpression of ABCA1 in the brain leads to an increase in apoE lipidation and a corresponding
decrease in amyloid deposition204.
To initially assess the effects of human apoE isoforms on Aβ in mouse models, transgenic
mice expressing human apoE isoforms under the control of the astrocyte-specific GFAP promoter
(in the absence of endogenous murine apoE) were crossed with APP Tg mice that develop Aβ
plaques. These studies showed that, relative to mouse apoE, human apoE delayed Aβ deposition
but that the order and amount of Aβ deposition was apoE4 > apoE3 > apoE2, as is seen in
humans56,84. Early in vivo studies on the role of apoE on AD-related pathology utilized PDAPP
mice, a model of Aβ amyloidosis that harbors the human APP transgene with the Indiana mutation
(V717F)63,172. Introduction of the human apoE leads to delayed Aβ deposition in comparison to
PDAPP mice expressing murine apoE or even those lacking apoE56,85 as was seen in previous
studies. In 1997, Patrick Sullivan and colleagues generated the first mouse strains carrying various
isoforms of human apoE through targeted replacement189. These lines allow for better
14
characterization of the isoform-dependent effects on Aβ aggregation propensity in that the apoE
gene is regulated by the endogenous factors that control its expression. When these mice were
crossed with different APP Tg mice, there is also a strong human apoE isoform specific effect on
Aβ deposition in the order of apoE4 > apoE3 > apoE212,35. These results are consistent with studies
in humans and confirm the relevance of genetically engineered mouse models that mimic at least
some aspects of the Aβ aggregation component of the disease. Using these human apoE knock-in
mouse models, the allele-dependent effects of apoE on Aβ accumulation have been studied
extensively.
In addition to isoform effects of APOE, the expression level of apoE also appears to
influence Aβ pathology. Deletion of the endogenous murine Apoe locus in PDAPP mice, as well
as in the Tg2576 or APPswe model leads to significantly less Aβ deposition and virtually abolishes
fibrillar Aβ deposits in the brain parenchyma as well as CAA and CAA-associated
microhemorrhage13,14,48,86. These results suggest that apoE is a critical factor that facilitates Aβ
aggregation in vivo into a fibrillar form, though the aforementioned studies did not offer insight
into the mechanism for such process. To examine the effects of human APOE gene dosage, human
APOE knock-in mouse lines were crossed to APP Tg (APP/PS1-21) mice. Interestingly, APP Tg
mice expressing only one copy of human apoE have significantly less Aβ plaque deposition
compared to mice expressing two copies of the same apoE isoform (either APOE-ε3 or APOE-
ε4)114. Very similar findings were also found by another group28, and have potentially important
therapeutic implications, since there has been a long debate about whether increasing or decreasing
apoE is beneficial for Aβ pathology. The caveat of these findings are that the animals carried the
APOE gene and gene dosage differences since birth, and there could be developmental
compensation in the genetic APOE haploinsufficiency model which could account for the
15
protective effect against Aβ deposition. Whether reducing APOE levels in adult mice would
similarly affect Aβ burden is unknown. Additionally, reduction of APOE expression could
influence both the aggregation and clearance of Aβ, the latter being another major effect of apoE
on Aβ metabolism that is well-described, as discussed in the following section
1.4.4 APOE and Aβ clearance

Substantial evidence exists to support the role of apoE isoforms on monomeric Aβ
clearance. Specifically, apoE has been proposed to influence Aβ clearance through several
mechanisms: enzymatic degradation106,153, transport across the blood brain barrier38, ISF-CSF bulk
flow, and cellular uptake/subsequent degradation60,195.
Role of APOE in Aβ transport and clearance
A large number of studies support the hypothesis that apoE influences Aβ transport and
clearance from the ISF. The level of sAβ in the ISF can be measured continuously in live, freely
moving animals through utilization of an in vivo microdialysis technique39. Clearance of Aβ from
the ISF was found to be faster in apoE-KO mice48, suggesting an important role for apoE in
regulating Aβ levels in the brain. ApoE isoforms differentially impact the level of ISF Aβ and rate
of Aβ clearance in vivo35. ApoE4-expressing mice exhibited higher ISF levels of Aβ and a slower
rate of Aβ clearance from the ISF than apoE3-expressing mice. Conversely, apoE2-expressing
mice exhibited a lower level of ISF Aβ and a faster Aβ clearance rate relative to apoE3. The
isoform-dependent effect of apoE was observed in aged mice but also at young ages well before
plaque accumulation occurs. These findings suggest that the difference in Aβ accumulation
between isoforms is likely due in part to their differential effects on Aβ clearance from the ISF,
which can occur through a number of mechanisms.
16
One potential mechanism subject to apoE-dependent modulation is the transport of Aβ
across the blood-brain barrier (BBB) to the systemic circulation. The BBB is a highly selective
permeability barrier that separates the blood from brain ISF. It is formed by continuous capillary
endothelial cells containing tight junctions, which are surrounded by basal lamina, astrocytic
perivascular end-feet, and pericytes. Through specific transporters, the BBB and pericytes work
together to control entry of substances from the blood and promote clearance from brain of various
potentially neurotoxic and vasculotoxic macromolecules182. Similar to CAA, AD is associated with
microvascular dysfunction and a locally defective BBB45,140,221, both of which could be influenced
by Aβ. Intriguingly, carriers of the APOE-ε4 allele are predisposed to CAA33,71,157,163. In Tg2576
mice, apoE4 promotes a shift of Aβ deposition from the brain parenchyma to arterioles in the form
of CAA, relative to apoE3 or murine apoE59. Consistent with these findings, a recent study using
5x-FAD mice (APP transgenic mice expressing these specific mutations in APP - APP
KM670/671NL and V717I) harboring both human apoE4 and murine apoE found a higher degree
of co-localization between murine apoE and parenchymal plaques, while plaques in the vasculature
contained more apoE4130. Mechanistic studies linking apoE to Aβ transport from the ISF have
identified a number of involved transporters including P-glycoprotein38, LRP1 (Low-density
lipoprotein receptor-related protein 1)182, and LDLR (Low-density lipoprotein receptor) 34.
LRP1 was found in amyloid plaques168 and can bind Aβ directly47, or indirectly via its
ligands, including apoE32,112 and others109,155. Additionally, LRP1 participates in a lipid transport
pathway that involves binding to heparan sulfate proteoglycans (HSPG)41,137. Intriguingly, HSPG
was found in senile plaques as well as CAA44,200,201, and had been shown to directly interact with
Aβ219, accelerating its oligomerization and aggregation31,37,207. A recent study found that ablation
of HSPG in postnatal forebrain neurons of APP/PS1 mice led to a reduction in both Aβ

17
oligomerization and the deposition of amyloid plaques133. These reductions were driven by an
accelerated rate of Aβ clearance from the ISF. Moreover, the authors also found a significantly
increased level of various HSPG species in postmortem brain tissues from AD patients relative to
controls. Deletion134 or overexpression218 of LRP1 causes increases or decreases of brain apoE
levels, respectively. Whereas Aβ40 is cleared across the BBB at a much more rapid rate than via
the ISF flow, binding to apoE-ε3 reduces Aβ40 efflux rate from the ISF by 5-7-fold21. Another
study found that Aβ binding to apoE4 redirects its clearance from LRP1 to VLDLR (Very-low-
density lipoprotein receptor), which internalizes Aβ-apoE4 complexes at the BBB more slowly
than LRP146. In contrast, Aβ-apoE2 and Aβ-apoE3 complexes are cleared through the BBB via
both VLDLR and LRP1 at an accelerated rate compared to that of Aβ-apoE4 complexes.
In support of LDLR’s role in APOE transport across the BBB, deletion of the LDLR gene
in the mouse brain leads to higher apoE levels in the brain and CSF58, while overexpression of
LDLR in the brain decreases brain apoE113. Furthermore, deletion of LDLR caused a decrease in
Aβ uptake, whereas increasing LDLR levels significantly enhanced both the uptake and clearance
of Aβ by primary astrocytes in culture, even in the absence of apoE15. Taken together, these data
suggest that the influence of apoE on sAβ metabolism may not require direct binding of apoE with
sAβ in solution, and that Aβ binding to apoE may lead to reduced clearance. This raises the
possibility that APOE isoforms can significantly inhibit the uptake of sAβ by competing for the
same pathway, facilitated through either LRP1 or LDLR. More rigorous in vivo studies are needed
to provide direct evidence that the aforementioned mechanism is responsible for the increase in
Aβ clearance in mice with reduced apoE level.
18
Independent from its effects on Aβ clearance, there are also isoform-specific effects of
apoE on the BBB, as expression of APOE-ε4 and lack of murine apoE, but not APOE-ε2 and
APOE-ε3, was found to lead to BBB breakdown in young mice22. The increase in vascular
permeability in these mice were linked to a decrease in apoE dependent pericyte-expressed LRP1
activation and a concomitant increase in CypA-MMP9 activity. In support of these findings, a
human study using post-mortem brain samples from control and AD subjects found accelerated
pericyte degeneration in AD APOE-ε4 carriers compared to AD APOE-ε3 carriers and non-AD
controls75. Intriguingly, a significant increase in CypA and MMP-9 was also detected in pericytes
and endothelial cells of APOE-ε4 subjects relative to APOE-ε3 subjects. However, in situ brain
perfusion of the vascular marker [14C]-sucrose found no differences in cerebral vascular volume
among mice carrying any of the APOE isoforms, despite an observed reduction in cerebral
vascularization and basement membrane thickness in 12-month-old APOE-ε4 mice compared to
APOE-ε2 and APOE-ε3 mice2. Additionally, a relatively recently study reported no apparent
differences in the level of brain IgG and radiotracer uptake in apoE4 or apoE-/- mice when assessed
at 2-3 months of age27. Though the latter results might not be expected, they suggest that the global
homeostatic capacity of the BBB might be intact in APOE-ε4 mice, despite highly localized
disruption in BBB integrity.
APOE and cellular metabolism of Aβ
Various cell types in the CNS have been shown to possess the ability to internalize Aβ,
including astrocytes117, neurons175, and microglia139,161,162, albeit with different capabilities.
Primary hippocampal neurons are more efficient at internalizing Aβ in the presence of apoE3
compared to apoE419. Nevertheless, neurons appear to lack the ability to effectively degrade Aβ,
resulting in formation of high molecular weight (HMW) Aβ species in endosomal vesicles90,218.

19
The rest of this section will focus on astrocytes and microglia, which probably account for a
significant amount of cellular Aβ metabolism.
Immunohistological studies on human AD brains using antibodies against various Aβ
epitopes identified N-terminal-truncated fragments of Aβ40/42 that are found inside lipofuscin-
like granules within astrocytes60,195. In agreement with human studies, in vitro studies using
primary astrocytes showed that astrocytes can internalize and degrade both soluble158,180 and
insoluble213 Aβ. Interestingly, the ability of astrocytes to engulf and degrade Aβ is compromised
in apoE knock-out astrocytes, or in WT astrocytes upon the addition of either an antibody against
Aβ, apoE, or an LDLR family antagonist117. These results suggest an essential role of apoE in a
receptor-mediated Aβ uptake mechanism by astrocytes. However, more recent studies provided
evidence that such processes can occur in the absence of apoE15, and apoE can actually compete
with Aβ for binding/uptake by LDLR receptors despite minimal interaction with sAβ202.
Microglia are the resident macrophages and primary immune effectors in the brain, whose
roles in AD are increasingly getting more attention, both in the context of disease pathogenesis as
well as therapeutic opportunities. Microglia have the ability to clear sAβ as well as insoluble Aβ
in vitro, followed by rapid degradation through the late endocytic/lysosomal pathway 40,139. ApoE
has been shown to be essential for efficient Aβ degradation via microglia by neprilysin or in the
extracellular milieu by insulin degrading enzymes (IDE)106. More importantly, this process is
dependent on the lipidation status of APOE, suggesting that apoE exerts its effects via
manipulation of cellular cholesterol levels106,125. More recently, the newly discovered AD risk gene
that encodes the Triggering receptor expressed on myeloid cells 2 (TREM2)73,107 protein was found
to have apoE as one of its ligands10,11. Accordingly, TREM2-deficient microglia or microglia with
20
an AD risk variant (R47H) lose the ability to effectively bind lipoproteins (including apoE), which
decreases their phagocytic capabilities216. Furthermore, the lipid-sensing component of TREM2
allows it to sustain the microglial response that is necessary to cluster and potentially play a role
in more efficient plaque phagocytosis, a phenomenon that is attenuated in TREM2 deficient
microglia206 as well as R47H mutants217. Intriguingly, APOE-ε4-expressing microglia exhibited
more pronounced down-regulation of TREM2 than those that express APOE-ε3 in response to
TLR (toll-like receptor) activation126. In the future, generation of murine models with human
TREM2 and mutant variants should allow for more rigorous in vivo studies that will fill in the gaps
in knowledge about TREM2’s role in AD pathogenesis and its potential link with apoE.
1.5 APOE and other amyloidogenic proteins

The pro-amyloidogenic nature of APOE has prompted investigation of its role in other
neurodegenerative diseases, many of which share the common features of pathogenic protein
64,127
aggregation. Specifically, APOE had been linked to Parkinson disease (PD), chronic
traumatic encephalopathy148, Huntington disease111,160, frontotemporal dementia1, and certain
subsets of Amyotrophic Lateral Sclerosis (ALS)121,128,167, though the latter findings conflicted with
some other studies49,70,151. Here, we discuss the current state of knowledge on the specific
interaction between APOE and the aggregation-prone proteins associated with some of these
diseases.
1.5.1 APOE and tau

The strong correlation between APOE genotypes and AD, and the presence of
immunoreactive apoE in neurons containing neurofibrillary tangles154,210 led to numerous clinical
and epidemiological studies on the potential interaction between APOE and Tau, both in the
context of AD as well as other tauopathies, including Frontotemporal dementia (FTD). The
21
majority of clinical studies found an over-representation of the APOE-ε4 allele in both AD and
FTD25,54,74,105, while histopathologic examinations revealed a significant positive correlation
between APOE genotype and stage of neurofibrillary pathology159 according to Braak staging62.
In support of these findings, the presence of the APOE-ε4 allele significantly correlates with brain
atrophy in disease-specific brains regions in both AD and FTD1. However, studies have not
demonstrated a consistent effect of APOE genotype on cognition in tauopathies1,51. It should be
mentioned that a few studies found either no association between APOE status and FTD171, or that
the association was only applicable to male cohorts184. The disagreement of these findings might
be explained by the population being studied and/or difference in statistical power of the studies.
More sufficiently powered longitudinal studies are necessary to investigate whether APOE status
has any effect on cognitive status as well as other aspects of neuropathology in patients with non-
AD tauopathies.
Early studies by Allen Roses, Warren Strittmatter and colleagues found apoE3, but not
apoE4, to interact with Tau in an in vitro binding assay186. This interaction is facilitated through
the microtubule-binding domain of Tau and the LDLR binding domain on apoE3, which is distinct
from its binding site for Aβ. Interestingly, expression of full length human apoE4 specifically in
neurons alone is sufficient to induce NFT-like inclusions and hyperphosphorylation of Tau in WT
mice92,194. Along with these findings, a C-terminal-truncated fragment of apoE ( 272-299) 80,92
was found to accumulate in the brains of AD patients and mice with neuronal expression of
APOE30. The same group also linked the increase in pTau to changes in the Zinc-induced Erk
activation pathway79. Considering the availability of mice that develop Tau pathology4 and APOE
knock-in189 mouse models, future in vivo studies on APOE/Tau interaction are feasible and warrant
22
new insights on the relationship between one of AD’s signature hallmarks and its biggest risk
factor.
1.5.2 APOE and alpha-synuclein (α-syn)

α-syn is a 140-amino-acid protein which is normally localized to pre-synaptic terminals.
Aggregates of α-syn form the main constituent of Lewy bodies and Lewy neurites99,101,211, the
pathological hallmarks of a class of neurodegenerative diseases termed “synucleinopathies” which
includes Parkinson disease (PD) and the related disorders Parkinson disease dementia (PDD) and
dementia with Lewy bodies (DLB) (Reviewed extensively in 124 and 97). Interestingly, up to 50%
of patients with synucleinopathy and dementia also have Aβ plaques, while a smaller subset also
has concomitant neurofibrillary tangles)94,96,104,120,146,149,176. Historically, this overlap presented a
challenge with regards to disease nomenclature. The overlapping features between PD and AD
have been demonstrated by clinical141,208, pathologic119,132, and genetic data129,142. Intriguingly,
some of the findings in this area suggest a possible connection between apoE and α-syn.
Initial epidemiological studies found contradictory results as to whether APOE genotype
influences the risk of PD. A meta-analysis of 22 clinical studies found the APOE-ε2 allele to
positively associated with risk for developing sporadic PD (OR = 1.20), whereas no association
was found for APOE-ε3 or APOE-ε491. On the contrary, an independent study by Li et al.
genotyped 658 PD affected families for APOE functional polymorphisms found the APOE-ε4
allele to increase the risk and decrease age at onset for PD, while APOE-ε3 allele had the opposite
effects127. Recent efforts to combine data across multiple genetic association studies have
demonstrated that compared to APOE-ε3, the APOE-ε2 allele modestly increases risk of PD (OR
= 1.11 [95% CI 1.02, 1.21]) while APOE-ε4 has no effect on overall PD risk (OR = 1.00 [95% CI
0.91, 1.10])131. In addition to the genetic diversity in study populations and differences in statistical
23
power, the disparity in results may also be attributed to the heterogeneity in both clinical and
pathologic entities within the PD spectrum: that is, many patients with a diagnosis of PD also have
cognitive impairment, and a large but not necessarily overlapping proportion have Aβ plaque
pathology. Numerous studies support the association of APOE-ε4 with increased Aβ and, to some
extent, tau pathology in individuals with PD as well as other neurodegenerative disorders98,108. The
effect of APOE-ε4 on cognitive impairment in PD may be mediated at least in part through Aβ, as
illustrated by a prospective cohort study of 45 patients with PD with at least one yearly follow-up
visit in which any observed correlation between APOE-ε4 status and cognitive impairment was
abolished after adjusting for CSF levels of Aβ42. However, this phenomenon does not account for
the effect of APOE genotype on dementia in PD patients who do not have concomitant Aβ plaque
pathology183. Several studies have found the presence of one or more APOE-ε4 alleles not only
increases the Aβ plaque load, but also the α-syn pathology burden in PD cases146,177,205.
Interestingly, when a relatively large group of PD cases was stratified pathologically and cases
with concomitant Aβ pathology were excluded (leaving a cohort with pure α-syn pathology),
APOE-ε4 was still strongly associated with dementia and even more strongly associated with early
development of dementia198. Taken together, these findings suggest that the impact of APOE
genotype on synucleinopathy and dementia is likely multifactorial and that apoE may directly
influence α-syn pathology.
Basic research on the role of APOE on α-syn has lagged behind clinical and
epidemiological studies, but several important findings have emerged. A study in Tg mice
expressing mutations in the SNCA gene which codes for α-syn found that aged, symptomatic mice
had elevated levels of endogenous murine Aβ40 and Aβ42, as well as apoE, relative to
asymptomatic littermates61. Interestingly, deletion of the murine Apoe gene prolonged survival and
24
decreased levels of insoluble Aβ40, Aβ42, and α-syn in addition to decreasing levels of
ubiquitinated proteins. These data suggest that apoE may directly influence proteostasis
mechanisms that regulated α-syn and Aβ. More recently, an in vitro study found that apoE, and
especially the apoE4 isoform, appeared to have a stimulatory effect on α-syn aggregation at low
concentrations (low nM); however, this effect was attenuated at higher concentrations50. One
caveat to this study is that the apoE particles used were lipid-poor, while most physiologically
active apoE species found in vivo are lipid-rich. It’s also not yet clear how apoE, a predominantly
secreted molecule found in the extracellular space, interacts with α-syn, which localizes to the
intracellular space in both monomeric and aggregated forms. Further research is clearly needed to
elucidate molecular mechanisms of this interaction and explore opportunities for therapeutic
intervention.
25
1.6 References
1 Agosta, F., Vossel, K. A., Miller, B. L., Migliaccio, R., Bonasera, S. J., Filippi, M., Boxer,
A. L., Karydas, A., Possin, K. L. & Gorno-Tempini, M. L. Apolipoprotein E epsilon4 is
associated with disease-specific effects on brain atrophy in Alzheimer's disease and
frontotemporal dementia. Proceedings of the National Academy of Sciences of the United
States of America 106, 2018-2022, doi:10.1073/pnas.0812697106 (2009).
2 Alata, W., Ye, Y., St-Amour, I., Vandal, M. & Calon, F. Human apolipoprotein E
varepsilon4 expression impairs cerebral vascularization and blood-brain barrier function in
mice. Journal of cerebral blood flow and metabolism : official journal of the International
Society of Cerebral Blood Flow and Metabolism 35, 86-94, doi:10.1038/jcbfm.2014.172
(2015).
3 Aleshkov, S., Abraham, C. R. & Zannis, V. I. Interaction of nascent ApoE2, ApoE3, and
ApoE4 isoforms expressed in mammalian cells with amyloid peptide beta (1-40).
Relevance to Alzheimer's disease. Biochemistry 36, 10571-10580, doi:10.1021/bi9626362
(1997).
4 Allen, B., Ingram, E., Takao, M., Smith, M. J., Jakes, R., Virdee, K., Yoshida, H., Holzer,
M., Craxton, M., Emson, P. C., Atzori, C., Migheli, A., Crowther, R. A., Ghetti, B.,
Spillantini, M. G. & Goedert, M. Abundant tau filaments and nonapoptotic
neurodegeneration in transgenic mice expressing human P301S tau protein. The Journal of
neuroscience : the official journal of the Society for Neuroscience 22, 9340-9351 (2002).
5 Allsop, D., Landon, M. & Kidd, M. The isolation and amino acid composition of senile
plaque core protein. Brain research 259, 348-352 (1983).
6 Alzgene. AlzGene - Gene overview of all published AD-association studies for
APOE_e2/3/4, <http://www.alzgene.org/geneoverview.asp?geneid=83> (2010).
7 Alzheimer's, A. 2016 Alzheimer's disease facts and figures. Alzheimer's & dementia : the
journal of the Alzheimer's Association 12, 459-509 (2016).
8 Alzheimer, A. Über eine eigenartige Erkrankung der Hirnrinde. Allg Z Psychiatr. 64, 146-
148 (1907).
9 Anderson, R., Barnes, J. C., Bliss, T. V., Cain, D. P., Cambon, K., Davies, H. A., Errington,
M. L., Fellows, L. A., Gray, R. A., Hoh, T., Stewart, M., Large, C. H. & Higgins, G. A.
Behavioural, physiological and morphological analysis of a line of apolipoprotein E
knockout mouse. Neuroscience 85, 93-110 (1998).
10 Atagi, Y., Liu, C. C., Painter, M. M., Chen, X. F., Verbeeck, C., Zheng, H., Li, X.,
Rademakers, R., Kang, S. S., Xu, H., Younkin, S., Das, P., Fryer, J. D. & Bu, G.
Apolipoprotein E Is a Ligand for Triggering Receptor Expressed on Myeloid Cells 2
(TREM2). The Journal of biological chemistry 290, 26043-26050,
doi:10.1074/jbc.M115.679043 (2015).
11 Bailey, C. C., DeVaux, L. B. & Farzan, M. The Triggering Receptor Expressed on Myeloid
Cells 2 Binds Apolipoprotein E. The Journal of biological chemistry 290, 26033-26042,
doi:10.1074/jbc.M115.677286 (2015).
12 Bales, K. R., Liu, F., Wu, S., Lin, S., Koger, D., DeLong, C., Hansen, J. C., Sullivan, P.
M. & Paul, S. M. Human APOE isoform-dependent effects on brain beta-amyloid levels in
PDAPP transgenic mice. The Journal of neuroscience : the official journal of the Society
for Neuroscience 29, 6771-6779, doi:10.1523/JNEUROSCI.0887-09.2009 (2009).
26
13 Bales, K. R., Verina, T., Cummins, D. J., Du, Y., Dodel, R. C., Saura, J., Fishman, C. E.,
DeLong, C. A., Piccardo, P., Petegnief, V., Ghetti, B. & Paul, S. M. Apolipoprotein E is
essential for amyloid deposition in the APP(V717F) transgenic mouse model of
Alzheimer's disease. Proceedings of the National Academy of Sciences of the United States
of America 96, 15233-15238 (1999).
14 Bales, K. R., Verina, T., Dodel, R. C., Du, Y., Altstiel, L., Bender, M., Hyslop, P.,
Johnstone, E. M., Little, S. P., Cummins, D. J., Piccardo, P., Ghetti, B. & Paul, S. M. Lack
of apolipoprotein E dramatically reduces amyloid beta-peptide deposition. Nature genetics
17, 263-264, doi:10.1038/ng1197-263 (1997).
15 Basak, J. M., Verghese, P. B., Yoon, H., Kim, J. & Holtzman, D. M. Low-density
lipoprotein receptor represents an apolipoprotein E-independent pathway of Abeta uptake
and degradation by astrocytes. The Journal of biological chemistry 287, 13959-13971,
doi:10.1074/jbc.M111.288746 (2012).
16 Bateman, R. J., Aisen, P. S., De Strooper, B., Fox, N. C., Lemere, C. A., Ringman, J. M.,
Salloway, S., Sperling, R. A., Windisch, M. & Xiong, C. Autosomal-dominant Alzheimer's
disease: a review and proposal for the prevention of Alzheimer's disease. Alzheimer's
research & therapy 3, 1, doi:10.1186/alzrt59 (2011).
17 Bateman, R. J., Benzinger, T. L., Berry, S., Clifford, D. B., Duggan, C., Fagan, A. M.,
Fanning, K., Farlow, M. R., Hassenstab, J., McDade, E. M., Mills, S., Paumier, K.,
Quintana, M., Salloway, S. P., Santacruz, A., Schneider, L. S., Wang, G., Xiong, C. &
Network, D.-T. P. C. f. t. D. I. A. The DIAN-TU Next Generation Alzheimer's prevention
trial: Adaptive design and disease progression model. Alzheimer's & dementia : the journal
of the Alzheimer's Association 13, 8-19, doi:10.1016/j.jalz.2016.07.005 (2017).
18 Beffert, U., Aumont, N., Dea, D., Lussier-Cacan, S., Davignon, J. & Poirier, J. Beta-
amyloid peptides increase the binding and internalization of apolipoprotein E to
hippocampal neurons. Journal of neurochemistry 70, 1458-1466 (1998).
19 Beffert, U., Aumont, N., Dea, D., Lussier-Cacan, S., Davignon, J. & Poirier, J.
Apolipoprotein E isoform-specific reduction of extracellular amyloid in neuronal cultures.
Brain research. Molecular brain research 68, 181-185 (1999).
20 Beffert, U. & Poirier, J. ApoE associated with lipid has a reduced capacity to inhibit beta-
amyloid fibril formation. Neuroreport 9, 3321-3323 (1998).
21 Bell, R. D., Sagare, A. P., Friedman, A. E., Bedi, G. S., Holtzman, D. M., Deane, R. &
Zlokovic, B. V. Transport pathways for clearance of human Alzheimer's amyloid beta-
peptide and apolipoproteins E and J in the mouse central nervous system. Journal of
cerebral blood flow and metabolism : official journal of the International Society of
Cerebral Blood Flow and Metabolism 27, 909-918, doi:10.1038/sj.jcbfm.9600419 (2007).
22 Bell, R. D., Winkler, E. A., Singh, I., Sagare, A. P., Deane, R., Wu, Z., Holtzman, D. M.,
Betsholtz, C., Armulik, A., Sallstrom, J., Berk, B. C. & Zlokovic, B. V. Apolipoprotein E
controls cerebrovascular integrity via cyclophilin A. Nature 485, 512-516,
doi:10.1038/nature11087 (2012).
23 Benilova, I., Karran, E. & De Strooper, B. The toxic Abeta oligomer and Alzheimer's
disease: an emperor in need of clothes. Nature neuroscience 15, 349-357,
doi:10.1038/nn.3028 (2012).
24 Benjamin, R., Leake, A., Ince, P. G., Perry, R. H., McKeith, I. G., Edwardson, J. A. &
Morris, C. M. Effects of apolipoprotein E genotype on cortical neuropathology in senile
27
dementia of the Lewy body and Alzheimer's disease. Neurodegeneration : a journal for
neurodegenerative disorders, neuroprotection, and neuroregeneration 4, 443-448 (1995).
25 Bernardi, L., Maletta, R. G., Tomaino, C., Smirne, N., Di Natale, M., Perri, M., Longo, T.,
Colao, R., Curcio, S. A., Puccio, G., Mirabelli, M., Kawarai, T., Rogaeva, E., St George
Hyslop, P. H., Passarino, G., De Benedictis, G. & Bruni, A. C. The effects of APOE and
tau gene variability on risk of frontotemporal dementia. Neurobiology of aging 27, 702-
709, doi:10.1016/j.neurobiolaging.2005.03.008 (2006).
26 Bertram, L., McQueen, M. B., Mullin, K., Blacker, D. & Tanzi, R. E. Systematic meta-
analyses of Alzheimer disease genetic association studies: the AlzGene database. Nature
genetics 39, 17-23, doi:10.1038/ng1934 (2007).
27 Bien-Ly, N., Boswell, C. A., Jeet, S., Beach, T. G., Hoyte, K., Luk, W., Shihadeh, V.,
Ulufatu, S., Foreman, O., Lu, Y., DeVoss, J., van der Brug, M. & Watts, R. J. Lack of
Widespread BBB Disruption in Alzheimer's Disease Models: Focus on Therapeutic
Antibodies. Neuron 88, 289-297, doi:10.1016/j.neuron.2015.09.036 (2015).
28 Bien-Ly, N., Gillespie, A. K., Walker, D., Yoon, S. Y. & Huang, Y. Reducing human
apolipoprotein E levels attenuates age-dependent Abeta accumulation in mutant human
amyloid precursor protein transgenic mice. The Journal of neuroscience : the official
journal of the Society for Neuroscience 32, 4803-4811, doi:10.1523/JNEUROSCI.0033-
12.2012 (2012).
29 Biere, A. L., Ostaszewski, B., Zhao, H., Gillespie, S., Younkin, S. G. & Selkoe, D. J. Co-
expression of beta-amyloid precursor protein (betaAPP) and apolipoprotein E in cell
culture: analysis of betaAPP processing. Neurobiology of disease 2, 177-187,
doi:10.1006/nbdi.1995.0019 (1995).
30 Brecht, W. J., Harris, F. M., Chang, S., Tesseur, I., Yu, G. Q., Xu, Q., Dee Fish, J., Wyss-
Coray, T., Buttini, M., Mucke, L., Mahley, R. W. & Huang, Y. Neuron-specific
apolipoprotein e4 proteolysis is associated with increased tau phosphorylation in brains of
transgenic mice. The Journal of neuroscience : the official journal of the Society for
Neuroscience 24, 2527-2534, doi:10.1523/JNEUROSCI.4315-03.2004 (2004).
31 Brunden, K. R., Richter-Cook, N. J., Chaturvedi, N. & Frederickson, R. C. pH-dependent
binding of synthetic beta-amyloid peptides to glycosaminoglycans. Journal of
neurochemistry 61, 2147-2154 (1993).
32 Bu, G. Apolipoprotein E and its receptors in Alzheimer's disease: pathways, pathogenesis
and therapy. Nature reviews. Neuroscience 10, 333-344, doi:10.1038/nrn2620 (2009).
33 Caselli, R. J., Walker, D., Sue, L., Sabbagh, M. & Beach, T. Amyloid load in nondemented
brains correlates with APOE e4. Neuroscience letters 473, 168-171,
doi:10.1016/j.neulet.2010.02.016 (2010).
34 Castellano, J. M., Deane, R., Gottesdiener, A. J., Verghese, P. B., Stewart, F. R., West, T.,
Paoletti, A. C., Kasper, T. R., DeMattos, R. B., Zlokovic, B. V. & Holtzman, D. M. Low-
density lipoprotein receptor overexpression enhances the rate of brain-to-blood Abeta
clearance in a mouse model of beta-amyloidosis. Proceedings of the National Academy of
Sciences of the United States of America 109, 15502-15507, doi:10.1073/pnas.1206446109
(2012).
35 Castellano, J. M., Kim, J., Stewart, F. R., Jiang, H., DeMattos, R. B., Patterson, B. W.,
Fagan, A. M., Morris, J. C., Mawuenyega, K. G., Cruchaga, C., Goate, A. M., Bales, K.
R., Paul, S. M., Bateman, R. J. & Holtzman, D. M. Human apoE isoforms differentially
28
regulate brain amyloid-beta peptide clearance. Science translational medicine 3, 89ra57,
doi:10.1126/scitranslmed.3002156 (2011).
36 Cedazo-Minguez, A., Wiehager, B., Winblad, B., Huttinger, M. & Cowburn, R. F. Effects
of apolipoprotein E (apoE) isoforms, beta-amyloid (Abeta) and apoE/Abeta complexes on
protein kinase C-alpha (PKC-alpha) translocation and amyloid precursor protein (APP)
processing in human SH-SY5Y neuroblastoma cells and fibroblasts. Neurochemistry
international 38, 615-625 (2001).
37 Cheng, F., Ruscher, K., Fransson, L. A. & Mani, K. Non-toxic amyloid beta formed in the
presence of glypican-1 or its deaminatively generated heparan sulfate degradation
products. Glycobiology 23, 1510-1519, doi:10.1093/glycob/cwt079 (2013).
38 Cirrito, J. R., Deane, R., Fagan, A. M., Spinner, M. L., Parsadanian, M., Finn, M. B., Jiang,
H., Prior, J. L., Sagare, A., Bales, K. R., Paul, S. M., Zlokovic, B. V., Piwnica-Worms, D.
& Holtzman, D. M. P-glycoprotein deficiency at the blood-brain barrier increases amyloid-
beta deposition in an Alzheimer disease mouse model. The Journal of clinical investigation
115, 3285-3290, doi:10.1172/JCI25247 (2005).
39 Cirrito, J. R., May, P. C., O'Dell, M. A., Taylor, J. W., Parsadanian, M., Cramer, J. W.,
Audia, J. E., Nissen, J. S., Bales, K. R., Paul, S. M., DeMattos, R. B. & Holtzman, D. M.
In vivo assessment of brain interstitial fluid with microdialysis reveals plaque-associated
changes in amyloid-beta metabolism and half-life. The Journal of neuroscience : the
official journal of the Society for Neuroscience 23, 8844-8853 (2003).
40 Cole, G. M. & Ard, M. D. Influence of lipoproteins on microglial degradation of
Alzheimer's amyloid beta-protein. Microscopy research and technique 50, 316-324,
doi:10.1002/1097-0029(20000815)50:4<316::AID-JEMT11>3.0.CO;2-E (2000).
41 Cooper, A. D. Hepatic uptake of chylomicron remnants. Journal of lipid research 38, 2173-
2192 (1997).
42 Corder, E. H., Saunders, A. M., Risch, N. J., Strittmatter, W. J., Schmechel, D. E., Gaskell,
P. C., Jr., Rimmler, J. B., Locke, P. A., Conneally, P. M., Schmader, K. E. & et al.
Protective effect of apolipoprotein E type 2 allele for late onset Alzheimer disease. Nature
genetics 7, 180-184, doi:10.1038/ng0694-180 (1994).
43 Corder, E. H., Saunders, A. M., Strittmatter, W. J., Schmechel, D. E., Gaskell, P. C., Small,
G. W., Roses, A. D., Haines, J. L. & Pericak-Vance, M. A. Gene dose of apolipoprotein E
type 4 allele and the risk of Alzheimer's disease in late onset families. Science 261, 921-
923 (1993).
44 Cotman, S. L., Halfter, W. & Cole, G. J. Agrin binds to beta-amyloid (Abeta), accelerates
abeta fibril formation, and is localized to Abeta deposits in Alzheimer's disease brain.
Molecular and cellular neurosciences 15, 183-198, doi:10.1006/mcne.1999.0816 (2000).
45 de la Torre, J. C. Vascular risk factor detection and control may prevent Alzheimer's
disease. Ageing research reviews 9, 218-225, doi:10.1016/j.arr.2010.04.002 (2010).
46 Deane, R., Sagare, A., Hamm, K., Parisi, M., Lane, S., Finn, M. B., Holtzman, D. M. &
Zlokovic, B. V. apoE isoform-specific disruption of amyloid beta peptide clearance from
mouse brain. The Journal of clinical investigation 118, 4002-4013, doi:10.1172/JCI36663
(2008).
47 Deane, R., Wu, Z., Sagare, A., Davis, J., Du Yan, S., Hamm, K., Xu, F., Parisi, M., LaRue,
B., Hu, H. W., Spijkers, P., Guo, H., Song, X., Lenting, P. J., Van Nostrand, W. E. &
Zlokovic, B. V. LRP/amyloid beta-peptide interaction mediates differential brain efflux of
Abeta isoforms. Neuron 43, 333-344, doi:10.1016/j.neuron.2004.07.017 (2004).
29
48 DeMattos, R. B., Cirrito, J. R., Parsadanian, M., May, P. C., O'Dell, M. A., Taylor, J. W.,
Harmony, J. A., Aronow, B. J., Bales, K. R., Paul, S. M. & Holtzman, D. M. ApoE and
clusterin cooperatively suppress Abeta levels and deposition: evidence that ApoE regulates
extracellular Abeta metabolism in vivo. Neuron 41, 193-202 (2004).
49 Drory, V. E., Birnbaum, M., Korczyn, A. D. & Chapman, J. Association of APOE epsilon4
allele with survival in amyotrophic lateral sclerosis. Journal of the neurological sciences
190, 17-20 (2001).
50 Emamzadeh, F. N., Aojula, H., McHugh, P. C. & Allsop, D. Effects of different isoforms
of apoE on aggregation of the alpha-synuclein protein implicated in Parkinson's disease.
Neuroscience letters 618, 146-151, doi:10.1016/j.neulet.2016.02.042 (2016).
51 Engelborghs, S., Dermaut, B., Marien, P., Symons, A., Vloeberghs, E., Maertens, K.,
Somers, N., Goeman, J., Rademakers, R., Van den Broeck, M., Pickut, B., Cruts, M., Van
Broeckhoven, C. & De Deyn, P. P. Dose dependent effect of APOE epsilon4 on behavioral
symptoms in frontal lobe dementia. Neurobiology of aging 27, 285-292,
doi:10.1016/j.neurobiolaging.2005.02.005 (2006).
52 Esparza, T. J., Wildburger, N. C., Jiang, H., Gangolli, M., Cairns, N. J., Bateman, R. J. &
Brody, D. L. Soluble Amyloid-beta Aggregates from Human Alzheimer's Disease Brains.
Scientific reports 6, 38187, doi:10.1038/srep38187 (2016).
53 Evans, K. C., Berger, E. P., Cho, C. G., Weisgraber, K. H. & Lansbury, P. T., Jr.
Apolipoprotein E is a kinetic but not a thermodynamic inhibitor of amyloid formation:
implications for the pathogenesis and treatment of Alzheimer disease. Proceedings of the
National Academy of Sciences of the United States of America 92, 763-767 (1995).
54 Fabre, S. F., Forsell, C., Viitanen, M., Sjogren, M., Wallin, A., Blennow, K., Blomberg,
M., Andersen, C., Wahlund, L. O. & Lannfelt, L. Clinic-based cases with frontotemporal
dementia show increased cerebrospinal fluid tau and high apolipoprotein E epsilon4
frequency, but no tau gene mutations. Experimental neurology 168, 413-418,
doi:10.1006/exnr.2000.7613 (2001).
55 Fagan, A. M., Murphy, B. A., Patel, S. N., Kilbridge, J. F., Mobley, W. C., Bu, G. &
Holtzman, D. M. Evidence for normal aging of the septo-hippocampal cholinergic system
in apoE (-/-) mice but impaired clearance of axonal degeneration products following injury.
Experimental neurology 151, 314-325, doi:10.1006/exnr.1998.6818 (1998).
56 Fagan, A. M., Watson, M., Parsadanian, M., Bales, K. R., Paul, S. M. & Holtzman, D. M.
Human and murine ApoE markedly alters A beta metabolism before and after plaque
formation in a mouse model of Alzheimer's disease. Neurobiology of disease 9, 305-318,
doi:10.1006/nbdi.2002.0483 (2002).
57 Farrer, L. A., Cupples, L. A., Haines, J. L., Hyman, B., Kukull, W. A., Mayeux, R., Myers,
R. H., Pericak-Vance, M. A., Risch, N. & van Duijn, C. M. Effects of age, sex, and ethnicity
on the association between apolipoprotein E genotype and Alzheimer disease. A meta-
analysis. APOE and Alzheimer Disease Meta Analysis Consortium. Jama 278, 1349-1356
(1997).
58 Fryer, J. D., Demattos, R. B., McCormick, L. M., O'Dell, M. A., Spinner, M. L., Bales, K.
R., Paul, S. M., Sullivan, P. M., Parsadanian, M., Bu, G. & Holtzman, D. M. The low
density lipoprotein receptor regulates the level of central nervous system human and
murine apolipoprotein E but does not modify amyloid plaque pathology in PDAPP mice.
The Journal of biological chemistry 280, 25754-25759, doi:10.1074/jbc.M502143200
(2005).
30
59 Fryer, J. D., Simmons, K., Parsadanian, M., Bales, K. R., Paul, S. M., Sullivan, P. M. &
Holtzman, D. M. Human apolipoprotein E4 alters the amyloid-beta 40:42 ratio and
promotes the formation of cerebral amyloid angiopathy in an amyloid precursor protein
transgenic model. The Journal of neuroscience : the official journal of the Society for
60 Funato, H., Yoshimura, M., Yamazaki, T., Saido, T. C., Ito, Y., Yokofujita, J., Okeda, R.
& Ihara, Y. Astrocytes containing amyloid beta-protein (Abeta)-positive granules are
associated with Abeta40-positive diffuse plaques in the aged human brain. The American
journal of pathology 152, 983-992 (1998).
61 Gallardo, G., Schluter, O. M. & Sudhof, T. C. A molecular pathway of neurodegeneration
linking alpha-synuclein to ApoE and Abeta peptides. Nature neuroscience 11, 301-308,
doi:10.1038/nn2058 (2008).
62 Gallyas, F. Silver staining of Alzheimer's neurofibrillary changes by means of physical
development. Acta morphologica Academiae Scientiarum Hungaricae 19, 1-8 (1971).
63 Games, D., Adams, D., Alessandrini, R., Barbour, R., Berthelette, P., Blackwell, C., Carr,
T., Clemens, J., Donaldson, T., Gillespie, F. & et al. Alzheimer-type neuropathology in
transgenic mice overexpressing V717F beta-amyloid precursor protein. Nature 373, 523-
527, doi:10.1038/373523a0 (1995).
64 Gao, J., Huang, X., Park, Y., Liu, R., Hollenbeck, A., Schatzkin, A., Mailman, R. B. &
Chen, H. Apolipoprotein E genotypes and the risk of Parkinson disease. Neurobiology of
aging 32, 2106 e2101-2106, doi:10.1016/j.neurobiolaging.2011.05.016 (2011).
65 Garai, K., Verghese, P. B., Baban, B., Holtzman, D. M. & Frieden, C. The binding of
apolipoprotein E to oligomers and fibrils of amyloid-beta alters the kinetics of amyloid
aggregation. Biochemistry 53, 6323-6331, doi:10.1021/bi5008172 (2014).
66 Glenner, G. G. Congophilic microangiopathy in the pathogenesis of Alzheimer's syndrome
(presenile dementia). Medical hypotheses 5, 1231-1236 (1979).
67 Glenner, G. G. & Wong, C. W. Alzheimer's disease and Down's syndrome: sharing of a
unique cerebrovascular amyloid fibril protein. Biochemical and biophysical research
communications 122, 1131-1135 (1984).
68 Glenner, G. G. & Wong, C. W. Alzheimer's disease: initial report of the purification and
characterization of a novel cerebrovascular amyloid protein. Biochemical and biophysical
research communications 120, 885-890 (1984).
69 Goate, A., Chartier-Harlin, M. C., Mullan, M., Brown, J., Crawford, F., Fidani, L., Giuffra,
L., Haynes, A., Irving, N., James, L. & et al. Segregation of a missense mutation in the
amyloid precursor protein gene with familial Alzheimer's disease. Nature 349, 704-706,
doi:10.1038/349704a0 (1991).
70 Govone, F., Vacca, A., Rubino, E., Gai, A., Boschi, S., Gentile, S., Orsi, L., Pinessi, L. &
Rainero, I. Lack of association between APOE gene polymorphisms and amyotrophic
lateral sclerosis: a comprehensive meta-analysis. Amyotrophic lateral sclerosis &
frontotemporal degeneration 15, 551-556, doi:10.3109/21678421.2014.918149 (2014).
71 Greenberg, S. M., Vonsattel, J. P., Segal, A. Z., Chiu, R. I., Clatworthy, A. E., Liao, A.,
Hyman, B. T. & Rebeck, G. W. Association of apolipoprotein E epsilon2 and vasculopathy
in cerebral amyloid angiopathy. Neurology 50, 961-965 (1998).
72 Grehan, S., Tse, E. & Taylor, J. M. Two distal downstream enhancers direct expression of
the human apolipoprotein E gene to astrocytes in the brain. The Journal of neuroscience :
the official journal of the Society for Neuroscience 21, 812-822 (2001).
31
73 Guerreiro, R., Wojtas, A., Bras, J., Carrasquillo, M., Rogaeva, E., Majounie, E., Cruchaga,
C., Sassi, C., Kauwe, J. S., Younkin, S., Hazrati, L., Collinge, J., Pocock, J., Lashley, T.,
Williams, J., Lambert, J. C., Amouyel, P., Goate, A., Rademakers, R., Morgan, K., Powell,
J., St George-Hyslop, P., Singleton, A., Hardy, J. & Alzheimer Genetic Analysis, G.
TREM2 variants in Alzheimer's disease. The New England journal of medicine 368, 117-
127, doi:10.1056/NEJMoa1211851 (2013).
74 Gustafson, L., Abrahamson, M., Grubb, A., Nilsson, K. & Fex, G. Apolipoprotein-E
genotyping in Alzheimer's disease and frontotemporal dementia. Dementia and geriatric
cognitive disorders 8, 240-243 (1997).
75 Halliday, M. R., Rege, S. V., Ma, Q., Zhao, Z., Miller, C. A., Winkler, E. A. & Zlokovic,
B. V. Accelerated pericyte degeneration and blood-brain barrier breakdown in
apolipoprotein E4 carriers with Alzheimer's disease. Journal of cerebral blood flow and
metabolism : official journal of the International Society of Cerebral Blood Flow and
Metabolism 36, 216-227, doi:10.1038/jcbfm.2015.44 (2016).
76 Hardy, J. Alzheimer's disease: the amyloid cascade hypothesis: an update and reappraisal.
Journal of Alzheimer's disease : JAD 9, 151-153 (2006).
77 Hardy, J. & Selkoe, D. J. The amyloid hypothesis of Alzheimer's disease: progress and
problems on the road to therapeutics. Science 297, 353-356, doi:10.1126/science.1072994
(2002).
78 Hardy, J. A. & Higgins, G. A. Alzheimer's disease: the amyloid cascade hypothesis.
Science 256, 184-185 (1992).
79 Harris, F. M., Brecht, W. J., Xu, Q., Mahley, R. W. & Huang, Y. Increased tau
phosphorylation in apolipoprotein E4 transgenic mice is associated with activation of
extracellular signal-regulated kinase: modulation by zinc. The Journal of biological
chemistry 279, 44795-44801, doi:10.1074/jbc.M408127200 (2004).
80 Harris, F. M., Brecht, W. J., Xu, Q., Tesseur, I., Kekonius, L., Wyss-Coray, T., Fish, J. D.,
Masliah, E., Hopkins, P. C., Scearce-Levie, K., Weisgraber, K. H., Mucke, L., Mahley, R.
W. & Huang, Y. Carboxyl-terminal-truncated apolipoprotein E4 causes Alzheimer's
disease-like neurodegeneration and behavioral deficits in transgenic mice. Proceedings of
the National Academy of Sciences of the United States of America 100, 10966-10971,
doi:10.1073/pnas.1434398100 (2003).
81 Heinonen, O., Lehtovirta, M., Soininen, H., Helisalmi, S., Mannermaa, A., Sorvari, H.,
Kosunen, O., Paljarvi, L., Ryynanen, M. & Riekkinen, P. J., Sr. Alzheimer pathology of
patients carrying apolipoprotein E epsilon 4 allele. Neurobiology of aging 16, 505-513
(1995).
82 Hirsch-Reinshagen, V., Maia, L. F., Burgess, B. L., Blain, J. F., Naus, K. E., McIsaac, S.
A., Parkinson, P. F., Chan, J. Y., Tansley, G. H., Hayden, M. R., Poirier, J., Van Nostrand,
W. & Wellington, C. L. The absence of ABCA1 decreases soluble ApoE levels but does
not diminish amyloid deposition in two murine models of Alzheimer disease. The Journal
of biological chemistry 280, 43243-43256, doi:10.1074/jbc.M508781200 (2005).
83 Hirsch-Reinshagen, V., Zhou, S., Burgess, B. L., Bernier, L., McIsaac, S. A., Chan, J. Y.,
Tansley, G. H., Cohn, J. S., Hayden, M. R. & Wellington, C. L. Deficiency of ABCA1
impairs apolipoprotein E metabolism in brain. The Journal of biological chemistry 279,
41197-41207, doi:10.1074/jbc.M407962200 (2004).
84 Holtzman, D. M., Bales, K. R., Tenkova, T., Fagan, A. M., Parsadanian, M., Sartorius, L.
J., Mackey, B., Olney, J., McKeel, D., Wozniak, D. & Paul, S. M. Apolipoprotein E
32
isoform-dependent amyloid deposition and neuritic degeneration in a mouse model of
of America 97, 2892-2897, doi:10.1073/pnas.050004797 (2000).
85 Holtzman, D. M., Bales, K. R., Wu, S., Bhat, P., Parsadanian, M., Fagan, A. M., Chang, L.
K., Sun, Y. & Paul, S. M. Expression of human apolipoprotein E reduces amyloid-beta
deposition in a mouse model of Alzheimer's disease. The Journal of clinical investigation
103, R15-R21, doi:10.1172/JCI6179 (1999).
86 Holtzman, D. M., Fagan, A. M., Mackey, B., Tenkova, T., Sartorius, L., Paul, S. M., Bales,
K., Ashe, K. H., Irizarry, M. C. & Hyman, B. T. Apolipoprotein E facilitates neuritic and
cerebrovascular plaque formation in an Alzheimer's disease model. Annals of neurology
47, 739-747 (2000).
87 Holtzman, D. M., Pitas, R. E., Kilbridge, J., Nathan, B., Mahley, R. W., Bu, G. & Schwartz,
A. L. Low density lipoprotein receptor-related protein mediates apolipoprotein E-
dependent neurite outgrowth in a central nervous system-derived neuronal cell line.
Proceedings of the National Academy of Sciences of the United States of America 92, 9480-
9484 (1995).
88 Hone, E., Martins, I. J., Jeoung, M., Ji, T. H., Gandy, S. E. & Martins, R. N. Alzheimer's
disease amyloid-beta peptide modulates apolipoprotein E isoform specific receptor
binding. Journal of Alzheimer's disease : JAD 7, 303-314 (2005).
89 Hong, S., Ostaszewski, B. L., Yang, T., O'Malley, T. T., Jin, M., Yanagisawa, K., Li, S.,
Bartels, T. & Selkoe, D. J. Soluble Abeta oligomers are rapidly sequestered from brain ISF
in vivo and bind GM1 ganglioside on cellular membranes. Neuron 82, 308-319,
doi:10.1016/j.neuron.2014.02.027 (2014).
90 Hu, X., Crick, S. L., Bu, G., Frieden, C., Pappu, R. V. & Lee, J. M. Amyloid seeds formed
by cellular uptake, concentration, and aggregation of the amyloid-beta peptide.
Proceedings of the National Academy of Sciences of the United States of America 106,
20324-20329, doi:10.1073/pnas.0911281106 (2009).
91 Huang, X., Chen, P. C. & Poole, C. APOE-[epsilon]2 allele associated with higher
prevalence of sporadic Parkinson disease. Neurology 62, 2198-2202 (2004).
92 Huang, Y., Liu, X. Q., Wyss-Coray, T., Brecht, W. J., Sanan, D. A. & Mahley, R. W.
Apolipoprotein E fragments present in Alzheimer's disease brains induce neurofibrillary
tangle-like intracellular inclusions in neurons. Proceedings of the National Academy of
(2001).
93 Huang, Y. A., Zhou, B., Wernig, M. & Sudhof, T. C. ApoE2, ApoE3, and ApoE4
Differentially Stimulate APP Transcription and Abeta Secretion. Cell 168, 427-441 e421,
doi:10.1016/j.cell.2016.12.044 (2017).
94 Hughes, A. J., Daniel, S. E., Blankson, S. & Lees, A. J. A clinicopathologic study of 100
cases of Parkinson's disease. Archives of neurology 50, 140-148 (1993).
95 Irizarry, M. C., Deng, A., Lleo, A., Berezovska, O., Von Arnim, C. A., Martin-Rehrmann,
M., Manelli, A., LaDu, M. J., Hyman, B. T. & Rebeck, G. W. Apolipoprotein E modulates
gamma-secretase cleavage of the amyloid precursor protein. Journal of neurochemistry 90,
1132-1143, doi:10.1111/j.1471-4159.2004.02581.x (2004).
96 Irwin, D. J., Grossman, M., Weintraub, D., Hurtig, H. I., Duda, J. E., Xie, S. X., Lee, E.
B., Van Deerlin, V. M., Lopez, O. L., Kofler, J. K., Nelson, P. T., Jicha, G. A., Woltjer, R.,
Quinn, J. F., Kaye, J., Leverenz, J. B., Tsuang, D., Longfellow, K., Yearout, D., Kukull,
33
W., Keene, C. D., Montine, T. J., Zabetian, C. P. & Trojanowski, J. Q. Neuropathological
and genetic correlates of survival and dementia onset in synucleinopathies: a retrospective
analysis. The Lancet. Neurology 16, 55-65, doi:10.1016/S1474-4422(16)30291-5 (2017).
97 Irwin, D. J., Lee, V. M. & Trojanowski, J. Q. Parkinson's disease dementia: convergence
of alpha-synuclein, tau and amyloid-beta pathologies. Nature reviews. Neuroscience 14,
626-636, doi:10.1038/nrn3549 (2013).
98 Irwin, D. J., White, M. T., Toledo, J. B., Xie, S. X., Robinson, J. L., Van Deerlin, V., Lee,
V. M., Leverenz, J. B., Montine, T. J., Duda, J. E., Hurtig, H. I. & Trojanowski, J. Q.
Neuropathologic substrates of Parkinson disease dementia. Annals of neurology 72, 587-
598, doi:10.1002/ana.23659 (2012).
99 Iwai, A., Masliah, E., Yoshimoto, M., Ge, N., Flanagan, L., de Silva, H. A., Kittel, A. &
Saitoh, T. The precursor protein of non-A beta component of Alzheimer's disease amyloid
is a presynaptic protein of the central nervous system. Neuron 14, 467-475 (1995).
100 Jack, C. R., Jr. & Holtzman, D. M. Biomarker modeling of Alzheimer's disease. Neuron
80, 1347-1358, doi:10.1016/j.neuron.2013.12.003 (2013).
101 Jakes, R., Spillantini, M. G. & Goedert, M. Identification of two distinct synucleins from
human brain. FEBS letters 345, 27-32 (1994).
102 Jansen, W. J., Ossenkoppele, R., Knol, D. L., Tijms, B. M., Scheltens, P., Verhey, F. R.,
Visser, P. J., Amyloid Biomarker Study, G., Aalten, P., Aarsland, D., Alcolea, D.,
Alexander, M., Almdahl, I. S., Arnold, S. E., Baldeiras, I., Barthel, H., van Berckel, B. N.,
Bibeau, K., Blennow, K., Brooks, D. J., van Buchem, M. A., Camus, V., Cavedo, E., Chen,
K., Chetelat, G., Cohen, A. D., Drzezga, A., Engelborghs, S., Fagan, A. M., Fladby, T.,
Fleisher, A. S., van der Flier, W. M., Ford, L., Forster, S., Fortea, J., Foskett, N.,
Frederiksen, K. S., Freund-Levi, Y., Frisoni, G. B., Froelich, L., Gabryelewicz, T., Gill, K.
D., Gkatzima, O., Gomez-Tortosa, E., Gordon, M. F., Grimmer, T., Hampel, H., Hausner,
L., Hellwig, S., Herukka, S. K., Hildebrandt, H., Ishihara, L., Ivanoiu, A., Jagust, W. J.,
Johannsen, P., Kandimalla, R., Kapaki, E., Klimkowicz-Mrowiec, A., Klunk, W. E.,
Kohler, S., Koglin, N., Kornhuber, J., Kramberger, M. G., Van Laere, K., Landau, S. M.,
Lee, D. Y., de Leon, M., Lisetti, V., Lleo, A., Madsen, K., Maier, W., Marcusson, J.,
Mattsson, N., de Mendonca, A., Meulenbroek, O., Meyer, P. T., Mintun, M. A., Mok, V.,
Molinuevo, J. L., Mollergard, H. M., Morris, J. C., Mroczko, B., Van der Mussele, S., Na,
D. L., Newberg, A., Nordberg, A., Nordlund, A., Novak, G. P., Paraskevas, G. P., Parnetti,
L., Perera, G., Peters, O., Popp, J., Prabhakar, S., Rabinovici, G. D., Ramakers, I. H., Rami,
L., Resende de Oliveira, C., Rinne, J. O., Rodrigue, K. M., Rodriguez-Rodriguez, E., Roe,
C. M., Rot, U., Rowe, C. C., Ruther, E., Sabri, O., Sanchez-Juan, P., Santana, I., Sarazin,
M., Schroder, J., Schutte, C., Seo, S. W., Soetewey, F., Soininen, H., Spiru, L., Struyfs, H.,
Teunissen, C. E., Tsolaki, M., Vandenberghe, R., Verbeek, M. M., Villemagne, V. L., Vos,
S. J., van Waalwijk van Doorn, L. J., Waldemar, G., Wallin, A., Wallin, A. K., Wiltfang,
J., Wolk, D. A., Zboch, M. & Zetterberg, H. Prevalence of cerebral amyloid pathology in
persons without dementia: a meta-analysis. Jama 313, 1924-1938,
doi:10.1001/jama.2015.4668 (2015).
103 Jarrett, J. T. & Lansbury, P. T., Jr. Seeding "one-dimensional crystallization" of amyloid:
a pathogenic mechanism in Alzheimer's disease and scrapie? Cell 73, 1055-1058 (1993).
104 Jellinger, K. A. Morphological substrates of parkinsonism with and without dementia: a
retrospective clinico-pathological study. Journal of neural transmission. Supplementum,
91-104 (2007).
34
105 Ji, Y., Liu, M., Huo, Y. R., Liu, S., Shi, Z., Liu, S., Wisniewski, T. & Wang, J.
Apolipoprotein Epsilon epsilon4 frequency is increased among Chinese patients with
frontotemporal dementia and Alzheimer's disease. Dementia and geriatric cognitive
disorders 36, 163-170, doi:10.1159/000350872 (2013).
106 Jiang, Q., Lee, C. Y., Mandrekar, S., Wilkinson, B., Cramer, P., Zelcer, N., Mann, K.,
Lamb, B., Willson, T. M., Collins, J. L., Richardson, J. C., Smith, J. D., Comery, T. A.,
Riddell, D., Holtzman, D. M., Tontonoz, P. & Landreth, G. E. ApoE promotes the
proteolytic degradation of Abeta. Neuron 58, 681-693, doi:10.1016/j.neuron.2008.04.010
(2008).
107 Jonsson, T., Stefansson, H., Steinberg, S., Jonsdottir, I., Jonsson, P. V., Snaedal, J.,
Bjornsson, S., Huttenlocher, J., Levey, A. I., Lah, J. J., Rujescu, D., Hampel, H., Giegling,
I., Andreassen, O. A., Engedal, K., Ulstein, I., Djurovic, S., Ibrahim-Verbaas, C., Hofman,
A., Ikram, M. A., van Duijn, C. M., Thorsteinsdottir, U., Kong, A. & Stefansson, K. Variant
of TREM2 associated with the risk of Alzheimer's disease. The New England journal of
medicine 368, 107-116, doi:10.1056/NEJMoa1211103 (2013).
108 Josephs, K. A., Tsuboi, Y., Cookson, N., Watt, H. & Dickson, D. W. Apolipoprotein E
epsilon 4 is a determinant for Alzheimer-type pathologic features in tauopathies,
synucleinopathies, and frontotemporal degeneration. Archives of neurology 61, 1579-1584,
doi:10.1001/archneur.61.10.1579 (2004).
109 Kanekiyo, T. & Bu, G. Receptor-associated protein interacts with amyloid-beta peptide
and promotes its cellular uptake. The Journal of biological chemistry 284, 33352-33359,
doi:10.1074/jbc.M109.015032 (2009).
110 Kang, J., Lemaire, H. G., Unterbeck, A., Salbaum, J. M., Masters, C. L., Grzeschik, K. H.,
Multhaup, G., Beyreuther, K. & Muller-Hill, B. The precursor of Alzheimer's disease
amyloid A4 protein resembles a cell-surface receptor. Nature 325, 733-736,
doi:10.1038/325733a0 (1987).
111 Kehoe, P., Krawczak, M., Harper, P. S., Owen, M. J. & Jones, A. L. Age of onset in
Huntington disease: sex specific influence of apolipoprotein E genotype and normal CAG
repeat length. Journal of medical genetics 36, 108-111 (1999).
112 Kim, J., Basak, J. M. & Holtzman, D. M. The role of apolipoprotein E in Alzheimer's
disease. Neuron 63, 287-303, doi:10.1016/j.neuron.2009.06.026 (2009).
113 Kim, J., Castellano, J. M., Jiang, H., Basak, J. M., Parsadanian, M., Pham, V., Mason, S.
M., Paul, S. M. & Holtzman, D. M. Overexpression of low-density lipoprotein receptor in
the brain markedly inhibits amyloid deposition and increases extracellular A beta
clearance. Neuron 64, 632-644, doi:10.1016/j.neuron.2009.11.013 (2009).
114 Kim, J., Jiang, H., Park, S., Eltorai, A. E., Stewart, F. R., Yoon, H., Basak, J. M., Finn, M.
B. & Holtzman, D. M. Haploinsufficiency of human APOE reduces amyloid deposition in
a mouse model of amyloid-beta amyloidosis. The Journal of neuroscience : the official
11.2011 (2011).
115 Klunk, W. E., Engler, H., Nordberg, A., Wang, Y., Blomqvist, G., Holt, D. P., Bergstrom,
M., Savitcheva, I., Huang, G. F., Estrada, S., Ausen, B., Debnath, M. L., Barletta, J., Price,
J. C., Sandell, J., Lopresti, B. J., Wall, A., Koivisto, P., Antoni, G., Mathis, C. A. &
Langstrom, B. Imaging brain amyloid in Alzheimer's disease with Pittsburgh Compound-
B. Annals of neurology 55, 306-319, doi:10.1002/ana.20009 (2004).
35
116 Klunk, W. E., Wang, Y., Huang, G. F., Debnath, M. L., Holt, D. P. & Mathis, C. A.
Uncharged thioflavin-T derivatives bind to amyloid-beta protein with high affinity and
readily enter the brain. Life sciences 69, 1471-1484 (2001).
117 Koistinaho, M., Lin, S., Wu, X., Esterman, M., Koger, D., Hanson, J., Higgs, R., Liu, F.,
Malkani, S., Bales, K. R. & Paul, S. M. Apolipoprotein E promotes astrocyte colocalization
and degradation of deposited amyloid-beta peptides. Nature medicine 10, 719-726,
doi:10.1038/nm1058 (2004).
118 Koldamova, R., Staufenbiel, M. & Lefterov, I. Lack of ABCA1 considerably decreases
brain ApoE level and increases amyloid deposition in APP23 mice. The Journal of
biological chemistry 280, 43224-43235, doi:10.1074/jbc.M504513200 (2005).
119 Korczyn, A. D. Dementia in Parkinson's disease. Journal of neurology 248 Suppl 3, III1-
4 (2001).
120 Kotzbauer, P. T., Cairns, N. J., Campbell, M. C., Willis, A. W., Racette, B. A., Tabbal, S.
D. & Perlmutter, J. S. Pathologic accumulation of alpha-synuclein and Abeta in Parkinson
disease patients with dementia. Archives of neurology 69, 1326-1331,
doi:10.1001/archneurol.2012.1608 (2012).
121 Lacomblez, L., Doppler, V., Beucler, I., Costes, G., Salachas, F., Raisonnier, A., Le
Forestier, N., Pradat, P. F., Bruckert, E. & Meininger, V. APOE: a potential marker of
disease progression in ALS. Neurology 58, 1112-1114 (2002).
122 LaDu, M. J., Falduto, M. T., Manelli, A. M., Reardon, C. A., Getz, G. S. & Frail, D. E.
Isoform-specific binding of apolipoprotein E to beta-amyloid. The Journal of biological
chemistry 269, 23403-23406 (1994).
123 LaDu, M. J., Gilligan, S. M., Lukens, J. R., Cabana, V. G., Reardon, C. A., Van Eldik, L.
J. & Holtzman, D. M. Nascent astrocyte particles differ from lipoproteins in CSF. Journal
of neurochemistry 70, 2070-2081 (1998).
124 Lashuel, H. A., Overk, C. R., Oueslati, A. & Masliah, E. The many faces of alpha-
synuclein: from structure and toxicity to therapeutic target. Nature reviews. Neuroscience
14, 38-48, doi:10.1038/nrn3406 (2013).
125 Lee, C. Y., Tse, W., Smith, J. D. & Landreth, G. E. Apolipoprotein E promotes beta-
amyloid trafficking and degradation by modulating microglial cholesterol levels. The
Journal of biological chemistry 287, 2032-2044, doi:10.1074/jbc.M111.295451 (2012).
126 Li, X., Montine, K. S., Keene, C. D. & Montine, T. J. Different mechanisms of
apolipoprotein E isoform-dependent modulation of prostaglandin E2 production and
triggering receptor expressed on myeloid cells 2 (TREM2) expression after innate immune
activation of microglia. FASEB journal : official publication of the Federation of American
Societies for Experimental Biology 29, 1754-1762, doi:10.1096/fj.14-262683 (2015).
127 Li, Y. J., Hauser, M. A., Scott, W. K., Martin, E. R., Booze, M. W., Qin, X. J., Walter, J.
W., Nance, M. A., Hubble, J. P., Koller, W. C., Pahwa, R., Stern, M. B., Hiner, B. C.,
Jankovic, J., Goetz, C. G., Small, G. W., Mastaglia, F., Haines, J. L., Pericak-Vance, M.
A. & Vance, J. M. Apolipoprotein E controls the risk and age at onset of Parkinson disease.
Neurology 62, 2005-2009 (2004).
128 Li, Y. J., Pericak-Vance, M. A., Haines, J. L., Siddique, N., McKenna-Yasek, D., Hung,
W. Y., Sapp, P., Allen, C. I., Chen, W., Hosler, B., Saunders, A. M., Dellefave, L. M.,
Brown, R. H. & Siddique, T. Apolipoprotein E is associated with age at onset of
amyotrophic lateral sclerosis. Neurogenetics 5, 209-213, doi:10.1007/s10048-004-0193-0
(2004).
36
129 Li, Y. J., Scott, W. K., Hedges, D. J., Zhang, F. Y., Gaskell, P. C., Nance, M. A., Watts, R.
L., Hubble, J. P., Koller, W. C., Pahwa, R., Stern, M. B., Hiner, B. C., Jankovic, J., Allen,
A. A., Goetz, C. G., Mastaglia, F., Stajich, J. M., Gibson, R. A., Middleton, L. T., Saunders,
A. M., Scott, B. L., Small, G. W., Nicodemus, K. K., Reed, A. D., Schmechel, D. E., Welsh-
Bohmer, K. A., Conneally, P. M., Roses, A. D., Gilbert, J. R., Vance, J. M., Haines, J. L.
& Pericak-Vance, M. A. Age at onset in two common neurodegenerative diseases is
genetically controlled. American journal of human genetics 70, 985-993, doi:Doi
10.1086/339815 (2002).
130 Liao, F., Zhang, T. J., Jiang, H., Lefton, K. B., Robinson, G. O., Vassar, R., Sullivan, P.
M. & Holtzman, D. M. Murine versus human apolipoprotein E4: differential facilitation of
and co-localization in cerebral amyloid angiopathy and amyloid plaques in APP transgenic
mouse models. Acta neuropathologica communications 3, 70, doi:10.1186/s40478-015-
0250-y (2015).
131 Lill, C. M., Roehr, J. T., McQueen, M. B., Kavvoura, F. K., Bagade, S., Schjeide, B. M.,
Schjeide, L. M., Meissner, E., Zauft, U., Allen, N. C., Liu, T., Schilling, M., Anderson, K.
J., Beecham, G., Berg, D., Biernacka, J. M., Brice, A., DeStefano, A. L., Do, C. B.,
Eriksson, N., Factor, S. A., Farrer, M. J., Foroud, T., Gasser, T., Hamza, T., Hardy, J. A.,
Heutink, P., Hill-Burns, E. M., Klein, C., Latourelle, J. C., Maraganore, D. M., Martin, E.
R., Martinez, M., Myers, R. H., Nalls, M. A., Pankratz, N., Payami, H., Satake, W., Scott,
W. K., Sharma, M., Singleton, A. B., Stefansson, K., Toda, T., Tung, J. Y., Vance, J.,
Wood, N. W., Zabetian, C. P., andMe Genetic Epidemiology of Parkinson's Disease, C.,
International Parkinson's Disease Genomics, C., Parkinson's Disease, G. C., Wellcome
Trust Case Control, C., Young, P., Tanzi, R. E., Khoury, M. J., Zipp, F., Lehrach, H.,
Ioannidis, J. P. & Bertram, L. Comprehensive research synopsis and systematic meta-
analyses in Parkinson's disease genetics: The PDGene database. PLoS genetics 8,
e1002548, doi:10.1371/journal.pgen.1002548 (2012).
132 Lippa, C. F., Schmidt, M. L., Lee, V. M. & Trojanowski, J. Q. Alpha-synuclein in familial
Alzheimer disease: epitope mapping parallels dementia with Lewy bodies and Parkinson
disease. Archives of neurology 58, 1817-1820 (2001).
133 Liu, C. C., Zhao, N., Yamaguchi, Y., Cirrito, J. R., Kanekiyo, T., Holtzman, D. M. & Bu,
G. Neuronal heparan sulfates promote amyloid pathology by modulating brain amyloid-
beta clearance and aggregation in Alzheimer's disease. Science translational medicine 8,
332ra344, doi:10.1126/scitranslmed.aad3650 (2016).
134 Liu, Q., Zerbinatti, C. V., Zhang, J., Hoe, H. S., Wang, B., Cole, S. L., Herz, J., Muglia, L.
& Bu, G. Amyloid precursor protein regulates brain apolipoprotein E and cholesterol
metabolism through lipoprotein receptor LRP1. Neuron 56, 66-78,
doi:10.1016/j.neuron.2007.08.008 (2007).
135 Ma, J., Yee, A., Brewer, H. B., Jr., Das, S. & Potter, H. Amyloid-associated proteins alpha
1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-protein into
filaments. Nature 372, 92-94, doi:10.1038/372092a0 (1994).
136 Mahley, R. W. Apolipoprotein E: cholesterol transport protein with expanding role in cell
biology. Science 240, 622-630 (1988).
137 Mahley, R. W. & Ji, Z. S. Remnant lipoprotein metabolism: key pathways involving cell-
surface heparan sulfate proteoglycans and apolipoprotein E. Journal of lipid research 40,
1-16 (1999).
37
138 Mak, A. C., Pullinger, C. R., Tang, L. F., Wong, J. S., Deo, R. C., Schwarz, J. M.,
Gugliucci, A., Movsesyan, I., Ishida, B. Y., Chu, C., Poon, A., Kim, P., Stock, E. O.,
Schaefer, E. J., Asztalos, B. F., Castellano, J. M., Wyss-Coray, T., Duncan, J. L., Miller,
B. L., Kane, J. P., Kwok, P. Y. & Malloy, M. J. Effects of the absence of apolipoprotein e
on lipoproteins, neurocognitive function, and retinal function. JAMA neurology 71, 1228-
1236, doi:10.1001/jamaneurol.2014.2011 (2014).
139 Mandrekar, S., Jiang, Q., Lee, C. Y., Koenigsknecht-Talboo, J., Holtzman, D. M. &
Landreth, G. E. Microglia mediate the clearance of soluble Abeta through fluid phase
macropinocytosis. The Journal of neuroscience : the official journal of the Society for
140 Marchesi, V. T. Alzheimer's dementia begins as a disease of small blood vessels, damaged
by oxidative-induced inflammation and dysregulated amyloid metabolism: implications for
early detection and therapy. FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 25, 5-13, doi:10.1096/fj.11-0102ufm (2011).
141 Marder, K., Tang, M. X., Cote, L., Stern, Y. & Mayeux, R. The frequency and associated
risk factors for dementia in patients with Parkinson's disease. Archives of neurology 52,
695-701 (1995).
142 Martin, E. R., Scott, W. K., Nance, M. A., Watts, R. L., Hubble, J. P., Koller, W. C., Lyons,
K., Pahwa, R., Stern, M. B., Colcher, A., Hiner, B. C., Jankovic, J., Ondo, W. G., Allen, F.
H., Goetz, C. G., Small, G. W., Masterman, D., Mastaglia, F., Laing, N. G., Stajich, J. M.,
Ribble, R. C., Booze, M. W., Rogala, A., Hauser, M. A., Zhang, F. Y., Gibson, R. A.,
Middleton, L. T., Roses, A. D., Haines, J. L., Scott, B. L., Pericak-Vance, M. A. & Vance,
J. M. Association of single-nucleotide polymorphisms of the tau gene with late-onset
Parkinson disease. Jama-J Am Med Assoc 286, 2245-2250, doi:DOI
10.1001/jama.286.18.2245 (2001).
143 Masliah, E., Mallory, M., Ge, N., Alford, M., Veinbergs, I. & Roses, A. D.
Neurodegeneration in the central nervous system of apoE-deficient mice. Experimental
neurology 136, 107-122, doi:10.1006/exnr.1995.1088 (1995).
144 Masters, C. L., Simms, G., Weinman, N. A., Multhaup, G., McDonald, B. L. & Beyreuther,
K. Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proceedings
of the National Academy of Sciences of the United States of America 82, 4245-4249 (1985).
145 Mathis, C. A., Mason, N. S., Lopresti, B. J. & Klunk, W. E. Development of positron
emission tomography beta-amyloid plaque imaging agents. Seminars in nuclear medicine
42, 423-432, doi:10.1053/j.semnuclmed.2012.07.001 (2012).
146 Mattila, P. M., Rinne, J. O., Helenius, H., Dickson, D. W. & Roytta, M. Alpha-synuclein-
immunoreactive cortical Lewy bodies are associated with cognitive impairment in
Parkinson's disease. Acta neuropathologica 100, 285-290 (2000).
147 Mauch, D. H., Nagler, K., Schumacher, S., Goritz, C., Muller, E. C., Otto, A. & Pfrieger,
F. W. CNS synaptogenesis promoted by glia-derived cholesterol. Science 294, 1354-1357,
doi:10.1126/science.294.5545.1354 (2001).
148 McKee, A. C., Cantu, R. C., Nowinski, C. J., Hedley-Whyte, E. T., Gavett, B. E., Budson,
A. E., Santini, V. E., Lee, H. S., Kubilus, C. A. & Stern, R. A. Chronic traumatic
encephalopathy in athletes: progressive tauopathy after repetitive head injury. Journal of
neuropathology and experimental neurology 68, 709-735,
doi:10.1097/NEN.0b013e3181a9d503 (2009).
38
149 Mikolaenko, I., Pletnikova, O., Kawas, C. H., O'Brien, R., Resnick, S. M., Crain, B. &
Troncoso, J. C. Alpha-synuclein lesions in normal aging, Parkinson disease, and Alzheimer
disease: evidence from the Baltimore Longitudinal Study of Aging (BLSA). Journal of
neuropathology and experimental neurology 64, 156-162 (2005).
150 Morris, J. C., Roe, C. M., Xiong, C., Fagan, A. M., Goate, A. M., Holtzman, D. M. &
Mintun, M. A. APOE predicts amyloid-beta but not tau Alzheimer pathology in cognitively
normal aging. Annals of neurology 67, 122-131, doi:10.1002/ana.21843 (2010).
151 Mui, S., Rebeck, G. W., McKenna-Yasek, D., Hyman, B. T. & Brown, R. H., Jr.
Apolipoprotein E epsilon 4 allele is not associated with earlier age at onset in amyotrophic
lateral sclerosis. Annals of neurology 38, 460-463, doi:10.1002/ana.410380318 (1995).
152 Musiek, E. S. & Holtzman, D. M. Three dimensions of the amyloid hypothesis: time, space
and 'wingmen'. Nature neuroscience 18, 800-806, doi:10.1038/nn.4018 (2015).
153 Nalivaeva, N. N., Beckett, C., Belyaev, N. D. & Turner, A. J. Are amyloid-degrading
enzymes viable therapeutic targets in Alzheimer's disease? Journal of neurochemistry 120
Suppl 1, 167-185, doi:10.1111/j.1471-4159.2011.07510.x (2012).
154 Namba, Y., Tomonaga, M., Kawasaki, H., Otomo, E. & Ikeda, K. Apolipoprotein E
immunoreactivity in cerebral amyloid deposits and neurofibrillary tangles in Alzheimer's
disease and kuru plaque amyloid in Creutzfeldt-Jakob disease. Brain research 541, 163-
166 (1991).
155 Narita, M., Holtzman, D. M., Schwartz, A. L. & Bu, G. Alpha2-macroglobulin complexes
with and mediates the endocytosis of beta-amyloid peptide via cell surface low-density
lipoprotein receptor-related protein. Journal of neurochemistry 69, 1904-1911 (1997).
156 Nathan, B. P., Bellosta, S., Sanan, D. A., Weisgraber, K. H., Mahley, R. W. & Pitas, R. E.
Differential effects of apolipoproteins E3 and E4 on neuronal growth in vitro. Science 264,
850-852 (1994).
157 Nelson, P. T., Pious, N. M., Jicha, G. A., Wilcock, D. M., Fardo, D. W., Estus, S. & Rebeck,
G. W. APOE-epsilon2 and APOE-epsilon4 correlate with increased amyloid accumulation
in cerebral vasculature. Journal of neuropathology and experimental neurology 72, 708-
715, doi:10.1097/NEN.0b013e31829a25b9 (2013).
158 Nielsen, H. M., Veerhuis, R., Holmqvist, B. & Janciauskiene, S. Binding and uptake of A
beta1-42 by primary human astrocytes in vitro. Glia 57, 978-988, doi:10.1002/glia.20822
(2009).
159 Ohm, T. G., Kirca, M., Bohl, J., Scharnagl, H., Gross, W. & Marz, W. Apolipoprotein E
polymorphism influences not only cerebral senile plaque load but also Alzheimer-type
neurofibrillary tangle formation. Neuroscience 66, 583-587 (1995).
160 Panegyres, P. K., Beilby, J., Bulsara, M., Toufexis, K. & Wong, C. A study of potential
interactive genetic factors in Huntington's disease. European neurology 55, 189-192,
doi:10.1159/000093867 (2006).
161 Paresce, D. M., Chung, H. & Maxfield, F. R. Slow degradation of aggregates of the
Alzheimer's disease amyloid beta-protein by microglial cells. The Journal of biological
chemistry 272, 29390-29397 (1997).
162 Paresce, D. M., Ghosh, R. N. & Maxfield, F. R. Microglial cells internalize aggregates of
the Alzheimer's disease amyloid beta-protein via a scavenger receptor. Neuron 17, 553-
565 (1996).
39
163 Pfeifer, L. A., White, L. R., Ross, G. W., Petrovitch, H. & Launer, L. J. Cerebral amyloid
angiopathy and cognitive function: the HAAS autopsy study. Neurology 58, 1629-1634
(2002).
164 Pfrieger, F. W. Cholesterol homeostasis and function in neurons of the central nervous
system. Cellular and molecular life sciences : CMLS 60, 1158-1171, doi:10.1007/s00018-
003-3018-7 (2003).
165 Pitas, R. E., Boyles, J. K., Lee, S. H., Foss, D. & Mahley, R. W. Astrocytes synthesize
apolipoprotein E and metabolize apolipoprotein E-containing lipoproteins. Biochimica et
biophysica acta 917, 148-161 (1987).
166 Poirier, J. Apolipoprotein E and cholesterol metabolism in the pathogenesis and treatment
of Alzheimer's disease. Trends in molecular medicine 9, 94-101 (2003).
167 Praline, J., Blasco, H., Vourc'h, P., Garrigue, M. A., Gordon, P. H., Camu, W., Corcia, P.,
Andres, C. R. & French, A. L. S. S. G. APOE epsilon4 allele is associated with an increased
risk of bulbar-onset amyotrophic lateral sclerosis in men. European journal of neurology
18, 1046-1052, doi:10.1111/j.1468-1331.2010.03330.x (2011).
168 Rebeck, G. W., Harr, S. D., Strickland, D. K. & Hyman, B. T. Multiple, diverse senile
plaque-associated proteins are ligands of an apolipoprotein E receptor, the alpha 2-
macroglobulin receptor/low-density-lipoprotein receptor-related protein. Annals of
neurology 37, 211-217, doi:10.1002/ana.410370212 (1995).
169 Rebeck, G. W., Reiter, J. S., Strickland, D. K. & Hyman, B. T. Apolipoprotein E in sporadic
Alzheimer's disease: allelic variation and receptor interactions. Neuron 11, 575-580 (1993).
170 Reiman, E. M., Chen, K., Liu, X., Bandy, D., Yu, M., Lee, W., Ayutyanont, N., Keppler,
J., Reeder, S. A., Langbaum, J. B., Alexander, G. E., Klunk, W. E., Mathis, C. A., Price, J.
C., Aizenstein, H. J., DeKosky, S. T. & Caselli, R. J. Fibrillar amyloid-beta burden in
cognitively normal people at 3 levels of genetic risk for Alzheimer's disease. Proceedings
of the National Academy of Sciences of the United States of America 106, 6820-6825,
doi:10.1073/pnas.0900345106 (2009).
171 Riemenschneider, M., Diehl, J., Muller, U., Forstl, H. & Kurz, A. Apolipoprotein E
polymorphism in German patients with frontotemporal degeneration. Journal of
neurology, neurosurgery, and psychiatry 72, 639-641 (2002).
172 Rockenstein, E. M., McConlogue, L., Tan, H., Power, M., Masliah, E. & Mucke, L. Levels
and alternative splicing of amyloid beta protein precursor (APP) transcripts in brains of
APP transgenic mice and humans with Alzheimer's disease. The Journal of biological
chemistry 270, 28257-28267 (1995).
173 Roses, A. D. Apolipoprotein E affects the rate of Alzheimer disease expression: beta-
amyloid burden is a secondary consequence dependent on APOE genotype and duration of
disease. Journal of neuropathology and experimental neurology 53, 429-437 (1994).
174 Roychaudhuri, R., Yang, M., Hoshi, M. M. & Teplow, D. B. Amyloid beta-protein
assembly and Alzheimer disease. The Journal of biological chemistry 284, 4749-4753,
doi:10.1074/jbc.R800036200 (2009).
175 Saavedra, L., Mohamed, A., Ma, V., Kar, S. & de Chaves, E. P. Internalization of beta-
amyloid peptide by primary neurons in the absence of apolipoprotein E. The Journal of
176 Sabbagh, M. N., Adler, C. H., Lahti, T. J., Connor, D. J., Vedders, L., Peterson, L. K.,
Caviness, J. N., Shill, H. A., Sue, L. I., Ziabreva, I., Perry, E., Ballard, C. G., Aarsland, D.,
Walker, D. G. & Beach, T. G. Parkinson disease with dementia: comparing patients with
40
and without Alzheimer pathology. Alzheimer disease and associated disorders 23, 295-
297, doi:10.1097/WAD.0b013e31819c5ef4 (2009).
177 Saito, Y., Kawashima, A., Ruberu, N. N., Fujiwara, H., Koyama, S., Sawabe, M., Arai, T.,
Nagura, H., Yamanouchi, H., Hasegawa, M., Iwatsubo, T. & Murayama, S. Accumulation
of phosphorylated alpha-synuclein in aging human brain. Journal of neuropathology and
experimental neurology 62, 644-654 (2003).
178 Sanan, D. A., Weisgraber, K. H., Russell, S. J., Mahley, R. W., Huang, D., Saunders, A.,
Schmechel, D., Wisniewski, T., Frangione, B., Roses, A. D. & et al. Apolipoprotein E
associates with beta amyloid peptide of Alzheimer's disease to form novel monofibrils.
Isoform apoE4 associates more efficiently than apoE3. The Journal of clinical
investigation 94, 860-869, doi:10.1172/JCI117407 (1994).
179 Schmechel, D. E., Saunders, A. M., Strittmatter, W. J., Crain, B. J., Hulette, C. M., Joo, S.
H., Pericak-Vance, M. A., Goldgaber, D. & Roses, A. D. Increased amyloid beta-peptide
deposition in cerebral cortex as a consequence of apolipoprotein E genotype in late-onset
Alzheimer disease. Proceedings of the National Academy of Sciences of the United States
of America 90, 9649-9653 (1993).
180 Shaffer, L. M., Dority, M. D., Gupta-Bansal, R., Frederickson, R. C., Younkin, S. G. &
Brunden, K. R. Amyloid beta protein (A beta) removal by neuroglial cells in culture.
Neurobiology of aging 16, 737-745 (1995).
181 Sherrington, R., Rogaev, E. I., Liang, Y., Rogaeva, E. A., Levesque, G., Ikeda, M., Chi,
H., Lin, C., Li, G., Holman, K., Tsuda, T., Mar, L., Foncin, J. F., Bruni, A. C., Montesi, M.
P., Sorbi, S., Rainero, I., Pinessi, L., Nee, L., Chumakov, I., Pollen, D., Brookes, A.,
Sanseau, P., Polinsky, R. J., Wasco, W., Da Silva, H. A., Haines, J. L., Perkicak-Vance,
M. A., Tanzi, R. E., Roses, A. D., Fraser, P. E., Rommens, J. M. & St George-Hyslop, P.
H. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's
disease. Nature 375, 754-760, doi:10.1038/375754a0 (1995).
182 Shibata, M., Yamada, S., Kumar, S. R., Calero, M., Bading, J., Frangione, B., Holtzman,
D. M., Miller, C. A., Strickland, D. K., Ghiso, J. & Zlokovic, B. V. Clearance of
Alzheimer's amyloid-ss(1-40) peptide from brain by LDL receptor-related protein-1 at the
blood-brain barrier. The Journal of clinical investigation 106, 1489-1499,
doi:10.1172/JCI10498 (2000).
183 Siderowf, A., Xie, S. X., Hurtig, H., Weintraub, D., Duda, J., Chen-Plotkin, A., Shaw, L.
M., Van Deerlin, V., Trojanowski, J. Q. & Clark, C. CSF amyloid {beta} 1-42 predicts
cognitive decline in Parkinson disease. Neurology 75, 1055-1061,
doi:10.1212/WNL.0b013e3181f39a78 (2010).
184 Srinivasan, R., Davidson, Y., Gibbons, L., Payton, A., Richardson, A. M., Varma, A.,
Julien, C., Stopford, C., Thompson, J., Horan, M. A., Pendleton, N., Pickering-Brown, S.
M., Neary, D., Snowden, J. S. & Mann, D. M. The apolipoprotein E epsilon4 allele
selectively increases the risk of frontotemporal lobar degeneration in males. Journal of
neurology, neurosurgery, and psychiatry 77, 154-158, doi:10.1136/jnnp.2005.063966
(2006).
185 St George-Hyslop, P. H., Haines, J. L., Farrer, L. A., Polinsky, R., Van Broeckhoven, C.,
Goate, A., McLachlan, D. R., Orr, H., Bruni, A. C., Sorbi, S., Rainero, I., Foncin, J. F.,
Pollen, D., Cantu, J. M., Tupler, R., Voskresenskaya, N., Mayeux, R., Growden, J., Fried,
V. A., Myers, R. H., Nee, L., Backhovens, H., Martin, J. J., Rossor, M., Owen, M. J.,
Mullan, M., Percy, M. E., Karlinsky, H., Rich, S., Heston, L., Montesi, M., Mortilla, M.,
41
Nacmias, N., Gusella, J. F., Hardy, J. A., Group, F. A. D. C. S. & et al. Genetic linkage
studies suggest that Alzheimer's disease is not a single homogeneous disorder. Nature 347,
194-197, doi:10.1038/347194a0 (1990).
186 Strittmatter, W. J., Saunders, A. M., Goedert, M., Weisgraber, K. H., Dong, L. M., Jakes,
R., Huang, D. Y., Pericak-Vance, M., Schmechel, D. & Roses, A. D. Isoform-specific
interactions of apolipoprotein E with microtubule-associated protein tau: implications for
of America 91, 11183-11186 (1994).
187 Strittmatter, W. J., Saunders, A. M., Schmechel, D., Pericak-Vance, M., Enghild, J.,
Salvesen, G. S. & Roses, A. D. Apolipoprotein E: high-avidity binding to beta-amyloid
and increased frequency of type 4 allele in late-onset familial Alzheimer disease.
1981 (1993).
188 Strittmatter, W. J., Weisgraber, K. H., Huang, D. Y., Dong, L. M., Salvesen, G. S., Pericak-
Vance, M., Schmechel, D., Saunders, A. M., Goldgaber, D. & Roses, A. D. Binding of
human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and
implications for late-onset Alzheimer disease. Proceedings of the National Academy of
Sciences of the United States of America 90, 8098-8102 (1993).
189 Sullivan, P. M., Mezdour, H., Aratani, Y., Knouff, C., Najib, J., Reddick, R. L., Quarfordt,
S. H. & Maeda, N. Targeted replacement of the mouse apolipoprotein E gene with the
common human APOE3 allele enhances diet-induced hypercholesterolemia and
atherosclerosis. The Journal of biological chemistry 272, 17972-17980 (1997).
190 Sunderland, T., Mirza, N., Putnam, K. T., Linker, G., Bhupali, D., Durham, R., Soares, H.,
Kimmel, L., Friedman, D., Bergeson, J., Csako, G., Levy, J. A., Bartko, J. J. & Cohen, R.
M. Cerebrospinal fluid beta-amyloid1-42 and tau in control subjects at risk for Alzheimer's
disease: the effect of APOE epsilon4 allele. Biological psychiatry 56, 670-676,
doi:10.1016/j.biopsych.2004.07.021 (2004).
191 Szaruga, M., Veugelen, S., Benurwar, M., Lismont, S., Sepulveda-Falla, D., Lleo, A.,
Ryan, N. S., Lashley, T., Fox, N. C., Murayama, S., Gijsen, H., De Strooper, B. & Chavez-
Gutierrez, L. Qualitative changes in human gamma-secretase underlie familial Alzheimer's
disease. The Journal of experimental medicine 212, 2003-2013,
doi:10.1084/jem.20150892 (2015).
192 Tamamizu-Kato, S., Cohen, J. K., Drake, C. B., Kosaraju, M. G., Drury, J. &
Narayanaswami, V. Interaction with amyloid beta peptide compromises the lipid binding
function of apolipoprotein E. Biochemistry 47, 5225-5234, doi:10.1021/bi702097s (2008).
193 Tanzi, R. E., Gusella, J. F., Watkins, P. C., Bruns, G. A., St George-Hyslop, P., Van
Keuren, M. L., Patterson, D., Pagan, S., Kurnit, D. M. & Neve, R. L. Amyloid beta protein
gene: cDNA, mRNA distribution, and genetic linkage near the Alzheimer locus. Science
235, 880-884 (1987).
194 Tesseur, I., Van Dorpe, J., Spittaels, K., Van den Haute, C., Moechars, D. & Van Leuven,
F. Expression of human apolipoprotein E4 in neurons causes hyperphosphorylation of
protein tau in the brains of transgenic mice. The American journal of pathology 156, 951-
964, doi:10.1016/S0002-9440(10)64963-2 (2000).
195 Thal, D. R., Schultz, C., Dehghani, F., Yamaguchi, H., Braak, H. & Braak, E. Amyloid
beta-protein (Abeta)-containing astrocytes are located preferentially near N-terminal-
42
truncated Abeta deposits in the human entorhinal cortex. Acta neuropathologica 100, 608-
617 (2000).
196 Tiraboschi, P., Hansen, L. A., Masliah, E., Alford, M., Thal, L. J. & Corey-Bloom, J.
Impact of APOE genotype on neuropathologic and neurochemical markers of Alzheimer
disease. Neurology 62, 1977-1983 (2004).
197 Tokuda, T., Calero, M., Matsubara, E., Vidal, R., Kumar, A., Permanne, B., Zlokovic, B.,
Smith, J. D., Ladu, M. J., Rostagno, A., Frangione, B. & Ghiso, J. Lipidation of
apolipoprotein E influences its isoform-specific interaction with Alzheimer's amyloid beta
peptides. The Biochemical journal 348 Pt 2, 359-365 (2000).
198 Tsuang, D., Leverenz, J. B., Lopez, O. L., Hamilton, R. L., Bennett, D. A., Schneider, J.
A., Buchman, A. S., Larson, E. B., Crane, P. K., Kaye, J. A., Kramer, P., Woltjer, R.,
Trojanowski, J. Q., Weintraub, D., Chen-Plotkin, A. S., Irwin, D. J., Rick, J., Schellenberg,
G. D., Watson, G. S., Kukull, W., Nelson, P. T., Jicha, G. A., Neltner, J. H., Galasko, D.,
Masliah, E., Quinn, J. F., Chung, K. A., Yearout, D., Mata, I. F., Wan, J. Y., Edwards, K.
L., Montine, T. J. & Zabetian, C. P. APOE epsilon4 increases risk for dementia in pure
synucleinopathies. JAMA neurology 70, 223-228, doi:10.1001/jamaneurol.2013.600
(2013).
199 Ulrich, J. D., Burchett, J. M., Restivo, J. L., Schuler, D. R., Verghese, P. B., Mahan, T. E.,
Landreth, G. E., Castellano, J. M., Jiang, H., Cirrito, J. R. & Holtzman, D. M. In vivo
measurement of apolipoprotein E from the brain interstitial fluid using microdialysis.
Molecular neurodegeneration 8, 13, doi:10.1186/1750-1326-8-13 (2013).
200 Van Gool, D., David, G., Lammens, M., Baro, F. & Dom, R. Heparan sulfate expression
patterns in the amyloid deposits of patients with Alzheimer's and Lewy body type
dementia. Dementia 4, 308-314 (1993).
201 van Horssen, J., Otte-Holler, I., David, G., Maat-Schieman, M. L., van den Heuvel, L. P.,
Wesseling, P., de Waal, R. M. & Verbeek, M. M. Heparan sulfate proteoglycan expression
in cerebrovascular amyloid beta deposits in Alzheimer's disease and hereditary cerebral
hemorrhage with amyloidosis (Dutch) brains. Acta neuropathologica 102, 604-614 (2001).
202 Verghese, P. B., Castellano, J. M., Garai, K., Wang, Y., Jiang, H., Shah, A., Bu, G.,
Frieden, C. & Holtzman, D. M. ApoE influences amyloid-beta (Abeta) clearance despite
minimal apoE/Abeta association in physiological conditions. Proceedings of the National
Academy of Sciences of the United States of America 110, E1807-1816,
doi:10.1073/pnas.1220484110 (2013).
203 Wahrle, S. E., Jiang, H., Parsadanian, M., Hartman, R. E., Bales, K. R., Paul, S. M. &
Holtzman, D. M. Deletion of Abca1 increases Abeta deposition in the PDAPP transgenic
mouse model of Alzheimer disease. The Journal of biological chemistry 280, 43236-
43242, doi:10.1074/jbc.M508780200 (2005).
204 Wahrle, S. E., Jiang, H., Parsadanian, M., Kim, J., Li, A., Knoten, A., Jain, S., Hirsch-
Reinshagen, V., Wellington, C. L., Bales, K. R., Paul, S. M. & Holtzman, D. M.
Overexpression of ABCA1 reduces amyloid deposition in the PDAPP mouse model of
Alzheimer disease. The Journal of clinical investigation 118, 671-682,
doi:10.1172/JCI33622 (2008).
205 Wakabayashi, K., Kakita, A., Hayashi, S., Okuizumi, K., Onodera, O., Tanaka, H.,
Ishikawa, A., Tsuji, S. & Takahashi, H. Apolipoprotein E epsilon4 allele and progression
of cortical Lewy body pathology in Parkinson's disease. Acta neuropathologica 95, 450-
454 (1998).
43
206 Wang, Y., Cella, M., Mallinson, K., Ulrich, J. D., Young, K. L., Robinette, M. L., Gilfillan,
S., Krishnan, G. M., Sudhakar, S., Zinselmeyer, B. H., Holtzman, D. M., Cirrito, J. R. &
Colonna, M. TREM2 lipid sensing sustains the microglial response in an Alzheimer's
disease model. Cell 160, 1061-1071, doi:10.1016/j.cell.2015.01.049 (2015).
207 Watanabe, N., Araki, W., Chui, D. H., Makifuchi, T., Ihara, Y. & Tabira, T. Glypican-1 as
an Abeta binding HSPG in the human brain: its localization in DIG domains and possible
roles in the pathogenesis of Alzheimer's disease. FASEB journal : official publication of
the Federation of American Societies for Experimental Biology 18, 1013-1015,
doi:10.1096/fj.03-1040fje (2004).
208 Wilson, R. S., Bennett, D. A., Gilley, D. W., Beckett, L. A., Schneider, J. A. & Evans, D.
A. Progression of parkinsonism and loss of cognitive function in Alzheimer disease.
Archives of neurology 57, 855-860 (2000).
209 Wisniewski, T., Castano, E. M., Golabek, A., Vogel, T. & Frangione, B. Acceleration of
Alzheimer's fibril formation by apolipoprotein E in vitro. The American journal of
pathology 145, 1030-1035 (1994).
210 Wisniewski, T. & Frangione, B. Apolipoprotein E: a pathological chaperone protein in
patients with cerebral and systemic amyloid. Neuroscience letters 135, 235-238 (1992).
211 Withers, G. S., George, J. M., Banker, G. A. & Clayton, D. F. Delayed localization of
synelfin (synuclein, NACP) to presynaptic terminals in cultured rat hippocampal neurons.
Brain research. Developmental brain research 99, 87-94 (1997).
212 Wood, S. J., Chan, W. & Wetzel, R. Seeding of A beta fibril formation is inhibited by all
three isotypes of apolipoprotein E. Biochemistry 35, 12623-12628, doi:10.1021/bi961074j
(1996).
213 Wyss-Coray, T., Loike, J. D., Brionne, T. C., Lu, E., Anankov, R., Yan, F., Silverstein, S.
C. & Husemann, J. Adult mouse astrocytes degrade amyloid-beta in vitro and in situ.
Nature medicine 9, 453-457, doi:10.1038/nm838 (2003).
214 Yang, D. S., Smith, J. D., Zhou, Z., Gandy, S. E. & Martins, R. N. Characterization of the
binding of amyloid-beta peptide to cell culture-derived native apolipoprotein E2, E3, and
E4 isoforms and to isoforms from human plasma. Journal of neurochemistry 68, 721-725
(1997).
215 Ye, S., Huang, Y., Mullendorff, K., Dong, L., Giedt, G., Meng, E. C., Cohen, F. E., Kuntz,
I. D., Weisgraber, K. H. & Mahley, R. W. Apolipoprotein (apo) E4 enhances amyloid beta
peptide production in cultured neuronal cells: apoE structure as a potential therapeutic
target. Proceedings of the National Academy of Sciences of the United States of America
102, 18700-18705, doi:10.1073/pnas.0508693102 (2005).
216 Yeh, F. L., Wang, Y., Tom, I., Gonzalez, L. C. & Sheng, M. TREM2 Binds to
Apolipoproteins, Including APOE and CLU/APOJ, and Thereby Facilitates Uptake of
Amyloid-Beta by Microglia. Neuron 91, 328-340, doi:10.1016/j.neuron.2016.06.015
(2016).
217 Yuan, P., Condello, C., Keene, C. D., Wang, Y., Bird, T. D., Paul, S. M., Luo, W., Colonna,
M., Baddeley, D. & Grutzendler, J. TREM2 Haplodeficiency in Mice and Humans Impairs
the Microglia Barrier Function Leading to Decreased Amyloid Compaction and Severe
Axonal Dystrophy. Neuron 92, 252-264, doi:10.1016/j.neuron.2016.09.016 (2016).
218 Zerbinatti, C. V., Wahrle, S. E., Kim, H., Cam, J. A., Bales, K., Paul, S. M., Holtzman, D.
M. & Bu, G. Apolipoprotein E and low density lipoprotein receptor-related protein
44
facilitate intraneuronal Abeta42 accumulation in amyloid model mice. The Journal of
219 Zhang, G. L., Zhang, X., Wang, X. M. & Li, J. P. Towards understanding the roles of
heparan sulfate proteoglycans in Alzheimer's disease. BioMed research international 2014,
516028, doi:10.1155/2014/516028 (2014).
220 Zhang, S. H., Reddick, R. L., Piedrahita, J. A. & Maeda, N. Spontaneous
hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258,
468-471 (1992).
221 Zlokovic, B. V. Neurovascular mechanisms of Alzheimer's neurodegeneration. Trends in
neurosciences 28, 202-208, doi:10.1016/j.tins.2005.02.001 (2005).
45
1.7 Figures and tables
Figure 1.1 In Search of an

Identity for Amyloid Plaques
A timeline of key discoveries in the
quest to identify the primary component
of amyloid plaques and its genetic links
to early-onset Alzheimer disease. The
numbers in the brackets refer to the
corresponding citation associated with
the findings.
46
Figure 1.2 Pathways by which apoE and Aβ interact in the brain
Solid black arrows indicate normal secretion and lipidation of apoE by astrocytes. Solid blue
arrows indicate the aggregation cascade and potential clearance route for Aβ. Solid red arrows
indicate pathways or processes that apoE had been shown to influence. Dashed blue arrow
indicate a small pool of Aβ-apoE complexes. Dashed red arrow indicate apoE’s proposed effect
on Aβ production.
47
Chapter 2
Age-dependent effects of apoE reduction

using antisense oligonucleotides in a model of
β-amyloidosis
This chapter is adapted from a manuscript published in Neuron:
Huynh, T. V., Liao, F., Francis, C. M., Robinson, G. O., Serrano, J. R., Jiang, H., Roh, J., Finn,
M. B., Sullivan, P. M., Esparza, T. J., Stewart, F. R., Mahan, T. E., Ulrich, J. D., Cole, T.
& Holtzman, D. M. Age-Dependent Effects of apoE Reduction Using Antisense
Oligonucleotides in a Model of beta-amyloidosis. Neuron 96, 1013-1023 e1014,
doi:10.1016/j.neuron.2017.11.014 (2017).
T-P.V.H., J.D.U., and D.M.H. conceived and designed the project, and wrote the paper. T-
P.V.H., F.L., C.F., G.O.R., J.S., H.J., J.R., M.B.F., T.J.E., F.S., and T.E.M. executed the
experiments. T-P.V.H., F.L., J.D.U., and C.F. analyzed the data. P.M.S. provided the APOE-KI
mice. T.C. designed and provided the ASO. All authors read and commented on the manuscript.
48
2.1 Summary
The apolipoprotein E (APOE) gene is the strongest genetic risk factor for late-onset
Alzheimer disease. Previous studies suggest reduction of apoE levels through genetic manipulation
can reduce Aβ pathology. However, it is not clear how reduction of apoE levels after birth would
affect amyloid deposition. We utilize an antisense oligonucleotide (ASO) to reduce apoE
expression in the brains of APP/PS1-21 mice homozygous for human APOE-ε4 or APOE-ε3 allele.
ASO treatment starting after birth led to a significant decrease in Aβ pathology when assessed at
4 months of age. Interestingly, ASO treatment starting at the onset of amyloid deposition led to an
increase in Aβ plaque size and a reduction in plaque-associated neuritic dystrophy, despite no
change in overall plaque load. These results suggest that manipulation of apoE levels can strongly
affect the initiation of Aβ pathology in vivo, while modulating plaque size and toxicity during the
later stages of amyloid deposition.
49
2.2 Introduction
Alzheimer disease (AD) is a neurodegenerative disorder which clinically manifests as
memory loss, cognitive dysfunction, and eventual death. Two main proteins accumulate in the
brain in aggregated forms in AD, amyloid-β (Aβ) and tau. A significant amount of evidence
suggests that Aβ aggregation initiates and is necessary but not sufficient for AD. Tau accumulation
strongly correlates with clinical decline and neurodegeneration 8. Aβ accumulation in extracellular
amyloid plaques consists mostly of aggregated forms of Aβ. In the early 1990s, apolipoprotein E
(apoE) was found to co-localize with amyloid plaques 42,61, and the APOE gene was subsequently
6,51,52
identified as the strongest genetic risk factor for late-onset AD . The human APOE gene
contains two single-nucleotide polymorphisms (SNPs) that result in three most common variants:
ε2 (cys112, cys158), ε3 (cys112, arg158), and ε4 (arg112, arg158). Individuals with one copy of
the ε4 allele have a 3.7-fold increased risk, and those with two copies of ε4 have a 12-fold increased
risk of developing AD relative to the ε3/ε3 genotype 6,17,48. Multiple lines of evidence suggest that
one way by which apoE strongly influences AD pathology is via its effects on Aβ metabolism,
particularly aggregation and clearance. ApoE influences Aβ aggregation directly 38,50,60 as well as
10,13
impairing its clearance from the brain interstitial fluid in an isoform-dependent fashion .
Consistent with these in vitro and in vivo findings, studies in APP transgenic mice that are
hemizygous for either human APOE4 or APOE3 (APOE+/-) have significantly less fibrillar plaques
7,31
compared to homozygous littermates . These results show that genetically engineered, germ-
line reduction of apoE levels decreases Aβ pathology. For both mechanistic and therapeutic
implications, we were interested in knowing whether lowering apoE before and after the onset of
Aβ pathology would have beneficial effects on Aβ deposition. To this end, we utilized an anti-
sense oligonucleotide (ASO) that specifically and effectively lowers apoE expression by more than
50
50% in the brains of APP/PS1-21 mice that are homozygous for either the human ε4 or ε3 allele
starting after birth. When ASO treatment was started just after birth, we observed a significant
reduction in Aβ plaque pathology at 16 weeks of age for mice carrying either apoE isotypes.
Interestingly, while significant changes in plaque size were detected when the treatment was
initiated at 6 weeks of age and assessed at 16 weeks, there was no significant effect on overall Aβ
levels in the brain of either cohort. Together, our data suggest that apoE level plays a critical role
in the early stages of plaque formation but the effects are much more limited in the presence of Aβ
pathology.
2.3 Results
Treatment with ASO effectively reduces APOE expression in vivo.
To assess the efficacy of the anti-apoE ASO (hereon referred to as ‘ASO’), and determine
the optimal dose for in vivo studies, APOE3/3 and APOE4/4-knock-in (KI) mice were subjected
to a number of different treatment strategies (with varying doses and treatment durations) to ensure
sufficient efficacy (Figure 2.1A). To control for any potential toxicity of the ASO, additional
cohorts of mice were treated with PBS. To test for ASO efficacy in post-natal pups, APOE4/4
mice were treated with ASO or PBS at P0 through unilateral ICV injections. We first tested ASO
efficacy in adult animals, where 3-month-old APOE3/3 and APOE4/4-KI mice were treated with
either ASO, PBS, or control ASO (cASO), which has the same length and chemical modifications
as the anti-apoE ASO, but is not specific for any known sequence in mouse. To test for efficacy
and determine the optimal dose, 10l of ASO dissolved in PBS was injected unilaterally into the
right lateral ventricle of adult animals at a concentration of either 35 or 50 µg/µl (for a total bolus
of 350 g or 500 g, respectively). Following a 2-week treatment period, apoE mRNA and protein
expression in the hippocampus and cortex were assessed. In the ipsilateral cortex of ASO-treated
51
brains, apoE mRNA and protein levels were reduced by at least 50% relative to either the PBS- or
cASO-treated brains when assessed through qPCR (Figure 2.1C) and ELISA (Figure 2.1D)
analyses. The reduction of apoE levels was also evident by Western blot analysis of the brain
lysates (Figure 2.1E). Similar knock-down of apoE was also seen in the contralateral hippocampus
(Figure 2.5D and 2.5E) and cortex (data not shown). Since the ASO can target both apoE4 and
apoE3, its efficacy was also tested in APOE3/3 knock-in mice and showed similar results (Figure
2.5F-H).
To test for ASO efficacy in newborn pups, the optimal dosage used in the adult mice (350
µg) was adjusted for post-natal day 0 (P0) pups relative to weight (mg/kg). A total of 4 µl of either
PBS or ASO dissolved in PBS was injected unilaterally intracerebroventricularly (ICV) into P0
pups at a concentration of 8 µg/µl (total bolus of 32 µg). cASO was not included in the P0-treated
cohort due to lack of any noticeable toxicity or modulation of apoE levels in the adult cohort.
Following treatment, apoE levels in PBS-soluble brain lysates from the ipsilateral cortex were
analyzed at 1 month (Figure 2.5B) and 2 months (Figure 2.1B) and were found to be significantly
reduced. A significant reduction of PBS-soluble apoE was also observed in the contralateral cortex
at 2 months (Figure 2.5C) following a single injection at P0. In all measures, we observed a ~40-
50% reduction of apoE in the ASO-treated group relative to the control (PBS-treated) group.
To create a mouse model that allows us to assess the effect of lowering apoE on
amyloidosis, we crossed APP/PS1-21 mice with either APOE4/4 or APOE3/3-KI mice to obtain
APP transgenic mice on an APOE4/4 or APOE3/3 background (APP/PS1-21/ε4 and APP/PS1-
21/ε3 mice, respectively). Previous studies found this strain to have visible neocortical plaque
31,46
deposits beginning around 2 months of age . To investigate whether the timing of apoE
52
reduction affected the outcome, the ASO treatment was initiated at two distinct developmental
time points: post-natal day (P) 0 and 6 weeks of age, which is about the time of detectable onset
of plaques in the neocortex. To maintain sufficient knockdown of apoE levels during the treatment
period, a booster dose was given at the half-way point of the treatment duration for both cohorts
(Figure 2.1F).
For the 6-week cohort, based on efficacy and tolerability results from ASO treatment of
adult animals, 10l of ASO dissolved in PBS was injected unilaterally into the right lateral
ventricle of adult animals at a concentration of 35 µg/µl for a total bolus of 350 g. For controls,
independent cohorts of mice were injected with PBS and cASO. ELISA analysis of PBS-soluble
brain lysates from the contralateral cortex of APP/PS1-21/ε4 mice showed the ASO-treated group
to have a significant reduction (at least 50%) relative to either control groups when assessed at the
end of the treatment period (16 weeks of age) (Figure 2.1I). ASO treatment of APP/PS1-21/ε3
mice starting at 6 weeks of age yielded similar levels of reduction of apoE in PBS-soluble fraction
of brain lysates when assessed at 4 months of age (Figure 2.5K).
For the P0 cohort, a 32 µg bolus of ASO (dissolved in PBS at 8 µg/µl) or PBS (at equivalent
volume) was injected ICV into the right hemisphere of APP/PS1-21/ε4 or APP/PS1-21/ε3 pups at
P0. Since a control ASO did not modulate apoE levels in the 6-week animals, we did not include
a cASO group in this cohort. A booster dose of 35 µg ASO or PBS was given at 8 weeks of age
(Figure 2.1F). At the end of the treatment period (4 months of age), significant reduction of PBS-
soluble apoE was observed in the contralateral cortex in both APP/PS1-21/ε4 (Figure 2.1G) and
APP/PS1-21/ε3 mice (Figure 2.5I).
53
From these results, ASO treatment effectively reduced apoE protein levels by ~40 – 50%
for the entirety of the treatment duration for both P0 and 6-week cohorts. There were no significant
changes in apoE level in the guanidine-soluble brain lysates of 4-month-old APP/PS1-21/ε4 mice
that were treated at P0 (Figure 2.1H) or 6 weeks of age (Figure 2.1J). In 4-month-old APP/PS1-
21/ε3 mice, a small reduction of guanidine-soluble apoE was detected in the brain lysates of mice
that are treated with ASO starting at P0 (Figure 2.5J), but no significant change of guanidine-
soluble apoE was detected when treatment was started at 6 weeks of age (Figure 2.5L).
Although the majority of apoE in the brain is secreted by astrocytes, microglia also secrete
apoE 20,45. The observed reduction in apoE levels upon ASO treatment were likely to be driven by
34
astrocytic uptake of the ASOs, which has been described previously . However, microglial
uptake of ASOs is not as well-characterized. Thus, we set out to qualitatively examine whether
ASO uptake occurs in microglia and astrocytes. To accomplish this, we co-stained brain sections
from APP/PS1-21/ε4 mice that had been treated with either PBS or ASO with antibodies that target
the ASO backbone, apoE, as well as with microglial (IBA1) and astrocytic (GFAP) markers.
Representative co-stained sections suggest that ASOs are taken up by both microglia and
astrocytes (Figure 2.1K). Similarly, analyses on APP/PS1-21/ε3 brain sections also reveal both
microglial and astrocytic uptake of the ASOs (data not shown).
ASO treatment at P0 significantly reduces Aβ plaque pathology
We first examined the nature of the Aβ deposition in the P0-treated APP/PS1-21/ε4 mice
(Figure 2.2A) by performing histological staining with the X-34 dye and Aβ immunostaining. The
ASO-treated mice had a clear reduction in Aβ staining (Figure 2.2B). Quantitative analysis of the
% area covered by Aβ immunostaining in the cortex showed a significant reduction of ~50% in
54
the ASO-treated compared to the PBS-treated group (Figure 2.2C). We next quantified the area
covered by X-34 staining, which detects fibrillar plaques (Figure 2.2D), and found a significant
reduction of ~50% in the ASO-treated group compared to the PBS-treated group (Figure 2.2E). In
APP/PS1-21/ε3 mice that underwent similar experimental conditions (Figures 2.6B and 2.6D), a
significant reduction of X-34-positive plaques was detected in mice treated with ASO relative to
those treated with PBS (Figure 2.6E). Interestingly, no significant difference was observed when
Aβ-immunoreactive plaques were analyzed (Figure 2.6C).
To further assess the total amount of Aβ accumulation, we measured the amount of PBS-
soluble and PBS-insoluble (guanidine fraction) Aβ40 and Aβ42 in the cortex of P0-treated
APP/PS1-21/ε4 mice. In the PBS-soluble fraction, significant reductions of both Aβ40 and Aβ42
were observed in the ASO-treated group compared to the PBS-treated group (Figure 2.2F and
2.2H). To determine if there was any change in oligomeric Aβ levels, we subjected the same PBS-
soluble brain lysates to a well-described ELISA for Aβ oligomers 16. No significant difference was
detected between the two treatment groups in the APP/PS1-21/ε4 (Figure 2.2J) or the APP/PS1-
21/ε3 cohort (Figure 2.6J). We detected a significant decrease in insoluble Aβ40 in the ASO-treated
group relative to the PBS-treated group (Figure 2.2G). While not statistically significant, there was
a similarly strong trend towards a reduction of insoluble Aβ42 (Figure 2.2I). We performed similar
biochemical analyses with brain lysates from the contralateral cortex of P0-treated APP/PS1-21/ε3
mice. There were significant reductions of guanidine-soluble Aβ40 (Figure 2.6G) and Aβ42 (Figure
2.6I) in mice treated with ASO relative to those treated with PBS. No significant differences of
either Aβ40 (Figure 2.6F) or Aβ42 (Figure 2.6H) were detected in the PBS fraction.
55
We next investigated whether the ASO treatment at P0 alter the degree of neuritic
dystrophy on a per-plaque basis by co-staining brain sections from P0-treated APP/PS1-21/ε4 mice
19,29
with X-34 and LAMP1, a well-described marker of dystrophic neurites (Figure 2.2K) . The
volume of LAMP1-positive area within 15 µm of an X-34-positive plaque was quantified, and was
normalized to the volume of X-34 to adjust for any differences in plaque size. We found ASO-
treated mice had a significant reduction of dystrophic neurites/plaque compared to PBS-treated
mice, independent of plaque size or plaque load (Figure 2.2L).
To investigate the possibility that the reduction in Aβ pathology was due to altered
metabolism of APP or Aβ, we performed western blot analyses for APP and C99 (a C-terminal
fragment of APP that is generated upon cleavage of APP by β-secretase to generate Aβ). Using
antibodies 6E10 and 82E1 to detect APP and C99, respectively, we did not detect a difference in
the levels of these proteins in RIPA-soluble brain lysates from APP/PS1-21/ε4 mice treated with
PBS or ASO at P0 (Figure 2.6L). Similarly, ASO treatment at P0 did not result in altered APP or
C99 levels in RIPA-soluble brain lysates from APP/PS1-21/ε3 mice (Figure 2.6K). Thus, the
reduction in Aβ pathology upon ASO treatment likely results from alterations in other Aβ
metabolism such as clearance or aggregation that are directly or indirectly affected by apoE.
Reduction of apoE expression starting at 6 weeks of age did not significantly alter total Aβ
levels.
To assess the effect of decreasing apoE expression on Aβ accumulation in the cohort of
APP/PS1-21/ε4 mice that were treated with ASO starting at 6 weeks of age (Figure 2.3A), brain
sections from 4-month-old APP/PS1-21/ε4 mice were assessed for Aβ immunostaining (Figure
2.3B). Quantitative analyses of the area covered by Aβ staining showed a significant increase in
56
the ASO treatment group relative to both the cASO- and PBS-treated groups (Figure 2.3D). To
further characterize the nature of the deposited Aβ plaques, brain sections were stained with X-34
(Figure 2.3C). Interestingly, quantitative analyses of the area stained by X-34 showed no
statistically significant difference among the treatment groups (Figure 2.3E). In histological
analyses of brain sections from the cohort of APP/PS1-21/ε4 mice that were treated with ASO
starting at 6 weeks of age, there were also no significant differences between any treatment group
in the percentage of area stained with either an anti-Aβ antibody (Figure 2.7B and 2.7D) or X-34
dye (Figure 2.7C and 2.7E).
Next, we analyzed total Aβ levels biochemically in the ASO-treated mice and controls.
The cortices of 4-month-old APP/PS1-21/ε4 mice were subsequently homogenized in PBS and
5M guanidine and the amounts of Aβ40 and Aβ42 were measured in each fraction via ELISA. In
the guanidine-soluble fraction, there was a small (~20%) reduction in the Aβ40 level in the ASO-
treated mice compared to the PBS treated mice (Figure 2.3G). However, there was no significant
difference in Aβ42 levels between any treatment groups (Figure 2.3I). No dramatic differences in
Aβ40 or Aβ42 among any treatment groups were detected in the PBS fraction, although there was a
slight, albeit statistically significant increase in Aβ42 levels in ASO compared to PBS-treated
groups. (Figure 2.3F and 2.3H). Together, these results suggest that, while ASO treatment starting
at 6 weeks of age did not significantly lower the amount of total Aβ deposition, there are some
subtle changes within the different Aβ pools as well as in types of plaques. Similar biochemical
analyses of brain lysates from the cohort of APP/PS1-21/ε3 mice in which ASO treatment started
at 6 weeks of age revealed a significant reduction of guanidine-soluble Aβ40, but not Aβ42, in the
ASO-treated group compared to either control groups (Figure 2.7G and 2.7I, respectively). No
changes in Aβ40 (Figure 2.7F) or Aβ42 (Figure 2.7H) were observed in the PBS fraction.
57
To determine whether the ASO treatment altered the degree of neuritic dystrophy on a per-
plaque basis, we performed co-staining of brain sections from the 6-week-treated cohort of
APP/PS1-21/ε4 mice with X-34 and LAMP1 (Figure 2.3J). When the volume of LAMP1-positive
area within 15 µm of an X-34-positive plaque was quantified, and was normalized to the volume
of X-34, we found that the ASO-treated mice had a significant reduction of dystrophic neurites
compared to PBS-treated mice, despite a lack of overall effect on plaque load. (Figure 2.3K).
Most of the biologically active apoE exists in the brain in lipidated HDL-like particles and
alterations in the lipidation state of apoE have been shown to drastically affect Aβ accumulation
in some models of amyloidosis 22,23,33,58,59. Thus, we investigated whether ASO treatment altered
the lipidation state of apoE. To accomplish this, we collected CSF samples from APP/PS1-21/ε4
and APP/PS1-21/ε3 mice treated with either cASO, PBS, or ASO and performed a native gel
analysis for apoE lipidated particles, as described previously 55. Western blotting analysis of CSF
samples from APP/PS1-21/ε4 (Figure 2.7K) or APP/PS1-21/ε3 (Figure 2.7J) mice did not show a
significant shift in the size or distribution of the apoE particles among mice treated with ASO
versus either control groups.
ASO treatment alters plaque size distribution
To investigate the increase in Aβ deposition in the cohort of ASO-treated APP/PS1-21/ε4
mice in which treatment started at 6 weeks of age, we analyzed the size of the plaques and
compared this measure across the treatment cohorts (Figure 2.4A). This was accomplished by
grouping the individual plaques based on size in bins of 326 µm2 per increment, and the total area
covered by each “size-group” was plotted on the same graph to obtain an overall size distribution.
Three brain sections, 300 µm apart, from each animal are included in the analysis. We first
58
performed an analysis on the plaque size data obtained from anti-Aβ staining (Figure 2.4B and
2.4C). Statistical analysis using the Kolmogorov–Smirnov test detected a significant shift in the
size distribution of the plaques between the ASO-treated and control groups. Specifically, analysis
of the frequency of each size-group revealed an increase in the number of the larger (> 694 µm2)
plaques in the ASO-treated group relative to the control groups (Figure 2.4C, bottom panel).
Correspondingly, the total area covered by the larger plaques was also increased in the ASO-
treated group (Figure 2.4C, top panel). This increase in the amount of larger plaques was
accompanied by an increase in both plaque density and average plaque size in the ASO-treated
group compared to either control groups (Figure 2.4F and 2.4G, respectively). To investigate
whether this increase in plaque size is antibody-dependent, we performed immunohistological
studies on tissue sections from the same cohort with another anti-Aβ antibody, 82E1 (Figure 2.8B).
Quantification of histological sections found an increase in percent area coverage of Aβ-stained
plaques (Figure 2.8D), as well as the number of plaques that are larger than 694 µm2 (Figure 2.8C).
Further analysis of individual plaques suggested this shift to be driven by both an increase in plaque
density (Figure 2.8E) and average plaque size (Figure 2.8F).
Next, we performed similar analyses on the X-34-stained dataset from APP/PS1-21/ε4
brain sections (Figure 2.4D and 2.4E). Interestingly, while the Kolmogorov-Smirnov test did not
indicate a significant shift in cumulative distribution of plaque size in the X-34 staining, we
detected a significant decrease in plaque density in the ASO-treated groups relative to either the
control groups (Figure 2.4H), and no change in average plaque size was detected (Figure 2.4I). A
frequency analysis of each size-group for the X-34-positive plaques suggests the significant
decrease in plaque density might be due to a decrease in smaller (< 1020 µm2) plaques (Figure
2.4E, bottom panel). Interestingly, plaque size analysis on Aβ-immunostained sections from
59
APP/PS1-21/ε3 mice also yielded very similar findings. Specifically, a two-sample Kolmogorov-
Smirnov test was used to compare the frequency of cumulative distribution of HJ3.4-stained
plaque sizes between the treatment groups, and significant differences were found between the
cASO and ASO groups, as well as between the PBS and ASO groups, but not between the cASO
and PBS groups (Figure 2.8H). Further analysis suggested that this shift in plaque size distribution
was primarily driven by an increase in average plaque size (Figure 2.8K), but not plaque density
(Figure 2.8J). Similar two-sample Kolmogorov-Smirnov analyses performed on the X-34-stained
brain sections from the same cohort of APP/PS1-21/ε3 mice found a significant shift in plaque size
distribution between the ASO and PBS groups, but not between the ASO and cASO, or between
the cASO and PBS groups (Figure 2.8I). No changes in plaque density (Figure 2.8L) or average
plaque size (Figure 2.8M) were detected.
Altered microglial responses have been shown to be associated with changes in plaque load
31
or plaque properties 62. To probe for any changes in the microglial response as a result of apoE
reduction and/or the changes in plaque size in the 6-week cohort, we performed a series of
histological staining for well-established microglial markers. We first stained brain sections from
these mice with an anti-CD45 antibody, a marker of activated microglia. Plaque-associated
microglial activation was evident around Aβ deposits in APP/PS1-21/ε4 mice of all treatment
groups (Figure 2.4J). Quantitative analysis of the area positive for CD45 did not detect any
significant differences between treatment groups (Figure 2.4K). Similarly, no changes in CD45-
stained areas were detected in APP/PS1-21/ε3 mice (Figure 2.8N and 2.8O).
60
2.4 Discussion
Aβ accumulation in aggregated forms is amongst the earliest detectable pathologies in AD
and identifying methods to reduce the formation of Aβ aggregates has been the goal of extensive
preclinical and clinical studies. APOE isoforms differentially affect the formation of amyloid
pathology and germ-line deletion of Apoe expression strongly reduces the formation of amyloid
plaques in mouse models of Aβ pathology, suggesting that modulating apoE expression could be
a potential therapeutic target in AD. ApoE has been implicated in regulating Aβ clearance from
the ISF, Aβ generation, and Aβ aggregation. However, the mechanistic basis by which apoE
expression level influences amyloid formation remains poorly characterized. In this study, we
investigated whether reducing apoE levels in post-natal animals onward would similarly affect Aβ
burden in APP transgenic mice using an anti-apoE ASO. Using APP/PS1-21/ε4 and APP/PS1-
21/ε3 mice, which are aggressive models of β-amyloidosis, we observed that ASO treatment
starting after birth led to a significant reduction in Aβ accumulation when assessed through
biochemical and histological means, regardless of apoE isoform. However, when ASO treatment
was initiated at 6 weeks of age, when Aβ aggregation is just beginning in the brain, no major
change in amyloid plaque burden was detected. These results suggest that both apoE4 and apoE3
promote the initial nucleation of Aβ into plaques, but following initial nucleation, apoE does not
exert a strong effect on the subsequent growth of amyloid plaques. Consistent with previous
publications in mice 1,7,18,24, it is likely that apoE4 is more potent as a pro-amyloidogenic agent as
our data showed the total levels of Aβ accumulation in APP/PS1-21/ε4 brains to be consistently
higher than that of APP/PS1-21/ε3 brains in any comparable treatment groups. Strikingly, we
observed a marked decrease in neuritic dystrophy around the plaques in APP/PS1-21/ε4 mice
treated with ASO under either treatment paradigm, independent of plaque size or plaque load. This
61
suggests a general role of apoE4 in modulating the brain’s response to neurotoxic insults (such as
Aβ plaques), independent of its effects on Aβ metabolism.
In addition to the well-established isoform-dependent effect of APOE on AD risk 1,24,41,47,
an important question in the field is whether the ε4 allele represents a loss of protective function
or a gain of toxic function relative to the other isoforms in regard to the different effects it has on
AD pathology and other functions. Mouse models of Aβ deposition expressing only one copy of
human apoE have significantly less Aβ plaque deposition compared to mice expressing two copies
of the same apoE isoform (either APOE-ε3 or APOE-ε4) 7,31

. These results suggest that both
APOE-ε3 and APOE-ε4 promote Aβ plaque deposition, but the latter allele is much more potent,
and reduction of apoE3 and apoE4 throughout life can reduce Aβ pathology. The caveat of these
findings is that the animals carried the APOE gene and gene dosage differences since conception.
Thus, there could be developmental compensation in the genetic APOE haploinsufficiency model.
Additionally, it remained unknown when reduction of apoE during development and adult life can
affect Aβ deposition. In this study, our experimental approach includes initiation of treatment at
two distinct developmental timepoints, thus allowing us to assess whether the timing of treatment
significantly affects the outcome. From a therapeutic perspective, this latter point is especially
important to address in lieu of recent clinical observations that AD pathology occurs and
progresses decades prior to symptom onset 2,26,44.
The different outcomes between the P0 and 6-week treatment cohorts likely result from the
6-week delay in the initiation of treatment. This developmental window in these mice likely
corresponds to the period just prior to the “lag phase” in the in vitro Aβ aggregation model, where
27
monomers aggregate to form oligomers . Traditionally, the metastable nature of these putative
62
oligomeric species had made them very difficult to be detected and studied reliably 16
. Aβ
oligomers have been proposed to act as nuclei (or seeds) that facilitate rapid fibrillization in the
exponential “growth phase” 49

. It should be noted that, while no Aβ deposits can be detected in
these mice until ~2 months of age, it is likely that oligomeric Aβ has already formed in sufficient
amount to initiate fibril elongation by 6 weeks of age in this model 32. While our oligomeric Aβ
ELISA assays did not detect a significant difference upon P0 treatment of ASO versus PBS, our
measurements were made once there was substantial plaque burden. It is possible that oligomeric
Aβ levels were lowered prior to plaque deposition. Additional time course studies are needed to
conclusively determine whether early apoE reduction affects Aβ oligomer accumulation. We also
point out while all APP/PS1-21 mice treated with ASO or control were assessed at 16 weeks of
age, treatment started at some cohorts at P0 and some at 6 weeks of age. It is possible that 6 weeks
less exposure to ASO-treatment in the group treated later is in part responsible for the decreased
effect on Aβ. This seems unlikely given that the effects seen in the group treated later are clearly
present but they are affecting fibrillar vs. non-fibrillar plaque distribution as opposed to Aβ levels.
Longer treatment studies will be needed to definitively address this issue.
There are many potential mechanisms though which apoE can alter the early stages of
plaque growth. A substantial body of evidence supports a role for apoE in soluble Aβ clearance
10,13,28 56
, potentially through competition for the LDLR family of receptors . These effects could
account in part for reduced Aβ deposition occurring with lower apoE levels in the ASO treated
mice starting at P0. However, lowering apoE by ASO treatment after 6 weeks of age, once Aβ
seeds/nuclei have formed, did not have a significant effect. This suggests that once Aβ seeding
and nucleation take place, further growth of plaques is primarily driven by other factors and not
greatly influenced by the effect of human apoE on ISF Aβ concentration. This is consistent with
63
previous work showing the reduction of Aβ levels by reducing Aβ production is effective prior to
Aβ seeding but has little effect once seeding has taken place 12
. Concurrently, apoE might be
directly affecting the aggregation propensity of Aβ. This hypothesis is supported by previous
studies showing that all three isoforms of apoE can promote the fibrillization of Aβ in vitro 9,38,50,60.
The pro-amyloidogenic effects of apoE on Aβ aggregation were also seen in vivo, where
exogenous gene transfer of different human apoE isoforms using adeno-associated virus (AAV)
25,63
can potentiate and differentially affect the trajectory of plaque accumulation . However, it
remained unclear whether apoE exerts its effects in the nucleation phase or the growth phase of
plaque growth, or both. Our results suggest a critical role of apoE4 in the early stages of plaque
formation. Findings from Liu et al. (submitted) utilizing an inducible APOE-overexpression
system supports this latter hypothesis. Specifically, induction of APOE4 expression in the
background of APPSWE/PSE9 amyloidosis mice at birth, but not at 6 months of age, accelerates
the plaque deposition. Altogether, data from our study and those from Liu et al. suggest that apoE
plays a critical role in the initial formation of Aβ seeds in vivo, and possibly to a much less extent
during the growth period of amyloid plaques.
In addition to its effects on the early stages of plaque formation, our results from the 6-
week treatment cohort also suggest an effect of apoE on Aβ fibrillar plaques. The discordance
between the significant increase in area coved by Aβ immunostaining following ASO treatment of
APP/PS1-21/ε4 mice and the lack of change in total Aβ assessed biochemically prompted us to
look closer at the plaques. When stratified according to size per immunostained plaque, the ASO-
treated group had significantly more of the larger Aβ-immunostained but not the fibrillar X-34
stained plaques compared to either control groups. Interestingly, we also detected a significant
shift in plaque size distribution when analyzing Aβ-immunostained sections from APP/PS1-21/ε3
64
brains, despite observing no change in the overall area covered by plaques. Together, our two data
sets from two different APOE backgrounds further support findings in the apoE hemizygous
models, and reinforce the notion that both apoE3 and apoE4 promote the accumulation of Aβ
plaques, albeit with different potencies 7,31. However, there are noticeable differences between the
APP/PS1-21/ε4 and APP/PS1-21/ε3 cohorts. First, there is an increase in plaque density in the
ASO-treated 6-week APP/PS1-21/ε4 mice, but not in APP/PS1-21/ε3 undergoing the same
treatment. This suggests that apoE4 is somehow able to facilitate more seeding events (despite the
decreased level) relative to apoE3. It is also worth noting that we detect a reduction in X-34
positive plaques, but not Aβ-immunoreactive plaques in P0-treated APP/PS1-21/ε3 mice. This
notion correlates with our biochemical analyses where a reduction of Aβ was detected in the
guanidine fraction, but not the PBS fraction. This distinction from the results described in APOE
hemizygous mice might be explained by some unknown developmental compensation that occurs
prior to P0, or lack of ASO uptake by a cell population that plays a role in plaque metabolism.
Alternatively, this could result from an off-target effect of the ASO. Nevertheless, it is critical for
future experiments to fully dissect out the differences in characteristics and behaviors (if any) of
apoE3 versus apoE4, especially in how they modulate plaque formation.
We next examined whether the microglial response is altered in response to this change in
plaque morphology, since the innate immune system is believed to play a critical role in the brain’s
response to amyloid plaques 21. We found no overall change in the microgliosis marker CD45 in
either APP/PS1-21/ε4 or APP/PS1-21/ε3 mice treated at 6 weeks. While these results suggest that
the ASO treatment in the 6-week cohort did not change the microglial response to the plaques at a
global level, there could be an altered microglial response at the local level. Intriguingly, we
observed a decrease in neuritic dystrophy immediately around the plaques in both the P0 and 6-
65
week-treated cohorts, independent of plaque size and plaque load. These phenotypes raise the
possibility that reduction of apoE4 levels may somehow alter the innate immune response (i.e.
microgliosis) at the local level, resulting in decreased toxicity and subsequently decrease
dystrophic neurites. This hypothesis is backed by a growing body of literature suggesting that
30,35,36,39
apoE4 can modulate the innate immune response in the brain , and that apoE4-KI mice
have a greater pro-inflammatory phenotype relative to other isoforms 57.
In summary, we report an in vivo study on the effects of apoE-lowering ASO treatment in
APP/PS1-21/ε4 mice, an aggressive model of β-amyloidosis. Our results show that lowering apoE
starting at P0, but not 6 weeks of age, can significantly decrease Aβ deposition when assessed at
4 months of age. Decreasing apoE at later times did not affect the total Aβ load, but did increases
the size of the deposited Aβ species. More importantly, reduction of apoE4 at either time point led
to a significant reduction in dystrophic neurites, which could reflect a role of apoE in modulating
the brain’s response to plaques. These findings carry important implications for APOE-targeted
therapy, suggesting that treatment would need to start very early, prior to significant amyloidosis
in order to achieve a meaningful effect on plaque load and decrease at least this aspect of AD
pathology. Alternatively, future studies on the role of apoE in modulating neurotoxicity and the
immune system might open up therapeutic options bypassing the need to reduce plaque pathology.
In addition, our findings also open up possibilities for future studies to examine in more details the
effects of apoE on the early stages of plaque development and possibly identify new targets for
therapeutic intervention.
2.5 Experimental Procedures

Experimental Model and Subject Details
66
Generation of human APOE isoform mice with APPswe/PS1(L166P) mutant transgenes.
To determine the effect of human apoE3 and apoE4 levels on amyloid deposition, we used knock-
in mouse models in which the endogenous murine Apoe gene is replaced with either the APOE3
or APOE4 gene 54. APPPS1-21 mice overexpress a human APP cDNA with a Swedish mutation
(KM670/671NL) and mutant PS1 with the L166P mutation. Breeding pairs were obtained from
Dr. Mathias Jucker, University of Tübingen, Tübingen, Germany 46. To replace the murine Apoe
gene with human APOE isoforms, APPPS1-21 mice were bred with either APOE3/E3 or APOE4/4
knock-in mice. APPPS1-21/APOE4/Apoe mice and APOE4/Apoe mice from the first generation
were bred with each other to generate APPPS1-21/APOE4/4 and APOE4/4 mice. APPPS1-
21/APOE4/4 and APOE4/4 mice were then bred to generate more APPPS1-21/APOE4/4 mice.
Similar breeding schemes were followed to generate APPPS1-21/APOE3/3 mice All mice used in
this study were maintained on a C57BL/6J background. Mice were subjected to experiments at
either P0, 1.5 months, or 3 months of age, per the various experimental designs. Mice were
individually housed in AAALAC accredited facilities with temperature and humidity controls, and
were under a 12-hours light/dark cycle (lights on at 6:00 AM) cycle with free access to food and
water ad libitum throughout all phases of the experiments. All animal procedures were approved
by the Institutional Animal Care and Use Committee (IACUC) at Washington University, and
were in agreement with the Association for Assessment and Accreditation of Laboratory Animal
Care (AAALAC, WUSM).
Method Details
ASOs. The ASOs were designed and synthesized by Ionis Pharmaceuticals as described previously
11,40
and had the following modifications: 5 nucleotides on the 5′- and 3′-termini containing 2′-O-
14
methoxyethyl modifications and 10 unmodified central oligodeoxynucleotides to support
67
RNaseH activity. To improve nuclease resistance and promote cellular uptake, the ASOs had a
phosphorothioate backbone 3. ASOs were solubilized in sterile DPBS immediately before
injections. ASO sequences were as follow: anti-apoE ASO: GGTGAATCTTTATTAAAC;
Control ASO: CCTATAGGACTATCCAGGAA.
Surgical procedures and tissue collection. Bolus injections of ASO into adult mice were
performed as previously described 15. Specifically, for the 6-week cohort, 10 µl of ASO dissolved
in DPBS at 35 µg/µl was injected into the right lateral ventricle using a Hamilton syringe (model
#1701, Hamilton Company). The injection was done at a rate of 1 µl/second and the needle was
held in place for 5 minutes following completion of injection. The mice were allowed to
completely recover on a warming blanket and then returned to the home cage. The following
coordinates were used, relative to bregma: 0.3 mm rostral, 1 mm lateral (right), 2.5 mm ventral.
43
P0 injections were performed under a protocol adapted from Passini et al. . Briefly, cryo-
anesthetized pups were injected using a 1701N Neuros syringe (Hamilton Company) with 4 µl of
DPBS-dissolved ASO at 8 µg/µl or DPBS into the right lateral ventricle at a 90o angle. The
injection was done at a rate of 1 µl/second and the needle was held in place for 10 seconds
following completion of injection. The pups were allowed to completely recover on a warming
blanket and then returned to the home cage. The following coordinates were used, relative to
lambda: 1 mm rostral, 1 mm Lateral (right), 2 mm ventral. Upon perfusion with PBS containing
0.3% heparin, the right hemisphere was fixed overnight at 4oC in 4% paraformaldehyde, followed
by immersion into 30% sucrose solution for at least 24 hours. The left hemisphere was snap-frozen
with dry ice and stored at -80oC.
68
Histology. Following immersion in sucrose for at least 24 hours, serial coronal sections (50
μm thickness) were collected from frontal cortex to caudal hippocampus (right hemisphere) using
a freezing sliding microtome (ThermoFisher). Three hippocampal-containing sections (separated
by 300 μm) from the right hemisphere of each brain were stained with biotinylated HJ3.4 (anti-
Aβ1–13, mouse monoclonal antibody generated in-house) and 82E1 (IBL America # 10323) to
visualize Aβ immunopositive plaques, as described previously 4. Activated microglia were
immunostained using rat anti-CD45 (Bio-Rad / AbD Serotec # MCA138), followed by biotinylated
goat anti-rat IgG secondary antibody (Thermo Fisher Scientific PA1-84402). Quantitative analysis
of immunopositive staining was performed as described previously 5. Briefly, images of
immunostained sections were exported with NDP viewer (Hamamatsu Photonics). Using ImageJ
software, images were converted to 8-bit grayscale, thresholded to highlight Aβ-specific staining
and analyzed. For analyses of immunofluorescent staining (including LAMP1, GFAP, IBA1,
ASO, APOE, X-34, and Aβ), 20X images were acquired on Nikon A1Rsi Confocal Microscope.
Random windows containing clusters of plaques are captured, spanning approximately 30 µm of
tissue in the z-plane. The images were obtained with steps of 1.5 µm and were analyzed using
Imaris software (Bitplane). Briefly, surfaces were created separately for each of the fluorescent
channels, and the volume of the corresponding markers were quantified under the same threshold.
Each data point represents the average value from three separate tissue sections (300 µm apart)
from one single animal. All analyses were done blinded to treatment and genotype. Please see Key
Resources Table for specific antibody references.
Real-time qPCR analysis. RNA was extracted from frozen cortical tissue using Trizol (Life
Technologies # 15596026) and purified using the RNeasy mine kit (Qiagen # 71404). Reverse
transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Life
69
Technologies). Real-time qPCR was conducted with TaqMan primers (Life Technologies) and the
TaqMan Universal PCR Master Mix (Thermo Fisher Scientific # 4304437) using the StepOnePlus
machine (Applied Biosystems). Relative gene expression levels in ASO- and control-treated mice
were compared using the ΔΔCt method with Taqman probe for human apoE (Hs00171168_m1).
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA level was used as a reference
(Mm99999915_g1 Gapdh)
Sandwich ELISA. Brain cortices or hippocampi were sequentially homogenized with cold
PBS and then the PBS insoluble material with 5M guanidine buffer in the presence of 1X protease
inhibitor mixture (Roche). The levels of Aβx-40 and apoE were measured by sandwich ELISA. For
apoE ELISA, HJ15.6 and HJ15.4b 37 were used as capture and detection antibodies, respectively.
For Aβx-40 ELISA, HJ2 (anti-Aβ35–40) was used as a capture antibody and for Aβx-42 ELISA, HJ7.4
5,37
(anti-Aβ37–42) was used as a capture antibody. HJ5.1-biotin (anti-Aβ13–18) was used as the
detecting antibody for both Aβ ELISAs. ELISA assays for oligomeric Aβ were performed on fresh
PBS-soluble brain homogenates as described previously 16.
Western blot analysis. PBS-soluble brain lysates from the sequential homogenization step
were analyzed for total protein concentration with a micro BCA kit (Thermo Scientific). 30 µg of
proteins from each sample were loaded onto a NU-PAGE 4-12% Bis-Tris 15 well gel (Thermo
Fisher Scientific # NP0336BOX) and the gel was run at 150 V for 1.5 hours. The proteins were
subsequently dry-transferred onto a PVDF membrane using the ibot2 system (Life Technologies)
and blocked with 5% milk in TBS-T. The membrane was incubated with anti-apoE antibody
37
HJ15.7 and anti-β-tubulin antibodies to probe for apoE and a loading control, respectively.
Donkey Anti-mouse IgG-HRP was used as secondary antibody (Santa Cruz Biotechnology # sc-
70
2096). For assessment of APP and C99 levels, brains were homogenized in detergent-containing
buffer (RIPA) and the lysates were analyzed through SDS-PAGE and Western blotting using 6E10
and 82E1 antibodies, respectively. All blots were developed for ~10 seconds using an enhanced
chemiluminescence (ECL) Ultra kit (Lumigen TMA-6) and imaged on the SynGene Imager
(BioRad) at the appropriate exposure. Assessment of APOE particles in the CSF were performed
as described previously 55. Briefly, 2 µl of CSF were loaded onto a Novex WedgeWell 4 – 20%
Tris-Glycine gel (Life Technologies # XP04205BOX) and was run at 100 V for 24 hours at 4oC.
The proteins were subsequently transferred onto a nitrocellulose membrane using the Mini Gel
Tank and Mini Blot Module (ThermoFisher). The blot was blocked with 5% milk in TBS-T and
probed with the anti-apoE antibody HJ15.7.
Quantification and Statistical Analysis
Statistics. All values are reported as mean ± SEM. A Mann-Whitney U test was used to
assess significance between two groups. A one-way ANOVA was used to assess significance
between more than two groups, and Bonferroni’s post-hoc test was used to test for differences
between each of the groups. A two-sample Kolmogorov-Smirnov test was used to compare the
cumulative distribution of plaque sizes. All statistical analyses were performed using Prism
software (Graphpad). p < 0.05 is considered significant for all tests. No statistical analysis was
used to determine sample size a priori. The sample sizes chosen are based on those used in previous
studies from our laboratory. The number of samples indicates biological replicates as indicated in
each of the figure legends.
2.6 Acknowledgements
This work was supported by NIH grants R01AG047644 and R01NS034467 (D.M.H.), the
JPB Foundation (D.M.H.), the Gilliam fellowship from the Howard Hughes Medical Institute (T-
71
P.H.), and NIH MSTP grant T32 GM07200 (T-V.P.H). We would like to thank Dr. Guojun Bu for
communicating his findings, as well as comments and suggestions for our manuscript. We would
also like to thank Dr. Sarah Fritschi for assisting with the illustrations, and we are grateful for the
suggestions and support from all of our colleagues in the Holtzman laboratory.
72
2.7 References
M. & Paul, S. M. Human APOE isoform-dependent effects on brain beta-amyloid levels in
PDAPP transgenic mice. The Journal of neuroscience : the official journal of the Society
for Neuroscience 29, 6771-6779, doi:10.1523/JNEUROSCI.0887-09.2009 (2009).
2 Bateman, R. J., Xiong, C., Benzinger, T. L., Fagan, A. M., Goate, A., Fox, N. C., Marcus,
D. S., Cairns, N. J., Xie, X., Blazey, T. M., Holtzman, D. M., Santacruz, A., Buckles, V.,
Oliver, A., Moulder, K., Aisen, P. S., Ghetti, B., Klunk, W. E., McDade, E., Martins, R.
N., Masters, C. L., Mayeux, R., Ringman, J. M., Rossor, M. N., Schofield, P. R., Sperling,
R. A., Salloway, S., Morris, J. C. & Dominantly Inherited Alzheimer, N. Clinical and
biomarker changes in dominantly inherited Alzheimer's disease. The New England journal
of medicine 367, 795-804, doi:10.1056/NEJMoa1202753 (2012).
3 Bennett, C. F. & Swayze, E. E. RNA targeting therapeutics: molecular mechanisms of
antisense oligonucleotides as a therapeutic platform. Annual review of pharmacology and
toxicology 50, 259-293, doi:10.1146/annurev.pharmtox.010909.105654 (2010).
4 Bero, A. W., Bauer, A. Q., Stewart, F. R., White, B. R., Cirrito, J. R., Raichle, M. E.,
Culver, J. P. & Holtzman, D. M. Bidirectional relationship between functional connectivity
and amyloid-beta deposition in mouse brain. The Journal of neuroscience : the official
11.2012 (2012).
5 Bero, A. W., Yan, P., Roh, J. H., Cirrito, J. R., Stewart, F. R., Raichle, M. E., Lee, J. M. &
Holtzman, D. M. Neuronal activity regulates the regional vulnerability to amyloid-beta
deposition. Nature neuroscience 14, 750-756, doi:10.1038/nn.2801 (2011).
6 Bertram, L., McQueen, M. B., Mullin, K., Blacker, D. & Tanzi, R. E. Systematic meta-
analyses of Alzheimer disease genetic association studies: the AlzGene database. Nature
genetics 39, 17-23, doi:10.1038/ng1934 (2007).
12.2012 (2012).
8 Brier, M. R., Gordon, B., Friedrichsen, K., McCarthy, J., Stern, A., Christensen, J., Owen,
C., Aldea, P., Su, Y., Hassenstab, J., Cairns, N. J., Holtzman, D. M., Fagan, A. M., Morris,
J. C., Benzinger, T. L. & Ances, B. M. Tau and Abeta imaging, CSF measures, and
cognition in Alzheimer's disease. Science translational medicine 8, 338ra366,
doi:10.1126/scitranslmed.aaf2362 (2016).
9 Castano, E. M., Prelli, F., Wisniewski, T., Golabek, A., Kumar, R. A., Soto, C. &
Frangione, B. Fibrillogenesis in Alzheimer's disease of amyloid beta peptides and
apolipoprotein E. The Biochemical journal 306 ( Pt 2), 599-604 (1995).
73
11 Cheruvallath, Z. S., Kumar, R. K., Rentel, C., Cole, D. L. & Ravikumar, V. T. Solid phase
synthesis of phosphorothioate oligonucleotides utilizing diethyldithiocarbonate disulfide
(DDD) as an efficient sulfur transfer reagent. Nucleosides, nucleotides & nucleic acids 22,
461-468, doi:10.1081/NCN-120022050 (2003).
12 Das, P., Verbeeck, C., Minter, L., Chakrabarty, P., Felsenstein, K., Kukar, T., Maharvi, G.,
Fauq, A., Osborne, B. A. & Golde, T. E. Transient pharmacologic lowering of Abeta
production prior to deposition results in sustained reduction of amyloid plaque pathology.
13 Deane, R., Sagare, A., Hamm, K., Parisi, M., Lane, S., Finn, M. B., Holtzman, D. M. &
Zlokovic, B. V. apoE isoform-specific disruption of amyloid beta peptide clearance from
mouse brain. The Journal of clinical investigation 118, 4002-4013, doi:10.1172/JCI36663
(2008).
14 DeVos, S. L. & Miller, T. M. Antisense oligonucleotides: treating neurodegeneration at the
level of RNA. Neurotherapeutics : the journal of the American Society for Experimental
NeuroTherapeutics 10, 486-497, doi:10.1007/s13311-013-0194-5 (2013).
15 DeVos, S. L. & Miller, T. M. Direct intraventricular delivery of drugs to the rodent central
nervous system. Journal of visualized experiments : JoVE, e50326, doi:10.3791/50326
(2013).
16 Esparza, T. J., Wildburger, N. C., Jiang, H., Gangolli, M., Cairns, N. J., Bateman, R. J. &
Brody, D. L. Soluble Amyloid-beta Aggregates from Human Alzheimer's Disease Brains.
Scientific reports 6, 38187, doi:10.1038/srep38187 (2016).
17 Farrer, L. A., Cupples, L. A., Haines, J. L., Hyman, B., Kukull, W. A., Mayeux, R., Myers,
R. H., Pericak-Vance, M. A., Risch, N. & van Duijn, C. M. Effects of age, sex, and ethnicity
on the association between apolipoprotein E genotype and Alzheimer disease. A meta-
analysis. APOE and Alzheimer Disease Meta Analysis Consortium. Jama 278, 1349-1356
(1997).
19 Gowrishankar, S., Yuan, P., Wu, Y., Schrag, M., Paradise, S., Grutzendler, J., De Camilli,
P. & Ferguson, S. M. Massive accumulation of luminal protease-deficient axonal
lysosomes at Alzheimer's disease amyloid plaques. Proceedings of the National Academy
of Sciences of the United States of America 112, E3699-3708,
doi:10.1073/pnas.1510329112 (2015).
20 Grehan, S., Tse, E. & Taylor, J. M. Two distal downstream enhancers direct expression of
the human apolipoprotein E gene to astrocytes in the brain. The Journal of neuroscience :
the official journal of the Society for Neuroscience 21, 812-822 (2001).
21 Heneka, M. T., Golenbock, D. T. & Latz, E. Innate immunity in Alzheimer's disease.
Nature immunology 16, 229-236, doi:10.1038/ni.3102 (2015).
A., Parkinson, P. F., Chan, J. Y., Tansley, G. H., Hayden, M. R., Poirier, J., Van Nostrand,
W. & Wellington, C. L. The absence of ABCA1 decreases soluble ApoE levels but does
not diminish amyloid deposition in two murine models of Alzheimer disease. The Journal
of biological chemistry 280, 43243-43256, doi:10.1074/jbc.M508781200 (2005).
74
41197-41207, doi:10.1074/jbc.M407962200 (2004).
24 Holtzman, D. M., Bales, K. R., Tenkova, T., Fagan, A. M., Parsadanian, M., Sartorius, L.
J., Mackey, B., Olney, J., McKeel, D., Wozniak, D. & Paul, S. M. Apolipoprotein E
isoform-dependent amyloid deposition and neuritic degeneration in a mouse model of
of America 97, 2892-2897, doi:10.1073/pnas.050004797 (2000).
25 Hudry, E., Dashkoff, J., Roe, A. D., Takeda, S., Koffie, R. M., Hashimoto, T., Scheel, M.,
Spires-Jones, T., Arbel-Ornath, M., Betensky, R., Davidson, B. L. & Hyman, B. T. Gene
transfer of human Apoe isoforms results in differential modulation of amyloid deposition
and neurotoxicity in mouse brain. Science translational medicine 5, 212ra161,
26 Jack, C. R., Jr. & Holtzman, D. M. Biomarker modeling of Alzheimer's disease. Neuron
80, 1347-1358, doi:10.1016/j.neuron.2013.12.003 (2013).
28 Jiang, Q., Lee, C. Y., Mandrekar, S., Wilkinson, B., Cramer, P., Zelcer, N., Mann, K.,
Lamb, B., Willson, T. M., Collins, J. L., Richardson, J. C., Smith, J. D., Comery, T. A.,
Riddell, D., Holtzman, D. M., Tontonoz, P. & Landreth, G. E. ApoE promotes the
proteolytic degradation of Abeta. Neuron 58, 681-693, doi:10.1016/j.neuron.2008.04.010
(2008).
29 Kandalepas, P. C., Sadleir, K. R., Eimer, W. A., Zhao, J., Nicholson, D. A. & Vassar, R.
The Alzheimer's beta-secretase BACE1 localizes to normal presynaptic terminals and to
dystrophic presynaptic terminals surrounding amyloid plaques. Acta neuropathologica
126, 329-352, doi:10.1007/s00401-013-1152-3 (2013).
30 Keene, C. D., Cudaback, E., Li, X., Montine, K. S. & Montine, T. J. Apolipoprotein E
isoforms and regulation of the innate immune response in brain of patients with
Alzheimer's disease. Current opinion in neurobiology 21, 920-928,
doi:10.1016/j.conb.2011.08.002 (2011).
31 Kim, J., Jiang, H., Park, S., Eltorai, A. E., Stewart, F. R., Yoon, H., Basak, J. M., Finn, M.
B. & Holtzman, D. M. Haploinsufficiency of human APOE reduces amyloid deposition in
a mouse model of amyloid-beta amyloidosis. The Journal of neuroscience : the official
11.2011 (2011).
32 Klementieva, O., Willen, K., Martinsson, I., Israelsson, B., Engdahl, A., Cladera, J., Uvdal,
P. & Gouras, G. K. Pre-plaque conformational changes in Alzheimer's disease-linked
Abeta and APP. Nature communications 8, 14726, doi:10.1038/ncomms14726 (2017).
34 Kordasiewicz, H. B., Stanek, L. M., Wancewicz, E. V., Mazur, C., McAlonis, M. M., Pytel,
K. A., Artates, J. W., Weiss, A., Cheng, S. H., Shihabuddin, L. S., Hung, G., Bennett, C.
F. & Cleveland, D. W. Sustained therapeutic reversal of Huntington's disease by transient
75
repression of huntingtin synthesis. Neuron 74, 1031-1044,
doi:10.1016/j.neuron.2012.05.009 (2012).
35 Laskowitz, D. T., Lee, D. M., Schmechel, D. & Staats, H. F. Altered immune responses in
apolipoprotein E-deficient mice. Journal of lipid research 41, 613-620 (2000).
triggering receptor expressed on myeloid cells 2 (TREM2) expression after innate immune
activation of microglia. FASEB journal : official publication of the Federation of American
Societies for Experimental Biology 29, 1754-1762, doi:10.1096/fj.14-262683 (2015).
M. & Holtzman, D. M. Murine versus human apolipoprotein E4: differential facilitation of
and co-localization in cerebral amyloid angiopathy and amyloid plaques in APP transgenic
mouse models. Acta neuropathologica communications 3, 70, doi:10.1186/s40478-015-
0250-y (2015).
38 Ma, J., Yee, A., Brewer, H. B., Jr., Das, S. & Potter, H. Amyloid-associated proteins alpha
1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-protein into
filaments. Nature 372, 92-94, doi:10.1038/372092a0 (1994).
39 Maezawa, I., Maeda, N., Montine, T. J. & Montine, K. S. Apolipoprotein E-specific innate
immune response in astrocytes from targeted replacement mice. Journal of
neuroinflammation 3, 10, doi:10.1186/1742-2094-3-10 (2006).
40 McKay, R. A., Miraglia, L. J., Cummins, L. L., Owens, S. R., Sasmor, H. & Dean, N. M.
Characterization of a potent and specific class of antisense oligonucleotide inhibitor of
human protein kinase C-alpha expression. The Journal of biological chemistry 274, 1715-
1722 (1999).
Mintun, M. A. APOE predicts amyloid-beta but not tau Alzheimer pathology in cognitively
normal aging. Annals of neurology 67, 122-131, doi:10.1002/ana.21843 (2010).
166 (1991).
43 Passini, M. A. & Wolfe, J. H. Widespread gene delivery and structure-specific patterns of
expression in the brain after intraventricular injections of neonatal mice with an adeno-
associated virus vector. Journal of virology 75, 12382-12392,
doi:10.1128/JVI.75.24.12382-12392.2001 (2001).
44 Perrin, R. J., Fagan, A. M. & Holtzman, D. M. Multimodal techniques for diagnosis and
prognosis of Alzheimer's disease. Nature 461, 916-922, doi:10.1038/nature08538 (2009).
biophysica acta 917, 148-161 (1987).
46 Radde, R., Bolmont, T., Kaeser, S. A., Coomaraswamy, J., Lindau, D., Stoltze, L.,
Calhoun, M. E., Jaggi, F., Wolburg, H., Gengler, S., Haass, C., Ghetti, B., Czech, C.,
Holscher, C., Mathews, P. M. & Jucker, M. Abeta42-driven cerebral amyloidosis in
transgenic mice reveals early and robust pathology. EMBO reports 7, 940-946,
doi:10.1038/sj.embor.7400784 (2006).
76
J., Reeder, S. A., Langbaum, J. B., Alexander, G. E., Klunk, W. E., Mathis, C. A., Price, J.
C., Aizenstein, H. J., DeKosky, S. T. & Caselli, R. J. Fibrillar amyloid-beta burden in
doi:10.1073/pnas.0900345106 (2009).
48 Roses, A. D. Apolipoprotein E affects the rate of Alzheimer disease expression: beta-
amyloid burden is a secondary consequence dependent on APOE genotype and duration of
disease. Journal of neuropathology and experimental neurology 53, 429-437 (1994).
doi:10.1074/jbc.R800036200 (2009).
51 Schmechel, D. E., Saunders, A. M., Strittmatter, W. J., Crain, B. J., Hulette, C. M., Joo, S.
H., Pericak-Vance, M. A., Goldgaber, D. & Roses, A. D. Increased amyloid beta-peptide
deposition in cerebral cortex as a consequence of apolipoprotein E genotype in late-onset
of America 90, 9649-9653 (1993).
52 Strittmatter, W. J., Saunders, A. M., Schmechel, D., Pericak-Vance, M., Enghild, J.,
Salvesen, G. S. & Roses, A. D. Apolipoprotein E: high-avidity binding to beta-amyloid
and increased frequency of type 4 allele in late-onset familial Alzheimer disease.
1981 (1993).
53 Sullivan, P. M., Mezdour, H., Aratani, Y., Knouff, C., Najib, J., Reddick, R. L., Quarfordt,
S. H. & Maeda, N. Targeted replacement of the mouse apolipoprotein E gene with the
common human APOE3 allele enhances diet-induced hypercholesterolemia and
54 Ulrich, J. D., Burchett, J. M., Restivo, J. L., Schuler, D. R., Verghese, P. B., Mahan, T. E.,
Landreth, G. E., Castellano, J. M., Jiang, H., Cirrito, J. R. & Holtzman, D. M. In vivo
doi:10.1073/pnas.1220484110 (2013).
56 Vitek, M. P., Brown, C. M. & Colton, C. A. APOE genotype-specific differences in the
innate immune response. Neurobiology of aging 30, 1350-1360,
77
43242, doi:10.1074/jbc.M508780200 (2005).
doi:10.1172/JCI33622 (2008).
pathology 145, 1030-1035 (1994).
61 Yuan, P., Condello, C., Keene, C. D., Wang, Y., Bird, T. D., Paul, S. M., Luo, W., Colonna,
M., Baddeley, D. & Grutzendler, J. TREM2 Haplodeficiency in Mice and Humans Impairs
the Microglia Barrier Function Leading to Decreased Amyloid Compaction and Severe
Axonal Dystrophy. Neuron 92, 252-264, doi:10.1016/j.neuron.2016.09.016 (2016).
62 Zhao, L., Gottesdiener, A. J., Parmar, M., Li, M., Kaminsky, S. M., Chiuchiolo, M. J.,
Sondhi, D., Sullivan, P. M., Holtzman, D. M., Crystal, R. G. & Paul, S. M. Intracerebral
adeno-associated virus gene delivery of apolipoprotein E2 markedly reduces brain amyloid
pathology in Alzheimer's disease mouse models. Neurobiology of aging 44, 159-172,
78
79
Figure 2.1 ASO Treatment reduces apoE mRNA and protein levels in
APP/PS1-21/ε4 mice
A, Timeline of various experimental approaches to test for efficacy and optimal dosing of the
ASO. B, APOE4/4 mice were treated with a single bolus of ASO or PBS at P0, and the PBS-
soluble apoE levels in the ipsilateral cortex were assessed at 8 weeks of age (n = 7 – 8 per group,
p = 0.0003). C, APOE4/4 mice were treated with cASO, PBS or ASOs at 3 – 4 months of age (n
= 5 per group) and apoE mRNA level was analyzed 2 weeks later. ASO treatment effectively
lowered apoE mRNA level by more than 50% in the ipsilateral posterior cortex (p = 0.0002, F =
18.56). D, PBS-soluble apoE levels were measured in brain lysates from the same cohort of mice
(p < 0.0001, F = 22.38). E, Western blot for apoE from the same cohort of mice using anti-apoE
antibody HJ15.7. F, Experimental timeline: separate cohorts of APP/PS1-21/ε4 and APP/PS1-
21/ε3 mice were given a bolus of ASO ICV into the right hemisphere starting at P0 or into the
right lateral ventricle starting 6 weeks of age, and the brains were harvested for analysis at 16
weeks of age. A booster dose was given at either 8 weeks (P0 cohort) or 11 weeks (6-week
cohort). G, APP/PS1-21/ε4 mice were unilaterally injected with a bolus of either ASO or PBS at
P0, a booster bolus at 2 months of age, and the PBS-soluble apoE levels in the contralateral
cortex were assessed at 4 months of age (n = 9 – 12 per group, p = 0.0129). H, Guanidine-
soluble apoE levels in the contralateral cortex were assessed from the same cohort of mice. (n =
11 – 12 per group, p = 0.2844). I, Following a 10-week treatment with either ASO or controls
starting at 6 weeks of age, the apoE protein levels in the contralateral cortex from 4-month old
APP/PS1-21/ε4 mice were measured via ELISA (n = 20 – 25 per group, p < 0.0001, F = 35.64).
J, ApoE protein levels were measured in the guanidine fraction from the same set of brain
homogenates (n = 20 – 25 per group, p = 0.4316, F = 0.8524). K, Immunofluorescent staining of
ASO- and PBS-treated brains from APP/PS1-21/ε4 mice. ASOs (Green) are taken up by both
astrocyte (blue) and microglia (red), as indicated by co-localization with GFAP and Iba1,
respectively. Scale bars = 500 µm, unless otherwise noted. *p < 0.05, **p < 0.01, ***p < 0.001,
****p < 0.0001. All values are reported as mean ± SEM. See also figure 2.5.
80
81
Figure 2.2 ASO treatment at P0 significantly reduces Aβ plaque pathology in
APP/PS1-21/ε4 mice
A, Experimental timeline for P0 cohort. B, Brain sections from 4-month-old APP/PS1-21/ε4

mice unilaterally injected with PBS or ASO starting at P0 were immunostained for Aβ with anti-
Aβ antibody and the extent of Aβ deposition was quantified from the ipsilateral cortex (C) (Scale
bar = 1mm). D, Brain sections from the same cohort of mice were stained with X-34 dye that
recognizes only fibrillar plaques and the fibrillar plaque load was quantified from the cortex (E)
(Scale bar = 1 mm). PBS-soluble Aβ40 (F) and Aβ42 levels (H) were measured from the
contralateral posterior cortex of 4-month-old APP/PS1-21/ε4 mice following treatment with
ASO or controls starting at P0 and a booster dose at 2 months of age (p = 0.0373 and 0.0129,
respectively). Guanidine-soluble Aβ40 (G) and Aβ42 levels (I) were measured from the same
cohort of mice (n = 9 – 10 per group, p = 0.0188 and 0.0903, respectively). J, PBS-soluble
oligomeric Aβ levels were measured from the same brain lysates. K, Representative images of
brain sections from P0-treated APP/PS1-21/ε4 mice co-stained with X-34 and LAMP1. Scale
bars = 100 µm. Inset: 60X magnification view of two plaques of similar sizes (one from each
treatment group). Scale bars = 25 µm. L, The volume of LAMP1 staining within 15 µm of an X-
34 positive plaque was quantified (n = 10 – 13 per group, p = 0.0196,). *p < 0.05. All values are
reported as mean ± SEM. See also figure 2.6.
82
83
Figure 2.3 Reduction of apoE expression starting at 6 weeks of age did not
significantly alter total Aβ levels in APP/PS1-21/ε4 mice
A, Experimental timeline for 6-week cohort of APP/PS1-21/ε4 mice. B, Brain sections from
APP/PS1-21/ε4 mice were immunostained with an anti-Aβ antibody and the extent of Aβ
deposition was quantified from the ipsilateral cortex (D) (p = 0.0002, F = 10.21). C. Brain
sections from the same cohort of mice were stained with X-34 dye that recognizes only fibrillar
plaques and the fibrillar plaque load was quantified from the ipsilateral cortex (E) (p = 0.2095, F
= 1.604). Scale bars = 1 mm. PBS-soluble Aβ40 (F) and Aβ42 levels (H) were measured in the
contralateral posterior cortex from 4-month-old APP/PS1-21/ε4 mice following 10-weeks
treatment (started at 6 weeks of age) with ASO or controls (p = 0.4673, F = 0.7711 and p =
0.0171, F = 4.379, respectively). Guanidine-soluble Aβ40 (G) and Aβ42 levels (I) in the
contralateral posterior cortex were measured from the same cohort of mice (p = 0.0326, F =
3.635 and p = 0.2568, F = 1.391, respectively). N = 20 – 25 per group. J, Representative images
of brain sections from P0-treated APP/PS1-21/ε4 mice co-stained with X-34 and LAMP1. Scale
bars = 100 µm. Inset: 60X magnification view of two plaques of similar sizes (one from each
treatment group). K, The volume of LAMP1 staining within 15 µm of an X-34 positive plaque
was quantified (n = 13 per group, p = 0.0019,). *p < 0.05, ****p < 0.0001. Scale bars = 100 µm.
All values are reported as mean ± SEM. See also figure 2.7.
84
85
Figure 2.4 ASO treatment alters plaque size distribution in APP/PS1-21/ε4
mice
A, Experimental timeline for 6-week cohort. B, Brain sections from APP/PS1-21/ε4 mice treated
with either ASO or cASO stained with anti-Aβ antibody HJ3.4 are shown (Scale bars = 500 µm).
Due to space constraints, only the representative images of cASO and ASO were shown. There
was no statistical significance between the PBS and cASO treatment groups. C, Analysis of the
plaque distribution was done by stratifying total plaque coverage based on size, and either the
total area covered by plaques of each group (top panel) or the frequency of occurrence (bottom
panel) was plotted on the Y-axis. Three brain sections, 300 µm apart, from each mouse are
included in the analysis, and only plaques larger than 694 µm2 are shown in bottom panel for
clarity. A two-sample Kolmogorov-Smirnov test was used to compare the cumulative
distribution of plaque sizes between the groups, and significant differences were found between
cASO and ASO groups (p = 1.39888E-14), as well as between PBS and ASO groups (p =
3.08816E-07). D, Brain sections from the same cohort stained with X-34 were shown (Scale bars
= 500 µm). E, Analysis of the plaque size distribution based on X-34 staining was done using a
similar approach as in (C), and the total area covered by plaques of each group (top panel) or the
frequency of occurrence (bottom panel) was plotted on the Y-axis. No significant differences in
the cumulative distribution of plaques were detected between the groups by the Kolmogorov-
Smirnov test. The density of Aβ antibody-stained plaques (F) and average plaque size (G) was
analyzed in the same cohort of mice (n = 20 – 25 per group, p = 0.0144, F = 4.563 and p <
0.0001, F = 19.80, respectively). The density of X-34-stained plaques (H) and average plaque
size (I) was analyzed in the same cohort of mice (n = 20 – 25 per group, p = 0.0173, F = 4.351
and p = 0.5839, F = 0.5429, respectively). J, Brain sections from 4-month-old APP/PS1-21/ε4
mice were immunostained with an antibody against activated microglial CD45 (Scale bars = 1
mm). K, The percentage of area covered by CD45 staining was quantified from the cortex of
APP/PS1-21/ε4 mice (n = 20 – 25 per group, p = 0.1764, F = 1.793). All values are reported as
mean ± SEM. See also figure 2.8.
86
Figure 2.5 Related to Figure 2.1. ASO Treatment effectively reduces
expression of apoE3 and apoE4 in mice
A, Timeline of various experimental approaches to test for efficacy and optimal dosing of the ASO.
B, APOE4/4 mice were given a single bolus of ASO or PBS at P0 through ICV injection ICV into
the right hemisphere, and the PBS-soluble apoE levels in the ipsilateral cortex were assessed at
one month of age. (n = 6 – 8 per group, p = 0.0004). C, A separate cohort of APOE4/4 mice were
unilaterally injected with a single bolus of either ASO or PBS at P0, and the apoE levels in the
contralateral cortex were assessed at 2 months of age through an ELISA. (n = 10 per group, p =
0.0354). D, PBS, cASO, or ASOs were injected into the right lateral ventricle of ε4/ε4 mice mice
at 3 – 4 months of age (n = 5 per group) and PBS-soluble apoE levels were measured in brain
lysates from the contralateral hippocampus 2 weeks later. (p = 0.0049, F = 8.963). E, Western blot
analysis of apoE from the same cohort of mice. F, 10 µl of PBS or ASOs at two different
concentrations (15 or 50 µg/µl) were injected into the right lateral ventricle of APOE3/3 mice at 3
– 4 months of age (n = 5 per group) and apoE mRNA level in the ipsilateral posterior cortex was
analyzed 2 weeks later. ASO treatment effectively lowered apoE mRNA level in the PBS fraction
by more than 50% in the ipsilateral posterior cortex (n = 5 per group, p = 0.0159). G, PBS-soluble
ApoE levels were measured using brain lysates from the same region (p = 0.0079). H, Western
blot analysis of apoE in the PBS fraction from the ipsilateral posterior cortex brain lysates using
anti-apoE antibody HJ15.7. I, A cohort of APP/PS1-21/ε3 mice were unilaterally injected with a
bolus of either ASO or PBS at P0, a booster bolus at 2 months of age, and the apoE levels in the
ipsilateral cortex were assessed at 4 months of age (n = 7 – 17 per group, p < 0.0001). J, ApoE
87
levels in the guanidine fraction was measured from the same cohort (p = 0.0004). K, A separate
cohort of APP/PS1-21/ε3 mice were unilaterally injected with a bolus of either cASO, PBS, or
ASO starting at 6 weeks of age, a booster bolus at 11 weeks of age, and the apoE levels in the PBS
fraction from the contralateral cortex brain lysates were assessed at 4 months of age (n = 20 – 25
per group, p < 0.0001, F = 52.43). L, ApoE levels in the guanidine fraction were measured from
the same cohort (p = 0.2099, F = 0.600). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All
values are reported as mean ± SEM
88
89
Figure 2.6 Related to Figure 2.2. ASO treatment at P0 significantly reduces
insoluble Aβ in APP/PS1-21/ε3 mice
A, Experimental timeline for P0 cohort of APP/PS1-21/ε3 mice. B, Brain sections from 4-month-
old APP/PS1-21/ε3 mice unilaterally injected with PBS or ASO starting at P0 were immunostained
for Aβ with anti-Aβ antibody and the extent of Aβ deposition was quantified from the ipsilateral
cortex (C) (Scale bar = 1mm). D, Brain sections from the same cohort of mice were stained with
X-34 dye that recognizes only fibrillar plaques and the fibrillar plaque load was quantified from
the cortex (E) (Scale bar = 1 mm). PBS-soluble Aβ40 (F) and Aβ42 levels (H) from the
contralateral posterior cortex were measured from the brains of 4- month-old APP/PS1-21/ε3 mice
following unilateral treatment with ASO or controls starting at P0 and a booster dose at 2 months
of age (p = 0.4722 and 0.3191, respectively). Guanidine-soluble Aβ40 (G) and Aβ42 levels (I)
were measured from the same cohort of mice (p = 0.0195 and 0.0106, respectively). n = 9 – 10 per
group. J, PBS-soluble oligomeric Aβ levels were measured from the same brain lysates. K,
Western blot analysis of APP, C99, and apoE from PBS-soluble brain homogenates of P0-treated
APP/PS1-21/ε3 mice, α-actin was used as a loading control. L, Similar analyses were done on
APP/PS1-21/ε4 mice. *p < 0.05. All values are reported as mean ± SEM.
90
91
Figure 2.7 Related to Figure 2.3. Reduction of apoE expression starting at 6
weeks of age did not significantly alter total Aβ levels in APP/PS1-21/ε3 mice
A, Experimental timeline for 6-week cohort of APP/PS1-21/ε3 mice. PBS, cASO, or ASOs were
injected into the right lateral ventricle of APP/PS1-21/ε3 mice starting at 6 weeks of age, and the
brains were harvested at 4 months of age. Brain sections were immunostained with an anti-Aβ
antibody (B), and the extent of Aβ deposition was quantified from the ipsilateral cortex (D) (p =
0.7417, F = 0.3003). C. Brain sections from the same cohort of mice were stained with X-34 dye
that recognizes only fibrillar plaques and the fibrillar plaque load was quantified from the cortex
(E) (p = 0.4559, F = 0.7955). PBS-soluble Aβ40 (F) and Aβ42 levels (H) were measured from the
contralateral posterior cortex of the same cohort of mice (p = 0.0531, F = 3.070 and p = 0.1289, F
= 2.114, respectively). Guanidine-soluble Aβ40 (G) and Aβ42 levels (I) were measured from the
same cohort of mice (p = 0.0074, F = 5.297 and p = 0.2918, F = 1.255, respectively), n = 20 – 25
per group. J, Native gel analysis of CSF samples from APP/PS1-21/ε3 mice treated with either
cASO, PBS, or ASO. K, Similar analyses were done on CSF samples from APP/PS1-21/ε4 mice.
*p < 0.05. Scale bars = 1 mm. All values are reported as mean ± SEM.
92
93
Figure 2.8 Related to Figure 2.4. ASO treatment significantly alters plaque
distribution in APP/PS1-21/ε4 mice
A, Experimental timeline for 6-week cohort of APP/PS1-21/ε4 mice. B, Brain sections from
APP/PS1-21/ε4 mice treated with either PBS or ASO stained with anti-Aβ antibody 82E1 are
shown (Scale bars = 1 mm). C, Analysis of the plaque distribution was done by stratifying total
plaque coverage based on size, and the frequency of occurrence was plotted on the Y-axis. Three
brain sections, 300 µm apart, from each mouse are included in the analysis, and only plaques larger
than 694 µm2 are shown for clarity. The extent of Aβ deposition was quantified from the ipsilateral
cortex as percent coverage (D). The density of Aβ antibody-stained plaques (E) and average plaque
size (F) was analyzed in the same cohort of mice (n = 20 – 25 per group, p < 0.0001 and p <
0.0001, respectively). G, Experimental timeline for 6-week cohort of APP/PS1-21/ε3 mice. H,
Brain sections from APP/PS1-21/ε3 mice treated with either ASO or controls starting at 6 weeks
of age were stained with anti-Aβ antibody HJ3.4 and the plaque size distribution was analyzed by
stratifying the total plaque coverage based on individual plaque size. The frequency distribution
of only plaques larger than 694 µm2 are shown for clarity. Three sections, 300 µm apart, from each
mouse was included in the analysis. A two-sample Kolmogorov-Smirnov test was used to compare
the frequency of cumulative distribution of plaque sizes between the groups, and significant
differences were found between cASO and ASO groups (p = 1.0614E-10), as well as between PBS
and ASO groups (p = 2.1456E-05), but not between the cASO and PBS groups (p = 0.05507). I,
Analysis of the plaque size distribution was done on brain sections from the same cohort of mice
stained with X-34 dye using a similar approach as in (H). A two-sample Kolmogorov-Smirnov
test was used to compare the frequency of cumulative distribution of plaque sizes between the
groups, and a significant shift in plaque size distribution were found between the ASO and PBS
groups (p = 0.03457), but not between the ASO and cASO groups (p = 0.94044) or between the
cASO and PBS groups (p = 0.20289). The density of Aβ antibody-stained plaques (J) and average
plaque size (K) were analyzed in the same cohort of mice (n = 20 – 25 per group, p = 0.6544, F =
0.4269 and p < 0.0001, F = 11.55, respectively). The density of X-34-stained plaques (L) and
average plaque size (M) were analyzed in the same cohort of mice (n = 20 – 25 per group, p =
0.0866, F = 2.544 and p = 0.7580, F = 0.2783, respectively). N, Brain sections from the same
cohort of APP/PS1-21/ε3 mice were immunostained with an antibody against activated microglial
CD45 (Scale bars = 1 mm). Due to space constraints, only the representative images of cASO and
ASO treatment groups were shown. There was no statistical significance between the PBS and
cASO treatment groups. O, The percentage of areas covered by CD45 staining was quantified from
the ipsilateral cortex of APP/PS1-21/ε3 mice (n = 20 – 25 per group, p = 0.3777, F = 0.9912).**p
< 0.01, ***p < 0.001, ****p < 0.0001. All values are reported as mean ± SEM.
94
Table 2.1 Key resources
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Mouse monoclonal anti-Aβ Antibody HJ3.4 Reference [4] N/A
Mouse monoclonal anti-Aβ Antibody HJ5.1 Reference [5] N/A
Mouse monoclonal anti-Aβ1-40 Antibody Reference [5] N/A

HJ2
Mouse monoclonal anti-Aβ1-42 Antibody Reference [5] N/A

HJ7.4
Mouse monoclonal anti-apoE Antibody Reference [37] N/A

(HJ15.6)

(HJ15.7)

(HJ15.4)
Mouse monoclonal anti-Aβ (82E1) IBL-America IBL-America Cat#

Antibody 10323;
RRID:AB_10707424
Rat anti mouse CD45 Antibody Bio-Rad / AbD Cat# MCA1388

Serotec RRID:AB_321729
Goat anti-Rat IgG Secondary Antibody, Thermo Fisher Cat# PA1-84402

Biotin conjugate Scientific RRID:AB_931503
Rat monoclonal anti-LAMP1 Antibody Iowa Developmental DSHB # 1D4B

Studies Hybridoma
bank
Goat polyclonal anti-iba1 Antibody Abcam Abcam # ab5076
GFAP Monoclonal Antibody (GA5), Alexa Thermo Fisher Cat# 53-9892-82 also
Fluor 488, eBioscience(TM), Thermo Fisher Scientific 53-9892
Scientific RRID:AB_10598515
95
Rabbit polyclonal anti-pan-ASO Antibody Ionis Pharmaceuticals # 13545
Donkey Anti-Mouse Donkey anti-mouse Santa Cruz Cat# sc-2096

IgG-HRP Polyclonal, HRP Conjugated Biotechnology RRID:AB_641168
antibody
β-Tubulin (H-235) antibody Santa Cruz Cat# sc-9104

Biotechnology RRID:AB_2241191
Peroxidase-AffiniPure Goat Anti-Mouse Jackson Cat# 115-035-003

IgG (H + L) antibody ImmunoResearch RRID:AB_10015289
Labs
Peroxidase-AffiniPure Goat Anti-Rabbit Jackson Cat# 111-035-003

IgG (H+L) antibody ImmunoResearch RRID:AB_2313567
Labs
Rabbit Anti-Actin Antibody, Unconjugated Sigma-Aldrich Cat# A2066

RRID:AB_476693
Purified anti-β-Amyloid1-16 antibody, BioLegend Cat# 803001

RRID:AB_2564653
Mouse Anti-Human ApoE Monoclonal, Novus Biologicals Cat# NB110-60531R

Alexa Fluor 647 Conjugated, Clone WUE-4 RRID:AB_1850315
antibody
Goat anti-Rat IgG (H+L) Cross-Adsorbed Thermo Fisher Cat# A-11006 also
Secondary Antibody, Alexa Fluor 488 Scientific A11006
RRID:AB_2534074
Streptavidin, Alexa Fluor® 568 conjugate Thermo Fisher Cat# S-11226

antibody Scientific RRID:AB_2315774
Donkey Anti-Goat IgG (H+L) Antibody, Molecular Probes Cat# A-11057,

Alexa Fluor 568 Conjugated RRID:AB_142581
Donkey Anti-Rabbit IgG (H+L) Polyclonal Molecular Probes Cat# A-31573 also
Antibody, Alexa Fluor 647 Conjugated, A31573
RRID:AB_2536183
Chemicals, Peptides, and Recombinant Proteins
96
Trizol Life Technologies 15596026
Ethyl Alcohol Pharmco-Aaper 11100020S
Sucrose Sigma-Aldrich S0389
Albumin, Bovine Fraction V (BSA) RPI Research 9048-46-86

Products
International
X-34 dye Gift from Dr. Robert N/A

Mach (Reference53)
Critical Commercial Assays
Lumigen ECL Ultra (TMa-6) Thermo Fisher # NC024069

Scientific
Micro BCA Protein Assay Kit Thermo Fisher # 23235

Scientific
TaqMan™ Universal PCR Master Mix Thermo Fisher # 4304437

Scientific
High-Capacity RNA-to-cDNA™ Kit Thermo Fisher # 4387406

Scientific
RNeasy Mini Kit (50) Quiagen # 74104
Experimental Models: Organisms/Strains
B6.129P2-Apoetm3(APOE*4)Mae N8 Taconic 1549
B6.129P2-Apoetm2(APOE*3)Mae N8 Taconic 1548
B6-Tg(Thy1-APPswe; Thy1-PS1 L166P) Gift from Dr. Mathias MGI:3765351

Jucker (Reference46)
Oligonucleotides
97
Anti-apoE ASO sequence: Ionis N/A
Pharmaceuticals, Inc.
5’-GGTGAATCTTTATTAAAC-3’
Control ASO sequence: Ionis N/A

Pharmaceuticals, Inc.
5’-CCTATAGGACTATCCAGGAA-3’
Taqman probe for apoE Applied Biosystems Hs00171168_m1
Taqman probe for GAPDH Applied Biosystems Mm99999915_g1

Gapdh
Software and Algorithms
Prism Graphpad Software Version 6.01;

http://www.graphpad.co
m
Excel Microsoft https://products.office.co

m/en/excel
Imaris 8 & 9 Bitplane http://www.bitplane.com

/software/imaris
ImageJ NIH Version 1.48q/1.50 g;

https://imagej.nih.gov/ij/
98
Chapter 3:
Differential effects of human APOE isoforms

on Aβ amyloidogenic seeds
99
3.1 Summary
The pathological hallmarks of Alzheimer disease (AD) are amyloid plaques, which are cerebral
aggregates consisting of fibrils of the amyloid β-protein (Aβ), and filamentous lesions of the
microtubule-associated protein tau known as neurofibrillary tangles. In the early 1990s, the
apolipoprotein E (apoE) was found to co-localize with amyloid plaques. The ε4 allele of the APOE
gene was sequentially identified as the strongest genetic risk factor for AD. Since then, multiple
lines of evidence suggest that the major mechanism by which apoE influences AD pathology is
via its effects on Aβ metabolism, particularly aggregation and clearance. The aggregation of Aβ
into higher-order species is nucleation-dependent, where the initial formation of amyloidogenic
seeds is required to facilitate further addition of monomers. Our previous work suggests apoE to
affect the earliest stages of plaque formation (the nucleation phase). Here we describe an isoform-
dependent effect of apoE on this process, particularly the formation and/or property of the Aβ
seeds.
We analyzed the seeding patterns in two different models of amyloidosis (APP23 and APP
NLF-KI) that had been inoculated with murine brain extracts (containing Aβ seeds) isolated from
aged donor brains with different human apoE backgrounds (APPE2, APPE3, and APPE4). In
APP23 hosts, APP/PS1 brain extracts from different APOE backgrounds produce plaques with
increasing compactness and fibril content in the order of ε2 < ε3 < ε4. APP NLF-KI hosts yield
differential seeding patterns that are driven by the donor APP strain, but not by APOE genotypes.
These results suggest that human APOE isoforms differentially affect the properties of Aβ seeds
in certain host environments, thus creating different strains of Aβ with distinct structural features
and seeding capabilities. This isoform-dependent effect of apoE on Aβ may contribute to the
overall AD risk associated with the different APOE alleles.
100
3.2 Introduction
Since the initial identification of the apolipoprotein E (apoE) as a component of cerebral
amyloid plaques in 1993, the ε4 allele of APOE have emerged as the most significant genetic risk
factor for the development of late-onset Alzheimer disease (AD). Despite intense research efforts
over the past 25 years, it is still not completely clear how APOE confers this elevated risk for AD.
Studies that looked at post-mortem AD patient brains found a strong correlation between APOE
status and cerebral amyloid plaque load. These findings suggests a modulatory effect of APOE on
the accumulation amyloid-β (Aβ) peptide, the principal component of these plaques. Indeed,
human APOE isoforms was found to differentially regulate the clearance of soluble Aβ from the
interstitial space (ISF) in vivo 8. Interestingly, this difference is isoform-dependent, and follows
the same order corresponding to their respective risk for developing AD (ε4>ε3>ε2, where ε4
impedes the clearance of soluble Aβ the most). These findings suggest that reduction of apoE
levels might improve the clearance of soluble Aβ, thus reducing plaque pathology. We previously
tested this hypothesis by utilizing an antisense oligonucleotide to reduce apoE expression and
examined the effect on cerebral Aβ accumulation in vivo 21. ASO treatment starting after birth led
to a strong and significant decrease in Aβ pathology in the cortex of APP/PS1/ε4 (APPE4) mice
at 4 months of age. Interestingly, when ASO treatment was initiated in adulthood, no reduction of
Aβ pathology was detected at 4 months of age in the cortex, despite achieving apoE reduction by
>50% starting at the onset of amyloid deposition. Our colleagues complemented our findings by
overexpressing different APOE isoforms in the brain, where overexpression of apoE4 at birth, but
not during adulthood, led to a significant increase in Aβ accumulation 29. Collectively, these results
suggest that apoE levels (at least the ε4 isoform) can strongly affect the initiation of Aβ pathology
101
in vivo but once Aβ plaque pathology is present, reducing apoE only has a minor effect on further
amyloid deposition.
Our observations in these studies may be explained by the in vitro model of Aβ
aggregation, a nucleation-dependent process with three distinct phases: an initial “lag phase”
resulting in the formation of dimers, trimers, and higher-order oligomers, an exponential phase
during which rapid fibrillization occurs, and a “plateau phase” where fibril growth reaches its
maximum 22. ApoE has been proposed to affect the fibrillization of Aβ in vitro, and the differential
30,37,44
effects of the different isoforms follow the order of apoE4>apoE3>apoE2 . While our
previous results support a role of apoE in the earliest stage of plaque formation (the “nucleation”
stage), we also observed some subtle (but significant) isoform-dependent effect of apoE on Aβ.
Specifically, postnatal (P0) reduction of apoE led to a decrease in soluble and insoluble Aβ in
APPE4 mice, but only reduces insoluble Aβ in APPE3 mice 21. Reduction of apoE4, but not apoE3,
in adult animals led to a paradoxical increase in Aβ area coverage, as well as plaque density.
Consistent with our findings, overexpression of apoE4, but not apoE3, led to a significant increase
in Aβ pathology in another model of amyloidosis 29. These results strongly suggest that apoE4 is
more potent as a pro-amyloidogenic agent. Thus, we hypothesized that apoE can influence the
formation and/or properties of the Aβ seeds in an isoform-dependent manner in vivo. To investigate
this hypothesis, we performed seeding studies in APP23 and APP NLF-KI hosts using brain
extracts from aged (20 – 22 month old) APP/PS1-21 mice that are homozygous for either murine
apoE (APP/PS1), human ε2 (APPE2), ε3 (APPE3), or ε4 (APPE4) allele (adjusted for Aβ
concentrations). This allows us to assess the characteristics of amyloidogenic seeds that were
formed in the presence of different apoE isoforms, particularly their ability to facilitate the
formation of new plaques in a neutral environment. Our results show that APP23 mice inoculated
102
with brain extracts from APPE2 mice produce diffuse amyloid deposits with a dense distribution
pattern across the granular cell layer of the hippocampus. In contrast, amyloid deposits induced by
APPE4 seed extracts are characterized by small, fairly compact Aβ deposits that are puncta-like in
appearance with a sparse distribution around the granular cell layer. Amyloid deposits induced by
APPE3 seed extracts have an intermediate phenotype. Brain extracts from non-transgenic APP
mice failed to induce any observable seeding pattern. These results suggest that human APOE
isoforms may differentially affect the properties of Aβ seeds, thus creating different strains of Aβ
with distinct structural features and seeding capabilities. Interestingly, these isoform-dependent
differences were abrogated in APP NLF-KI hosts, suggesting some degree of dependency on the
properties of the host, such as APP expression levels or distribution pattern.
3.3 Results
Isolation and characterization of Aβ seed extracts from brain homogenates
Several studies have demonstrated that SEs derived from AD patients or aged APP
14,17,33
transgenic (Tg) mice can induce formation of new amyloid plaques . Interestingly, SEs
derived from different APP Tg strains induced Aβ lesions that are distinct and resemble those seen
in their respective donor strain 18,33. Thus, we hypothesized that SEs from APP Tg mice harboring
different human APOE isoforms can induce morphologically distinct lesions in the same host
environment. We adapted the Aβ seeding assay from those studies to design an in vivo seeding
experiment that allowed us to test this hypothesis (Figure 3.1A). Notably, we needed to create
donor strains that express APP alongside the various human APOE isoforms. To obtain donor
brains with those characteristics, we crossed APP/PS1-21 Tg mice to APOE-KI mice to obtain
APP transgenic mice on an APOE2/2, APOE3/3 or APOE4/4 background (APPE2, APPE3, and
APPE4 mice, respectively). These mice were aged until approximately 20 – 22 months, when their
103
brains were harvested to serve as donor brains. Various control donor brains were aged and
harvested in the same manner: APP/PS1-21 non-Tg (APPPS1-nTg), APP/PS1-21 (APPPS1), and
APP-NLF-KI (NLF-KI), all of which carry the endogenous murine Apoe locus.
To obtain seeding-capable material from donor brains, snap-froze hemispheres were
homogenized in sterile PBS, and the 3000x g supernatants were collected as crude SEs. We first
measured the levels of Aβ in the SEs using an in-house Aβ ELISA assay that utilizes our in-house
antibodies HJ2, HJ7.4, and HJ5.1. Since potential differences in the fibril content of the SEs might
affect the absolute concentration detected by ELISA, we also treated crude SEs with formic acid
(FA-SE) to dissociate larger aggregates into monomers. Aβ1-40 and Aβ1-42 levels were measured
from both SE preparations (Figure 3.1B). As predicted, there are approximately 20x more Aβ
detected in the FA-SE fraction relative to the crude SE fraction. However, the Aβ1-42 to Aβ1-40
ratios remain consistent among the fractions and also the different genotypes. Similarly, the total
Aβ concentration between the crude SE and FA-SE fractions follow the same trend (Figure 3.1C).
To ensure accurate quantification of Aβ concentration, we subjected the FA-SE fractions to a
second ELISA platform from Meso Scale Discovery that utilizes the 6E10 antibody (Figure 3.1D).
When compared to values obtained from our in-house assay, the Meso Scale platform reported
absolute values that are 1.5x higher on average. However, the general trend is very consistent
between the two platforms.
Seed extracts from donors with different human APOE isoforms produces distinct seeding
patterns in APP23 hosts
Previous studies using a similar Aβ seeding paradigm reported that the characteristics of
the induced Aβ lesions were also influenced by the host 18,33. Thus we utilized two different APP-
104
expressing host models with distinct Aβ accumulation profiles: APP23 and APP NLF-KI (NLF-
KI). Several studies have established APP23 mice as a robust model for studying Aβ seeding
activities, both as hosts 18,33 and donors 17. APP23 mice carry a construct that expresses the APP751
Swedish mutation driven by the murine Thy-1 promoter 38. The transgene is overexpressed by 7
fold in these mice with an elevated Aβ1-40 to Aβ1-42 ratio. The mice were reported to develop Aβ-
immunopositive plaques in the neocortex starting at ~ 6 months and in the hippocampus at 8 – 10
months of age 33. APP23 mice heterozygous for the transgene were inoculated with SEs starting
around 3 – 4 months of age, and the seeding patterns were analyzed 4 months post-injection (Figure
3.2A)
Prior to being inoculated into host brains through stereotaxic injections, the total Aβ
concentration ([Aβ1-40] + [Aβ1-42]) in SEs were adjusted through appropriate dilution with sterile
PBS. Based on the concentration of the FA-SE fractions measured from our in-house ELISA
platform, SEs from all donor/genotypes were diluted to contain 1.5 ng/ml of total Aβ (Figure 3.1C
– dashed line). SEs from non-Tg APP/PS1-21 donors were not diluted. We did not attempt to
adjust/normalize apoE levels in the SEs due to various reasons that will be discussed further in the
discussion (section 3.4).
To inoculate the APP23 hosts, SEs were injected bilaterally into the hippocampus (dentate
gyrus) of young, pre-depositing 3 – 4 month-old APP23 mice. A total of 3 ng (1.5 ng/µl x 2 µl) of
monomer-equivalence Aβ was injected into each hemisphere. We first attempted to reproduce
previously described findings by examining APP23 hosts inoculated with SEs from APP/PS1-nTg
(Figure 3.2C) and APP/PS1 (Figure 3.2B) donors. Formaldehyde-fixed brain sections from the
host were immunostained with an anti-Aβ antibody, and the seeding patterns were analyzed.
105
Consistent with previous reports, β-amyloid-containing APPPS1 extract injected in APP23 hosts
induces punctate, coarse and compact Aβ-plaques 4 months after injections. Additionally, the
induced Aβ deposits by the APPPS1 extract were largely confined to the subgranular layer and
polymorphic region of the dentate gyrus. SEs from APPPS1-nTg donor failed to produce any
detectable seeding pattern. It is important to note that the amount of induced Aβ deposits we
18
observed here are significantly lower than those reported from the Jucker lab , despite closely
following every applicable experimental parameter. This could be due to many reasons, but one
explanation could be the genetic drift in either the donor or the host. Notably, our APP23 founders
were from a colony that was re-derived from a single animal after many generations of back-
crossing to the C57Bl/6 strain. APP23 mice used in previous studies originated from the initial
founders created on a C57Bl/6xDBA2 mixed background, though they were also back-crossed
with C57Bl/6 strain for at least 10 generations. These inconsistent genetic background might also
explain the lack of any significant endogenous plaque in our APP23 hosts at 7 – 8 months of age,
while these mice were initially reported to develop neocortical plaques at 6 months and
hippocampal plaques at 8 months. The overall lower level of Aβ concentration in the host might
explain for the lower seeding activity compared to previous studies.
Next, we analyzed the seeding patterns in APP23 hosts that was seeded with SEs from
APPE2, APPE3, and APPE4 donors (Figure 3.2D, 3.2E, and 3.2F). Qualitative analysis of brain
sections (n = 3 per genotype) stained with the same anti-Aβ antibody revealed several induced Aβ
deposits that are distributed in an anatomically similar manner to those seen with APPPS1 SE: the
deposits were largely confined to the subgranular layer and polymorphic region of the dentate
gyrus. However, there are considerable differences in the morphotype of the induced Aβ lesions.
APPE2 SEs induce Aβ deposits that possess a very diffuse (sometimes filamentous) pattern (Figure
106
3.2D), while APPE4 SEs induce punctate, coarse, and compact Aβ plaques (Figure 3.2F). APPE3
SEs yield an intermediate phenotype (Figure 3.2E). This pattern is consistent with our previous
studies on APPPS1 mice expressing either of the three human APOE isoforms, where most of the
plaques in APPE2 mice are diffuse at 3 – 4 months of age (unpublished data). For future studies,
we are interested in performing similar analysis of the plaques in APPE2, APPE3, and APPE4
mice at 4 months of age, and those at 20 – 22 months of age (the same animals from which the
SEs were derived).
To further examine the nature of the induced Aβ lesions in APP23 hosts, we stained the
brain sections with X-34, a fluorescent dye that binds to β-sheet structures, which are only found
in more compact, fibrillar plaques (Figure 3.3A). Consistent with our Aβ-immunostaining
analysis, SEs derived from APPE3 (Figure 3.3C) and APPE4 (Figure 3.3D) donors yielded mostly
X-34-positive plaques, with an abundance of small punctate that clusters around the subgranular
layer of the dentate gyrus. SEs from APPE2 donors produced X-34-positive deposits that are
generally lower in intensity, and spread out in a diffuse pattern over the subgranular layer and
polymorphic region of the dentate gyrus (Figure 3.3B).
Altogether, our data supports a role of human APOE in determining the characteristics of
Aβ seeds the subsequently influence the induced plaque deposits. The three isoforms differ in their
influence on this process, with the ε2 allele producing more diffuse plaques, whereas the ε3 and
ε4 allele yielding plaques that are more compact and rich in β-sheet content. Of note, we
experienced an unusually high mortality rate in APP23 hosts following the inoculation of SEs.
There was no qualitative correlation between the source of the SEs and the mortality rate.
107
However, female mice seem to be more susceptible than male mice among the APP23 hosts (Table
3.1).
Seed extracts derived from different APP models produce different seeding patterns in APP
NLF-KI hosts
The NLF-KI line was created through a knock-in approach to express APP at wild-type
levels with an elevated Aβ1-42 to Aβ1-40 ratio 36

. The construct contains a humanized Aβ region
along with two pathogenic mutations, the Swedish (APP KM670/671NL), and the
Beyreuther/Iberian (APP I716F) mutations. APP expression is controlled through the endogenous
murine APP promoter, allowing for appropriate cell-type and temporal specificity. Initial
description of these mice reported Aβ accumulation to begin six months of age. However, no
substantial pathology was observed until around 12 months of age. Due to the overall lower Aβ
levels and slower Aβ aggregation kinetics, we decided to start the SE inoculation at a later time
point (5 – 6 months), and incubate for a longer period (6 months post-injection), compare to those
parameters for APP23 hosts (Figure 3.4A).
In addition to the same donor genotypes examined in APP23 hosts, we included SE from
an aged (~26 month-old) NLF-KI donor to detect any strain-specific phenotype. We first
performed immunohistological analysis on fixed brain sections from 11 – 12 month-old NLF-KI
hosts that were inoculated with either NLF-KI (Figure 3.4B), APPPS1 (Figure 3.4C), or APPPS1-
nTg (Figure 3.4D) SEs. Qualitative analysis of the stained sections revealed striking differences
in the amount and distribution of induced Aβ lesions from APPPS1 and NLF-KI donors. The NLF-
KI-derived SEs induced several small Aβ deposits that are punctate-like, but only with moderate
compaction. The induced lesions are distributed sparsely along the inner and outer molecular
108
layers. The APPPS1 SEs did not yield a stereotypical seeding pattern, instead we only observed a
single line of Aβ immunoreactive material in an anatomical fissure, just above the outer molecular
layer (Figure 3.4C, red arrowheads). APPPS1-nTg SEs did not induced any detectable seeding
pattern (Figure 3.4D). At this age, endogenous plaques are seen throughout the neocortex of the
NLF-KI hosts (blue arrowheads).
We next examined the hosts inoculated with SEs from APPE2 (Figure 3.4E), APPE3
(Figure 3.4F), and APPE4 (Figure 3.4G) donors. Interestingly, no isoform-dependent phenotype
of APOE on the induced plaque deposits was observed. Additionally, the induced seeding patterns
are qualitatively identical to that seen with APPPS1 SEs, with a single line of Aβ-immunopositive
materials just above the outer molecular layer. For future experiments, we will further characterize
these Aβ lesions by staining them with X-34 dye to analyze their fibrillar component.
Altogether, our data suggest that the exogenous induction of Aβ plaques in vivo is
dependent on both the characteristics of the donor seeds and also the host. In the NLF-KI hosts,
the effect of the APP donor strain (APPPS1 versus NLF-KI) is much stronger than that of the
APOE genotypes of the donor. The post-inoculation mortality rate in NLF-KI hosts is qualitatively
much lower than that of APP23 hosts (Table 3.2).
Aβ seeding in APP23/EKO hosts – future direction
Although our experimental design allows for SEs from different APOE donors to induce
seeding in the same host, it is possible that the presence of murine apoE in the hosts can have some
confounding effects on how the SEs induce further aggregates. This scenario is plausible, since
murine apoE is more pro-amyloidogenic than any of the human isoforms. Replacement of the
endogenous murine apoE locus by human APOE constructs in APP transgenic models delay the
109
appearance of amyloid plaques by several months. Thus, to rule out any potential confounding
effects from murine apoE, we propose to perform similar seeding experiments using APP23 host
mice that lack murine apoE (APP23/EKO) (Figure 3.5A). These hosts will be acquired through
crossing of apoE knock-out mice (EKO) to APP23 mice for successive generations.
Similar to our experimental construct in figure 3.1, our donor brains include frozen
hemispheres from APPE2, APPE3, and APPE4 mice harvested at approximately 20 – 22 months.
Various control donor brains were aged and harvested in the same manner: APPPS1-nTg, APPPS1,
and APP23. To account for potential variations in donors’ pathology (i.e. differential transgene
expression, litter effects, etc...), we pooled seeding-capable material from at least three donor
brains for each genotype. Crude SEs were treated with formic acid to dissociate larger aggregates
into monomers, and the Aβ levels were measured using a validated ELISA platform from Meso
Scale Discovery that can detect Aβ1-38, Aβ1-40, and Aβ1-42. Consistent with the genetic construct and
our prior data, Aβ1-42 is the major species in APPPS1, APPE2, APPE3, and APPE4 mice, whereas
Aβ1-40 is the major species in APP23 mice (Figure 3.5C). Aβ levels in SEs from APPPS1/EKO and
APP NLF-KI brains were shown for comparative purposes. The total concentration of soluble Aβ
follows an isoform-dependent pattern (ε4 > ε3 > ε2) in APP/PS1-21 mice, all of which were
significantly higher than those found in APP NLF-KI mice (Figure 3.5B).
Data from this experimental setup is important in determining the role of sustained apoE
production from the host in facilitating Aβ seeding. Such knowledge can carry important
implications, both from research and therapeutic standpoints.
110
3.4 Discussion
The aggregation cascade of Aβ monomers into larger aggregates have been studied
extensively in vitro, and was proposed to follow three major phases (the term “aggregation” refers
to all three phases in this context). In this model, monomers collide and aggregate to form
oligomers in the initial “lag phase”, appropriately named due to its slow kinetics. Aβ oligomers
have been proposed to act as nuclei (or seeds) that facilitate rapid fibrillization in the second phase,
termed the exponential “growth phase”. Lastly, the growing plaques enter the “saturation phase”,
where the growth rate slows and eventually reaches a plateau. In the context of in vitro
experiments, this could be due to either the limitation of the technique (saturation of signals), or
depletion of the pool of monomers. While previous in vivo studies by us 21 and our colleagues 29
demonstrated a prominent role of apoE in the early stages of plaque pathology, it was still unclear
whether such effect is isoform-dependent. In this study, our experimental design allowed us to
address this question without being confounded by the well-described effect of APOE isoforms on
the clearance of soluble Aβ from the ISF during the lifetime of the animal. Our data demonstrated
that APOE isoforms differentially influence Aβ seeds in terms of the type of plaques that they can
induce. However, these phenotypes are dependent on the context that they are examined, and the
effect of the “strains” of Aβ (which can be influenced by many factors) are much stronger than the
isoform-dependent effect of APOE.
The effects of APOE isoforms on Aβ aggregation were investigated shortly after the initial
discovery of APOE’s role in AD risk. It is critical to note that these early studies measured Aβ
aggregation kinetics in vitro by adding the Thioflavin T (ThT) dye to the reaction and monitoring
its fluorescent signal. ThT becomes fluorescently active by inserting itself in between fibril sheets,
and the signal intensity increases as more Aβ fibrils are formed. Early experiments on the effects
111
of apoE isoforms on the aggregation of Aβ found all three isoforms of apoE to promote the
fibrillization of Aβ in vitro, and the potency follows the order of apoE4 > apoE3> apoE2 30,37,44
.
However, technical limitations of the ThT assay prevented closer examination of the lag phase,
when no fibrils were present and when soluble oligomeric species are being formed. Thus, it
remained unclear for some time whether apoE exerts its effects in the nucleation, the elongation
of plaque, or both. More recently, development of a newer, more sensitive detection method using
Aβ conjugated to tetramethylrhodamine (TMR) offered a glimpse into what happens during the
16
lag phase . The higher temporal resolution allowed the authors to categorize the in vitro
aggregation of Aβ into three phases that are slightly different from those proposed earlier. First,
an initial oligomeric phase that results in the formation of dimers, trimers, and higher-order
oligomers. This is followed by an intermediate phase during which there is little change in
monomer concentration but rather clustering of oligomers. Lastly, the fibrillization phase reflects
the formation and growth of fibrils. Under this new technique, the authors found all APOE
isoforms to interact with both oligomeric intermediates and fibrils of Aβ with high affinity, with
apoE4 having the most dramatic effect compared to apoE2 or apoE3. Specifically, the presence of
apoE4 dramatically increases the time that Aβ species are in the intermediate stage, presumably
by binding and stabilizing oligomers. Our results in the APP23 hosts are consistent can further
supplement this model, where the presence of apoE4 not only stabilizes, but also morphologically
alter the oligomeric species being formed. On the other hand, the authors also found apoE4 to be
most efficient at stabilizing fibrils in the final stage. Again, our results can also be explained by
this model, since fibrils are capable of growing both by monomer addition or by fragmentation,
followed by secondary nucleation 9,15,24,26

. In this scenario, stabilization of Aβ fibrils by apoE4
112
favors the growth of fibrils over the slower conversion of oligomers to fibrils, thus resulting in
more fibrillar species of plaques.
In the context of in vitro experiments, it remains unclear whether human APOE isoforms
generally inhibit Aβ aggregation 3,11,16,45 or promote their aggregation 30,37,44. These contradictory
findings most likely result from differences in experimental conditions, such as the preparation of
apoE, Aβ, and/or their concentrations. Of note, the early studies 30,37,44
that reported apoE to
accelerate Aβ fibrillization examined the interaction using the lipid-free form of apoE and prepared
Aβ at an unusually high concentrations (~100 µM) at which almost all of the Aβ species exist as a
mixture of oligomers 4,7,15. Thus, the observed phenotype might be an artifact produced under these
extreme conditions. Regardless of the overall effect, all of these studies found an isoform-
dependent effect on Aβ aggregation, with apoE4 having either a stronger facilitative effect, or a
weaker preventative effect, on Aβ aggregation. More importantly, these isoform-specific
phenotypes were recapitulated in vivo in at least one model of amyloidosis 8. Interestingly, murine
apoE is more amyloidogenic than all human isoforms 12,19,20, while lack of apoE reduces formation
of fibrillar plaques 1,41.
Previous in vivo seeding studies found the molecular composition and conformation of the
aggregated Aβ from different APP models to be distinct, and these characteristics are maintained
by seeded conversion 14,18. Our results from APP23 hosts support these latter conclusions, with the
seed characteristics being differentially influenced by APOE isoforms. Although we did not
measure the apoE levels in the SEs after adjusting for Aβ concentration, it is conceivable that the
concentration and/or total amount of apoE varies among the SEs. This could be due to either
intrinsic differences between human and murine apoE, or among the human isoforms themselves
113
(i.e. differences in binding affinity to Aβ16, lipids13, and conformational stability34). These
differences, if exist, might explain for any potential differences in the SEs’ characteristics and
potency. From a practical perspective, normalization of both Aβ and apoE levels requires extensive
processing and handling of the SEs beyond simple dilution, potentially risking protein degradation
and alteration of the SEs’ biochemical composition. Nevertheless, it is of great interest to assess
the levels of apoE (both soluble and insoluble) in our SEs in the future. Of note, while the half-life
of soluble apoE under is relatively short (~1 day for human apoE in the CNS 43 and ~7 hours for
murine apoE2), insoluble forms of apoE are bound to to Aβ fibrils with potentially much longer
half-life, and can potentially play a significant role in facilitating seeding activities.
In the seeding experiments involving NLF-KI hosts, our results corroborate the conclusions
from another study: the exogenous induction of cerebral β-amyloidosis to be influenced by both
the donor and the host 33

. Indeed, SEs derived from APPPS1 and NLF-KI induce distinct Aβ
deposits, both of their morphology and distribution. This strain-like behavior of Aβ was previously
described in the context of APP23 versus APPPS1 models, where their respective Aβ morphotypes
were presumably influenced by APP expression level and opposite Aβ1-42 to Aβ1-40 ratio 18,33
.
However, both strains overexpress APP by several folds (3 fold for APPPS1 and 7 fold for APP23),
whereas NLF-KI mice expresses APP under the endogenous promoter 36. This affects not only the
Aβ levels but potentially the distribution of APP (and subsequently Aβ) throughout the brain. It is
entirely possible that the induced seeding pattern requires more time to spread to different layers
of the dentate gyrus due to the overall lower Aβ concentration. To test this hypothesis, a small
cohort of NLF-KI hosts that had been seeded with various SEs is being aged until 14 – 15 months
of age (for a total of 9 month post-inoculation). These longer incubation, if show a different seeding
pattern, does not dismiss a strain-like transmission of Aβ in this model, as the NLF-KI SEs clearly
114
induce a more stereotypical seeding pattern over several layers of the dentate gyrus, despite having
the lowest level of Aβ relative to all other genotypes (Figure 3.1B, 1C, and 1D). More importantly,
this strain-dependent effect is stronger than the effects induced by the APOE isoforms, at least in
this particular host.
In conclusion, we report here an investigation on the isoform-dependent effect of APOE
on the molecular conformation and composition of Aβ seeds, where apoE2 induces Aβ plaques
that are diffuse in nature, whereas apoE3 and apoE4 induces Aβ deposits that are punctate-like and
more compact. Based on these results, we propose a model where the interaction between apoE
and soluble Aβ species (monomer or oligomers) somehow modify the characteristics of the seed-
capable species that are subsequently formed (Figure 3.6A and 3.6B). We also found an Aβ strain-
dependent effect on seeding-associated phenotypes in an APP knock-in model that is much
stronger than the effects of APOE isoforms. Since all of our findings here were done in hosts with
endogenous apoE, it will be interesting to follow up on our ongoing seeding experiments in
APP23/EKO hosts. Additionally, we plan to examine whether the different morphology of the
resulting plaques lead to an altered glial response. Several studies on APOE-knock-out mice found
an altered plaque morphology (more diffuse) that is associated with an altered microglial or
astrocytic response. However, from those studies, it is difficult to tell whether the altered plaque
morphology leads to the altered glial response, or vice versa. This latter point is critical to address,
as apoE can modulate the innate immune response in the brain, where apoE4 is more pro-
23,25,27,31
inflammatory relative to the other isoforms . ApoE4-KI mice also have a greater pro-
inflammatory phenotype upon exposure to certain stimulus 42. Our experimental design, where the
induced Aβ plaques are exposed to the same host environment can help delineate this important
relationship between apoE and amyloid plaques.

115
3.5 Experimental procedures
Generation of human APOE isoform mice with APPswe/PS1(L166P) mutant transgenes.
To examine any potential isoform-dependent effect of APOE on Aβ seeds, it was necessary to
generate an amyloidogenic model that also harbors the different human APOE isoforms. These
mice will then be utilized as “donors” in our experimental design. To accomplish this, we used
knock-in mouse models in which the endogenous murine Apoe gene is replaced with either the
40
APOE3 or APOE4 gene . To model the amyloidosis aspect, we utilized APPPS1-21 mice that
overexpress a human APP cDNA with a Swedish mutation (KM670/671NL) and mutant PS1 with
the L166P mutation. APPPS1-21 Breeding pairs were obtained from Dr. Mathias Jucker,
35
University of Tübingen, Tübingen, Germany . To replace the murine Apoe gene with human
APOE isoforms, APPPS1-21 mice were bred with either APOE3/3 or APOE4/4 knock-in mice.
APPPS1-21/APOE4/Apoe mice and APOE4/Apoe mice from the first generation were bred with
each other to generate APPPS1-21/APOE4/4 and APOE4/4 mice. APPPS1-21/APOE4/4 and
APOE4/4 mice were then bred to generate more APPPS1-21/APOE4/4 (APPE4) mice. Similar
breeding schemes were followed to generate APPPS1-21/APOE3/3 (APPE3) and APPPS1-
21/APOE2/2 (APPE2) mice. All mice used in this study were maintained on a C57BL/6J
background. Based on many Aβ seeding protocols, these mice were aged to 20 – 22 months when
their brains are harvested to generate “seed extracts”, per our experimental design. Mice were
individually housed in AAALAC accredited facilities with temperature and humidity controls, and
were under a 12-hours light/dark cycle (lights on at 6:00 AM) cycle with free access to food and
water ad libitum throughout all phases of the experiments. All animal procedures were approved
by the Institutional Animal Care and Use Committee (IACUC) at Washington University, and
116
were in agreement with the Association for Assessment and Accreditation of Laboratory Animal
Care (AAALAC, WUSM).
Acquisition and maintenance of APP23 and APP NLF-KI mice. We needed an APP-
expressing model to serve as “hosts”, per our experimental design. The hosts need to have a
relatively slow Aβ aggregation kinetics in order for us to differentiate between Aβ-seeded plaques
and the endogenous plaques. We utilized two different APP mouse lines: APP23 and APP NLF-
KI. The APP23 transgenic line was a generous gift from Novartis Pharmaceuticals. This strain
harbors a construct that expresses the APP751 Swedish mutation driven by the murine Thy-1
promoter38. The APP23 line was initially created on the C57Bl/6xDBA2 mixed background, but
were backcrossed to C57Bl/6 strain for many generations, and the whole line was re-established
from a single animal that was completely black in color (which indicated that a large part of the
DBA chromosome was now replaced by Bl6). The mice were reported to develop Aβ-
immunopositive plaques in the neocortex starting at ~ 6 months and in the hippocampus at 8 – 10
months of age 33. The APP NLF-KI (NLF-KI) line was a generous gift from Dr. Takaomi Saido
(RIKEN Brain Science, Japan). This line was created through a knock-in approach to express APP
at wild-type levels with an elevated Aβ1-42 to Aβ1-40 ratio 36

. Specifically, the APP knock-in
construct contains a humanized Aβ region along with two pathogenic mutations, the Swedish (APP
KM670/671NL), and the Beyreuther/Iberian (APP I716F) mutations. APP expression is controlled
through the endogenous murine APP promoter, allowing for appropriate cell-type and temporal
specificity. Initial description of these mice reported Aβ accumulation to begin six months of age.
However, no substantial pathology was observed until around 12 months of age. APP23 mice were
bred to be heterozygous for the transgene and was aged to 3 months for experiments, while NLF-
KI mice were bred to be homozygous and utilized for experiments at 5 months of age.
117
Preparation of seed extracts. Fresh-frozen brain tissue was homogenized at 10% in sterile
PBS using the Precellys Evolution super homogenizer (Bertin Instruments), 3 x 10 seconds with a
10-second break 32. Homogenates will then be transferred into fresh 1.5 ml tube and centrifuged
for 5 minutes at 3000 x g (4oC). The supernatant (“seed extract” - SE) will be aliquoted and stored
at –80oC until use. Before inoculation, total Aβ concentration (Aβx-38/x-40/x-42) in each extract
was measured through ELISA as previously shown 10

. The total amount of Aβ were adjusted
among the different donor genotypes so that the same amount of Aβ monomer-equivalence were
injected into each brain. This was done through appropriate dilution with sterile PBS just prior to
inoculation. The level of apoE were measured, but not adjusted. There were two independent
rounds of SE preparation: one for APP23 and NLF-KI hosts, and one for APP23/EKO hosts. In
the first round, SEs from a single animal from each genotype were inoculated into host brains. In
the second round, SEs from 2 – 3 animals were mixed at equal ratios for each genotype, and the
Aβ concentrations were adjusted accordingly prior to injections. This approach reduces the risk
that any observable phenotype in the host is real, and not due to any unknown confounding factor
that is unique to a donor.
Sandwich ELISA. Brain cortices or hippocampi were sequentially homogenized with cold
PBS (no protease inhibitor was added). The levels of Aβx-40 were measured on two different ELISA
platforms to ensure accuracy of measurements. Prior to analysis on either platforms, the SEs were
first treated with formic acid (final concentration: 70%) (Sigma, St. Louis, MO, USA), then
sonicated for 30 seconds on ice and centrifuged at 25,000 × g for 1 h at 4°C. These steps ensure
complete dissociation of plaques into monomeric Aβ species. The supernatants were equilibrated
in neutralization buffer (1M Tris base, 0.5M Na2HPO4, 0.05% NaN3), then subjected to ELISA.
Our in-house Aβ ELISA utilizes HJ2 (anti-Aβ35–40) as capture antibody for Aβ1-40 and HJ7.4 (anti-
118
Aβ37–42) as a capture antibody for Aβ1-42. HJ5.1-biotin (anti-Aβ13–18) 6,28 was used as the detecting
antibody for both Aβ ELISAs. For the commercial ELISA platform, Aβ levels (Aβx–38, Aβx–40
and Aβx–42) were measured using the MSD® 96-well MULTI-SPOT® Human (6E10) Aβ
Triplex Assay (Meso Scale Discovery, Gaithersburg, MD, USA). Aβ detection was conducted
according to the manufacturer’s instructions. In brief, 96-well plates pre-spotted with capture
antibodies against Aβx–38, Aβx–40, Aβx–42 and bovine serum albumin were blocked for 1 h with
1% Blocker A solution and then washed three times with 1× Tris buffer. In a second step, samples
were diluted 1:100 in 1% Blocker A solution, except supernatant of ultracentrifugation, and co-
incubated with the SULFO-TAG 6E10 detection antibody solution on the plate for 2 h. After
washing, MSD Read Buffer T was added and the plate was read immediately on a Sector® Imager
6000. Data analysis used MSD® DISCOVERY WORKBENCH® software 2.0. For total Aβ,
Aβx–38, Aβx–40 and Aβx–42 were combined. For apoE ELISA (in-house), HJ15.6 and HJ15.4b
28
were used as capture and detection antibodies, respectively. All ELISA assays were performed
in triple technical replicates with appropriate positive and negative controls.
Surgical procedures and tissue collection. The SEs was injected bilaterally into the
hippocampus (specifically, the dentate gyrus) of host mice using a Hamilton syringe (model #1701,
Hamilton Company). The injection was done at a rate of 1 µl per minute for a total of 2.5 µl of
SEs on each side, as previously described 33. The needle was held in place for 2 minutes following
completion of injection, then withdrawn slowly. The mice were allowed to completely recover in
a warm chamber and then returned to the home cage. The following coordinates were used, relative
to bregma: AP -2.5 mm, L +/- 2.0 mm, DV -2.2 mm (from the surface of the skull). The surgical
area was cleaned with sterile saline and the incision was sutured. At the end of the incubation
period, the brains were perfused with ice-cold PBS containing 0.3% heparin, and the whole brain
119
was fixed overnight at 4oC in 4% paraformaldehyde, followed by immersion into 30% sucrose
solution for at least 24 hours.
μm thickness) were collected from frontal cortex to caudal hippocampus using a freezing sliding
microtome (ThermoFisher). Successive coronal sections 360 μm apart were stained with
biotinylated HJ3.4 (anti-Aβ1–13, mouse monoclonal antibody generated in-house) to visualize Aβ
immunopositive plaques, as described previously 5. Analysis of fibrillar plaques were done by
staining the tissues with X-34 dye 39. Quantitative analysis of immunopositive staining and X-34
dye was performed as described previously 6. Briefly, images of Aβ-immunostained or X-34-
stained sections were acquried at 20X using a Nanozoomer 2.0-HT system (Hamamatsu,
Bridgewater NJ)) and exported to TIFF files with NDP viewer (Hamamatsu Photonics). Using
ImageJ software, images were converted to 8-bit grayscale, thresholded to highlight Aβ-specific
staining and analyzed.
This work was supported by NIH grants R01AG047644 and R01NS034467 (D.M.H.), the
JPB Foundation (D.M.H.), and the Gilliam fellowship from the Howard Hughes Medical Institute
(T-P. V. H.). We would also like to thank Dr. Sarah Fritschi for assisting with the illustrations, and
we are grateful for the suggestions and support from all of our colleagues in the Holtzman
laboratory.
120
3.7 References
Johnstone, E. M., Little, S. P., Cummins, D. J., Piccardo, P., Ghetti, B. & Paul, S. M.
Lack of apolipoprotein E dramatically reduces amyloid beta-peptide deposition. Nature
genetics 17, 263-264, doi:10.1038/ng1197-263 (1997).
2 Basak, J. M., Kim, J., Pyatkivskyy, Y., Wildsmith, K. R., Jiang, H., Parsadanian, M.,
Patterson, B. W., Bateman, R. J. & Holtzman, D. M. Measurement of apolipoprotein E
and amyloid beta clearance rates in the mouse brain using bolus stable isotope labeling.
3 Beffert, U. & Poirier, J. ApoE associated with lipid has a reduced capacity to inhibit beta-
amyloid fibril formation. Neuroreport 9, 3321-3323 (1998).
4 Bernstein, S. L., Dupuis, N. F., Lazo, N. D., Wyttenbach, T., Condron, M. M., Bitan, G.,
Teplow, D. B., Shea, J. E., Ruotolo, B. T., Robinson, C. V. & Bowers, M. T. Amyloid-
beta protein oligomerization and the importance of tetramers and dodecamers in the
aetiology of Alzheimer's disease. Nat Chem 1, 326-331, doi:10.1038/nchem.247 (2009).
Culver, J. P. & Holtzman, D. M. Bidirectional relationship between functional
connectivity and amyloid-beta deposition in mouse brain. The Journal of neuroscience :
the official journal of the Society for Neuroscience 32, 4334-4340,
doi:10.1523/JNEUROSCI.5845-11.2012 (2012).
6 Bero, A. W., Yan, P., Roh, J. H., Cirrito, J. R., Stewart, F. R., Raichle, M. E., Lee, J. M.
& Holtzman, D. M. Neuronal activity regulates the regional vulnerability to amyloid-beta
7 Bitan, G., Lomakin, A. & Teplow, D. B. Amyloid beta-protein oligomerization:
prenucleation interactions revealed by photo-induced cross-linking of unmodified
proteins. The Journal of biological chemistry 276, 35176-35184,
doi:10.1074/jbc.M102223200 (2001).
9 Cohen, S. I., Linse, S., Luheshi, L. M., Hellstrand, E., White, D. A., Rajah, L., Otzen, D.
E., Vendruscolo, M., Dobson, C. M. & Knowles, T. P. Proliferation of amyloid-beta42
aggregates occurs through a secondary nucleation mechanism. Proceedings of the
National Academy of Sciences of the United States of America 110, 9758-9763,
doi:10.1073/pnas.1218402110 (2013).
10 Eisele, Y. S., Obermuller, U., Heilbronner, G., Baumann, F., Kaeser, S. A., Wolburg, H.,
Walker, L. C., Staufenbiel, M., Heikenwalder, M. & Jucker, M. Peripherally applied
Abeta-containing inoculates induce cerebral beta-amyloidosis. Science 330, 980-982,
doi:10.1126/science.1194516 (2010).
11 Evans, K. C., Berger, E. P., Cho, C. G., Weisgraber, K. H. & Lansbury, P. T., Jr.
Apolipoprotein E is a kinetic but not a thermodynamic inhibitor of amyloid formation:
implications for the pathogenesis and treatment of Alzheimer disease. Proceedings of the
National Academy of Sciences of the United States of America 92, 763-767 (1995).
121
12 Fagan, A. M., Watson, M., Parsadanian, M., Bales, K. R., Paul, S. M. & Holtzman, D. M.
Human and murine ApoE markedly alters A beta metabolism before and after plaque
formation in a mouse model of Alzheimer's disease. Neurobiology of disease 9, 305-318,
doi:10.1006/nbdi.2002.0483 (2002).
13 Frieden, C., Wang, H. & Ho, C. M. W. A mechanism for lipid binding to apoE and the
role of intrinsically disordered regions coupled to domain-domain interactions.
6292-6297, doi:10.1073/pnas.1705080114 (2017).
14 Fritschi, S. K., Cintron, A., Ye, L., Mahler, J., Buhler, A., Baumann, F., Neumann, M.,
Nilsson, K. P., Hammarstrom, P., Walker, L. C. & Jucker, M. Abeta seeds resist
inactivation by formaldehyde. Acta neuropathologica 128, 477-484, doi:10.1007/s00401-
014-1339-2 (2014).
15 Garai, K. & Frieden, C. Quantitative analysis of the time course of Abeta oligomerization
and subsequent growth steps using tetramethylrhodamine-labeled Abeta. Proceedings of
the National Academy of Sciences of the United States of America 110, 3321-3326,
doi:10.1073/pnas.1222478110 (2013).
16 Garai, K., Verghese, P. B., Baban, B., Holtzman, D. M. & Frieden, C. The binding of
apolipoprotein E to oligomers and fibrils of amyloid-beta alters the kinetics of amyloid
aggregation. Biochemistry 53, 6323-6331, doi:10.1021/bi5008172 (2014).
17 Hamaguchi, T., Eisele, Y. S., Varvel, N. H., Lamb, B. T., Walker, L. C. & Jucker, M.
The presence of Abeta seeds, and not age per se, is critical to the initiation of Abeta
deposition in the brain. Acta neuropathologica 123, 31-37, doi:10.1007/s00401-011-
0912-1 (2012).
18 Heilbronner, G., Eisele, Y. S., Langer, F., Kaeser, S. A., Novotny, R., Nagarathinam, A.,
Aslund, A., Hammarstrom, P., Nilsson, K. P. & Jucker, M. Seeded strain-like
transmission of beta-amyloid morphotypes in APP transgenic mice. EMBO reports 14,
1017-1022, doi:10.1038/embor.2013.137 (2013).
19 Holtzman, D. M., Bales, K. R., Wu, S., Bhat, P., Parsadanian, M., Fagan, A. M., Chang,
L. K., Sun, Y. & Paul, S. M. Expression of human apolipoprotein E reduces amyloid-beta
deposition in a mouse model of Alzheimer's disease. The Journal of clinical investigation
103, R15-R21, doi:10.1172/JCI6179 (1999).
20 Holtzman, D. M., Fagan, A. M., Mackey, B., Tenkova, T., Sartorius, L., Paul, S. M.,
Bales, K., Ashe, K. H., Irizarry, M. C. & Hyman, B. T. Apolipoprotein E facilitates
neuritic and cerebrovascular plaque formation in an Alzheimer's disease model. Annals of
neurology 47, 739-747 (2000).
21 Huynh, T. V., Liao, F., Francis, C. M., Robinson, G. O., Serrano, J. R., Jiang, H., Roh, J.,
Finn, M. B., Sullivan, P. M., Esparza, T. J., Stewart, F. R., Mahan, T. E., Ulrich, J. D.,
Cole, T. & Holtzman, D. M. Age-Dependent Effects of apoE Reduction Using Antisense
doi:10.1016/j.neuron.2017.11.014 (2017).
23 Keene, C. D., Cudaback, E., Li, X., Montine, K. S. & Montine, T. J. Apolipoprotein E
isoforms and regulation of the innate immune response in brain of patients with
Alzheimer's disease. Current opinion in neurobiology 21, 920-928,
doi:10.1016/j.conb.2011.08.002 (2011).
122
24 Knowles, T. P., Waudby, C. A., Devlin, G. L., Cohen, S. I., Aguzzi, A., Vendruscolo, M.,
Terentjev, E. M., Welland, M. E. & Dobson, C. M. An analytical solution to the kinetics
of breakable filament assembly. Science 326, 1533-1537, doi:10.1126/science.1178250
(2009).
25 Laskowitz, D. T., Lee, D. M., Schmechel, D. & Staats, H. F. Altered immune responses
in apolipoprotein E-deficient mice. Journal of lipid research 41, 613-620 (2000).
26 Lee, J., Culyba, E. K., Powers, E. T. & Kelly, J. W. Amyloid-beta forms fibrils by
nucleated conformational conversion of oligomers. Nat Chem Biol 7, 602-609,
doi:10.1038/nchembio.624 (2011).
triggering receptor expressed on myeloid cells 2 (TREM2) expression after innate
immune activation of microglia. FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 29, 1754-1762, doi:10.1096/fj.14-262683
(2015).
M. & Holtzman, D. M. Murine versus human apolipoprotein E4: differential facilitation
of and co-localization in cerebral amyloid angiopathy and amyloid plaques in APP
transgenic mouse models. Acta neuropathologica communications 3, 70,
doi:10.1186/s40478-015-0250-y (2015).
29 Liu, C. C., Zhao, N., Fu, Y., Wang, N., Linares, C., Tsai, C. W. & Bu, G. ApoE4
Accelerates Early Seeding of Amyloid Pathology. Neuron 96, 1024-1032 e1023,
doi:10.1016/j.neuron.2017.11.013 (2017).
30 Ma, J., Yee, A., Brewer, H. B., Jr., Das, S. & Potter, H. Amyloid-associated proteins
alpha 1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-
protein into filaments. Nature 372, 92-94, doi:10.1038/372092a0 (1994).
31 Maezawa, I., Maeda, N., Montine, T. J. & Montine, K. S. Apolipoprotein E-specific
innate immune response in astrocytes from targeted replacement mice. Journal of
neuroinflammation 3, 10, doi:10.1186/1742-2094-3-10 (2006).
32 Maia, L. F., Kaeser, S. A., Reichwald, J., Hruscha, M., Martus, P., Staufenbiel, M. &
Jucker, M. Changes in amyloid-beta and Tau in the cerebrospinal fluid of transgenic mice
overexpressing amyloid precursor protein. Science translational medicine 5, 194re192,
33 Meyer-Luehmann, M., Coomaraswamy, J., Bolmont, T., Kaeser, S., Schaefer, C., Kilger,
E., Neuenschwander, A., Abramowski, D., Frey, P., Jaton, A. L., Vigouret, J. M.,
Paganetti, P., Walsh, D. M., Mathews, P. M., Ghiso, J., Staufenbiel, M., Walker, L. C. &
Jucker, M. Exogenous induction of cerebral beta-amyloidogenesis is governed by agent
and host. Science 313, 1781-1784, doi:10.1126/science.1131864 (2006).
34 Morrow, J. A., Segall, M. L., Lund-Katz, S., Phillips, M. C., Knapp, M., Rupp, B. &
Weisgraber, K. H. Differences in stability among the human apolipoprotein E isoforms
determined by the amino-terminal domain. Biochemistry 39, 11657-11666,
doi:10.1021/bi000099m (2000).
123
doi:10.1038/sj.embor.7400784 (2006).
36 Saito, T., Matsuba, Y., Mihira, N., Takano, J., Nilsson, P., Itohara, S., Iwata, N. & Saido,
T. C. Single App knock-in mouse models of Alzheimer's disease. Nature neuroscience
17, 661-663, doi:10.1038/nn.3697 (2014).
38 Sturchler-Pierrat, C., Abramowski, D., Duke, M., Wiederhold, K. H., Mistl, C.,
Rothacher, S., Ledermann, B., Burki, K., Frey, P., Paganetti, P. A., Waridel, C., Calhoun,
M. E., Jucker, M., Probst, A., Staufenbiel, M. & Sommer, B. Two amyloid precursor
protein transgenic mouse models with Alzheimer disease-like pathology. Proceedings of
the National Academy of Sciences of the United States of America 94, 13287-13292
(1997).
39 Styren, S. D., Hamilton, R. L., Styren, G. C. & Klunk, W. E. X-34, a fluorescent
derivative of Congo red: a novel histochemical stain for Alzheimer's disease pathology.
The journal of histochemistry and cytochemistry : official journal of the Histochemistry
Society 48, 1223-1232, doi:10.1177/002215540004800906 (2000).
40 Sullivan, P. M., Mezdour, H., Aratani, Y., Knouff, C., Najib, J., Reddick, R. L.,
Quarfordt, S. H. & Maeda, N. Targeted replacement of the mouse apolipoprotein E gene
with the common human APOE3 allele enhances diet-induced hypercholesterolemia and
41 Ulrich, J. D., Ulland, T. K., Mahan, T. E., Nystrom, S., Nilsson, K. P., Song, W. M.,
Zhou, Y., Reinartz, M., Choi, S., Jiang, H., Stewart, F. R., Anderson, E., Wang, Y.,
Colonna, M. & Holtzman, D. M. ApoE facilitates the microglial response to amyloid
plaque pathology. The Journal of experimental medicine 215, 1047-1058,
doi:10.1084/jem.20171265 (2018).
42 Vitek, M. P., Brown, C. M. & Colton, C. A. APOE genotype-specific differences in the
innate immune response. Neurobiology of aging 30, 1350-1360,
43 Wildsmith, K. R., Basak, J. M., Patterson, B. W., Pyatkivskyy, Y., Kim, J., Yarasheski,
K. E., Wang, J. X., Mawuenyega, K. G., Jiang, H., Parsadanian, M., Yoon, H., Kasten,
T., Sigurdson, W. C., Xiong, C., Goate, A., Holtzman, D. M. & Bateman, R. J. In vivo
human apolipoprotein E isoform fractional turnover rates in the CNS. PloS one 7,
e38013, doi:10.1371/journal.pone.0038013 (2012).
pathology 145, 1030-1035 (1994).
45 Wood, S. J., Chan, W. & Wetzel, R. Seeding of A beta fibril formation is inhibited by all
three isotypes of apolipoprotein E. Biochemistry 35, 12623-12628,
doi:10.1021/bi961074j (1996).
124
125
Figure 3.1 Characterization of Seed Extracts from aged donor brains
A, Experimental design and general timeline for seeding experiments. B, PBS-soluble seed
extracts from aged APPPS1, APPPS1-nTg, APPE2, APPE3, APPE4, and NLF-KI donors were
subjected to in-house ELISA assays for Aβ1-40 and Aβ1-42. The absolute levels for crude and
formic acid-treated seed extracts are reported on two independent y-axis, as indicated. C, Total
Aβ levels (Aβ1-40 + Aβ1-42) for crude and formic acid-treated seed extracts measured from our in-
house ELISA assay. For seeding experiments, all seed extracts were diluted to 1.5 ng/ml, as
measured from formic acid-treated fractions (dashed line). D, Formic acid-treated seed extracts
were analyzed on the Meso Scale Discovery platform, and the absolute values were plotted on
the left y-axis. Absolute values from our in-house assay were plotted on the right y-axis for
comparison purposes. E, ApoE levels were measured from the same crude seed extracts using
our in-house ELISA assay. All values are reported as mean ± SEM.
126
127
Figure 3.2 Isoform-dependent effect of APOE on induced Aβ seeding pattern
in APP23 hosts
A, Experimental timeline for seeding studies in APP23 hosts. B, Seed extract from an aged
APPPS1 donor was injected into the dentate gyrus of APP23 hosts at 3 months of age. The host
brains were harvested 4 months later, and fixed brain slices were stained with an anti-Aβ
antibody for qualitative analysis of the induced seeding pattern. C, Similar seeding experiments
were performed using seed extracts from an aged APPPS1-nTg donor, and the Aβ-
immunostained deposits were analyzed. No induced Aβ lesions were detected. Similar seeding
experiments were performed using seed extracts from aged APPPE2 (D), APPE3 (E), and
APPE4 (F) donors. Right panels show higher magnification of Aβ-immunostained layers of the
dentate gyrus from corresponding genotypes shown in (D), (E), and (F). In APP23 hosts, APPE2
seed extract-induced Aβ-deposits appeared to be diffuse and, to a lesser extent, filamentous. On
the contrary, the Aβ-deposits induced by APPE3 or APPE4 seed extracts are highly coarse,
punctate and compact (sgl = subgranular cell layer; g = granular cell layer). Images are
representative of at least 2 – 3 biological replicates.
128
Figure 3.3 Characterization of induced Aβ lesions in APP23 hosts
A, Experimental timeline for seeding studies in APP23 hosts. Seed extracts from aged APPE2
(B), APPE3 (C), and APPE4 (D) donors were injected into the dentate gyrus of APP23 hosts at 3
months of age. The host brains were harvested 4 months later, and fixed brain slices were stained
with X-34 dye for qualitative assessment of the fibrillar content of the induced lesions. Images
are representative of at least 2 – 3 biological replicates.
129
130
Figure 3.4 Seed extracts derived from different APP models produce
different seeding patterns in APP NLF-KI hosts
A, Experimental timeline for seeding studies in NLF-KI hosts. Seed extracts from an aged NLF-
KI (B) or APPPS1 (C) donor was injected into the dentate gyrus of NLF-KI hosts at 5 months of
age. The host brains were harvested 6 months later, and fixed brain slices were stained with an
anti-Aβ antibody for qualitative analysis of the induced seeding pattern. There are significantly
more Aβ deposits detected in NLF-KI hosts seeded with NLF-KI seed extracts compared to those
seed with APPPS1 seed extracts. The distribution of the induced Aβ deposits throughout the
different layers was also different between the two extracts (sgl = subgranular cell layer; g =
granular cell layer; iml, oml = inner and outer molecular layer). D, Seed extracts derived from
APPPS1-nTg donor failed to induce any detectable seeding pattern in NLF-KI hosts. Seed extracts
from aged APPE2 (E), APPE3 (F), or APPE4 (G) donors were injected into the dentate gyrus of
NLF-KI hosts at 5 months of age. The host brains were harvested 6 months later, and fixed brain
slices were stained with an anti-Aβ antibody for qualitative analysis of the induced seeding pattern.
No isoform-dependent effect of donors’ APOE genotype on induced lesions were detected. Images
are representative of at least 2 – 4 biological replicates.
131
Figure 3.5 Aβ seeding in APP23/EKO hosts
A, Experimental design and general timeline for seeding experiments in APP23/EKO hosts. B,
PBS-soluble seed extracts from aged APP23, APPPS1, APPPS1/EKO, APPPS1-nTg, APPE2,
APPE3, APPE4, and NLF-KI donors were subjected to Meso Scale ELISA assays. The total Aβ
levels (Aβ1-38 + Aβ1-40 + Aβ1-42) for formic acid-treated seed extracts were measured. C, The
individual contribution from each of the Aβ pools (Aβ1-38, Aβ1-40 and Aβ1-42). All values are
reported as mean ± SEM.
132
Figure 3.6 Proposed model of how APOE isoforms differentially modulate
Aβ aggregation properties
A, A model for possible ways that Aβ and apoE interact that can alter the trajectory of plaque
formation. Hypothetically, apoE isoforms can differentially affect the kinetic rates of Aβ
aggregation at any step, resulting in different amounts of plaques being formed. Alternatively,
the isoforms can exert different influences on the molecular conformation or composition of the
seed-capable species of Aβ (oligomers) early on in the process. This, in turn, can change their
seeding potency or morphology, both of which can affect the Aβ plaques being formed
downstream, either in terms of number or morphotype. Our study attempted to test this latter
hypothesis. Length of arrows are surrogate of kinetic rates for the corresponding reactions. B, A
graphical abstract of our experimental findings and conclusions.
133
Table 3.1 Post-inoculation mortality rates in APP23 hosts
APP23 Hosts # Injected # Survive Mortality Rate

Male 33 6 81.8 %
Female 27 13 51.8 %
Total 60 19 68.3 %
Table 3.2 Post-inoculation mortality rates in APP NLF-KI hosts
APP NLF-KI # Injected # Survive Mortality Rate

Hosts
Male 26 22 15.4 %
Female 31 28 9.7 %
Total 57 50 12.3 %
134
Chapter 4
Lack of hepatic apoE does not influence early

Aβ deposition: Observations from a new
APOE knock-in model
This chapter is adapted from a manuscript published in Molecular Neurodegeneration:
Huynh, T.V.*, Wang*, C., Tran, A.S., Mahan T.E., Tabor, G.T., Francis, C.M., Finn, M.B.,
Spellman, R., Manis, M., Rudolph E. Tanzi, Ulrich, J.D., & Holtzman, D.M. Lack of
hepatic apoE does not influence early Aβ deposition: Observations from a new APOE
knock-in model. Molecular Neurodegeneration 14(1):37, doi:10.1186/s13024-019-0337-1
(2019).
*Equal contribution
T-P.V.H., C.W., J.D.U., and D.M.H. conceived the project and designed the experiments. T-
P.V.H, J.D.U, and D.M.H. analyzed the data and wrote the paper. T-P.V.H. and C.W. performed
most of the experiments, assisted by A.C.T, G.T.T, T.E.M, C.M.F., M.B.F., R.S., M.M., R.E.T.,
and J.D.U. All authors read and commented on the manuscript.
135
4.1 Summary
Background: The apolipoprotein E (APOE) gene is the strongest genetic risk factor for
late-onset Alzheimer disease (AD). ApoE is produced by both astrocytes and microglia in the
brain, whereas hepatocytes produce the majority of apoE found in the periphery. Studies using
APOE knock-in and transgenic mice have demonstrated a strong isoform-dependent effect of apoE
on the accumulation of amyloid-β (Aβ) deposition in the brain in the form of both Aβ-containing
amyloid plaques and cerebral amyloid angiopathy. However, the specific contributions of different
apoE pools to AD pathogenesis remain unknown.
Methods: We have begun to address these questions by generating new lines of APOE
knock-in (APOE-KI) mice (ε2/ε2, ε3/ε3, and ε4/ε4) where the exons in the coding region of APOE
are flanked by loxP sites, allowing for cell type-specific manipulation of gene expression. We
assessed these mice both alone as well as after crossing them with mice with and without amyloid
deposition in the brain as well as after removing apoE expression from hepatocytes using
biochemical and histological methods.
Results: As in other APOE knock-in mice, apoE protein was present predominantly in
astrocytes in the brain under basal conditions and was also detected in reactive microglia
surrounding amyloid plaques. Primary cultured astrocytes and microglia from the APOE KI mice
secreted apoE in lipoprotein particles of distinct size distribution upon native gel analysis with
microglia particles being substantially smaller than the HDL-like particles secreted by astrocytes.
Crossing of APP/PS1 transgenic mice to the different APOE-KI mice recapitulated the previously
described isoform-specific effect (ε4 > ε3) on amyloid plaque and Aβ accumulation. Deletion of
APOE in hepatocytes did not alter brain apoE levels but did lead to a marked decrease in plasma
136
apoE levels and changes in plasma lipid profile. Despite these changes in peripheral apoE and on
plasma lipids, cerebral accumulation of amyloid plaques in APP/PS1 mice was not affected.
Conclusions: Altogether, these new knock-in strains offer a novel and dynamic tool to
study the role of APOE in AD pathogenesis in a spatially and temporally controlled manner.
137
4.2 Introduction
Over the past 20 years, studies on apolipoprotein E (apoE) and its roles in various
physiologic processes (atherosclerosis, Alzheimer disease – AD, etc..) have relied heavily on
murine models that express the three main human isoforms (ε2, ε3, and ε4) under the control of
30,33,78
the endogenous murine apoE regulatory sequences . These APOE knock-in mice were
generated through targeted replacement strategies (referred to as APOE-TR mice from here
onward) and have played instrumental roles in elucidating the isoform-specific differences in lipid
metabolism and receptor binding affinity. In the context of AD, APOE modifies the risk for
development of late-onset AD in an isoform-dependent manner (ε2 < ε3 < ε4, where the ε4 allele
carries the highest risk) 39. One mechanism through which APOE influences AD risk is through
its effects on the metabolism of the amyloid-β peptide (Aβ), the main constituent of amyloid
plaques found in AD patients. Indeed, crossing of transgenic mice that develop Aβ deposition in
the brain (e.g. APP/PS1 or PDAPP mice that develop human-like Aβ plaques) to APOE-TR mice
2,14
led to an isoform-dependent effect on cerebral amyloid plaque accumulation , which is
consistent with observations in humans 58. Intriguingly, the effects of APOE on amyloidosis appear
to be both isoform- and quantity-dependent, as reduction of apoE3 and apoE4 levels through
genetic 8,43 or pharmacologic 38 manipulations results in reduction of cerebral amyloid plaque load.
While these studies shed important insights on one aspect of apoE’s role in AD pathogenesis, it
remains unclear whether the effects resulted from a cell-independent or cell-autonomous
mechanism.
Emerging data indicate that APOE not only affects AD risk, but also severity of pathology
19,46,75,81
in dementia with Lewy bodies and neurodegeneration in tauopathies . In particular,
42,47,62,75
microglia-derived apoE appears to regulate the inflammatory response , suggesting that
138
the cellular source of apoE in both the brain and periphery has distinct functions in different
63 76
diseases. In the brain, both astrocytes and microglia contribute to the pool of apoE.
Additionally, apoE cannot cross the blood-brain barrier (BBB) 9, thus the pools of apoE in the
central nervous system (CNS) and the periphery exist predominantly independently from one
another. Some early studies in Apoe-deficient mice found age-dependent synaptic loss and learning
56
deficits . These deficits reflect the potential role of apoE in multiple physiologic processes
74,84
responsible for maintaining brain homeostasis, including protection from oxidative damage ,
maintenance of the BBB 5,26, and cholesterol transport in the setting of synapse development 57 or
neuronal injury 66. Intriguingly, rescue of peripheral Apoe expression in an Apoe knock-out mice
rescues the learning and memory deficit found in Apoe-deficient mice, despite exhibiting a similar
49
degree of synaptic loss . These findings suggest that both CNS and peripheral apoE (together
with plasma lipids) are independent parameters that can affect neuronal function.
These and many other outstanding gaps in knowledge regarding apoE biology necessitate
an experimental model where APOE expression can be specifically manipulated in different tissues
and cell types. Here, we report the generation of an APOE knock-in mouse model where the
various human APOE variants (ε2, ε3, and ε4) replace the endogenous murine Apoe locus (termed
E2F, E3F, E4F mice individually, and APOE-KI mice collectively). Importantly, the human locus
(specifically exons 2 to 4) is flanked by loxP sites that allow for the tissue-specific manipulation
of APOE expression. We characterized the expression of apoE in the brain and brain cell types as
well as the effects of APOE isoforms on Aβ deposition in this new model. We also investigated
the effects of peripheral APOE knock-out (via hepatocyte-specific deletion of APOE expression
using the albumin promoter) on plasma cholesterol homeostasis as well as Aβ deposition in the
brain.
139
4.3 Results
Design and generation of APOE-KI mice
In order to investigate the effects of tissue-specific APOE deletion, we set out to create a
knock-in model that can allow for promoter-specific deletion of the APOE coding region under
the Cre-loxP system. Three separate vector constructs with human sequences corresponding to the
ε2, ε3, and ε4 alleles of APOE were generated with loxP sites flanking exons 2 through 4 (Figure
4.1A – 4.1E). The targeting strategy allows for the humanization of the coding region within the
murine Apoe gene (Figure 4.1A) with the various human isoforms (APOE-ε2, APOE-ε3, and
APOE-ε4), as well as the opportunity to conditionally knock-out the coding region of the gene.
Mouse genomic sequence from the translation initiation codon in exon 2 to the termination codon
in exon 4 was replaced with its human counterparts: [Cys130, Cys176] for APOE-ε2, [Cys130,
Arg176] for APOE-ε3, and [Arg130, Arg176] for APOE-ε4 (Figures 4.10B, 4.10C, and S1D).
Exons 2 to 4 (~3.9 kb) are flanked by LoxP sites to allow for conditional deletion by Cre-
recombinase. Homologous recombinant clones were isolated using double positive (NeoR and
PuroR) and negative (Thymidine kinase - TK) selections, and the respective resistance genes were
included in the targeting vector (Figures 4.1B, 4.1C). The constitutive humanized/conditional
knock-out alleles were achieved after in vivo Flp-mediated removal of the selection markers
(Figure 4.1D). In the presence of Cre-recombinase (either through directed genetic crossing with
a Cre line or viral vector), constitutive knock-out of the APOE gene is achieved when the loxP-
flanked region is removed (Figure 4.1E). Of note, the chimeric locus retains all normal mouse
regulatory sequences in addition to the non-coding exon one. Exon 2 contains the translation
initiation codon (Figure 4.10A). The cleavable signal peptide is encoded within exons 2 and 3
(amino acids 1-18 – Figure 4.10A). Due to the non-conserved cleavage sites of mouse and human
140
signal peptides (please see alignment – Figure 4.10A), the humanized allele expresses the full-
length human APOE protein, including its signal peptide, rather than a fusion protein between the
mouse signal peptide and the human mature protein. To verify accuracy and successful creation of
the model, brain samples from all 3 lines were submitted for sequencing of exon 4 of the APOE
locus by GENEWIZ, which confirmed the presence of human sequence and appropriate single
nucleotide polymorphisms (SNPs) specific for each isoform. Further details on the specific design
of the vector can be found in the methods section.
We first characterized the newly created APOE-KI strains by confirming the presence of
human APOE mRNA expression in the mice with qPCR analysis (Figures 4.10E and 4.10F). At 3
months of age, there was a slight, but statistically significant, elevation in APOE mRNA level in
the hippocampus of E4F mice compared to E2F or E3F mice (Figure 4.10E). We also assessed
APOE mRNA levels in whole brain hemispheres. Again, APOE mRNA levels were similar
between genotypes, although APOE mRNA levels were slightly lower in E2F mice compared to
either E3F or E4F mice, both of which were statistically significant (Figure 4.10F). Next, we
biochemically assessed the apoE protein levels in the brains of APOE-KI mice at 21 days and 3
months after birth. At 21 days of age, apoE protein levels in the cortex were significantly higher
in E2F mice relative to those found in E3F or E4F mice (Figure 4.1F). At 3 months of age, there
was no difference in PBS-soluble apoE protein concentration between E2F and E3F mice, while
E4F mice had significantly lower levels relative to E2F mice (Figure 4.1G). We also measured
guanidine-soluble apoE and found E3F mice to have significantly higher levels than E2F mice
(Figure 4.1H). Lower apoE protein levels in 3-month-old E4F mice were also seen via Western
blot analysis of the same brain lysates utilizing HJ15.7 as the detecting antibody (Figure 4.1I).
This latter finding was replicated using another anti-apoE antibody (Figure 4.10H). These data
141
demonstrated that the newly generated APOE-KI mice expressing different apoE isoforms have
similar levels of human APOE mRNA in the brain. Some differences in protein levels (higher
apoE2, lower apoE4) are likely secondary to differences in protein stability, half-life, and
metabolism, as has been seen in previous APOE knock-in mice 2,16,27,32,41,48,87,91,96.
Human APOE is expressed in astrocytes and microglia in APOE-KI mice
The majority of apoE molecules in the CNS are synthesized by astrocytes 63, with a small
portion coming from microglia 76. We further characterized the expression pattern of apoE in the
brain of APOE-KI mice by co-staining for apoE and traditional markers for astrocytes as well as
microglia. We confirmed the presence of apoE protein in astrocytes by co-staining for apoE and
the astrocytic marker GFAP (Figure 4.2A). We also assessed microglia for the presence of apoE
protein by co-staining for the microglial marker IBA1, however, we did not observe significant
overlap of apoE and IBA1 signal (Figure 4.2B). For simplicity, only representative images from
E4F mice are shown, as similar findings were found in E2F and E3F mice.
ApoE’s role in AD pathogenesis was first recognized when apoE was found to co-localize
with amyloid plaques, specifically at the center (i.e. the “core”) of mature, fibrillar amyloid plaques
59,89
. ApoE expression is low in microglia under basal, homeostatic conditions, but is strongly up-
12,13,62,95
regulated in the setting of various neurodegenerative insults . Thus, we investigated
whether apoE can be found in microglia in the setting of amyloidosis, specifically in the APP/PS1-
21 model which develops Aβ deposition in amyloid plaques beginning at 6-8 weeks of age 67
.
APP/PS1-21 mice were crossed with APOE-KI mice for two successive generations and the brain
sections from 4-month-old APP/PS1-21 mice homozygous for human APOE alleles (ε2/ε2, ε3/ε3,
or ε4/ε4) were subjected to immunohistochemical analysis. Qualitative assessment of the staining
142
pattern showed co-localization of apoE in the center of plaques, and significant co-localization
with IBA1 in surrounding microglia, suggesting microglial expression of apoE (Figures 4.3A,
4.3B). We made similar observations in APP/PS1-21 mice expressing APOE-ε2 and APOE-ε3
(data not shown). These histological observations confirm the presence of apoE in astrocytes and
microglia, which is consistent with previous studies, and highlight the validity of our model
system.
Qualitative assessment of microglia and astrocyte-derived apoE particles
Most of the biologically active apoE exists in the brain in lipidated HDL-like particles and
alterations in the lipidation state of apoE have been shown to drastically affect Aβ accumulation
in models of Aβ amyloidosis 34,35,45,85,86

. Thus, we investigated whether apoE particles from
astrocytes and microglia are comparable in size, which is associated with the amount of lipidation.
To assess how apoE lipoprotein particles derived from microglia compare to those derived
from astrocytes, conditioned media samples from primary microglial and astrocyte cultures
derived from post-natal day 1-3 E2F, E3F, and E4F pups were subjected to non-denaturing
gradient gel electrophoresis (NDGGE) followed by Western blotting. ApoE-containing
lipoprotein particles from astrocyte-conditioned media for all three APOE isoforms were > 12 nm
17,21
in diameter, consistent with what has been reported previously (Figure 4.4) . While the E2F
and E3F astrocyte-derived particles showed little to no particles that were < 12 nm in size, E4F
astrocytes did appear to produce a small, but notable, amount of approximately 8 nm-sized
particles (Figure 4.4). Microglia-conditioned media contained apoE particles that were overall
much smaller than the astrocyte-derived particles. For E3F and E4F microglia, the majority of
particles produced were about 8 nm in size with a small amount of particles 10 – 17 nm in size
143
(Figure 4.4). However, for E2F microglia there did appear to be a shift in the relative amount of
10-15 nm-sized particles versus 8-nm-sized particles. While E2F microglia did produce a
considerable amount of ~8 nm-sized particles, more 10 – 15-nm-sized particles were present than
what was seen for E3F and E4F microglia. As larger particles contain greater amounts of
cholesterol and phospholipid, these findings suggest that microglia secrete poorly lipidated apoE
relative to the larger HDL-like lipoproteins secreted by astrocytes. These results highlight the need
for future studies to more closely examine the properties of these apoE-containing particles and
whether they also differ in their normal function as well as in pathological states.
APOE isoform-dependent effect on Aβ accumulation in APP/PS1/EKI mice
While APOE may influence AD pathogenesis in several ways, one of the major
mechanisms is via its effect on Aβ accumulation in the brain, specifically on Aβ seeding and
clearance. As previous APOE knock-in mice have been shown to influence Aβ deposition in an
2,8,14,24,43,61,91
isoform-dependent fashion , we wanted to assess the effects of the major human
APOE isoforms in the new APOE-KI model. Specifically, we investigated the effect of different
human APOE alleles on Aβ accumulation in APP/PS1-21 transgenic mice. In this model,
overexpression of the amyloid precursor protein (APP) in neurons leads to cerebral accumulation
of Aβ-containing plaques that resemble those found in AD brains 67. We crossed APP/PS1-21 mice
on a C57BL/6 background with either E2F, E3F, or E4F mice on a C57BL/6 background to obtain
APP/PS1-21 transgenic mice on an APOE-ε2, ε3, or ε4 background (APP/PS1/E2F, APP/PS1/E3F,
and APP/PS1/E4F mice, respectively) that do not express murine Apoe (collectively referred to as
APP/PS1/EKI mice). We first measured the amount of PBS-soluble apoE in the cortex of
APP/PS1/EKI mice via ELISA (Figure 4.6A) and found overall apoE protein levels to be similar
144
to those seen in APOE-KI mice. ApoE protein concentration in the cortex of APP/PS1/E4F mice
was slightly, albeit statistically significantly, higher than those found in APP/PS1/E3F mice.
Since the APP/PS1-21 mice have visible neocortical plaque deposits beginning around 2
67
months of age , we assessed plaque accumulation in APP/PS1/EKI mice at 4 months of age,
when sufficient plaques are present in the neocortex to allow for quantitative assessments. We first
examined cerebral plaque load histologically by staining brain sections with an anti-Aβ antibody
HJ3.4b (Figure 4.5A). Quantitative analysis of the area covered by HJ3.4b staining in the cortex
showed independent, but significant, effects of sex and APOE isoform. Post hoc analysis
comparing APOE genotype within each sex found a significant increase in Aβ deposition in female
apoE4-expressing mice compared to apoE3. There were no significant difference in Aβ burden
between APP/PS1/E2F mice (males or females) and either of the other APOE genotypes. We next
quantified the area covered by X-34 staining, which detects fibrillar amyloid plaques (Figure
4.5B). Again, there were significant and independent effects of sex and APOE genotype. Post hoc
analysis comparing apoE isoform within each sex did not find a statistically significant difference,
although there was a trend towards elevated X-34 staining in apoE4-expressing female mice
compared to apoE2 and apoE3. The relative differences in cortical burden of Aβ and X-34
pathology between different isoforms are very similar to what we observed when APP/PS1-21
43
mice were crossed to APOE-TR mice (Figure 4.11A and 4.11C) and in our published data .
Interestingly, there was no effect of sex on Aβ pathology in this latter model (Figure 4.11B and
4.11D).
To characterize the factors that account for the differences in Aβ pathology, we assessed
the plaque density and average plaque size in APP/PS1/EKI mice. For Aβ staining, there was a
145
significant effect of sex and APOE genotype, but no interaction. Post hoc analysis showed an
increase in plaque density in female APP/PS1/E4F compared to APP/PS1/E3F mice (Figure 4.5C).
There was a significant effect of sex, but not of APOE genotype, on average plaque size (Figure
4.5D). For X-34 staining, there was a significant effect of sex and APOE genotype (but no
interaction) on plaque density. Post hoc analysis comparing APOE genotype within each sex found
a significant increase in plaque density in female APP/PS1/E4F mice compared to APP/PS1/E3F
or APP/PS1/E2F mice (Figure 4.5E). There was a significant effect of sex, but not APOE genotype
on average X-34 plaque size. No differences were detected on post hoc analysis between any
subgroup (Figure 4.5F).
To further assess the total amount of Aβ accumulation, we measured the amount of PBS-
soluble and PBS-insoluble (guanidine fraction) Aβ40 and Aβ42 in the cortex of APP/PS1/EKI mice.
We observed a significant increase in PBS-soluble Aβ40 and Aβ42 in APP/PS1/E2F mice compared
to APP/PS1/E3F mice (Figures 4.6B and 4.6C) and significantly higher levels of Aβ42 in
APP/PS1/E4F compared to APP/PS1/E3F mice (Figure 4.6C). In the guanidine fraction (PBS-
insoluble fraction) where the majority of Aβ accumulates, we detected a significant increase (~ 2-
fold) in insoluble Aβ42 in APP/PS1/E4F mice relative to APP/PS1/E3F mice (Figure 4.6D and
4.6E). There were no statistically significant differences between the other groups.
Our findings are consistent with previous studies where APOE-TR mice were crossed to
80
various models of amyloidosis and recapitulate (at least in part) the allele-dependent effect of
APOE on amyloid deposition found in humans.
Plasma lipid alterations in mice lacking liver-derived apoE
146
3,4,25,36,83
Previous studies from our lab and others showed that complete ablation or
reduction 8,38,43
of apoE levels results in a decrease of Aβ pathology, particularly a marked
reduction of fibrillar Aβ in the brain. However, it was difficult to assess the contribution of
peripheral apoE ablation to phenotypes found in the brain in complete knock-out models. Thus, it
remains unclear whether peripherally-derived apoE (or lack thereof) exerts any effect on cerebral
amyloid pathology when apoE is still present in the brain. To this end, we took advantage of the
newly created APOE-KI lines and investigated whether a lack of the main source of peripheral
apoE in the blood, (i.e. the liver), can influence Aβ pathology in the brain.
While apoE is synthesized by a number of different organs outside of the CNS, the liver
53
accounts for most circulating apoE . Thus, we set out to ablate APOE expression in the liver
through Cre-lox technology, targeted through the hepatocyte-specific Alb promoter (that normally
controls albumin expression). Specifically, mice expressing Cre-recombinase under the Alb
90
promoter (Alb-Cre mice) were crossed with APOE-KI mice for two successive generations to
obtain Alb-Cre mice on all three human APOE backgrounds (AlbCre-EKI). The AlbCre-EKI mice
were subsequently crossed with APP/PS1/EKI mice to achieve hepatocyte-specific knock-out of
APOE in APP/PS1/EKI mice (APP/PS1/E2FCre, APP/PS1/E3FCre, APP/PS1/E4FCre mice, and
APP/PS1/EKICre mice collectively). Littermates lacking Cre-recombinase expression (Cre-/-) serve
as controls, which are effectively APP/PS1/EKI mice. We first confirmed successful deletion of
APOE from hepatocytes by performing qPCR analysis from liver tissue, which showed
undetectable levels of APOE mRNA in Cre-expressing mice (Figure 4.7A). We next measured
apoE protein from liver tissue and also found the levels to be markedly decreased in Cre-expressing
mice, regardless of APOE genotype (Figure 4.7B). APP/PS1/E2F mice also had significantly more
147
apoE protein in the liver relative to APP/PS1/E3F or APP/PS1/E4F mice, despite similar hepatic
expression of APOE mRNA.
We also collected the plasma from APP/PS1/EKICre mice and investigated the effect of
Alb-Cre expression on the levels of apoE protein as well as the major lipid species. Due to the
observed effect of sex on Aβ pathology in APP/PS1/EKI mice (Figures 4.5 and 4.6), the males and
females from this cohort were analyzed independently. Assessment of apoE levels in the plasma
of male APP/PS1/EKICre mice through an ELISA assay showed a significant effect of APOE
genotype and Cre expression, with a significant interaction (Figure 4.7C). Plasma apoE levels in
female mice were also influenced by APOE genotype and Cre expression, with a significant
interaction between the latter two parameters (Figure 4.7D). We performed post hoc pair-wise
comparisons between male Cre+/- and Cre-/- groups, and found Cre expression significantly
decreased plasma apoE levels across apoE isoforms regardless of sex (Figures 4.7C and 4.7D).
Notably, residual amounts of apoE protein were detected in both male (Figure 4.7C) and female
(Figure 4.7D) APP/PS1/E2FCre mice, likely because apoE2 has a low affinity for the LDL receptor.
As apoE plays an essential physiologic role in peripheral lipid homeostasis, we next
examined the levels of total cholesterol (TC), triglycerides, and HDL in the plasma of
APP/PS1/EKICre mice. For these analyses, male and female were analyzed separately, and plasma
samples from mice with global deletion of murine Apoe (EKO mice) were included for
comparative purposes (n = 5 males, 3 females). Our analyses of male mice showed a significant
effect of both APOE and Cre genotype on plasma TC, with a significant interaction between these
two parameters. Post hoc pair-wise comparisons between Cre+/- and Cre-/- groups found Cre
expression to significantly increase plasma TC levels in mice expressing apoE2 or apoE3, but not
148
apoE4 (Figure 4.7E). Similarly, significant effects of APOE and Cre genotype on plasma TC were
found in female mice, with significant interaction between APOE and Cre genotype. Post hoc pair-
wise comparisons between Cre+/- and Cre-/- groups found Cre expression to significantly increase
plasma TC levels in apoE2-expressing mice, but not apoE3 or apoE4-expressing mice (Figure
4.7F). In both male and female mice, the TC level in APP/PS1/E2FCre mice is of greatest
magnitude, and appeared to be comparable to those found in EKO mice (though the EKO mice
were not included in the direct statistical analysis). Plasma triglyceride concentrations in male mice
follow a similar trend with a significant effect of APOE genotype and Cre expression, with a
significant interaction. Post hoc pairwise comparisons between Cre+/- and Cre-/- groups found Cre
expression significantly increased triglyceride levels in mice expressing apoE2 and apoE3, but not
apoE4 (Figure 4.7G). In female mice, there was a significant effect of APOE and Cre genotype,
but no significant interaction. Post hoc pair-wise comparisons did not identify significant
differences in triglyceride levels in that are dependent on Cre expression (Figure 4.7H). In male
mice, there was a significant effect of APOE genotype, but not Cre expression, on plasma HDL
levels, with a significant interaction between APOE and Cre genotypes (Figure 4.7I). Similarly,
there was a significant effect of APOE genotype, but not Cre expression in female mice (Figure
4.7J). There were no significant interactions between APOE and Cre genotypes in female mice.
The changes in plasma lipid composition found in APP/PS1/EKICre mice have some
similarities and some differences compared to what was found in EKO mice. Though no direct
statistical comparison was performed, the incongruence in some of the dataset relative to the EKO
control could reflect the effect of residual extrahepatic APOE expression (e.g. in macrophages)
that is below the detection limit of our ELISA assay.
149
Liver-derived apoE does not influence Aβ accumulation in the brain
We next examined the effects of hepatocyte-specific APOE deletion on cerebral Aβ
accumulation. Again, due to the observed effect of sex on Aβ pathology in APP/PS1/EKI mice
(Figures 4.5 and 4.6), the males and females from this cohort were analyzed independently. Brain
sections from 4-month-old APP/PS1/EKICre mice and littermate controls were assessed for Aβ
immunostaining with HJ3.4b antibody (Figures 4.8A, 4.8B, and 4.8C). Quantitative analyses in
both male (Figure 4.8G) and female (Figure 4.8H) mice found a significant effect of APOE
genotype, but not Cre expression on the cortical area covered by Aβ staining. To further
characterize the nature of the deposited Aβ plaques, brain sections were stained with X-34 dye
which only stains fibrillar plaques (Figures 4.8D, 4.8E, and 4.8F). Quantitative analyses of the area
covered by X-34 staining showed similar trends to those found in HJ3.4b staining, with a
significant effect of APOE genotype, but not Cre expression, in both male (Figure 4.8I) and female
(Figure 4.8J) mice.
To examine whether Alb-Cre expression alter apoE protein levels in the brain of
APP/PS1/EKICre mice, we performed ELISA assays on cortical brain homogenates. In PBS-
soluble fraction from male mice, there was a trend towards a significant effect of APOE genotype,
but no significant effect of Cre genotype, on apoE protein levels (Figure 4.9A). In female mice,
there was no significant effect of APOE or Cre genotype (Figure 4.9B). No differences between
any subgroups were detected on post hoc analyses of male or female mice. In the guanidine-soluble
fraction from male mice, there was a trend towards a significant effect of APOE genotype, but not
Cre genotype, on apoE protein level (Figure 4.9G). In female mice, there was a significant effect
of APOE genotype, but not Cre genotype, on apoE protein level (Figure 4.9H). Post hoc analysis
150
found no significant effect of Alb-Cre on guanidine-soluble apoE in either male (Figure 4.9G) or
female (Figure 4.9H) mice.
Next, we analyzed total Aβ levels in APP/PS1/EKICre mice and their respective Cre-/-
littermates. For these analyses, cortical samples from APP/PS1-21 mice with global deletion of
murine Apoe (APP/PS1/EKO mice) were included for comparative purposes, and were not
included in statistical analyses due to low n (n = 4, 3 males, 1 female). The cortices were
sequentially homogenized in PBS and 5M guanidine and the amounts of Aβ40 and Aβ42 were
measured in each fraction via ELISA. In the PBS-soluble fraction from both male (Figure 4.9C)
and female (Figure 4.9D) mice, we detected a significant effect of APOE genotype on the levels
of Aβ40. Similarly, there was significant effect of APOE genotype on Aβ42 levels in male mice
(Figure 4.9E). In female mice, there was a trend towards a significant effect of APOE genotype on
the levels of Aβ42 (Figure 4.9F). In our analyses of PBS-soluble Aβ40 or Aβ42, there were no
significant effects of Cre expression or an interaction between APOE genotype and Cre expression
in male or female mice. In the guanidine-soluble fraction, we also observed a significant effect of
APOE genotype on Aβ40 (Figure 4.9I) and Aβ42 (Figure 4.9K) in male mice. In female mice, there
was a significant effect of APOE genotype on Aβ40 (Figure 4.9J) and Aβ42 (Figure 4.9L) levels. In
our analyses of guanidine-soluble Aβ40 or Aβ42, there were no significant effects of Cre expression
or an interaction between APOE genotype and Cre expression in male or female mice. Of note,
the APP/PS1/EKO mice had lower levels of Aβ40 or Aβ42 than most other genotypes, but direct
comparison was not performed due to low n value.
151
Together, these results suggest that, while depletion of human APOE expression in
hepatocytes led to a marked lowering of plasma apoE with some changes in plasma lipid
composition, there were no significant effects on cerebral Aβ accumulation.
4.4 Discussion
APOE is the strongest genetic risk factor for late-onset AD and intensive research efforts
have led to several important insights regarding apoE and its role in AD. Nevertheless, cell-type
specific roles for APOE isoform expression, secretion, and lipidation in neurodegenerative disease
remain poorly understood. In an effort to help to begin to answer these and other questions, we
created a new generation of human APOE-expressing mice to study cell-specific processes.
Specifically, we generated three separate lines of APOE-KI mice, each carrying one of the three
most common variants of the human APOE gene. The presence of loxP site on either side of the
human gene sequence allow for cell-type-specific manipulation of APOE expression through the
Cre-loxP system. Here, we characterized the newly created mice in terms of CNS as well as
peripheral expression. We also qualitatively compared apoE particles isolated from astrocytes and
microglia, and found the latter to produce significantly smaller lipid-containing particles. We took
a step further to validate the functionality of the loxP sites by specifically ablating hepatocyte
expression of APOE, effectively eliminating the majority of apoE protein in the plasma. We found
this virtual absence of apoE in the plasma to cause significant alterations in the plasma lipid profile
without significantly altering cerebral amyloid plaque accumulation in a model of Aβ-driven
amyloidosis.
Our targeting construct retained the natural genetic context surrounding the human exon
sequence, including endogenous regulatory elements such as enhancers. Thus, we expected the
152
tissue-specific expression of the human APOE gene to closely parallel that of the endogenous
mouse Apoe gene. Our APOE gene expression and protein analysis in the brain and plasma showed
2,28,78,91
a similar expression level to wild type C57/BL6 mice and other APOE knock-in mice .
Interestingly, we detected a subtle but statistically significant isoform-dependent difference in
APOE mRNA levels in APOE-KI mice, where higher mRNA levels were detected in E4F mice
relative to E2F or E3F mice in the hippocampus and lower levels of mRNA were detected in the
brain hemisphere of E2F mice compared to E3F or E4F mice. These different mRNA levels could
arise from compensatory changes in APOE transcription in response to isoform-dependent
differences in protein stability or subtle differences in mRNA stability. Other than our new model,
one other APOE knock-in model with floxed APOE alleles has been described 8. In one
experiment, apoE4 reduction in adult hippocampal astrocytes using an AAV-Cre vector resulted
in a 50% decrease in insoluble Aβ42 in PDAPP mice 8. Future studies using floxed allele APOE KI
mice can test the temporal and cell-type specific effects of disrupting APOE expression on Aβ and
tau pathology using a variety of inducible Cre mouse strains.
At 3 months of age, there was significantly less PBS-soluble apoE in the cortex of E4F
mice compared to those from E2F or E3F mice at the same age, consistent with previously
described findings in human and other APOE transgenic and knock-in mouse models
2,16,27,32,41,48,87,91,96
. Concordantly, the level of apoE2 protein is the highest compared with other
2,70
apoE isoforms in the CSF , interstitial fluid (ISF) 82, brain parenchyma 77, and plasma 52,65,68
.
The reason apoE2 is generally higher both in brain and plasma is likely due to decreased strongly
reduced binding affinity to the LDL receptor 73. Some studies report apoE4 is more susceptible to
31,37
proteolysis compared to the other major isoforms of APOE , and other studies have
15,71
demonstrated the presence of apoE4 fragments (14–20 kDa) in AD brains . Structural
153
differences between apoE3 and apoE4, particularly at the hinge region between the N- and C-
terminal domains, may explain their different susceptibility to proteolytic degradation as well as
lipid binding affinity 23. In spite of these numerous observations, the exact nature of the protease
responsible for apoE4 cleavage is unknown, although several candidates have been reported
including cathepsin D 97, aspartic proteases 55, and a chymotrypsin-like protease 31. A prior study
using APOE-TR mice reported differences in apoE protein levels only in the hippocampus and
cortex, regions that are susceptible to neurodegeneration in AD brains 91. Significant differences
in protein levels among apoE isoforms (apoE4 < apoE3 < apoE2) were also observed in the CSF
and brain homogenates of APOE-TR mice when crossed to PDAPP mice 2. It will be important in
future studies to assess both CSF and brain levels of apoE in our new model in multiple brain
regions as well as in all relevant cell types. Importantly, these results should be complemented
with similar studies in human.
In regards to the effects of apoE isoforms in our new model on Aβ aggregation and
accumulation in the brain, we found very similar findings that we described previously in
APP/PS1-21 mice crossed to another APOE knock-in model 38,43. Namely, the presence of apoE4
in the brain resulted in significantly greater Aβ deposition than apoE3, similar to what is seen in
58,69
humans . However, when different APP transgenic mouse strains were crossed with other
APOE knock-in mice, apoE2-expressing mice generally exhibited less Aβ deposition than those
expressing apoE3 or apoE4 2,8,14, also similar to what is seen in humans. Crossing of APP/PS1-21
mice to our new APOE-KI model results in similar levels of Aβ accumulation in those expressing
apoE2 and apoE4. Interestingly, crossing of another APOE knock-in model (APOE-TR mice) with
APP/PS1-21 mice also resulted in similar levels of Aβ deposition in apoE2- and apoE4-expressing
mice (Figures 4.11A and 4.11C). The effect of sex on Aβ pathology in our new EKI models are
154
intriguing, as we did not detect an effect of sex on Aβ pathology when the APOE-TR mice were
crossed to the same strain of APP/PS1-21 mice (Figures 4.11B and 4.11D). In another APP/PS1
transgenic model, 5XFAD mice, apoE2-expressing mice were also found to have similar Aβ
deposition to those expressing apoE3 or apoE4 in the subiculum 91. In aggressive amyloidogenic
models such as APP/PS1-21 and 5XFAD, due to the particular APP and PS1 mutations present,
there is a much higher ratio of Aβ42 to other Aβ species than in many less aggressive APP
transgenic mice 67. Since Aβ42 is more aggregation-prone than other Aβ species 72, this difference
might abrogate the effect of apoE2 on lowering Aβ pathology compared to other models and in
humans. Further studies with our new model can test this hypothesis in other APP models such as
APP knock-in mice or APP transgenic mice.
Outside of the brain, apoE is synthesized in multiple other sites, including the liver, spleen,
20,88,92
adrenal gland, lung, testis, and ovary . Total knock-out of Apoe results in severe
hypercholesterolemia with accelerated atherosclerosis in the periphery 64,94, accompanied in some

56
but not all studies 22 by synaptic loss and cognitive dysfunction. Due to the nature of a global
knock-out, it was difficult to assess in the latter finding whether lack of apoE in the brain, in the
periphery, or both, was responsible for the aforementioned phenotype. Given these outstanding
questions, we tested whether specific ablation of a large source of peripheral apoE could modulate
cerebral Aβ pathology. Indeed, virtual ablation of plasma apoE using an Alb-Cre line did not result
in any change in cerebral apoE levels, which is consistent with previous reports on the inability of
peripheral apoE to cross the BBB 9 or the blood-CSF barrier 51. It is worth noting that hepatocytes
92 93
are not the sole source of apoE in the periphery, as peripheral macrophages and adipocytes
are known to contribute to the pool of apoE in the plasma. Accordingly, we did detect a non-
negligible amount of apoE protein in plasma from APP/PS1/E2FCre mice, likely due to apoE2’s
155
low affinity for the LDL receptor 10,44 that results in slower clearance from the plasma. The lack
of detection in APP/PS1/E3FCre and APP/PS1/E4FCre mice was perhaps due to a combination of
lower protein levels and over-dilution that put the concentration outside of the assay’s detection
limits. Our histological and biochemical analyses of cerebral Aβ pathology did not reveal a
significant effect of knocking out liver-derived apoE at 4 months of age. Additionally, we failed
to detect any changes in the degree of astrogliosis or microgliosis immediately surrounding the
plaques between APP/PS1/EKICre mice and their Cre-/- littermates (data not shown). Altogether,
our data suggest CNS- and peripherally-derived apoE exist in distinct pools that are independent
from one another, as has been suggested in human studies 1. However, we cannot rule out other
hypotheses that would otherwise explain for a lack of any appreciable effect on Aβ in
APP/PS1/EKICre mice, such as an unknown adaptive response that masked the contribution of
hepatic apoE to brain Aβ pathology.
Alternatively, it is possible that apoE from one pool can indirectly exert an effect on the
other side of the BBB. For example, a recent study showed that restoration of peripheral Apoe
49
expression led to a partial rescue of cognitive phenotypes in mice lacking apoE in the brain .
These findings suggest a dual mechanism by which apoE deficiency causes behavioral deficits,
and that peripherally derived apoE may influence neuronal function through an indirect
mechanism, such as vascular dysfunction secondary to dyslipidemia or via effects on brain
endothelial cells that make up the BBB. In support of this latter hypothesis, prior studies found the
BBB in EKO mice to be severely compromised 26,29, and the severity (or permeability of the BBB)
29
also increased with age . Thus, it is conceivable that an effect of hepatocyte-derived apoE on
brain Aβ pathology may be observed in aged APP/PS1/EKICre mice, or if conditional knock-out
of hepatic apoE occurs at a later stage of Aβ pathology. Such an effect may be modulated by
156
apoE’s effects on cerebrovascular function and/or through its ability to cross the leaky BBB. Some
researchers have proposed a two-hit vascular hypothesis of AD cerebrovascular damage, where hit
1 is an initial insult on the BBB itself that is sufficient to initiate neuronal injury and
neurodegeneration, but can also promote the accumulation of Aβ in the brain through defects in
clearance of Aβ through the BBB (reviewed extensively in 60 and 79).
BBB dysfunction is a common co-occurrence and may directly contribute to

60,79
neurodegeneration and cognitive decline in AD . In support of this latter hypothesis, data
obtained from an older APOE knock-in model also supports an isoform-dependent effect of apoE
on BBB integrity, where EKO and apoE4-expressing mice developed vascular defects before
neuronal and synaptic changes occur 5. A more recent study showed apoE4-expressing mice to
have impaired spontaneous BBB repair following traumatic brain injury (TBI) compared to apoE2-
or apoE3-expressing mice 54. Both studies explored various mechanisms that could explain for the
negative influence of apoE4 on the BBB integrity, all of which involved changes in astrocytes and
pericytes located in the neurovascular unit. However, it is theoretically possible that peripherally
derived apoE species can somehow contribute to this process, especially with the leakiness of the
BBB in early stages of TBI and later stages of AD. As there are several sources of apoE in the
periphery, they could differentially affect BBB homeostasis. Intriguingly, a prior study utilized
bone marrow transplant to show that BBB homeostasis depends on equal contributions from tissue
and blood cell derived apoE, but lack of Apoe expression in bone marrow-derived cells alone was
enough to significantly increase the BBB permeability 29. These findings underscore the putative
role for leukocytes (i.e. macrophages) in BBB maintenance. It remains elusive how apoE from
bone marrow-derived cells may contribute to the integrity of the BBB, the dysfunction of which
79
had been proposed to contribute to neurodegeneration in AD . In this context, it would be
157
interesting to investigate whether restoration of APOE-ε4 expression in peripheral macrophages
could rescue BBB defects in EKO mice, and how that compares to restoration of APOE-ε2 or
APOE-ε3 expression.
It is our hope that these new APOE-KI mice will facilitate studies into apoE physiology
and AD pathogenesis. It is also important, however, to acknowledge their limitations. While the
APOE-KI mice harbor the human gene sequence, they retain the regulatory elements found in
mice. Considerable species differences between rodents and humans exist and might challenge our
ability to generate findings that are all relevant and directly translatable to humans from studies in
mice and rats. Apparent differences in physiological function and metabolism, such as lipid
metabolism and immune response between humans and rodents might preclude some discoveries
that are relevant to disease mechanism. For example, apoB is a ligand for the LDLR along with
apoE in humans, albeit with a lower affinity than apoE. Hepatic-derived apoB is secreted as
apoB100 (a full length protein) and contains the LDLR binding domain. However, a large portion
of hepatically derived apoB in mice is truncated (apoB48) and does not contain the LDLR domain.
Wild-type mouse VLDL and IDL contain roughly equal portions of apoB48 and apoB100, and this
leads to a compromised compensatory mechanism in the absence of apoE, leading to severe

11,94
hypercholesterolemia in Apoe knock-out mice . This latter example highlights the need to
address these and other caveats when interpreting rodent studies, especially in those where such
physiologic differences might confound some findings.
Conclusions
We employed a targeted gene replacement strategy to generate mouse lines that express
the three most common alleles of the human APOE gene at physiological levels. We fully
158
characterized all three lines with respect to their apoE levels in the CNS as well as the plasma,
from early life to adulthood. We partially recapitulated the isoform-dependent effect of APOE on
Aβ accumulation in a model of amyloidosis. Furthermore, we also validated the functionality of
the loxP sites in facilitating constitutive, tissue-specific, knock-out of APOE through liver-specific
expression of Cre-recombinase. Lastly, we also investigated the effects of knocking out liver-
derived apoE on plasma lipid profiles and Aβ deposition in the brain. Moving forward, these mice
should prove an invaluable asset for further studies on the physiological and pathophysiological
roles of APOE, especially the role of apoE isoforms in specific cell types and different organs in
the context of AD and other neurodegenerative diseases.
4.5 Experimental Procedures

Targeting construct. The targeting strategy allows the generation of a constitutive
humanization of the Apoe gene with the various human isoforms (APOE-ε2, APOE-ε3, and APOE-
ε4), as well as a conditional knock-out and a constitutive knock-out of the gene. The targeting
strategy is based on Ensembl transcripts ENSMUST00000174064 (mouse, corresponding to NCBI
transcript NM_009696.3) and ENST00000252486 (human, corresponding to NCBI transcript
NM_000041.3). The humanized alleles express the full length human proteins, including its signal
peptide. Mouse genomic sequence from the translation initiation codon in exon 2 to the termination
codon in exon 4 was replaced with its human counterparts: [Cys130, Cys176] for APOE-ε2,
[Cys130, Arg176] for APOE-ε3, and [Arg130, Arg176] for APOE-ε4. Exons 2 to 4 (~3.9 kb) have
been flanked by LoxP sites. A polyadenylation signal (hGHpA: human Growth Hormone
polyadenylation signal) has been inserted to the 3’ of the genes (downstream of the distal loxP
sites) in order to prevent transcriptional read-through. Positive selection markers were flanked by
159
FRT (Neomycin resistance – NeoR) and F3 (Puromycin resistance – PuroR) sites and inserted
downstream of the proximal loxP site and upstream of the distal loxP site, respectively. The
targeting vectors were generated using BAC clones from the mouse C57BL/6J RPCI-23 and
human RPCI-11 BAC libraries.
Generation of knock-in mice homozygous for human APOE isoforms (APOE-KI mice).
Targeting vectors for the various human APOE isoforms were individually transfected into the
Taconic Biosciences C57BL/6N Tac ES cell line. Homologous recombinant clones were isolated
using double positive (NeoR and PuroR) and negative (Thymidine kinase – Tk) selections. The
constitutive humanized/conditional knock-out alleles were obtained after in vivo Flp-mediated
removal of the selection markers. The newly introduced human APOE gene is expressed under
control of the endogenous Apoe promoter. The resulting strains are referred to by their specific
isoform expression (E2F, E3F, and E4F), or collectively as APOE-KI mice. The specific DNA
sequence corresponding to each isoform (see figure 4.10) were verified through sequencing of
exon 4 by GENEWIZ. DNA was isolated from fresh-frozen brain tissues, and exon 4 were
amplified using specific primers (Forward: AACAACTGACCCCGGTGG; and reverse:
GCTCGAACCAGCTCTTGAGG).
Conditional knock-out of human APOE alleles. To achieve tissue-specific knock-out of the
human APOE alleles, APOE-KI mice were crossed to the appropriate strain with tissue-specific
expression of Cre-recombinase. Specifically, peripheral knock-out of apoE was achieved by
crossing Albumin-Cre (Alb-Cre) mice 90 (purchased from Jackson laboratory, strain # 003574, also
known as B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J) to APOE-KI mice for two successive generations to
obtain Alb-Cre mice homozygous for various APOE isoforms. All mice used in this study were
160
maintained on a C57BL/6J background. Mice were subjected to experiments at either P7, P21, 1.5
months, or 3 months of age, per the various experimental designs. Mice were individually housed
in AAALAC accredited facilities with temperature and humidity controls, and were under a 12-
hours light/dark cycle (lights on at 6:00 AM) cycle with free access to food and water ad libitum
throughout all phases of the experiments. All animal procedures were approved by the Institutional
Animal Care and Use Committee (IACUC) at Washington University, and were in agreement with
the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC,
WUSM).
Method Details
Brain extraction and preparation. At the predetermined date of brain harvesting, the
appropriate mice were anesthetized with intraperitoneal pentobarbital (200 mg kg−1), and
subsequently perfused with 3 U ml−1 heparin in cold Dulbecco’s PBS for 3 minutes. The brains
were then extracted carefully from the skull. The right hemisphere were fixed in 4%
paraformaldehyde for at least 48 hours before being transferred to 30% sucrose and stored at 4 °C
until they were sectioned. The left hemi-brain was dissected on an ice-cold stage into various parts
(cortex, hippocampus, etc...), all of which were flash-frozen on dry ice and subsequently stored at
-80 °C until needed for biochemical analyses.
μm thickness) were collected from frontal cortex to caudal hippocampus (right hemisphere) using
a freezing sliding microtome (ThermoFisher). Three hippocampal-containing sections (separated
by 300 μm) from the right hemisphere of each brain were stained with biotinylated HJ3.4 (anti-
Aβ1–13, mouse monoclonal antibody generated in-house, 1:500 dilution) 6

or biotinylated 3D6
161
antibody (anti-Aβ1–x) 18,40
to visualize Aβ immunopositive plaques, as described previously.
Microglia were immunostained using goat anti- IBA1 antibody (Abcam ab5076, 1:500 dilution).
Astrocytes were immunostained using mouse anti-GFAP antibody (MAB3402, 1:1000 dilution).
ApoE was immunostained with rabbit anti-apoE antibody (Cell signaling D719N, 1:500 dilution.
All secondary antibodies were used in appropriate combinations depending on the primary
antibody host, including: donkey anti-goat AF-488 (Invitrogen catalog # A-32814), donkey anti-
rabbit AF-647 (Invitrogen catalog # A-31573), donkey anti-mouse AF-488 (Invitrogen catalog #
A-21202), donkey anti-rabbit AF-568 (Invitrogen catalog # A-10042). All secondary antibodies
were incubated at 1:500 dilution. Quantitative analysis of immunopositive staining was performed
as described previously 7. Briefly, images of immunostained sections were exported with NDP
viewer (Hamamatsu Photonics). Using ImageJ software, images were converted to 8-bit grayscale,
thresholded to highlight Aβ-specific staining and the percent area of a given brain region covered
by thresholded staining calculated. For analyses of immunofluorescent staining (including GFAP,
IBA1, apoE, X-34, and Aβ), 20X – 40X images were acquired on Nikon A1Rsi confocal
microscope. Random z-stacks containing clusters of plaques were imaged, spanning
approximately 30 µm of tissue in the z-plane with steps of 1.5 µm. Representative images are
generated by projecting maximal intensity of each voxel on the same z-plane (using ImageJ
software). All analyses were done blinded to treatment and genotype.
Real-time qPCR analysis. RNA was extracted from frozen cortical tissue using Trizol (Life
Technologies # 15596026) and purified using the RNeasy mini kit (Qiagen # 71404). Reverse
transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Life
Technologies). Real-time qPCR was conducted with TaqMan primers (Life Technologies) and the
TaqMan Universal PCR Master Mix (Thermo Fisher Scientific # 4304437) using the StepOnePlus
162
machine (Applied Biosystems). Relative gene expression levels were compared using the ΔΔCt
method with Taqman probe for human apoE (Hs00171168_m1). Glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) mRNA level was used as a reference (Mm99999915_g1 Gapdh)
Brain homogenization. Brain cortices or hippocampi were sequentially homogenized with
cold PBS and then the PBS insoluble material with 5M guanidine buffer in the presence of 1X
protease inhibitor (PI) mixture (Roche). Specifically, the frozen brain tissue were weighed on a
microscale, and the ice-chilled PBS/PI buffer solution were added at a ratio of 1 ml of buffer per
100 mg tissue. The mixture were then manually homogenized with a double-ended pestle
(ThermoFisher Scientific catalog # 50-256-12), until no visible chunks were seen. The samples
were subsequently centrifuged at 12,000 g (4 °C ) for 30 minutes, and the supernatant were
collected as PBS-soluble homogenates. To the remaining pellet, 5M guanidine/PI buffer were
added at the same ratio (1 ml buffer per 100 mg tissue) and homogenized by sonication. The
homogenates were rotated at room temperature for 1 hour and subsequently centrifuged at 12,000
g (4 °C) for 30 minutes. The supernatant was collected at guanidine-soluble fraction. All
procedures were done on ice as much as possible unless noted otherwise.
Sandwich ELISA. The levels of Aβx-40, Aβx-42 and apoE in PBS- and guanidine-soluble
brain homogenates were measured by sandwich ELISA. For apoE ELISA, HJ15.3 and HJ15.7b
were used as capture and detection antibodies, respectively. For Aβx-40 ELISA, HJ2 (anti-Aβ35–40)
was used as a capture antibody and for Aβx-42 ELISA, HJ7.4 (anti-Aβ37–42) was used as a capture
antibody. HJ5.1-biotin (anti-Aβ13–18) 7,50 was used as the detecting antibody for both Aβ ELISAs.
Primary Astrocyte and Microglia Cultures. Mixed glial cultures were prepared from the
cortex of E2F, E3F, and E4F neonatal mice (1 – 3 days old), similar to as previously described
163
17,21
. Cortices were dissected in calcium- and magnesium-free Hanks’ Balanced Salt solution
(HBSS) with careful removal of meninges. Tissue was digested in HBSS containing 0.25% trypsin
and 0.2 mg/ml DNase at 37°C for 10 minutes, and was dissociated by trituration in HBSS
containing 0.4 mg/ml DNase. Material was filtered through a 70-μm nylon mesh, pelleted at 1000
g for 5 min, and re-suspended in glia media (DMEM + 10% FBS+ 1X Glutamax + 1X
Penicillin/Streptomyicin). Cells were then plated on a poly-L-lysine (PLL)-coated 10 cm dish and
then switched to glia media containing 10% L929-conditioned media (10% L929 glia media) the
next day. 10% L929 glia media changes were performed every 3-4 days until cells were grown to
confluence (14 – 16 days). The top layer of loosely attached microglia were then harvested by
pipetting media over the dish ~10 – 15 times to flush off the microglia. The media containing the
suspended microglia was then collected and spun down at 1000x G for 5 minutes at 4°C. Microglia
were then re-suspended in 10% L929 glia media and re-plated onto a 12-well plate coated with
PLL. Astrocytes remaining in the 10 cm dish were detached by treating with 3 ml of 0.25%
Trypsin-EDTA for 10 minutes at 37°C. 7 ml of glia media was added to suspend the astrocytes
and material was then collected and spun down at 1000 g for 5 minutes at 4°C. Cells were re-
suspended in glia media and re-plated onto a T75 flask coated with Geltrex. Microglia were
allowed to grow for 3 days in 10% L929 glia media before being washed 2-times with sterile PBS
and then switched to serum-free glia media (DMEM + 1X Glutamax + 1X
Penicillin/Streptomyicin) containing 25 ng/ml mCSF. Astrocytes were allowed to grow for 4 days
in glia media before being shaken overnight at 250 RPM at 37°C to remove loosely attached cells
from astrocyte layer. The glia media was removed and astrocytes were then washed 2-times with
sterile PBS and switched to serum-free glia media. Serum-free glia media from microglia and
164
astrocyte cultures was collected after 48 hours and stored at 4°C for non-denaturing gel
electrophoresis.
Non-Denaturing Gradient Gel Electrophoresis. Microglia-conditioned serum-free media
and astrocyte-conditioned serum-free media samples were run on a 4-20% Tris-Glycine native
non-denaturing gel at 100 V for 18hours at 4°C. Gels were transferred to PVDF membrane at 25V
for 90 minutes at 4°C and probed with an anti-ApoE antibody (HJ15.7, 1:1000; in house). ApoE
immunoreactivity was detected by chemiluminescent development with ECL ultra reagents.
Western blot analysis. PBS-soluble brain lysates from the sequential homogenization step
were analyzed for total protein concentration with a micro BCA kit (Thermo Scientific). 30 µg of
proteins from each sample were loaded onto a NU-PAGE 4-12% Bis-Tris 15 well gel (Thermo
Fisher Scientific # NP0336BOX) and the gel was run at 150 V for 1.5 hours. The proteins were
subsequently dry-transferred onto a PVDF membrane using the iblot2 system (Life Technologies)
and blocked with 5% milk in TBS-Tween (0.05%). The membrane was incubated with anti-apoE
50
antibody HJ15.7 (or HJ15.3) and anti-β-tubulin antibodies to probe for apoE and a loading
control, respectively. Donkey-anti-mouse IgG-HRP was used as secondary antibody (Santa Cruz
Biotechnology # sc-2096). All blots were developed for ~10 seconds using an enhanced
chemiluminescence (ECL) Ultra kit (Lumigen TMA-6) and imaged on the SynGene Imager
(BioRad) at the appropriate exposure.
Lipid Measurements. Plasma Triglyceride (Wako Diagnostics catalog # 290-63701), HDL
(HDL-Cholesterol E, Wako Diagnostics catalog # 997-01301), and Total Cholesterol (Total
Cholesterol-E, Wako Diagnostics catalog # 999-02601) concentrations were measured using kits
from Wako Diagnostics adapted to half-area 96-well dishes (Corning, catalog # 3690). The
165
protocols were performed according to the manufacturer’s specifications with the following
adjustments. For the triglyceride and cholesterol measurements: half volumes of the samples and
standards described in the provided microplate/microtiter methods were used. For the cholesterol
measurements: a standard curve with levels of 0, 25, 100, 200, 397.4, 592.2 mg/dL was used. For
the HDL measurements: 20 µL sample were mixed with an equal amount of Precipitating Reagent.
Due to low sample HDL concentrations, samples were loaded at twice the volume of the standard
curve. As a result, the derived sample concentrations were halved to reach the true value. After
adding color reagent to the wells (150 µL/well), the dishes were gently mixed and incubated at
37oC for ~5 minutes before reading. Absorbance at 600 nm and 700 nm were measured using a
Cytation 5 Imaging Reader. Analysis was performed using Gen5 software and Microsoft Excel.
Absorbance at 700 nm was subtracted from that at 600 nm to correct for contaminants. Samples
and standards were measured in duplicate and triplicate, respectively. Sample concentrations were
derived from a linear regression fit to the standard curve. For analysis, the blank absorbance was
counted as the 0 mg/dL level (it was not subtracted). Samples were subjected to ~1-3 freeze-thaw
cycles.
Quantification and Statistical Analysis
Statistics. All values are reported as mean ± SEM. A one-way ANOVA was used to assess
significance between more than two groups (Figures 4.1 and 4.10), and Bonferroni’s post-hoc test
was used to test for differences between each of the groups. A two-way ANOVA was used to
assess significance between more than two groups in the presence of additional variables (Figures
4.5, 4.6, 4.7, 4.8, and 4.9), and Tukey’s post-hoc test was used to test for differences between each
of the groups (Figures 4.5, 4.6, 4.7, 4.8, 4.9), with the exception of figures 4.7C – 4.7H, where
166
Holm-Sidak multiple comparisons testing was used due to non-normal distribution of data in some
groups. All statistical analyses were performed using Prism software (Graphpad). p < 0.05 is
considered significant for all tests. No statistical analysis was used to determine sample size a
priori. The sample sizes chosen are based on those used in previous studies from our laboratory.
The number of samples indicates biological replicates as indicated in each of the figure legends.
At most one outlier was removed per genotype via the Grubb’s test (alpha = 0.05, GraphPad
QuickCalcs1).
The research was financially supported by a grant from the Cure Alzheimer’s Fund (J.D.U.
and D.M.H.) and the Gilliam Fellowships for Advanced Study from the Howard Hughes Medical
Institute (T.-P.V.H.). We thank our colleagues in the Holtzman lab for assistance, critical
comments, and suggestions.
167
4.7 References
1 Baker-Nigh, A. T., Mawuenyega, K. G., Bollinger, J. G., Ovod, V., Kasten, T., Franklin,
E. E., Liao, F., Jiang, H., Holtzman, D., Cairns, N. J., Morris, J. C. & Bateman, R. J.
Human Central Nervous System (CNS) ApoE Isoforms Are Increased by Age,
Differentially Altered by Amyloidosis, and Relative Amounts Reversed in the CNS
Compared with Plasma. The Journal of biological chemistry 291, 27204-27218,
doi:10.1074/jbc.M116.721779 (2016).
M. & Paul, S. M. Human APOE isoform-dependent effects on brain beta-amyloid levels
in PDAPP transgenic mice. The Journal of neuroscience : the official journal of the
Society for Neuroscience 29, 6771-6779, doi:10.1523/JNEUROSCI.0887-09.2009
(2009).
3 Bales, K. R., Verina, T., Cummins, D. J., Du, Y., Dodel, R. C., Saura, J., Fishman, C. E.,
DeLong, C. A., Piccardo, P., Petegnief, V., Ghetti, B. & Paul, S. M. Apolipoprotein E is
essential for amyloid deposition in the APP(V717F) transgenic mouse model of
Alzheimer's disease. Proceedings of the National Academy of Sciences of the United
States of America 96, 15233-15238 (1999).
Johnstone, E. M., Little, S. P., Cummins, D. J., Piccardo, P., Ghetti, B. & Paul, S. M.
Lack of apolipoprotein E dramatically reduces amyloid beta-peptide deposition. Nature
genetics 17, 263-264, doi:10.1038/ng1197-263 (1997).
5 Bell, R. D., Winkler, E. A., Singh, I., Sagare, A. P., Deane, R., Wu, Z., Holtzman, D. M.,
Betsholtz, C., Armulik, A., Sallstrom, J., Berk, B. C. & Zlokovic, B. V. Apolipoprotein E
controls cerebrovascular integrity via cyclophilin A. Nature 485, 512-516,
doi:10.1038/nature11087 (2012).
Culver, J. P. & Holtzman, D. M. Bidirectional relationship between functional
connectivity and amyloid-beta deposition in mouse brain. The Journal of neuroscience :
doi:10.1523/JNEUROSCI.5845-11.2012 (2012).
7 Bero, A. W., Yan, P., Roh, J. H., Cirrito, J. R., Stewart, F. R., Raichle, M. E., Lee, J. M.
& Holtzman, D. M. Neuronal activity regulates the regional vulnerability to amyloid-beta
12.2012 (2012).
9 Bjorkhem, I., Lutjohann, D., Diczfalusy, U., Stahle, L., Ahlborg, G. & Wahren, J.
Cholesterol homeostasis in human brain: turnover of 24S-hydroxycholesterol and
evidence for a cerebral origin of most of this oxysterol in the circulation. Journal of lipid
research 39, 1594-1600 (1998).
10 Bohnet, K., Pillot, T., Visvikis, S., Sabolovic, N. & Siest, G. Apolipoprotein (apo) E
genotype and apoE concentration determine binding of normal very low density
168
lipoproteins to HepG2 cell surface receptors. Journal of lipid research 37, 1316-1324
(1996).
11 Boisvert, W. A., Spangenberg, J. & Curtiss, L. K. Treatment of severe
hypercholesterolemia in apolipoprotein E-deficient mice by bone marrow transplantation.
The Journal of clinical investigation 96, 1118-1124, doi:10.1172/JCI118098 (1995).
12 Butovsky, O., Jedrychowski, M. P., Cialic, R., Krasemann, S., Murugaiyan, G., Fanek,
Z., Greco, D. J., Wu, P. M., Doykan, C. E., Kiner, O., Lawson, R. J., Frosch, M. P.,
Pochet, N., Fatimy, R. E., Krichevsky, A. M., Gygi, S. P., Lassmann, H., Berry, J.,
Cudkowicz, M. E. & Weiner, H. L. Targeting miR-155 restores abnormal microglia and
attenuates disease in SOD1 mice. Annals of neurology 77, 75-99, doi:10.1002/ana.24304
(2015).
13 Butovsky, O., Jedrychowski, M. P., Moore, C. S., Cialic, R., Lanser, A. J., Gabriely, G.,
Koeglsperger, T., Dake, B., Wu, P. M., Doykan, C. E., Fanek, Z., Liu, L., Chen, Z.,
Rothstein, J. D., Ransohoff, R. M., Gygi, S. P., Antel, J. P. & Weiner, H. L. Identification
of a unique TGF-beta-dependent molecular and functional signature in microglia. Nature
neuroscience 17, 131-143, doi:10.1038/nn.3599 (2014).
15 Cho, H. S., Hyman, B. T., Greenberg, S. M. & Rebeck, G. W. Quantitation of apoE
domains in Alzheimer disease brain suggests a role for apoE in Abeta aggregation.
Journal of neuropathology and experimental neurology 60, 342-349 (2001).
16 Cushley, R. J. & Okon, M. NMR studies of lipoprotein structure. Annu Rev Biophys
Biomol Struct 31, 177-206, doi:10.1146/annurev.biophys.31.101101.140910 (2002).
17 DeMattos, R. B., Brendza, R. P., Heuser, J. E., Kierson, M., Cirrito, J. R., Fryer, J.,
Sullivan, P. M., Fagan, A. M., Han, X. & Holtzman, D. M. Purification and
characterization of astrocyte-secreted apolipoprotein E and J-containing lipoproteins from
wild-type and human apoE transgenic mice. Neurochemistry international 39, 415-425
(2001).
18 Demattos, R. B., Lu, J., Tang, Y., Racke, M. M., Delong, C. A., Tzaferis, J. A., Hole, J.
T., Forster, B. M., McDonnell, P. C., Liu, F., Kinley, R. D., Jordan, W. H. & Hutton, M.
L. A plaque-specific antibody clears existing beta-amyloid plaques in Alzheimer's disease
mice. Neuron 76, 908-920, doi:10.1016/j.neuron.2012.10.029 (2012).
19 Dickson, D. W., Heckman, M. G., Murray, M. E., Soto, A. I., Walton, R. L., Diehl, N. N.,
van Gerpen, J. A., Uitti, R. J., Wszolek, Z. K., Ertekin-Taner, N., Knopman, D. S.,
Petersen, R. C., Graff-Radford, N. R., Boeve, B. F., Bu, G., Ferman, T. J. & Ross, O. A.
APOE epsilon4 is associated with severity of Lewy body pathology independent of
Alzheimer pathology. Neurology 91, e1182-e1195,
doi:10.1212/WNL.0000000000006212 (2018).
20 Driscoll, D. M. & Getz, G. S. Extrahepatic synthesis of apolipoprotein E. Journal of lipid
research 25, 1368-1379 (1984).
21 Fagan, A. M., Holtzman, D. M., Munson, G., Mathur, T., Schneider, D., Chang, L. K.,
Getz, G. S., Reardon, C. A., Lukens, J., Shah, J. A. & LaDu, M. J. Unique lipoproteins
secreted by primary astrocytes from wild type, apoE (-/-), and human apoE transgenic
169
mice. The Journal of biological chemistry 274, 30001-30007,
doi:10.1074/jbc.274.42.30001 (1999).
22 Fagan, A. M., Murphy, B. A., Patel, S. N., Kilbridge, J. F., Mobley, W. C., Bu, G. &
Holtzman, D. M. Evidence for normal aging of the septo-hippocampal cholinergic system
in apoE (-/-) mice but impaired clearance of axonal degeneration products following
injury. Experimental neurology 151, 314-325, doi:10.1006/exnr.1998.6818 (1998).
23 Frieden, C., Wang, H. & Ho, C. M. W. A mechanism for lipid binding to apoE and the
role of intrinsically disordered regions coupled to domain-domain interactions.
6292-6297, doi:10.1073/pnas.1705080114 (2017).
25 Fryer, J. D., Taylor, J. W., DeMattos, R. B., Bales, K. R., Paul, S. M., Parsadanian, M. &
Holtzman, D. M. Apolipoprotein E markedly facilitates age-dependent cerebral amyloid
angiopathy and spontaneous hemorrhage in amyloid precursor protein transgenic mice.
The Journal of neuroscience : the official journal of the Society for Neuroscience 23,
7889-7896 (2003).
26 Fullerton, S. M., Shirman, G. A., Strittmatter, W. J. & Matthew, W. D. Impairment of the
blood-nerve and blood-brain barriers in apolipoprotein e knockout mice. Experimental
27 Gangabadage, C. S., Zdunek, J., Tessari, M., Nilsson, S., Olivecrona, G. & Wijmenga, S.
S. Structure and dynamics of human apolipoprotein CIII. The Journal of biological
chemistry 283, 17416-17427, doi:10.1074/jbc.M800756200 (2008).
28 Grehan, S., Tse, E. & Taylor, J. M. Two distal downstream enhancers direct expression
of the human apolipoprotein E gene to astrocytes in the brain. The Journal of
neuroscience : the official journal of the Society for Neuroscience 21, 812-822 (2001).
29 Hafezi-Moghadam, A., Thomas, K. L. & Wagner, D. D. ApoE deficiency leads to a
progressive age-dependent blood-brain barrier leakage. American journal of physiology.
Cell physiology 292, C1256-1262, doi:10.1152/ajpcell.00563.2005 (2007).
30 Hamanaka, H., Katoh-Fukui, Y., Suzuki, K., Kobayashi, M., Suzuki, R., Motegi, Y.,
Nakahara, Y., Takeshita, A., Kawai, M., Ishiguro, K., Yokoyama, M. & Fujita, S. C.
Altered cholesterol metabolism in human apolipoprotein E4 knock-in mice. Human
molecular genetics 9, 353-361 (2000).
31 Harris, F. M., Brecht, W. J., Xu, Q., Tesseur, I., Kekonius, L., Wyss-Coray, T., Fish, J.
D., Masliah, E., Hopkins, P. C., Scearce-Levie, K., Weisgraber, K. H., Mucke, L.,
Mahley, R. W. & Huang, Y. Carboxyl-terminal-truncated apolipoprotein E4 causes
Alzheimer's disease-like neurodegeneration and behavioral deficits in transgenic mice.
10966-10971, doi:10.1073/pnas.1434398100 (2003).
32 Hawkes, C. A., Sullivan, P. M., Hands, S., Weller, R. O., Nicoll, J. A. & Carare, R. O.
Disruption of arterial perivascular drainage of amyloid-beta from the brains of mice
expressing the human APOE epsilon4 allele. PloS one 7, e41636,
doi:10.1371/journal.pone.0041636 (2012).
170
33 Hayashi, H., Igbavboa, U., Hamanaka, H., Kobayashi, M., Fujita, S. C., Wood, W. G. &
Yanagisawa, K. Cholesterol is increased in the exofacial leaflet of synaptic plasma
membranes of human apolipoprotein E4 knock-in mice. Neuroreport 13, 383-386 (2002).
A., Parkinson, P. F., Chan, J. Y., Tansley, G. H., Hayden, M. R., Poirier, J., Van
Nostrand, W. & Wellington, C. L. The absence of ABCA1 decreases soluble ApoE levels
but does not diminish amyloid deposition in two murine models of Alzheimer disease.
The Journal of biological chemistry 280, 43243-43256, doi:10.1074/jbc.M508781200
(2005).
41197-41207, doi:10.1074/jbc.M407962200 (2004).
36 Holtzman, D. M., Fagan, A. M., Mackey, B., Tenkova, T., Sartorius, L., Paul, S. M.,
Bales, K., Ashe, K. H., Irizarry, M. C. & Hyman, B. T. Apolipoprotein E facilitates
neuritic and cerebrovascular plaque formation in an Alzheimer's disease model. Annals of
neurology 47, 739-747 (2000).
37 Huang, Y., Liu, X. Q., Wyss-Coray, T., Brecht, W. J., Sanan, D. A. & Mahley, R. W.
Apolipoprotein E fragments present in Alzheimer's disease brains induce neurofibrillary
tangle-like intracellular inclusions in neurons. Proceedings of the National Academy of
(2001).
doi:10.1016/j.neuron.2017.11.014 (2017).
Alexander, M., Almdahl, I. S., Arnold, S. E., Baldeiras, I., Barthel, H., van Berckel, B.
N., Bibeau, K., Blennow, K., Brooks, D. J., van Buchem, M. A., Camus, V., Cavedo, E.,
Chen, K., Chetelat, G., Cohen, A. D., Drzezga, A., Engelborghs, S., Fagan, A. M.,
Fladby, T., Fleisher, A. S., van der Flier, W. M., Ford, L., Forster, S., Fortea, J., Foskett,
N., Frederiksen, K. S., Freund-Levi, Y., Frisoni, G. B., Froelich, L., Gabryelewicz, T.,
Gill, K. D., Gkatzima, O., Gomez-Tortosa, E., Gordon, M. F., Grimmer, T., Hampel, H.,
Hausner, L., Hellwig, S., Herukka, S. K., Hildebrandt, H., Ishihara, L., Ivanoiu, A.,
Jagust, W. J., Johannsen, P., Kandimalla, R., Kapaki, E., Klimkowicz-Mrowiec, A.,
Klunk, W. E., Kohler, S., Koglin, N., Kornhuber, J., Kramberger, M. G., Van Laere, K.,
Landau, S. M., Lee, D. Y., de Leon, M., Lisetti, V., Lleo, A., Madsen, K., Maier, W.,
Marcusson, J., Mattsson, N., de Mendonca, A., Meulenbroek, O., Meyer, P. T., Mintun,
M. A., Mok, V., Molinuevo, J. L., Mollergard, H. M., Morris, J. C., Mroczko, B., Van der
Mussele, S., Na, D. L., Newberg, A., Nordberg, A., Nordlund, A., Novak, G. P.,
Paraskevas, G. P., Parnetti, L., Perera, G., Peters, O., Popp, J., Prabhakar, S., Rabinovici,
G. D., Ramakers, I. H., Rami, L., Resende de Oliveira, C., Rinne, J. O., Rodrigue, K. M.,
Rodriguez-Rodriguez, E., Roe, C. M., Rot, U., Rowe, C. C., Ruther, E., Sabri, O.,
Sanchez-Juan, P., Santana, I., Sarazin, M., Schroder, J., Schutte, C., Seo, S. W.,
171
Soetewey, F., Soininen, H., Spiru, L., Struyfs, H., Teunissen, C. E., Tsolaki, M.,
Vandenberghe, R., Verbeek, M. M., Villemagne, V. L., Vos, S. J., van Waalwijk van
Doorn, L. J., Waldemar, G., Wallin, A., Wallin, A. K., Wiltfang, J., Wolk, D. A., Zboch,
M. & Zetterberg, H. Prevalence of cerebral amyloid pathology in persons without
dementia: a meta-analysis. Jama 313, 1924-1938, doi:10.1001/jama.2015.4668 (2015).
40 Johnson-Wood, K., Lee, M., Motter, R., Hu, K., Gordon, G., Barbour, R., Khan, K.,
Gordon, M., Tan, H., Games, D., Lieberburg, I., Schenk, D., Seubert, P. & McConlogue,
L. Amyloid precursor protein processing and A beta42 deposition in a transgenic mouse
model of Alzheimer disease. Proceedings of the National Academy of Sciences of the
United States of America 94, 1550-1555, doi:10.1073/pnas.94.4.1550 (1997).
41 Jones, P. B., Adams, K. W., Rozkalne, A., Spires-Jones, T. L., Hshieh, T. T., Hashimoto,
T., von Armin, C. A., Mielke, M., Bacskai, B. J. & Hyman, B. T. Apolipoprotein E:
isoform specific differences in tertiary structure and interaction with amyloid-beta in
human Alzheimer brain. PloS one 6, e14586, doi:10.1371/journal.pone.0014586 (2011).
42 Keren-Shaul, H., Spinrad, A., Weiner, A., Matcovitch-Natan, O., Dvir-Szternfeld, R.,
Ulland, T. K., David, E., Baruch, K., Lara-Astaiso, D., Toth, B., Itzkovitz, S., Colonna,
M., Schwartz, M. & Amit, I. A Unique Microglia Type Associated with Restricting
Development of Alzheimer's Disease. Cell 169, 1276-1290 e1217,
doi:10.1016/j.cell.2017.05.018 (2017).
43 Kim, J., Jiang, H., Park, S., Eltorai, A. E., Stewart, F. R., Yoon, H., Basak, J. M., Finn,
M. B. & Holtzman, D. M. Haploinsufficiency of human APOE reduces amyloid
deposition in a mouse model of amyloid-beta amyloidosis. The Journal of neuroscience :
doi:10.1523/JNEUROSCI.3773-11.2011 (2011).
44 Knouff, C., Hinsdale, M. E., Mezdour, H., Altenburg, M. K., Watanabe, M., Quarfordt, S.
H., Sullivan, P. M. & Maeda, N. Apo E structure determines VLDL clearance and
atherosclerosis risk in mice. The Journal of clinical investigation 103, 1579-1586,
doi:10.1172/JCI6172 (1999).
46 Koriath, C., Lashley, T., Taylor, W., Druyeh, R., Dimitriadis, A., Denning, N., Williams,
J., Warren, J. D., Fox, N. C., Schott, J. M., Rowe, J. B., Collinge, J., Rohrer, J. D. &
Mead, S. ApoE4 lowers age at onset in patients with frontotemporal dementia and
tauopathy independent of amyloid-beta copathology. Alzheimers Dement (Amst) 11, 277-
280, doi:10.1016/j.dadm.2019.01.010 (2019).
47 Krasemann, S., Madore, C., Cialic, R., Baufeld, C., Calcagno, N., El Fatimy, R., Beckers,
L., O'Loughlin, E., Xu, Y., Fanek, Z., Greco, D. J., Smith, S. T., Tweet, G., Humulock,
Z., Zrzavy, T., Conde-Sanroman, P., Gacias, M., Weng, Z., Chen, H., Tjon, E., Mazaheri,
F., Hartmann, K., Madi, A., Ulrich, J. D., Glatzel, M., Worthmann, A., Heeren, J.,
Budnik, B., Lemere, C., Ikezu, T., Heppner, F. L., Litvak, V., Holtzman, D. M.,
Lassmann, H., Weiner, H. L., Ochando, J., Haass, C. & Butovsky, O. The TREM2-APOE
Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in
Neurodegenerative Diseases. Immunity 47, 566-581 e569,
doi:10.1016/j.immuni.2017.08.008 (2017).
172
48 Krul, E. S. & Cole, T. G. Quantitation of apolipoprotein E. Methods Enzymol 263, 170-
187 (1996).
49 Lane-Donovan, C., Wong, W. M., Durakoglugil, M. S., Wasser, C. R., Jiang, S., Xian, X.
& Herz, J. Genetic Restoration of Plasma ApoE Improves Cognition and Partially
Restores Synaptic Defects in ApoE-Deficient Mice. The Journal of neuroscience : the
official journal of the Society for Neuroscience 36, 10141-10150,
doi:10.1523/JNEUROSCI.1054-16.2016 (2016).
M. & Holtzman, D. M. Murine versus human apolipoprotein E4: differential facilitation
of and co-localization in cerebral amyloid angiopathy and amyloid plaques in APP
transgenic mouse models. Acta neuropathologica communications 3, 70,
doi:10.1186/s40478-015-0250-y (2015).
51 Liu, M., Kuhel, D. G., Shen, L., Hui, D. Y. & Woods, S. C. Apolipoprotein E does not
cross the blood-cerebrospinal fluid barrier, as revealed by an improved technique for
sampling CSF from mice. American journal of physiology. Regulatory, integrative and
comparative physiology 303, R903-908, doi:10.1152/ajpregu.00219.2012 (2012).
52 Mahley, R. W. Central Nervous System Lipoproteins: ApoE and Regulation of
Cholesterol Metabolism. Arterioscler Thromb Vasc Biol 36, 1305-1315,
doi:10.1161/ATVBAHA.116.307023 (2016).
53 Mahley, R. W., Innerarity, T. L., Rall, S. C. & Weisgraber, K. H. Plasma-Lipoproteins -
Apolipoprotein Structure and Function. Journal of lipid research 25, 1277-1294 (1984).
54 Main, B. S., Villapol, S., Sloley, S. S., Barton, D. J., Parsadanian, M., Agbaegbu, C.,
Stefos, K., McCann, M. S., Washington, P. M., Rodriguez, O. C. & Burns, M. P.
Apolipoprotein E4 impairs spontaneous blood brain barrier repair following traumatic
brain injury. Molecular neurodegeneration 13, 17, doi:10.1186/s13024-018-0249-5
(2018).
55 Marques, M. A., Owens, P. A. & Crutcher, K. A. Progress toward identification of
protease activity involved in proteolysis of apolipoprotein e in human brain. Journal of
molecular neuroscience : MN 24, 73-80, doi:10.1385/JMN:24:1:073 (2004).
56 Masliah, E., Mallory, M., Ge, N., Alford, M., Veinbergs, I. & Roses, A. D.
Neurodegeneration in the central nervous system of apoE-deficient mice. Experimental
57 Mauch, D. H., Nagler, K., Schumacher, S., Goritz, C., Muller, E. C., Otto, A. & Pfrieger,
F. W. CNS synaptogenesis promoted by glia-derived cholesterol. Science 294, 1354-
1357, doi:10.1126/science.294.5545.1354 (2001).
Mintun, M. A. APOE predicts amyloid-beta but not tau Alzheimer pathology in
cognitively normal aging. Annals of neurology 67, 122-131, doi:10.1002/ana.21843
(2010).
166 (1991).
60 Nelson, A. R., Sweeney, M. D., Sagare, A. P. & Zlokovic, B. V. Neurovascular
dysfunction and neurodegeneration in dementia and Alzheimer's disease. Biochimica et
biophysica acta 1862, 887-900, doi:10.1016/j.bbadis.2015.12.016 (2016).
173
61 Pankiewicz, J. E., Baquero-Buitrago, J., Sanchez, S., Lopez-Contreras, J., Kim, J.,
Sullivan, P. M., Holtzman, D. M. & Sadowski, M. J. APOE Genotype Differentially
Modulates Effects of Anti-Abeta, Passive Immunization in APP Transgenic Mice.
Molecular neurodegeneration 12, 12, doi:10.1186/s13024-017-0156-1 (2017).
62 Parhizkar, S., Arzberger, T., Brendel, M., Kleinberger, G., Deussing, M., Focke, C.,
Nuscher, B., Xiong, M., Ghasemigharagoz, A., Katzmarski, N., Krasemann, S.,
Lichtenthaler, S. F., Muller, S. A., Colombo, A., Monasor, L. S., Tahirovic, S., Herms, J.,
Willem, M., Pettkus, N., Butovsky, O., Bartenstein, P., Edbauer, D., Rominger, A.,
Erturk, A., Grathwohl, S. A., Neher, J. J., Holtzman, D. M., Meyer-Luehmann, M. &
Haass, C. Loss of TREM2 function increases amyloid seeding but reduces plaque-
associated ApoE. Nature neuroscience 22, 191-204, doi:10.1038/s41593-018-0296-9
(2019).
biophysica acta 917, 148-161 (1987).
64 Plump, A. S., Smith, J. D., Hayek, T., Aalto-Setala, K., Walsh, A., Verstuyft, J. G.,
Rubin, E. M. & Breslow, J. L. Severe hypercholesterolemia and atherosclerosis in
apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell
71, 343-353 (1992).
65 Poirier, J. Apolipoprotein E, cholesterol transport and synthesis in sporadic Alzheimer's
disease. Neurobiology of aging 26, 355-361, doi:10.1016/j.neurobiolaging.2004.09.003
(2005).
66 Poirier, J., Baccichet, A., Dea, D. & Gauthier, S. Cholesterol synthesis and lipoprotein
reuptake during synaptic remodelling in hippocampus in adult rats. Neuroscience 55, 81-
90 (1993).
doi:10.1038/sj.embor.7400784 (2006).
68 Rasmussen, K. L., Tybjaerg-Hansen, A., Nordestgaard, B. G. & Frikke-Schmidt, R.
Plasma levels of apolipoprotein E and risk of dementia in the general population. Annals
of neurology 77, 301-311, doi:10.1002/ana.24326 (2015).
J., Reeder, S. A., Langbaum, J. B., Alexander, G. E., Klunk, W. E., Mathis, C. A., Price,
J. C., Aizenstein, H. J., DeKosky, S. T. & Caselli, R. J. Fibrillar amyloid-beta burden in
doi:10.1073/pnas.0900345106 (2009).
70 Riddell, D. R., Zhou, H., Atchison, K., Warwick, H. K., Atkinson, P. J., Jefferson, J., Xu,
L., Aschmies, S., Kirksey, Y., Hu, Y., Wagner, E., Parratt, A., Xu, J., Li, Z., Zaleska, M.
M., Jacobsen, J. S., Pangalos, M. N. & Reinhart, P. H. Impact of apolipoprotein E (ApoE)
polymorphism on brain ApoE levels. The Journal of neuroscience : the official journal of
the Society for Neuroscience 28, 11445-11453, doi:10.1523/JNEUROSCI.1972-08.2008
(2008).
174
71 Rohn, T. T., Catlin, L. W., Coonse, K. G. & Habig, J. W. Identification of an amino-
terminal fragment of apolipoprotein E4 that localizes to neurofibrillary tangles of the
Alzheimer's disease brain. Brain research 1475, 106-115,
doi:10.1016/j.brainres.2012.08.003 (2012).
doi:10.1074/jbc.R800036200 (2009).
73 Ruiz, J., Kouiavskaia, D., Migliorini, M., Robinson, S., Saenko, E. L., Gorlatova, N., Li,
D., Lawrence, D., Hyman, B. T., Weisgraber, K. H. & Strickland, D. K. The apoE
isoform binding properties of the VLDL receptor reveal marked differences from LRP
and the LDL receptor. Journal of lipid research 46, 1721-1731,
doi:10.1194/jlr.M500114-JLR200 (2005).
74 Shea, T. B., Rogers, E., Ashline, D., Ortiz, D. & Sheu, M. S. Apolipoprotein E deficiency
promotes increased oxidative stress and compensatory increases in antioxidants in brain
tissue. Free Radic Biol Med 33, 1115-1120 (2002).
75 Shi, Y., Yamada, K., Liddelow, S. A., Smith, S. T., Zhao, L., Luo, W., Tsai, R. M.,
Spina, S., Grinberg, L. T., Rojas, J. C., Gallardo, G., Wang, K., Roh, J., Robinson, G.,
Finn, M. B., Jiang, H., Sullivan, P. M., Baufeld, C., Wood, M. W., Sutphen, C., McCue,
L., Xiong, C., Del-Aguila, J. L., Morris, J. C., Cruchaga, C., Alzheimer's Disease
Neuroimaging, I., Fagan, A. M., Miller, B. L., Boxer, A. L., Seeley, W. W., Butovsky,
O., Barres, B. A., Paul, S. M. & Holtzman, D. M. ApoE4 markedly exacerbates tau-
mediated neurodegeneration in a mouse model of tauopathy. Nature 549, 523-527,
doi:10.1038/nature24016 (2017).
76 Stone, D. J., Rozovsky, I., Morgan, T. E., Anderson, C. P., Hajian, H. & Finch, C. E.
Astrocytes and microglia respond to estrogen with increased apoE mRNA in vivo and in
vitro. Experimental neurology 143, 313-318, doi:10.1006/exnr.1996.6360 (1997).
77 Sullivan, P. M., Han, B., Liu, F., Mace, B. E., Ervin, J. F., Wu, S., Koger, D., Paul, S. &
Bales, K. R. Reduced levels of human apoE4 protein in an animal model of cognitive
impairment. Neurobiology of aging 32, 791-801,
78 Sullivan, P. M., Mezdour, H., Aratani, Y., Knouff, C., Najib, J., Reddick, R. L.,
Quarfordt, S. H. & Maeda, N. Targeted replacement of the mouse apolipoprotein E gene
with the common human APOE3 allele enhances diet-induced hypercholesterolemia and
79 Sweeney, M. D., Sagare, A. P. & Zlokovic, B. V. Blood-brain barrier breakdown in
Alzheimer disease and other neurodegenerative disorders. Nat Rev Neurol 14, 133-150,
doi:10.1038/nrneurol.2017.188 (2018).
80 Tai, L. M., Balu, D., Avila-Munoz, E., Abdullah, L., Thomas, R., Collins, N., Valencia-
Olvera, A. C. & LaDu, M. J. EFAD transgenic mice as a human APOE relevant
preclinical model of Alzheimer's disease. Journal of lipid research 58, 1733-1755,
doi:10.1194/jlr.R076315 (2017).
81 Tsuang, D., Leverenz, J. B., Lopez, O. L., Hamilton, R. L., Bennett, D. A., Schneider, J.
A., Buchman, A. S., Larson, E. B., Crane, P. K., Kaye, J. A., Kramer, P., Woltjer, R.,
Trojanowski, J. Q., Weintraub, D., Chen-Plotkin, A. S., Irwin, D. J., Rick, J.,
Schellenberg, G. D., Watson, G. S., Kukull, W., Nelson, P. T., Jicha, G. A., Neltner, J.
H., Galasko, D., Masliah, E., Quinn, J. F., Chung, K. A., Yearout, D., Mata, I. F., Wan, J.
175
Y., Edwards, K. L., Montine, T. J. & Zabetian, C. P. APOE epsilon4 increases risk for
dementia in pure synucleinopathies. JAMA neurology 70, 223-228,
doi:10.1001/jamaneurol.2013.600 (2013).
82 Ulrich, J. D., Burchett, J. M., Restivo, J. L., Schuler, D. R., Verghese, P. B., Mahan, T.
E., Landreth, G. E., Castellano, J. M., Jiang, H., Cirrito, J. R. & Holtzman, D. M. In vivo
83 Ulrich, J. D., Ulland, T. K., Mahan, T. E., Nystrom, S., Nilsson, K. P., Song, W. M.,
Zhou, Y., Reinartz, M., Choi, S., Jiang, H., Stewart, F. R., Anderson, E., Wang, Y.,
Colonna, M. & Holtzman, D. M. ApoE facilitates the microglial response to amyloid
plaque pathology. The Journal of experimental medicine 215, 1047-1058,
doi:10.1084/jem.20171265 (2018).
84 Veinbergs, I., Mante, M., Mallory, M. & Masliah, E. Neurotrophic effects of
Cerebrolysin in animal models of excitotoxicity. Journal of neural transmission.
Supplementum 59, 273-280 (2000).
43242, doi:10.1074/jbc.M508780200 (2005).
doi:10.1172/JCI33622 (2008).
87 Wang, N., Weng, W., Breslow, J. L. & Tall, A. R. Scavenger receptor BI (SR-BI) is up-
regulated in adrenal gland in apolipoprotein A-I and hepatic lipase knock-out mice as a
response to depletion of cholesterol stores. In vivo evidence that SR-BI is a functional
high density lipoprotein receptor under feedback control. The Journal of biological
chemistry 271, 21001-21004, doi:10.1074/jbc.271.35.21001 (1996).
88 Williams, D. L., Dawson, P. A., Newman, T. C. & Rudel, L. L. Apolipoprotein E
synthesis in peripheral tissues of nonhuman primates. The Journal of biological chemistry
260, 2444-2451 (1985).
90 Yakar, S., Liu, J. L., Stannard, B., Butler, A., Accili, D., Sauer, B. & LeRoith, D. Normal
growth and development in the absence of hepatic insulin-like growth factor I.
7324-7329 (1999).
91 Youmans, K. L., Tai, L. M., Nwabuisi-Heath, E., Jungbauer, L., Kanekiyo, T., Gan, M.,
Kim, J., Eimer, W. A., Estus, S., Rebeck, G. W., Weeber, E. J., Bu, G., Yu, C. & Ladu,
M. J. APOE4-specific changes in Abeta accumulation in a new transgenic mouse model
of Alzheimer disease. The Journal of biological chemistry 287, 41774-41786,
doi:10.1074/jbc.M112.407957 (2012).
92 Zannis, V. I., Cole, F. S., Jackson, C. L., Kurnit, D. M. & Karathanasis, S. K. Distribution
of apolipoprotein A-I, C-II, C-III, and E mRNA in fetal human tissues. Time-dependent
176
induction of apolipoprotein E mRNA by cultures of human monocyte-macrophages.
Biochemistry 24, 4450-4455 (1985).
93 Zechner, R., Moser, R., Newman, T. C., Fried, S. K. & Breslow, J. L. Apolipoprotein E
gene expression in mouse 3T3-L1 adipocytes and human adipose tissue and its regulation
by differentiation and lipid content. The Journal of biological chemistry 266, 10583-
10588 (1991).
94 Zhang, S. H., Reddick, R. L., Piedrahita, J. A. & Maeda, N. Spontaneous
hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258,
468-471 (1992).
95 Zhao, N., Liu, C. C., Qiao, W. & Bu, G. Apolipoprotein E, Receptors, and Modulation of
Alzheimer's Disease. Biological psychiatry 83, 347-357,
doi:10.1016/j.biopsych.2017.03.003 (2018).
96 Zhao, N., Liu, C. C., Van Ingelgom, A. J., Linares, C., Kurti, A., Knight, J. A., Heckman,
M. G., Diehl, N. N., Shinohara, M., Martens, Y. A., Attrebi, O. N., Petrucelli, L., Fryer, J.
D., Wszolek, Z. K., Graff-Radford, N. R., Caselli, R. J., Sanchez-Contreras, M. Y.,
Rademakers, R., Murray, M. E., Koga, S., Dickson, D. W., Ross, O. A. & Bu, G. APOE
epsilon2 is associated with increased tau pathology in primary tauopathy. Nature
communications 9, 4388, doi:10.1038/s41467-018-06783-0 (2018).
97 Zhou, W., Scott, S. A., Shelton, S. B. & Crutcher, K. A. Cathepsin D-mediated
proteolysis of apolipoprotein E: possible role in Alzheimer's disease. Neuroscience 143,
689-701, doi:10.1016/j.neuroscience.2006.08.019 (2006).
177
178
Figure 4.1 Replacement of the mouse Apoe gene with the human APOE gene
in APOE-KI mice
A, Genomic organization of the mouse Apoe gene containing exons 1 – 4. B, The APOE-ε3
targeting construct containing the 5’ and 3’ arms of mouse homology interrupted by the human
APOE-ε3 gene sequence. Exons 2 to 4 of the human sequence were flanked with loxP sites.
Positive selection markers were flanked by FRT (Neomycin resistance – NeoR) and F3
(Puromycin resistance – PuroR) sites and inserted downstream of the proximal loxP site and
upstream of the distal loxP site, respectively. C, Homologous recombinant clones were isolated
using double positive (NeoR and PuroR) and negative (Thymidine kinase - TK) selections. D,
The constitutive humanized/conditional knock-out alleles were achieved after in vivo Flp-
mediated removal of the selection markers. The newly introduced human APOE gene is
expressed under control of the endogenous Apoe promoter. E, Constitutive knock-out allele is
achieved when the loxP-flanked region is removed by Cre-recombinase. F, PBS-soluble apoE
protein concentration was measured in cortical brain homogenates from APOE-KI mice at 21
days (p = 0.0004, F = 15.77). G, PBS-soluble apoE protein concentration was measured in
cortical brain homogenates from APOE-KI mice at 3 months of age (p = 0.0043, F = 8.880). H,
Guanidine-soluble apoE protein concentration was also measured in cortical brain homogenates
from APOE-KI mice at 3 months of age (p = 0.0144, F = 6.169). I, The same brain homogenates
were subjected to Western blot analysis for apoE using antibody HJ15.7. White arrowhead =
sialylated apoE (MW ~ 35.3 kDa). Black arrow = non-sialylated apoE (MW ~ 33.6 kDa). N = 2
males, 2 females per genotype. *p < 0.05, ***p < 0.001. A one-way ANOVA was used to assess
significance between more than two groups, and Bonferroni’s post-hoc test was used to test for
differences between each of the groups. All values are reported as mean ± SEM. N = 5 per
genotype for F, G, and H, with approximately equal numbers of males and females.
179
Figure 4.2 Human APOE is expressed in astrocytes in APOE-KI mice
A, Brain sections from APOE-KI mice were co-stained for nuclei (DAPI), apoE, and GFAP.
Multiple foci of ApoE/GFAP co-localization can be seen at high magnification (bottom panels).
B, Brain sections from APOE-KI mice were co-stained for nuclei (DAPI), apoE, and IBA1. No
overlap of apoE and IBA1 staining was observed. Scale bars = 200 µm (top panels) and 50 µm
(bottom panels). Images are from E4F mice, and are representative of at least 3 random cortical
areas from 3 biological replicates. There were no appreciable qualitative differences between
E2F, E3F, and E4F samples.
180
Figure 4.3 Microglial APOE expression in APP/PS1/EKI mice
A, Brain sections from APP/PS1/E4F mice were co-stained for nuclei (DAPI), apoE, and IBA1.
Multiple foci of apoE/ IBA1 co-localization can be seen (arrows). Scale bars = 20 µm B, Brain
sections from APP/PS1/E4F mice were co-stained with DAPI, apoE, Aβ, and IBA1. ApoE is co-
localized with IBA1 (arrowhead). Scale bars = 25 µm. Images are representative of at least 3
random cortical areas from 3 biological replicates. There were no appreciable qualitative
differences between APP/PS1/E2F, APP/PS1/E3F, and APP/PS1/E4F samples.
181
Figure 4.4 Qualitative assessment of microglia and astrocyte-derived apoE
particles
Conditioned media samples from E2F, E3F, and E4F-derived primary cultures enriched for
microglia and astrocyte were subjected to non-denaturing 4-20% Tris-glycine gradient gel
electrophoresis followed by Western blotting. Approximate hydrated radius of marker proteins,
run on the same gel, are shown for comparative purposes. Data shown are representative of 3
independent cultures from different cohorts of mice.
182
183
Figure 4.5 ApoE isoforms differentially influence Aβ plaque deposition in
APP/PS1/EKI mice
A, Brain sections from 4-month-old APP/PS1/EKI mice were immunostained with anti-
Aβ antibody (HJ3.4-biotin) and the extent of Aβ deposition in the cortex quantified. There was a
significant effect of sex (F1,57 = 5.792, p = 0.0194) and apoE isoform (F2,57 = 4.356, p = 0.0174)
but no interaction (F2,57 = 0.3269, p = 0.7225). Post hoc analysis comparing apoE isoform within
each sex found a statistically significant increase in Aβ deposition in female apoE4-
expressing mice compared to apoE3 (p = 0.0466), APP/PS1/E2F = 8 males, 10 female;
APP/PS1/E3F = 9 males, 10 females; APP/PS1/E4F = 13 males, 13 females. Scale bar = 1 mm.
B, Brain sections from 4-month-old APP/PS1/EKI mice were stained with X-34 dye that
recognizes only fibrillar plaques and the cortical area stained by X-34 was quantified. There was
a significant effect of sex (F1,59 = 9.008, p = 0.0039) and apoE isoform (F2,59 = 4.838, p = 0.0113)
but no interaction (F2,59 = 0.1898, p = 0.8276). Post hoc analysis comparing apoE isoform within
each sex did not find a statistically significant difference, although there was a trend towards
elevated X-34 staining in apoE4-expressing female mice compared to apoE2 (p = 0.0602) and
apoE3 (0.0830), APP/PS1/E2F = 8 males, 9 females; APP/PS1/E3F = 11 males, 10 females;
APP/PS1/E4F = 12 males, 15 females. Scale bar = 1 mm. C, The density of plaques from 4-
month old APP/PS1/EKI mice was calculated. There was a significant effect of sex (F1,57 =
5.101, p = 0.0278) and apoE isoform (F2,57 = 8.8085, p = 0.0008) but no interaction (F2,57 =
0.7514, p = 0.4763). Post hoc analysis comparing apoE isoform within each sex found a
statistically significant increase in Aβ plaque density in female apoE4-expressing mice compared
to apoE3 (p = 0.0032) or apoE2 (p = 0.0484), APP/ PS1/E2F = 8 males, 10 females;
APP/PS1/E3F = 9 males, 10 females; APP/PS1/E4F = 13 males, 13 females. D, The average
plaque size was quantified. There was a significant effect of sex (F1,57 = 5.410, p = 0.0236), but
not of apoE isoform (F2,57 = 2.202, p = 0.1420) with no interaction (F2,57 = 0.05053, p = 0.9508),
APP/PS1/E2F = 8 males, 10 females; APP/PS1/E3F = 9 males, 10 females; APP/PS1/E4F = 13
males, 13 females. E, The density of X-34+ plaques was quantified. There was a significant
effect of sex (F1,61 = 9.527, p = 0.0030) and apoE isoform (F2,61 = 9.941, p = 0.0002) but no
interaction (F2,61 = 0.8835, p = 0.4186). Post hoc analysis comparing apoE isoforms within each
sex found a statistically significant increase in plaque density in female apoE4-expressing mice
compared to apoE3 (p = 0.0053), or apoE2 (p = 0.0016), APP/PS1/E2F = 8 males, 9 females;
APP/ PS1/E3F = 11 males, 10 females; APP/PS1/E4F = 14 males, 15 females. F, The
average X-34+ plaque size was quantified. There was a significant effect of sex (F1,61 = 11.97, p
= 0.0010), but not apoE isoform (F2,61 = 2.094, p =0.1320) with no interaction (F2,61 = 0.9353, p
= 0.3980). All statistics were performed using a 2-way ANOVA followed by Tukey post-
hoc test. *p < 0.05, **p < 0.01. All values are reported as mean ± SEM.
184
185
Figure 4.6 APOE isoforms differentially influence Aβ accumulation in
APP/PS1/EKI mice
Cortical tissues from 4-month-old APP/PS1-EKI mice were sequentially homogenized in PBS
and 5 M guanidine-HCl buffer. A, The amount of PBS-soluble apoE was quantified by ELISA.
There was a significant effect of sex (F1,66 = 8.373, p = 0.0052) and apoE isoform (F2,66 = 3.911,
p = 0.0248) but no interaction (F2,66 = 0.8546, p = 0.4301). Post hoc analysis comparing apoE
isoform within each sex identified a statistically significant increase in apoE levels in
female apoE4-expressing compared to apoE3 (p = 0.0293). B, The amount of PBS-
soluble Aβ40 was quantified by ELISA. There was a significant effect of apoE genotype (F2,66 =
3.204, p = 0.0470), and a trend towards a significant effect of sex (F1,66 = 3.203, p = 0.0781),
with no interaction (F2,66 = 0.06043, p = 0.9414). Post hoc analysis comparing apoE isoforms
within each sex did not identify statistically significant pair-wise differences. C, The amount
of PBS-soluble Aβ42 was quantified by ELISA. There was a significant effect of sex (F1, 66 =
4.246, p = 0.0433) and apoE isoform (F2,66 = 4.943, p = 0.0100) without interaction (F2,66 =
0.5411, p = 0.5847). Post hoc analysis comparing apoE isoform within each sex identified a
statistically significant increase in Aβ42 levels in male apoE2-expressing mice compared to
apoE3 (p = 0.0338). D, The amount of guanidine-soluble Aβ40 was quantified by ELISA. There
was a significant effect of sex (F1, 66 = 5.240, p = 0.0253) and apoE isoform (F2,66 = 3.953, p =
0.0239) without interaction (F2,66 = 1.211, p = 0.3044). Post hoc analysis comparing apoE
isoforms within each sex identified a statistically significant increase of Aβ40 in female apoE4-
expressing mice compared to apoE3 (p = 0.0086). E, The amount of guanidine-soluble Aβ42 was
quantified by ELISA. There was a trend towards a significant effect of sex (F1, 66 = 3.915, p =
0.0520) and a significant effect of apoE isoform (F2,66 = 5.476, p = 0.0063) without interaction
(F2,66 = 1.384, p = 0.2578). Post hoc analysis comparing apoE isoform within each sex identified
a statistically significant increase in Aβ42 levels in female apoE4-expressing mice compared to
apoE3 (p = 0.0030). 2-way ANOVA, Tukey’s post-hoc test, APP/PS1/E2F = 9 males, 10
females; APP/PS1/E3F = 12 males, 12 females; APP/PS1/E4F = 14 males, 15 females. Data
plotted as mean ± SEM. * p < 0.05, ** p < 0.01.
186
187
Figure 4.7 Plasma lipid alterations in APP/PS1/EKI mice lacking liver-
derived apoE
A, APOE mRNA levels in liver tissues from 4-month-old APP/ PS1-EKI mice were analyzed by
qPCR (p < 0.0001, F = 31.60). Post hoc analysis showed a significant difference between Cre+/-
and Cre-/- mice in all APOE genotypes (p < 0.0001 for all). B, PBS-soluble apoE protein
concentration was measured in liver homogenates from the same cohort of mice (p < 0.0001, F =
23.03) Post hoc analysis showed a significant difference between Cre+/- and Cre-/- mice in all
APOE genotypes (p < 0.0001 for all). Data for (A) and (B) were analyzed by one-way ANOVA,
followed by Bonferroni’s post-hoc test for differences between each of the groups. N = 3 males,
2 females in each group. C, Plasma apoE levels in male mice were measured by ELISA. There
was a significant effect of apoE isoform (F2,49 = 70.97, p<0.0001) and Cre expression (F1,49 =
51.79, p < 0.0001) with a significant interaction (F2,49 = 7.748, p = 0.0012). Post hoc pair-
wise comparisons between Cre+/- and Cre-/- groups found Cre expression significantly decreased
plasma apoE levels across apoE isoforms. (apoE2, p <0.0001; apoE3, p = 0.0112; apoE4, p =
0.0232). (n; E2F: 8 Cre-/-, 12 Cre+/-; E3F: 11 Cre-/-, 12 Cre+/-; E4F: 5 Cre-/-, 8 Cre+/-). D, Plasma
apoE levels in female mice were measured by ELISA. There was a significant effect of apoE
isoform (F1,41 = 43.03, p<0.0001) and Cre expression (F1,41 = 61.81, p<0.0001) with a significant
interaction (F2,41 = 9.954, p = 0.0003). Post hoc pair-wise comparisons between Cre+/− and
Cre−/− groups found Cre expression significantly decreased plasma apoE levels across apoE
isoforms. (apoE2, p < 0.0001; apoE3, p = 0.0372; apoE4, p = 0.0025). (n; E2F: 5 Cre−/−, 8 Cre+/−;
E3F: 11 Cre−/−, 6 Cre+/−; E4F: 11 Cre−/−, 7 Cre+/−). E, Total cholesterol in male mice was
quantified. There was a significant effect of apoE isoform (F2,49 = 31.14, p < 0.0001) and Cre
expression (F1,49 = 86.12, p < 0.0001) and a significant interaction (F2,49 = 24.10, p < 0.0001).
Post hoc pair-wise comparisons between Cre+/− and Cre−/− groups found Cre expression
significantly increased plasma cholesterol levels in mice expressing apoE2 (p < 0.0001) or apoE3
(p = 0.0001), but not apoE4 (p = 0.1971). (n; E2F: 8 Cre−/−, 12 Cre+/−; E3F: 11 Cre−/−, 12 Cre+/−;
E4F: 4 Cre−/−, 9 Cre+/−). F, Total plasma cholesterol in female mice was quantified. There was a
significant effect of apoE isoform (F2,41 = 46.39, p < 0.0001) and Cre genotype (F1,41 = 24.31, p
< 0.0001) with a significant interaction (F2,41 = 12.59, p < 0.0001). Post hoc pair-
wise comparisons between Cre+/− and Cre−/− groups found Cre expression significantly increased
plasma cholesterol levels in apoE2-expressing mice (p < 0.0001), but not apoE3 or apoE4-
expressing mice. (n; E2F: 5 Cre−/−, 8 Cre+/−; E3F: 10 Cre−/−, 6 Cre+/−; E4F: 11 Cre−/−, 7 Cre+/−).
G, Total plasma triglycerides in male mice were quantified. There was a significant effect of
apoE isoform (F2,48 = 13.31, p < 0.0001) and Cre expression (F1,48 = 36.70, p < 0.0001), with a
significant interaction (F2,48 = 3.755, p = 0.0306). Post hoc pairwise comparisons between
Cre+/− and Cre−/− groups found Cre expression significantly increased triglyceride levels in mice
expressing apoE2 (p < 0.0001) or apoE3 (p = 0.0001), but not apoE4. (n; E2F: 8 Cre−/−, 11
Cre+/−; E3F: 11 Cre−/−, 12 Cre+/−; E4F: 4 Cre−/−, 9 Cre+/−). H, Total plasma triglycerides in female
mice were quantified. There was a significant effect of apoE isoform (F2,40 = 10.68, p = 0.0002)
and Cre expression (F1,40 = 4.168, p = 0.0478), but no significant interaction (F2,40 = 0.1031, p =
0.9023). Post hoc pair-wise comparisons did not identify significant differences in triglyceride
levels in mice dependent on Cre expression. (n; E2F: 4 Cre−/−, 8 Cre+/−; E3F: 10 Cre−/−, 6 Cre+/−;
E4F: 11 Cre−/−, 7 Cre+/−). I, Total plasma HDL in male mice was quantified. There was a
significant effect of apoE isoform (F2,49 = 8.239, p = 0.0008), but not Cre expression (F1,49 =
0.9027, p = 0.3467) with a significant interaction (F2,49 = 5.434, p = 0.0074). (n; E2F: 8 Cre−/−,
188
12 Cre+/−; E3F: 11 Cre−/−, 12 Cre+/−; E4F: 4 Cre−/−, 9 Cre+/−). J, Total plasma HDL in female
mice was quantified. There was a significant effect of apoE isoform (F2,42 = 9.9098, p = 0.0005),
but not Cre expression (F1,42 = 0.9699, p = 0.3304), with no interaction (F2,42 = 1.668, p =
0.2010). (n; E2F: 5 Cre−/−, 8 Cre+/−; E3F: 11 Cre−/−, 6 Cre+/−; E4F: 11 Cre−/−, 7 Cre+/−). Data
analyzed by 2-way ANOVA followed by Holm-Sidak multiple comparisons testing. Values from
EKO mice are also plotted according to sex (n = 5 males, 3 females), but were not included in
statistical comparisons. * p < 0.05, ** p < 0.01, ***p < 0.001, **** p < 0.0001.
189
190
Figure 4.8 Liver-derived apoE does not influence Aβ accumulation in the
brain
A, B, C, Brain sections from 4-month-old APP/PS1/EKICre mice and littermates were

immunostained with an anti-Aβ antibody. Scale bars = 1 mm. G, The extent of cortical
Aβ deposition in male mice was quantified. There was a significant effect of apoE isoform
(F2,49 = 10.63, p = 0.0001), but not Cre expression (F1,49 = 2.693, p = 0.1072) with no interaction
(F2,49 = 0.1845). (n; E2F: 8 Cre−/−, 12 Cre+/−; E3F: 10 Cre−/−, 12 Cre+/−; E4F: 5 Cre−/−, 8 Cre+/−).
H, The extent of cortical Aβ deposition in female mice was quantified. There was a significant
effect of apoE isoform (F2,41 = 12.00, p < 0.0001), but not Cre expression (F1,41 = 0.2520, p =
0.6183) with no interaction (F2,41 = 0.09684, p = 0.9079). (n; E2F: 5 Cre−/−, 8 Cre+/−; E3F: 11
Cre−/−, 6 Cre+/−; E4F: 10 Cre−/−, 7 Cre+/−). D, E, F, Brain sections from the same cohort were
stained with X-34 dye. I, The cortical fibrillar plaque load in male mice was quantified. There
was a significant effect of apoE isoform (F2,50 = 11.34, p < 0.0001), but not Cre expression
(F1,50 = 0.3027, p = 0.5846) with no interaction (F2,50 = 1.607, p = 0.2106). (n; E2F: 8 Cre−/−, 12
Cre+/−; E3F: 11 Cre−/−, 12 Cre+/−; E4F: 4 Cre−/−, 9 Cre+/−). J, The cortical fibrillary plaque load in
female mice was quantified. There was a significant effect of apoE isoform (F2,42 = 10.53, p =
0.0002), but not Cre expression (F1,42 = 0.5502, p = 0.4624) with no interaction (F2,42 = 0.2734, p
= 0.7622). (n; E2F: 5 Cre−/−; 8 Cre+/−; E3F: 11 Cre−/−, 6 Cre+/−; E4F: 11 Cre−/−, 7 Cre+/−). Data
analyzed by 2-way ANOVA.
191
192
in APOE-KI mice
Cortical tissues were sequentially homogenized in PBS and 5M guanidine HCl buffer. Aβ and
apoE levels were quantified by ELISA. A, Levels of PBS-soluble apoE in cortex of male mice.
There was a trend towards a significant effect of apoE isoform (F2,50 = 3.040, p = 0.568), and no
significant effect of Cre (F1,50 = 0.3673, p = 0.5472) or interaction (F2,50 = 0.1696, p = 0.8445).
(n; APP/PS1/E2F: 8 Cre-/-,12 Cre+/-; APP/PS1/E3F: Cre-/-,12 Cre+/-; APP/PS1/E4F: 5 Cre-/-, 8
Cre+/-). B, Levels of PBS-soluble apoE in cortex of female mice. There was no significant effect
of apoE isoform (F2,42 = 0.1669, p = 0.8468), Cre expression (F1,42 = 0.02187, p = 0.8831) or
interaction (F2,42 = 2.277, p = 0.1151). (n; APP/PS1/E2F: 5 Cre-/-, 8 Cre+/-; APP/PS1/E3F: 11
Cre-/-, 6 Cre+/-; APP/PS1/E4F: 11 Cre-/-, 7 Cre+/-). C, Levels of PBS-soluble Aβ40 in the cortex of
male mice. There was a significant effect of apoE isoform (F2,49 = 10.12, p = 0.0002), but not
Cre expression (F1,49 = 0.002707, p = 0.9587) or interaction (F2,49 = 0.4113, p = 0.6650). (n;
APP/PS1/E2F: 8 Cre-/-, 12 Cre+/-; APP/PS1/E3F: 10 Cre-/-, 12 Cre+/-; APP/PS1/E4F: 5 Cre-/-, 8
Cre+/-). D, Levels of PBS-soluble Aβ40 in the cortex of female mice. There was a significant
effect of apoE isoform (F2,42 = 3.495, p = 0.0394), but not Cre expression (F1,42 = 0.4314, p =
0.5149) or interaction (F2,42 = 1.217, p = 0.3065). (n; APP/PS1/E2F: 8 Cre-/-, 12 Cre+/-;
APP/PS1/E3F: 11 Cre-/-, 12 Cre+/-; APP/PS1/E4F: 5 Cre-/-, 8 Cre+/-). E, Levels of PBS-soluble
Aβ42 in cortex of male mice. There was a significant effect of apoE isoform (F2,50 = 5.328, p =
0.0080), but not Cre expression (F1,50 = 0.07241, p = 0.7890), or interaction (F2,50 = 0.1759, p =
0.8392). (n; APP/PS1/E2F: 8 Cre-/-, 12 Cre+/-; APP/PS1/E3F: 11 Cre-/-, 12 Cre+/-; APP/PS1/E4F:
5 Cre-/-, 8 Cre+/-). F, Levels of PBS-soluble Aβ42 in the cortex of female mice. There was a trend
towards a significant effect of apoE isoform (F2,42 = 2.597, p = 0.0864), and no significant effect
of Cre expression (F1,42 = 0.1586, p = 0.6925) or interaction (F2,42 = 0.2245, p = 0.7999). (n;
Cre+/-). G, Levels of guanidine-soluble apoE in the cortex of male mice. There was a trend
towards a significant effect of apoE isoform (F2,50 = 2.513, p = 0.0912), and no effect of Cre
expression (F1,50 = 0.8026, p = 0.3746) or interaction (F2,50 = 0.9035, p = 0.4116). (n;
Cre+/-). H, Levels of guanidine soluble apoE in the cortex of female mice. There was a
significant effect of apoE isoform (F2,42 = 3.669, p = 0.0340), but no significant effect of Cre
expression (F1,42 = 0.0003, p =0.9857) or interaction (F2,42 = 0.2874, p = 0.7517). (n;
Cre+/-). I, Levels of guanidine-soluble Aβ40 in the cortex of male mice. There was a significant
effect of apoE isoform (F2,48 = 7.273, p = 0.0017), but not Cre expression (F1,48 = 0.1102, p =
0.7414) or interaction (F2,48 = 2.333, p = 0.1079). (n; APP/PS1/E2F: 7 Cre-/-, 12 Cre+/-;
APP/PS1/E3F: 11 Cre-/-, 12 Cre+/-; APP/PS1/E4F: 5 Cre-/-, 7 Cre+/-). J, Levels of guanidine-
soluble Aβ40 in the cortex of female mice. There was a significant effect of apoE isoform (F2,41 =
9.575, p =0.0004), but no significant effect of Cre expression (F1,41 = 0.1030, p = 0.7499) and no
interaction (F2,41 = 2.354, p = 0.1077). (n; APP/PS1/E2F: 4 Cre-/-, 8 Cre+/-; APP/PS1/E3F: 11
Cre-/-, 6 Cre+/-; APP/PS1/E4F: 11 Cre-/-, 7 Cre+/-). K, Levels of guanidine-soluble Aβ42 in the
cortex of male mice. There was a significant effect of apoE isoform (F2,49 = 10.88, p = 0.0001),
but no significant effect of Cre expression (F1,49 = 0.05731, p = 0.8118), and a trend towards a
significant interaction (F2,49 = 2.925, p = 0.0631). (n; APP/PS1/E2F: 7 Cre-/-, 12 Cre+/-;
193
APP/PS1/E3F: 11 Cre-/-, 12 Cre+/-; APP/PS1/E4F: 5 Cre-/-, 8 Cre+/-). L, Levels of guanidine-
soluble Aβ42 in the cortex of female mice. There was a significant effect of apoE isoform (F2,41 =
16.32, p<0.0001), but not Cre expression (F1,41 = 0.4266, p = 0.5173) and no interaction (F2,41 =
1.722, p = 0.1914). (n; APP/PS1/E2F: 4 Cre-/-, 8 Cre+/-; APP/PS1/E3F: 11 Cre-/-, 6 Cre+/-;
APP/PS1/E4F: 11 Cre-/-, 7 Cre+/-). Data analyzed by 2 way ANOVA. Data from APP/PS1/EKO
mice (3 males, 1 female) are also plotted, but were not included in statistical analysis.
194
195
in APOE-KI mice
A, The specific sequence of the genomic region surrounding the translation initiation codon of
the human and mouse APOE gene, located on exon 2, is shown. The mouse and human
sequences are aligned for comparative purposes. The cleavable signal peptide is encoded within
exons 2 and 3 (amino acids 1-18). B, C, D, Targeting vectors for the ε2 and ε4 alleles have
identical sequence other than their respective SNPs at positions 130 and 176, both located on
exon 4 ([Cys130, Cys176] for APOE-ε2 (B), [Cys130, Arg176] for APOE-ε3 (C), and [Arg130,
Arg176] for APOE-ε4) (D). The red arrowheads identify the SNPs at positions 130 and 176 in
each of the allele sequences. E, F, APOE mRNA levels in the hippocampus (E), and hemisphere
(F) of APOE-KI mice were analyzed at 3 months of age (p = 0.0169, F = 5.843 and p = 0.0025,
F = 10.88, respectively). G, Cortex-derived brain homogenates from 3-month-old APOE-KI mice
were subjected to western blot analysis for apoE using antibody HJ15.3. White arrowhead =
sialylated apoE (MW ~ 35.3 kDa). Black arrow = non-sialylated apoE (MW ~ 33.6 kDa). *p <
0.05, **p < 0.01, ***p < 0.001. A one-way ANOVA was used to assess significance between
more than two groups, and Bonferroni’s post-hoc test was used to test for differences between
each of the groups. All values are reported as mean ± SEM. N = 5 per genotype for ELISA
analysis, with approximately equal numbers of males and females.
196
197
Figure 4.11 ApoE isoforms differentially influence Aβ plaque deposition in
APP/PS1/APOE-TR mice
A, Brain sections from 3- month-old APP/PS1/APOE-TR mice were immunostained with anti-
Aβ antibody 3D6 and the extent of Aβ deposition in the cortex quantified. Two-way ANOVA
analysis found a significant effect of apoE isoform (F2,38 = 10.13, p = 0.0003) but no significant
effect of sex (F1,38 = 0.001177, p = 0.9728), and no interaction (F2,38 = 0.06101, p = 0.9409). Post
hoc analysis comparing apoE isoform within each sex found a statistically significant increase in
Aβ deposition in male apoE2- (p = 0.0010) and apoE4- expressing (p = 0.0430) mice compared
to apoE3, APP/PS1/E2 = 8 males, 9 female; APP/PS1/E3 = 11 males, 4 females; APP/PS1/E4 =
7 males, 5 females. B, Since there was no effect of sex on Aβ staining, data for both males and
females were pooled together. A one-way ANOVA was performed (F = 11.92, p < 0.0001),
followed by Tukey’s post hoc test for multiple comparisons. C, Brain sections from 4-month-
old APP/PS1/APOE-TR mice were stained with X-34 dye that recognizes only fibrillar plaques
and the cortical area stained by X-34 was quantified. There was a significant effect of genotype
(F2,37 = 8.701, p = 0.0008) but no significant effect of sex (F1,37 = 0.6014, p = 0.4430), and no
interaction (F2,37 = 0.2230, p = 0.8012). Post hoc analysis comparing apoE isoform within each
sex found a statistically significant increase in X-34 staining in male apoE2-expressing mice
compared to apoE3 (p = 0.0011), APP/PS1/E2 = 8 males, 9 female; APP/ PS1/E3 = 10 males, 4
females; APP/PS1/E4 = 7 males, 5 females. D, Since there was no effect of sex on X-34 staining,
data for both males and females were pooled together. A one-way ANOVA was performed (F =
11.69, p = 0.0001), followed by Tukey’s post hoc test for multiple comparisons. * p < 0.05, ** p
< 0.01, **** p < 0.0001. All values are reported as mean ± SEM.
198
Chapter 5
Conclusions and future directions
199
5.1 Delineating the effects of apoE on amyloid plaques
versus the innate immune response
We discussed in chapter 1 the many ways that APOE can influence Aβ, one of the key
players in the pathogenesis of Alzheimer disease (AD). We initiated the ASO studies (discussed
in chapter 2) with some understanding of how APOE isoforms can influence the clearance of
soluble Aβ from the ISF 3,13

. Additionally, genetically lower apoE levels lead to an impressive
reduction of cerebral Aβ accumulation in at least one model of amyloidosis9. During the process,
however, we learned more about how apoE influences the earliest stages of Aβ aggregation, an
unexpected finding. Though this aspect of the APOE-Aβ interaction was described
previously2,11,14, our study6 and that of our colleagues10 were the first ones to demonstrate the
consequences of such interaction in an in vivo context. More importantly, our study carries
important therapeutic indications: simply lowering apoE levels in symptomatic AD patients may
not lead to reduction of cerebral plaque load. Based on our data, apoE reduction must be initiated
before any Aβ aggregates can be detected in order to slow the overall progression of amyloidosis.
These results, if translated to humans, mean that one must be treated in their 20s or 30s (depending
on their APOE genotype), based on some estimates7. Though biomarker studies are hitting great
strides towards finding an early diagnostic marker of AD, we currently have no proven method to
predict late-onset AD risk reliably that early in the disease process.
However, another finding from our ASO studies offers a glimpse of hope for APOE-
targeted therapy for late-onset AD: the reduction of dystrophic neurites. Cerebral Aβ accumulation
does not correlate well with clinical symptoms of AD1,8, and most models of amyloidosis do not
develop significant neurodegeneration. However, most APP transgenic models, including the
APPPS1 strain we utilized, do develop neuritic dystrophy. Neuritic dystrophy is a phenomenon
200
where damaged neuronal processes become dysmorphic, and are often referred to as dystrophic
neurites. This phenotype is used as a surrogate read-out for plaque toxicity, as they are often found
immediately around the plaques. We found a reduction in the amount of dystrophic neurites in the
mice treated with the ASO, whether or not there was a reduction in plaques. Interestingly, we also
found a small, but significant, reduction of the complement protein C1q in the same mice
(unpublished data). This is consistent with a previous study that found elevated C1q levels in
APOE4-knock-in mice that subsequently affected astrocytic functions in those mice4. Thus, future
studies on the role of apoE in modulating neurotoxicity and the immune system might open up
therapeutic options bypassing the need to reduce plaque pathology (Figure 5.1).
In the context of our Aβ seeding studies (discussed in chapter 3), future analysis on the
glial response to the induced Aβ species will shed more insight on the role of apoE on the innate
immune response. Specifically, we will be able to examine whether the glial response leads to
alterations in plaque morphology or dystrophic neurites, or the other way around. Having been
demonstrated to influence both of these events, APOE remains an attractive therapeutic target for
AD. This goal must be approached cautiously in a step-wise manner, where one scientific question
is addressed at a time. Along with the lessons learned during the early trials that target Aβ, a
systematic approach to developing AD therapeutics can increase the likelihood of success for
future trials.
5.2 Current and future challenges to Alzheimer disease

research
The increasing prevalence of Alzheimer disease (AD) and other neurodegenerative
diseases is not only due to the aging population, but also the severe lack of effective treatment
options. Over 200 compounds were tested in over 400 clinical trials for AD between 2002 and
201
2012, with only one single compound approved. That’s a 99.6 % failure rate (compared to 81%
failure rate for trials on cancer drugs)5.
Why is our knowledge gained from the bench not translating to the bed side? This lack of
translatability is one of the biggest challenges of current neurodegeneration research. In addition
to technical limitations of the clinical trials (flawed study design, lack of definitive endpoint
measures, etc...), a key challenge lies in the lack of an ideal disease model. Many rodent models
used to study neurodegenerative diseases retain the native regulatory elements, despite harboring
the human sequence. This precludes rigorous studies on the upstream components of the novel
gene. Most transgenic mice used to study amyloidosis in the context of AD overexpress the human
gene by several folds. Flooding the system with such high concentration of the transgene might
overwhelm the brain’s homeostatic capacity, and potentially create phenotypes that are artifacts.
The artificially strong phenotype might also mask beneficial effects of potentially effective drugs.
Additionally, considerable species differences between rodents and humans exist and challenge
our ability to generate findings that are relevant and directly translatable to humans from studies
in mice and rats. Apparent differences in physiological function and metabolism, such as lipid
metabolism and immune response between humans and rodents might preclude important
discoveries that are relevant to disease mechanism.
Our effort to address some of the limitations of the existing APOE knock-in (APOE-TR)
mice resulted in the generation of the novel APOE-KI mice, whose genetic construct and general
characterization was discussed in chapter 4. The engineered loxP sites around the APOE locus
have allowed us to specifically suppress APOE expression in hepatocytes, and investigate the
physiologic response both in the periphery and the CNS. In addition to the ability to target a
specific tissue, the Cre-loxP system also allows researchers to manipulate APOE expression in a
202
temporally controlled manner. It is important to acknowledge that, while our newly created mouse
lines (and the previous generation of APOE knock-in mice) harbor the human gene sequence, they
retain the regulatory elements found in mice. It is critical to address this caveat in past, current,
and future rodent studies, in lieu of a recent studies including one showing evidence that apoE can
act as a transcription factor and influence a wide variety of signaling pathways12. To circumvent
the limitation of existing animal models, new experimental paradigms, particularly those derived
from humans (such as iPSCs and brain organoids), need to be developed and characterized. An
alternative approach is to engineer human Aβ and/or Tau into species with more human-like
physiology than rodents. These new experimental platforms will undoubtedly complement the
current animal models and fuel a new wave of discovery that is necessary to fully understand AD
pathology, explore its relationship with apoE, and design new therapies. Another motivation for
developing better model systems is the high incidence of unexpected side effects in human trials,
particularly with antibody-based therapy, despite not being observed in preclinical studies.
More than 20 years have passed since the landmark discovery linking APOE with AD, and
APOE remains the strongest known genetic risk factor for LOAD. Intensive research efforts have
undoubtedly unveiled several important insights regarding apoE and its role in AD. Nevertheless,
no APOE-based (or any) disease-modifying therapy has been approved for AD treatment within
that period. That means many questions remain unanswered, including the most important
question: how does APOE gene polymorphism confer AD risk? While the evidence that APOE
influences AD risk substantially via effects on Aβ is strong, it should be noted that a relatively
large body of literature also exists to support APOE’s roles in AD pathogenesis that are Aβ-
independent. This area needs further exploration. It is possible that apoE participates in an
unknown fundamental mechanistic event (such as a general signaling cascade) that influences
203
brain homeostasis. If true, the single amino acid change among the different isoforms (particularly
apoE4) somehow alters the behavior/function of apoE in this process that ultimately lowers the
brain’s ability to tolerate neurotoxic insults (such as Aβ or tau accumulations). This increased
vulnerability, in turn, could affect AD risk. Similarly, apoE’s potential role in facilitating the
immune response to AD pathology needs further investigation. Considering TREM2’s newly
described role as a lipid-sensing receptor, it is necessary to definitively determine whether there’s
a true, meaningful connection between APOE and TREM2.
Along with the affordability and availability of big data science, there needs to be more
studies that look at apoE isoforms’ differential effects on specific cell populations in the brain in
an unbiased fashion. Such studies might identify novel targets that will allow us to gain a deeper
understand as to why AD occurs when it does (old age) and where it does (susceptibility regions
within the brain). Standing on the shoulder of giants, and aided by the advancement of technology,
researchers are empowered more than ever to push the field towards a meaningful understanding
of APOE and AD pathogenesis. From that insight, we hope to develop new and effective therapies
that will alter the course of the disease.
204
5.3 References
1 Arriagada, P. V., Growdon, J. H., Hedley-Whyte, E. T. & Hyman, B. T. Neurofibrillary
tangles but not senile plaques parallel duration and severity of Alzheimer's disease.
Neurology 42, 631-639 (1992).
2 Castano, E. M., Prelli, F., Wisniewski, T., Golabek, A., Kumar, R. A., Soto, C. &
Frangione, B. Fibrillogenesis in Alzheimer's disease of amyloid beta peptides and
apolipoprotein E. The Biochemical journal 306 ( Pt 2), 599-604 (1995).
4 Chung, W. S., Verghese, P. B., Chakraborty, C., Joung, J., Hyman, B. T., Ulrich, J. D.,
Holtzman, D. M. & Barres, B. A. Novel allele-dependent role for APOE in controlling
the rate of synapse pruning by astrocytes. Proceedings of the National Academy of
Sciences of the United States of America 113, 10186-10191,
doi:10.1073/pnas.1609896113 (2016).
5 Cummings, J. L., Morstorf, T. & Zhong, K. Alzheimer's disease drug-development
pipeline: few candidates, frequent failures. Alzheimer's research & therapy 6, 37,
doi:10.1186/alzrt269 (2014).
doi:10.1016/j.neuron.2017.11.014 (2017).
Alexander, M., Almdahl, I. S., Arnold, S. E., Baldeiras, I., Barthel, H., van Berckel, B.
N., Bibeau, K., Blennow, K., Brooks, D. J., van Buchem, M. A., Camus, V., Cavedo, E.,
Chen, K., Chetelat, G., Cohen, A. D., Drzezga, A., Engelborghs, S., Fagan, A. M.,
Fladby, T., Fleisher, A. S., van der Flier, W. M., Ford, L., Forster, S., Fortea, J., Foskett,
N., Frederiksen, K. S., Freund-Levi, Y., Frisoni, G. B., Froelich, L., Gabryelewicz, T.,
Gill, K. D., Gkatzima, O., Gomez-Tortosa, E., Gordon, M. F., Grimmer, T., Hampel, H.,
Hausner, L., Hellwig, S., Herukka, S. K., Hildebrandt, H., Ishihara, L., Ivanoiu, A.,
Jagust, W. J., Johannsen, P., Kandimalla, R., Kapaki, E., Klimkowicz-Mrowiec, A.,
Klunk, W. E., Kohler, S., Koglin, N., Kornhuber, J., Kramberger, M. G., Van Laere, K.,
Landau, S. M., Lee, D. Y., de Leon, M., Lisetti, V., Lleo, A., Madsen, K., Maier, W.,
Marcusson, J., Mattsson, N., de Mendonca, A., Meulenbroek, O., Meyer, P. T., Mintun,
M. A., Mok, V., Molinuevo, J. L., Mollergard, H. M., Morris, J. C., Mroczko, B., Van der
Mussele, S., Na, D. L., Newberg, A., Nordberg, A., Nordlund, A., Novak, G. P.,
Paraskevas, G. P., Parnetti, L., Perera, G., Peters, O., Popp, J., Prabhakar, S., Rabinovici,
G. D., Ramakers, I. H., Rami, L., Resende de Oliveira, C., Rinne, J. O., Rodrigue, K. M.,
Rodriguez-Rodriguez, E., Roe, C. M., Rot, U., Rowe, C. C., Ruther, E., Sabri, O.,
Sanchez-Juan, P., Santana, I., Sarazin, M., Schroder, J., Schutte, C., Seo, S. W.,
Soetewey, F., Soininen, H., Spiru, L., Struyfs, H., Teunissen, C. E., Tsolaki, M.,
205
Vandenberghe, R., Verbeek, M. M., Villemagne, V. L., Vos, S. J., van Waalwijk van
Doorn, L. J., Waldemar, G., Wallin, A., Wallin, A. K., Wiltfang, J., Wolk, D. A., Zboch,
M. & Zetterberg, H. Prevalence of cerebral amyloid pathology in persons without
dementia: a meta-analysis. Jama 313, 1924-1938, doi:10.1001/jama.2015.4668 (2015).
8 Josephs, K. A., Whitwell, J. L., Ahmed, Z., Shiung, M. M., Weigand, S. D., Knopman, D.
S., Boeve, B. F., Parisi, J. E., Petersen, R. C., Dickson, D. W. & Jack, C. R., Jr. Beta-
amyloid burden is not associated with rates of brain atrophy. Annals of neurology 63,
204-212, doi:10.1002/ana.21223 (2008).
9 Kim, J., Jiang, H., Park, S., Eltorai, A. E., Stewart, F. R., Yoon, H., Basak, J. M., Finn,
M. B. & Holtzman, D. M. Haploinsufficiency of human APOE reduces amyloid
deposition in a mouse model of amyloid-beta amyloidosis. The Journal of neuroscience :
doi:10.1523/JNEUROSCI.3773-11.2011 (2011).
10 Liu, C. C., Zhao, N., Fu, Y., Wang, N., Linares, C., Tsai, C. W. & Bu, G. ApoE4
Accelerates Early Seeding of Amyloid Pathology. Neuron 96, 1024-1032 e1023,
doi:10.1016/j.neuron.2017.11.013 (2017).
11 Ma, J., Yee, A., Brewer, H. B., Jr., Das, S. & Potter, H. Amyloid-associated proteins
alpha 1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-
protein into filaments. Nature 372, 92-94, doi:10.1038/372092a0 (1994).
12 Theendakara, V., Peters-Libeu, C. A., Spilman, P., Poksay, K. S., Bredesen, D. E. & Rao,
R. V. Direct Transcriptional Effects of Apolipoprotein E. The Journal of neuroscience :
doi:10.1523/JNEUROSCI.3562-15.2016 (2016).
doi:10.1073/pnas.1220484110 (2013).
pathology 145, 1030-1035 (1994).
206
Figure 5.1 Delineating the effects of apoE on amyloid plaques versus the
innate immune response
Our work suggests an active role of apoE in the initial stages of Aβ aggregation (red arrow).
However, apoE’s role in modulating the immune response in the context of amyloid plaques or
neurodegeneration is not as well understood (blue arrows). A deeper understanding of how apoE
might influence the microglial response or complement activation might yield new opportunities
for therapeutic intervention
207
5579 Waterman Blvd., Unit D, Saint Louis, MO 63112
Huynh.t.v@wustl.edu
(714) 823-6407
Education
Aug 2012 – May 2020 Washington University in St. Louis, School of Medicine
Medical Scientist Training Program (MSTP)
M.D.-Ph.D Combined Degree Program
Ph.D, Neuroscience
Jul 2009 – Jun 2012 University of California, Los Angeles

Bachelor of Science
Major: Molecular, Cell, and Developmental Biology
Minor: Biomedical Research
Summa Cum Laude
College Honors
Phi Beta Kappa
Highest Departmental Honors
Senior Thesis: Understanding the Formation of Neurotoxic Aβ Oligomers
in Alzheimer’s disease
Aug 2007 – Jun 2009 California State University, Long Beach

Major: Biological Sciences
Research Experience
Jun 2013 – Oct 2018 MD-PhD Student – Department of Neurology, Washington University School of
Medicine, Saint Louis, MO
Thesis Advisor: David M. Holtzman, M.D.
Department of Neurology
Thesis Project: The role of apolipoprotein E in Alzheimer disease: from
therapy to mechanism
Oct 2009 – Jul 2012 Undergraduate Researcher – Department of Neurology, David Geffen School of
Medicine at UCLA, Los Angeles, CA
Faculty Advisor: David B. Teplow, Ph.D.
Department of Neurology
Project: Understanding the Formation of Neurotoxic Aβ Oligomers In
Alzheimer’s disease
Jun 2011 – Sep 2011 Summer Research Intern – Howard Hughes Medical Institute and Department of
Cell Biology, Harvard Medical School, Boston, MA
Faculty Advisor: Tom A. Rapoport, Ph.D.
Department of Cell Biology
Project: The role of Ice1 and Fld1 in Neutral Lipid Homeostasis in
Yeast
208
Feb 2009 – Jun 2009 Undergraduate Researcher - Department of Biological Sciences, California State
University, Long Beach, CA
Faculty Advisor: Jesse Dillon, Ph.D.
Department of Biological Sciences
Project: Characterization of halophiles isolated from solar salterns in
Baja California, Mexico
Publications
Huynh, T.V.*, Wang*, C., Tran, A.S., Mahan T.E., Tabor, G.T., Francis, C.M., Finn, M.B., Spellman,
R., Manis, M., Rudolph E. Tanzi, Ulrich, J.D., & Holtzman, D.M. Lack of
hepatic apoE does not influence early Aβ deposition: Observations from a new
APOE knock-in model. Molecular Neurodegeneration 14(1):37,
doi:10.1186/s13024-019-0337-1 (2019).
*These authors contributed equally
Huynh, T. V. & Holtzman, D. M. Amyloid-beta 'seeds' in old vials of growth hormone. Nature 564, 354-
355, doi:10.1038/d41586-018-07604-6 (2018).
Huynh, T. V. & Holtzman, D. M. In Search of an Identity for Amyloid Plaques. Trends in neurosciences
41, 483-486, doi:10.1016/j.tins.2018.06.002 (2018).
Huynh, T. V., Liao, F., Francis, C. M., Robinson, G. O., Serrano, J. R., Jiang, H., Roh, J., Finn, M. B.,
Sullivan, P. M., Esparza, T. J., Stewart, F. R., Mahan, T. E., Ulrich, J. D., Cole,
T. & Holtzman, D. M. Age-Dependent Effects of apoE Reduction Using
Antisense Oligonucleotides in a Model of beta-amyloidosis. Neuron 96, 1013-
1023 e1014, doi:10.1016/j.neuron.2017.11.014 (2017).
Huynh, T. V., Cipriano, C. A., Hagemann, I. S. & Friedman, M. V. Osteolipoma of the knee. Radiology
case reports 12, 124-129, doi:10.1016/j.radcr.2016.10.015 (2017).
Huynh, T. V., Davis, A. A., Ulrich, J. D. & Holtzman, D. M. Apolipoprotein E and Alzheimer's disease:
the influence of apolipoprotein E on amyloid-beta and other amyloidogenic
proteins. Journal of lipid research 58, 824-836, doi:10.1194/jlr.R075481 (2017).
Featured on Journal Cover
Roychaudhuri, R., Huynh, T. V., Whitaker, T. R., Hodara, E., Condron, M. M. & Teplow, D. B. A
Critical Role of Ser26 Hydrogen Bonding in Abeta42 Assembly and Toxicity.
Biochemistry 56, 6321-6324, doi:10.1021/acs.biochem.7b00772 (2017).
Ulrich, J. D., Huynh, T. P. & Holtzman, D. M. Re-evaluation of the Blood-Brain Barrier in the Presence
of Alzheimer's Disease Pathology. Neuron 88, 237-239,
doi:10.1016/j.neuron.2015.10.008 (2015).
Yamin, G.*, Huynh, T. P.* & Teplow, D. B. Design and Characterization of Chemically Stabilized
Abeta42 Oligomers. Biochemistry 54, 5315-5321,
doi:10.1021/acs.biochem.5b00318 (2015).
*These authors contributed equally
209
Book Chapter
1. David B. Teplow, Mingfeng Yang, Robin Roychaudhuri, Eric Pang, Tien-Phat Huynh, Mei-Sha
Chen, Shiela Beroukhim. “Chapter 1. The amyloid β-protein and Alzheimer's disease,” in
Alzheimer’s Disease: Targets for New Clinical Diagnostic and Therapeutic Strategies, Frontiers
in Neuroscience Series, A. S. Rudolph and R. D. Wegrzyn (eds), CRC Press, 2012, Boca Raton,
FL
Grants/Fellowships
Aug 2014 Gilliam Fellowship for Advanced Studies, Howard Hughes Medical Institute
(HHMI), Chevy Chase, MD
Graduate fellowship from HHMI that provides financial and career mentoring
support for exceptional graduate students who are committed to increasing
diversity among scientific leaders, with a goal of becoming faculty members at
colleges and universities. The award totaled $56,000 per year, for up to 5 years. 9
students were awarded each year from a national pool of applicant at time of award.
Awards/Honors
Oct 2018 The Richard and Mildred Poletsky Award for contributions to dementia care
and research, Knight Alzheimer Disease Research Center (ADRC), Washington
University School of Medicine. St. Louis, MO
Annual award by the Knight ADRC at Washington University presented to a
promising graduate student working in the aging and dementia field and making a
meaningful contribution in their chosen discipline. One award per year.
Oct 2018 Outstanding Summer Research Mentor Award. Office of Undergraduate
Research, Washington University in St. Louis. St. Louis, MO
Mar 2018 Finalist – The James L. O’leary Prize for Excellence in Neuroscience
Research. Washington University School of Medicine, St. Louis, MO
Jun 2012 Senior Research Award, Department of Molecular, Cell, and Developmental
Biology (MCDB), University of California, Los Angeles, CA
Awarded to a graduating senior in MCDB in recognition of outstanding
accomplishments in research. One award per graduating class.
Jun 2012 Phi Beta Kappa Graduate Study Award, University of California, Los Angeles,
CA
Awarded by the Phi Beta Kappa Alumni Association of Southern California for a
graduate with outstanding academic performance and accomplishments in medical
210
research who will pursue graduate studies following graduation. One award per
graduating class.
Jun 2012 Chancellor’s Service Award, University of California, Los Angeles, CA
A selective award honoring graduating undergraduate students who have made
significant contributions to UCLA and/or the surrounding Los Angeles
community through a sustained record of outstanding leadership and service.
The recipients of this award are selected by a panel of service-minded
UCLA staff members and are distinguished during the Commencement
ceremony.
Jun 2012 College Honors, College of Letters and Science, University of California, Los
Angeles, CA
Awarded to graduating seniors who successfully complete the College Honors
program and who have an overall University of California grade-point average of
3.5 or better. The program provides exceptional undergraduate students an
opportunity to pursue individual excellence.
Jun – Sep 2011 Exceptional Research Opportunity Program (EXROP), Howard Hughes
Medical Institute (HHMI), Chevy Chase, MD
Research award offered by the Howard Hughes Medical Institute that provides
funding to undergraduate researchers to conduct scientific experiments as part of
a research project with an HHMI investigator. 80 students were awarded per year
from a national pool of applicants.
Sep 2010 – Jun 2011 Wasserman Foundation Scholarship, Undergraduate Research Scholars
Program (URSP), College of Letters and Science, University of California, Los
Angeles, CA
Sep 2011 SACNAS Travel Award, 2011 Annual Conference of the Society for
Advancement of Chicanos and Native Americans in Science (SACNAS)
May 2011 Dean’s Prize for outstanding presentation, 2011 UCLA Undergraduate Science
Poster Day, University of California, Los Angeles, CA
Jun 2010 O F Munson Memorial Scholarship, Financial Aid Office, University of
California, Los Angeles, CA
Jun 2010 Rose Gilbert in Memory of Maggie Gilbert Scholarship, Honors Program,
University of California, Los Angeles, CA
Jun - Sep 2010 CARE SEM SPUR Summer Research Program, Undergraduate Research
Center (URC), Center for Academic and Research Excellence (CARE), Summer
Program for Undergraduate Research (SPUR), University of California, Los
Angeles, CA
Mar – Jun 2010 CARE Fellows Research Program, Center for Academic and Research
Excellence (CARE), University of California, Los Angeles, CA
Apr 2010 2010 Naumberg Summer Research Stipend, Honors Program, University of
California, Los Angeles, CA
2009 – 2011 Dean’s Honors List, University of California, Los Angeles, CA
Apr 2009 Scholarship Recognition Award – University of California, Los Angeles, CA
211
Apr 2009 Exemplary Service Award, Clinical Care Extender Program, Emergency
Department, Hoag Memorial Hospital Presbyterian, Newport Beach, CA
2009 Perfect Attendance Award, Clinical Care Extender Program, Department of
Gynecology, Stroke Unit, and Emergency Department, Hoag Memorial Hospital
Presbyterian, Newport Beach, CA
2007-2009 President’s Honor Roll, California State University, Long Beach, CA
2009 National Dean’s List
2007 National Honor Roll
Conferences/Presentations
Aug 2018 Presenter (Talk/Poster) – Gordon Research Conferences: Neurobiology of

brain disorders. Castelldefels, Spain
Abstract: Differential effects of APOE isoforms on Aβ
amyloidogenic seeds
Apr 2018 Presenter (Talk) – Annual Hope Center Retreat. Danforth Plant Science
Center, Saint Louis, MO
Abstract: Age-dependent effects of apoE reduction using
antisense oligonucleotide in a model of β-amyloidosis
Apr 2018 Presenter (Talk) – 2018 AAT-AD/PD Focus Meeting. Torino, Italy
May 2017 Presenter (Poster) – Annual Hope Center Retreat. Danforth Plant Science
Center, Saint Louis, MO
Apr 2017 Presenter (Poster) – AD/PD 2017: The 13th International Conference on
Alzheimer’s and Parkinson’s disease. Vienna, Austria
Sep 2016 Presenter (Talk) – Knight Alzheimer Disease Research Center (ADRC)
Seminar. Department of Neurology, Washington University School of Medicine,
Saint Louis, MO
Abstract: Targeting human APOE using antisense
oligonucleotides (ASO) in APP-APOE KI mice
Aug 2016 Presenter (Talk/Poster) – Gordon Research Conferences: Neurobiology of
Brain Disorders. Girona, Spain
Apr 2016 Presenter (Poster) – Washington University School of Medicine Medical
Scientist Training Program Retreat. Trout Lodge, Potosi, MO
212
Oct 2011 Presenter (Poster) – 2011 Annual Conference of the Society for the
Advancement of Chicanos and Native Americans in Science (SACNAS), San
Jose, CA
Abstract: Stabilization of Aβ42 oligomers through PICUP and Tyr
“scanning” mutagenesis.
Aug 2011 Presenter (Poster) – Harvard University Poster Session for Summer Programs,
2011, Harvard University, Boston, MA
Abstract: The role of Ice2 in neutral lipid homeostasis of yeast.
May 2011 Presenter – 7th Annual Undergraduate Research Symposium, Department of

Molecular, Cell, and Developmental Biology, University of California, Los
Angeles, CA
May 2011 Presenter – 2011 UCLA Science Poster Day Undergraduate Symposium,
Nov 2010 Presenter – Annual Biomedical Research Conference for Minority Students
(ABRCMS), Charlotte, North Carolina.
Abstract: Understanding the Formation of Neurotoxic Aβ
Oligomers Responsible for Alzheimer’s Disease.
Aug 2010 Presenter – Poster Sessions, Summer Program for Undergraduate

Research (SPUR), University of California, Los Angeles, CA
May 2010 Presenter – 2010 UCLA Science Poster Day Undergraduate Symposium,
May 2010 Presenter – 6th Annual Undergraduate Research Symposium, Department of

Molecular, Cell, and Developmental Biology, University of California, Los
Angeles, CA
Teaching Experience
Sep 2015 – Present Certified CPR Instructor – Washington University School of Medicine
Provide CPR training (Basic Life Support) to medical students and staff
213
Sep 2014 – Aug 2018 Head of Teaching Team – Anatomy and Physiology teaching team, Young
Scientist Program (YSP), Washington University School of Medicine
YSP is a community outreach organization designed to attract high school students
from disadvantaged backgrounds into scientific careers through hands-on
learning/research activities and mentorship between young people and active
scientists. I organized teams of graduate and medical students to hold scientific
demonstrations at local public schools with topics ranging from human anatomy
(heart, lung, and gastrointestinal), physiology, to neuroscience. Our
demonstrations with preserved human organs in small-group format fosters an
atmosphere where the students feel comfortable posing their own questions and
discussion. I also held open discussions about the different paths to pursue a
scientific career and presented available opportunities for the students to get
involved in the STEM field at different ages/levels. Our team reaches hundreds of
students in the Saint Louis City public schools each year, ranging from elementary
to high school.
Aug 2014 – Dec 2014 Teaching assistant – Human Body: Anatomy, Embryology, Imaging, first year
medical school curriculum, Washington University School of Medicine.
Served as teaching assistant in anatomy course for first year medical students.
Responsibilities included lecture attendance, cadaver dissection, hands-on
teaching in the anatomy lab, preparation and presentation of review sessions, and
exam grading.
Leadership Experience
Sep 2013 – Present Coordinator – Acute stroke action program (ASAP), Washington University
School of Medicine.
ASAP provides an opportunity for first year medical students to carry the acute
stroke pager for 2 weeks and come to the emergency department along with the
stroke team to observe the hyperacute management of patients experiencing a
stroke, including the administration of tPA or mechanical thrombectomy
procedures. I organize the training sessions, compose the schedule and facilitate
communication between student participants and faculty to ensure the program
provides a great learning experience. In addition to education on acute stroke
management, ASAP also aims to attract students to a career in neurology through
exposure and networking opportunities.
Jun 2016 – Jun 2018 MSTP Representative – Medical Student Government (MSG), Washington
University School of Medicine
MSG is the main communication pathway between the student body and the
administration. MSG takes an active role in addressing student concerns and is
responsible for advancing student interests and welfare to achieve excellence in
academic pursuits and professional interactions. I served on the student life
subcommittee of MSG and advocated for improvement of student well-being,
including new discounts at on-campus dining facilities and broader dental
214
insurance coverage. I also participated in other common MSG activities, such as
organizing social events, award ceremonies, and voted on various proposals.
Jun 2015 – Jun 2017 MSTP Representative – Neuroscience Steering Committee, Division of Biology
and Biomedical Sciences, Washington University School of Medicine
Served as a liaison between the neuroscience graduate students and faculty,
offered students advice and expectations for qualifying exam. I also participated
in faculty steering committee meetings and addressed student needs by making
recommendation for curriculum changes. I organized school-wide social events
at scientific meetings and participated in editing/re-writing of the neuroscience
program guidelines.
Sep 2012 – Sep 2014 Founder and President – Radiology Interest Group (RIG), Washington
University School of Medicine, Saint Louis, MO
RIG is committed to fostering interest in radiology among all medical students.
Through various activities and resources, we aim to bring students an educational
experience that not only broadens their understanding of radiology, but also
contribute to their professional development. As RIG founder, I organized
educational sessions about the nature of the specialty, career paths, and residency
applications. We also encourage networking between students and
residents/faculty and announce opportunities to establish these relationships by
getting involved with shadowing, electives, or research at the Mallinckrodt
Institute of Radiology (MIR). RIG enables students to gain early exposure and
involvement in preparation for a career in radiology.
Sep 2012 – Sep 2014 IT Liaison – Washington University School of Medicine Class of 2016
Represent the students to the information technology (IT) department of the
medical school. Solicit to student concerns regarding IT. Communicate with the
IT department to address issues and discuss/propose solutions to improve the
student’s educational experience. I helped implementing a new scheduling system,
as well as improving the quality of lecture recordings.
Summer 2013, 2014 Counselor – Camp Neuro. Washington University School of Medicine
Served as lecturer and camp counselor in a one-week, non-profit summer day camp
for high school students who are interested in medicine with a primary focus on
neurology/neurosurgery/psychiatry. Tasks include coordinating camp activities,
giving lecture on basic neuron physiology, and work with faculty to organize
lectures.
2012 – 2013 Coordinator – Washington University Medical Plunge (WUMP)
Served as leader on a subcommittee responsible for coordinating site visits
for incoming medical students participating in WUMP. WUMP is week-
long program that exposes new students to public health in St. Louis.
WUMP consists of presentations on public health topics relevant to St.
Louis, visits to different sites around the city that serve the St. Louis
community, and community service projects.
Sep 2012 – Jun 2013 Participant – Dementia understanding opportunity (DUO) program,
Washington University School of Medicine.
215
Community outreach program that pairs a medical student with a “mentor”, who
has a dementia diagnosis. I developed a meaningful relationship with my mentor
and his caregiver through various interpersonal activities. I also learned about the
challenges they face while developing an appreciation for their positivity and
resilience that will meaningfully influence my clinical practice.
2012 – 2013 Sectional Editor – Dis-orientation Guide, Washington University School of
Medicine
Served as editor and writer for a subsection of Dis-orientation Guide, a detailed
and personal guide to the school and the city for the next incoming class. The Dis-
orientation Guide is conceived, written, edited and published entirely by first year
medical students.
Feb 2010 – Sep 2011 Volunteer – Care Extender Program, Ronald Reagan UCLA Medical Center.
Volunteer site: Clinical Research Unit, Department of Hematology and oncology,
UCLA Jonsson Comprehensive Cancer Center.
Principal Investigator: Dr. Antoni Ribas, M.D.
Department of hematology and oncology,
Ronald Reagan UCLA Medical Center
Assist clinical investigators in clinical trials for melanoma patients. Tasks include
preparing lab kits, processing data, drugs delivery, sample preparation and
shipment, and handling administrative paperwork. I also observe procedures, and
shadow doctors in clinical settings.
May 2011 – Sep 2011 Volunteer – No One Dies Alone (NODA) Program, Hoag memorial hospital
Presbyterian, Newport Beach, CA
Participate in a program that provides the reassuring presence of a volunteer
companion to dying patients who would otherwise be alone. As a NODA
volunteer, I act as a family member and stay alongside the patients who are in the
process of passing away naturally, where the family either cannot be or choose not
to be there. Tasks include holding the hand of the patient, play music, read to the
patient, fluff pillows, and assist in comfort care measures as requested by the
patient or directed by the nurse.
Mar 2011 - Jun 2011 Undergraduate Teaching Assistant - Life Sciences Core Curriculum,
Course assigned: Life Sciences 3 – Introduction to Molecular Biology
Assist in the teaching of a Life Sciences Lab Course. Prepare laboratory reagents
and equipment for the class, instruct students on lab techniques as well as
procedures. Prepare presentations on the background information and present them
to the class, and assist the Teaching assistant to run the lab smoothly.
Dec 2010 - Jun 2011 Reviewer – Review Board, Undergraduate Science Journal (USJ), University
of California, Los Angeles, CA
Serve as reviewer of undergraduate scientific research submitted to the journal
for publication. Evaluate articles for completeness and logic and provide
feedback to the author prior to recommending for publication.
216
Sep 2010 – Jun 2011 Special Events Coordinator – Community and Public Health committee,
American Medical Student Association (AMSA), UCLA pre-medical chapter
Organize community outreach events to raise AMSA members’ awareness about
the local community and urge them to give back by taking the initiatives and
participate in various volunteer projects. Frequent trips are made to the Ronald
McDonald House of Los Angeles, where food and entertainment are provided to
the children as well as their families
Sep 2010 – Jun 2011 Director of Scholarships – Golden Key International Honour Society, UCLA
Chapter.
Responsible for organizing and direct the selection process for scholarship
applications quarterly. I am also in the finance committee to coordinate the
available funds and organize fundraising events for the chapter
Jul 2010 – Sep 2010 Special Projects Coordinator – Leadership Team, Clinical Care Extender
Pipeline, Hoag Memorial Hospital Presbyterian, Newport Beach, CA
Organize and monitor special projects that promote volunteerism and help clinical
care extenders to reach out and give back to the community. Ongoing Special
Projects: Patient Ambassadors Program, Adopt-A-Family Campaign, March of
Dimes for babies, etc. I also interview prospective interns and assist in a rigorous
3-day training process
Oct 2008 – Sep 2010 Clinical Care Extender – Hoag Memorial Hospital Presbyterian, Newport
Beach, CA
Hands-on Clinical Experience, tasks include, but are not limited to, shadow
doctors, transport and assist patients, and help the nurses
Floors Rotated: Gynecology/Urology
Stroke Unit
Emergency Department
Orthopedics
Interventional Radiology
Membership/Associations
2019 – present Member – American Neurological Association (ANA)

2018 – present Member – American Physician Scientists Association (APSA)
2012 – present Member – Radiological Society of North America (RSNA)
2012 – present Member – Phi Beta Kappa National Honor Society
2010 – 2012 Member – American Medical Student Association (AMSA) UCLA Pre-Medical
Chapter
2010 – 2012 Member – Golden Key International Honour Society, UCLA Chapter
217

The Role of Apolipoprotein E in Alzheimer Disease - From Therapy T

Uploaded by

Copyright:

Available Formats

You might also like

The Role of Apolipoprotein E in Alzheimer Disease - From Therapy T

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

The Role of Apolipoprotein E in Alzheimer Disease - From Therapy T

Uploaded by

Copyright:

Available Formats

Washington University in St.

Arts & Sciences Electronic Theses and Arts & Sciences

The Role of Apolipoprotein E in Alzheimer Disease: From Therapy

Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds

Division of Biology and Biomedical Sciences

Dissertation Examination Committee:

The Role of Apolipoprotein E in Alzheimer Disease: From Therapy to Mechanism

acknowledge by undergraduate mentors at the University of California, Los Angeles (UCLA),

colony, from Lori Logan and Loli.

are truly amazing, and I will always cherish our friendships.

made my time at UCLA memorable.

and the JPB foundation.

everything I have accomplished to my family, and would be nowhere without them.

Tien-Phat Vuong Huynh

Washington University in St. Louis

The Role of Apolipoprotein E in Alzheimer disease: From Therapy to Mechanism

Tien-Phat Vuong Huynh

Doctor of Philosophy in Biology and Biomedical Sciences

Washington University in St. Louis, 2020

Professor David M. Holtzman, Chair

Alzheimer’s disease (AD) is a neurodegenerative disorder associated with irreversible

metabolism, particularly aggregation and clearance.

adulthood is unknown. To address this gap in knowledge, we utilized an apoE antisense

Aβ plaques), independent of its effects on Aβ metabolism.

The aggregation of Aβ into higher-order species follow nucleation-dependent kinetics in

formation and/or potency of the Aβ seeds in an isoform-dependent manner. We inoculated PBS-

consequences of this isoform-specific difference in plaque morphology.

pathogenesis in a spatially and temporally controlled manner.

Alzheimer disease and the apolipoprotein E

1.2 The amyloid cascade hypothesis

In the late 1960s, the pathological accumulation of proteinaceous deposits of β-sheet-

limitations of biochemical techniques at the time, specifically those required to produce a

1.2.2 The breakthrough

Subsequent solubilization in the chaotropic salt guanidine hydrochloride (6M), followed by

terminal sequencing. Of note, their report of a glutamine (instead of a glutamate) at position 11

was later corrected in their subsequent sequencing of amyloid isolated from DS

1.2.3 Additional insights from Down syndrome

proved remarkably prescient. Glenner and Wong noted, for instance:

Alzheimer’s disease is localized on chromosome 21’ 67.

1.2.4 The amyloid cascade hypothesis, circa 1992

damage, and dementia follow as a direct result of this deposition” 78

1.2.5 The amyloid cascade hypothesis, circa 2018

decades, during a period known as “preclinical” AD 100

for future interventions or preventative measures.

1.3 Apolipoprotein E: physiologic functions and risk factor

different classes of lipoproteins, including very low-density lipoproteins (VLDLs), intermediate

1.3.2 Apolipoprotein E as a risk factor for Alzheimer disease

pathological studies have established the Apolipoprotein E (APOE) gene on chromosome 19 as

microglia to a lesser extent165 72

in the brain and cerebrovasculature.

1.4 The Interaction between APOE and the β-amyloid

dominantly-inherited missense mutations in APP or components of the human γ-secretase complex

such as presenilin-1 (PS1) or presenilin-2 (PS2)77 appear to cause EOAD by increasing Aβ

plaques196. Remarkably, the isoform-dependent effect of APOE isoforms on the accumulation of

epidemiological observations, APOE-ε2 carriers rarely develop fibrillar Aβ that is detected by

1.4.1 APOE and Aβ production

promoter as well as in humans provide insight into this important question.

1.4.2 Direct APOE-Aβ interaction