Theriogenology 80 (2013) 34–40

Contents lists available at SciVerse ScienceDirect

Theriogenology
journal homepage: www.theriojournal.com

Expression and distribution of cell adhesion-related proteins in bovine

parthenogenetic embryos: The effects of oocyte vitrification
Yan Zeng a,1, Xiangwei Fu a,1, Guangbin Zhou a, b, Mingxing Yue a, Yanhua Zhou a, Shien Zhu a, *
a
Key Laboratory of Animal Genetics, Breeding and Reproduction, Ministry of Agriculture and National Engineering Laboratory for Animal Breeding, College of
Animal Science and Technology, China Agricultural University, Beijing, China
b
Institute of Animal Genetics and Breeding, College of Animal Science and Technology, Sichuan Agricultural University (Chengdu Campus), Wenjiang, China

a r t i c l e i n f o a b s t r a c t

Article history: The objective was to investigate expression of cell adhesion-related proteins (E-cadherin, b-
Received 14 November 2012 catenin, and the cytoskeletal protein F-actin) in bovine parthenogenetic embryos derived
Received in revised form 1 March 2013 from vitrified-warmed oocytes. Bovine oocytes at metaphase II were randomly allocated
Accepted 17 March 2013
into three groups: (1) untreated (control); (2) exposed to vitrification solution without
freezing (toxicity); and (3) vitrified and warmed by the open-pulled straw method (vitri-
Keywords:
fication). After parthenogenetic activation, in the vitrification group compared with the
Oocytes
control, the timing of compaction was delayed in (108–120 vs. 96–108 hours, respectively),
Cattle
Vitrification and the percentage of blastocysts that developed from eight-cell embryos was lower
E-cadherin (32.08% vs. 61.03%; P < 0.05). To investigate whether vitrification delayed embryo
b-catenin compaction by affecting adhesion junction formation and function, immunostaining and
F-actin quantitative reverse transcription polymerase chain reaction were done to characterize
distribution patterns (E-cadherin, b-catenin, and the cytoskeletal protein F-actin) and
expression levels of cell adhesion-related proteins (b-catenin). Distribution of b-catenin in
eight-cell embryos from the vitrification group changed dramatically compared with the
control and toxicity groups. Relative expression of b-catenin at the mRNA and protein levels
was lower (P < 0.05) than that of the fresh and toxicity groups. However, expression and
distribution of E-cadherin were similar among groups. In conclusion, abnormal distribution
and decreased expression of b-catenin in bovine parthenogenetic eight-cell embryos
derived from vitrified-warmed oocytes were associated with embryo compaction and
reduced competence for subsequent embryo development.
Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction across the plasma membrane [3]. Although the birth of

Highly efficient oocyte cryopreservation is very impor-
tant for the success of assisted reproduction technology in
humans and for preservation of genetic material in
domestic or endangered species [1,2]. However, mamma-
lian oocyte cryopreservation remains difficult, at least in
part because of their large size and low surface:volume
ratio, which makes it difficult for cryoprotectants to move
* Corresponding author. Tel.: þ86 10 62731979; fax: þ86 10 62731979.
E-mail address: zhushien@cau.edu.cn (S. Zhu).
1
Yan Zeng and Xiangwei Fu contributed equally to this work.
healthy calves from cryopreserved oocytes has been re-
ported, the developmental potential of vitrified-warmed
bovine oocytes is extremely low after IVF [4–6]. The
decreased blastocyst rate caused by oocyte cryopreserva-
tion might be a result of many factors [7,8], including
instability of plasma membrane proteins [9,10], change
of ultrastructural consequences [11], loss of cytoplasmic
mRNA [12], and DNA damage [13].
Cell adhesion molecules, a group of cell surface proteins
[14], have key roles in trophectoderm epithelium differen-
tiation and blastocyst morphogenesis [15]. In the mouse
embryo, E–cadherin-mediated adhesion initiates embryo

0093-691X/$ – see front matter Ó 2013 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.theriogenology.2013.03.006
 Y. Zeng et al. / Theriogenology 80 (2013) 34–40
compaction at the eight-cell stage, largely dependent on
protein kinase C activities [15]. Embryos deficient in E-cad-
herein mRNA and proteins had lower blastocyst rates [16].
Catenins were first identified as molecules tightly associated
with the cell adhesion molecule E-cadherin [17] and were
termed a-, b-, and g-catenin, based on their molecular sizes
of 102, 88, and 80 kDa, respectively [18,19]. b-Catenin
becomes plasma membrane-associated when it interacts
with E-cadherin and mediates zonula adherens formation
during preimplantation [20,21]. In addition, E-cadherin/
b-catenin complex can also partner with a-catenin to form
an E-cadherin/b-catenin/a-catenin complex [22]. This com-
plex, derived from maternal and zygotic genes, mediates
adhesion of early blastomeres at two-, four-, and early eight-
cell stages, but an increasing amount of the complex is
accumulated and stored in a nonfunctional form ready to be
used for compaction [23]. F-actin association is essential for
adherens junction development, remodeling, and function
[24]. Alteration in expression of any of these molecules
might result in abnormal embryo compaction and decreased
embryo development. However, it is unclear whether
expression of these molecules in the embryo is affected by
oocyte cryopreservation.
The switch from maternal to embryonic genome control
in cattle appears to occur at the eight- to 16-cell stages [25].
Depletion of active maternal mRNA in the oocyte cytoplasm
or interruption of the shift from the maternal to embryonic
control might result in a permanent arrest of embryo
development at the eight- to 16-cell stages before com-
paction [26]. Therefore we focused our interest on eight-cell
stage embryos. In this study, the effects of vitrification on
bovine oocyte development and embryo compaction were
examined. Because oocyte vitrification delayed compaction
timing in eight-cell embryos, distribution patterns and
expression levels of three cell adhesion-related molecules
were examined to determine whether vitrification affected
embryo compaction by modulating adhesion molecules in
preimplantation embryos.
2. Materials and methods
All chemicals and media were purchased from Sigma
Chemical Co. (St. Louis, MO, USA), unless otherwise
indicated.
2.1. Oocyte collection and in vitro maturation
Bovine (Bos taurus, age 3–6 years) ovaries were trans-
ported from the abattoir to the laboratory in physiological
saline solution at 26  C to 30  C within 2 hours after
slaughter. Antral follicles (2–8 mm in diameter) were
manually aspirated using an 18-gauge needle attached to
a 10-mL syringe. Oocytes with at least four layers and
compact cumulus cells (COCs) were selected for in vitro
maturation (IVM). Oocytes were washed three times in
HEPES-buffered TCM-199 medium and then washed twice
in NaHCO3-buffered TCM-199. Fifty COCs were transferred
to 0.75-mL maturation medium (M199 with 10 mg/mL
oFSH [Ovagen, Auckland, New Zealand], 10 mg/mL oLH
[Ovagen], 1 mg/mL estradiol [Ovagen], and 10% fetal bovine
serum [FBS; Gibco]) in 4-well plates (Nunclon). The COCs
35
were cultured for 22 hours at 38.5  C in a humidified
atmosphere with 5% CO2.
2.2. Oocyte vitrification and warming
After IVM, cumulus cells were removed by incubation in
hyaluronidase at 38  C for 5 minutes and then disrupted by
repeated pipetting for 1 minute. Cumulus-free normal
metaphase (M)II oocytes with the first polar body were
selected and randomly allocated to the following experi-
mental groups:
(1) Control group: oocytes underwent no treatment, but
were cultured until parthenogenetic activation.
(2) Toxicity group: oocytes were first exposed to 10%
ethylene glycol (EG) and 10% dimethyl sulfoxide (DMSO)
in Dulbecco’s phosphate-buffered saline (DPBS) con-
taining 20% FBS for 30 seconds; EDFSF30 solution (15%
EG and 15% DMSO in FSF solution, which consisted of
DPBS medium with 300 g/L Ficoll, 0.5 M sucrose, and 20%
FBS) for 25 seconds; then rinsed in 0.25 M sucrose
solution for 3 minutes followed by 0.15 M sucrose solu-
tion for 3 minutes. Oocytes were then washed twice in
maturation medium. Surviving oocytes were transferred
to fresh culture media and incubated for 1 hour at 38.5  C
in 5% CO2 before parthenogenetic activation.
(3) Vitrification group: oocytes were first pretreated in 10%
EG with 10% DMSO in DPBS containing 20% FBS for 30
seconds, then transferred to EDFSF30 in the narrow end
of the pulled straw, and held for 25 seconds. The straws
were then immediately plunged into liquid nitrogen,
and five to six oocytes were then loaded into each open
pulled straw.
When warming oocytes, the tip of the open pulled straw
was placed into 0.25 M sucrose solution (at approximately
38  C–39.8  C), and oocytes were expelled using a mouth
pipette. Then, oocytes were then rinsed in sucrose solutions
according to the procedure mentioned in the toxicity
group. Surviving oocytes were cultured for 1 hour, followed
by parthenogenetic activation.
2.3. Parthenogenetic activation
Before activation, oocytes were washed three times in
HEPES-buffered TCM-199 with 10% FBS (H199) and then
activated by the following treatments: (1) incubation for 5
minutes in 7% ethanol in H199 at room temperature; or (2)
cultured for 4 hours in 2 mM 6-DMAP in M199. Fifteen
oocytes were transferred to development culture drops of
60 mL Charles Rosenkrans 1 [27] with BSA (3 mg/mL) and
cultured at 38.5  C in 5% CO2 for up to 48 hours before
determining rates of activation and cleavage. Cleaved
embryos were cultured for an additional 5 days in Charles
Rosenkrans 1 with 5% FBS.
2.4. Cell counting
Blastocysts were fixed and stained for differential cell
counting as described by Thouas et al. [28]. All blastocysts
36 Y. Zeng et al. / Theriogenology 80 (2013) 34–40

Table 1
Gene primers in encoding regions.

Primer names Primer sequences PCR products (bp) GenBank accession number Reference
E-cadherin
FW 50 -GACACTGGAGGTATCAGCGCAC -30 194 NM_001002763.1 [31]
REV 50 - TGATCTGGACCAGCGACTTAGG -30
b-catenin
FW 50 -ATTCAGCAGAAGGTCCGAGTGC-30 208 NM_001037142.1 [30]
REV 50 -GTTGAAGCTACTGCCTCCGGTC-30
Actin
FW 50 -CGACCACTGGCATTGTCAT-30 227 NM_001033618 [29,32]
REV 50 -TCCAAGGCGACGTAGCAGAG-30

Abbreviations: bp, base pair; FW, forward; PCR, polymerase chain reaction; REV, reverse.

were incubated in 500 mL BSA-free TCM-199 HEPES (Gibco)
with 1% Triton X-100 for 8 seconds and 100 mg/mL propidium
iodide for 30 seconds. They were then fixed in 500 mL ethanol
with 25 mg/mL bisbenzimide (Hoechst 33342) and stored
overnight at 4  C. Fixed and stained blastocysts were trans-
ferred directly into a glycerol microdrop on a glass micro-
scope slide. Cells were counted using digital images obtained
with an inverted microscope equipped with an ultraviolet-
excitation filter at 330 to 385 nm and a barrier filter at
420 nm. The trophectoderm cells were identified by their red
fluorescence, and inner cell mass (ICM) cells were blue.
2.5. Immunostaining of cadherin, b-catenin, and F-actin
Immunostaining was done as described [28] with minor
modifications. All eight-cell embryos were washed in PBS,
fixed with paraformaldehyde (4% wt/vol in PBS at room
temperature for 1 hour) and permeabilized in Triton X-100
for 30 minutes. For F-actin, embryos were incubated with
Phalloidin-Tetramethylrhodamine B isothiocyanate (Sigma,
P-1951) at a concentration of 1 mg/mL in PBS (3% [wt/vol]
BSA for 1 hour at 38  C), then embryos were mounted on
slides with antifade solution (Dabco).
For catenin and cadherin, after incubation in block
buffers (3% BSA in PBS) for 1 hour, embryos were randomly
allocated into two groups. They were then incubated with
polyclonal rabbit anti–b-catenin antibodies (Abcam)
diluted at 1:150 in PBS and monoclonal mouse anti–pan-
cadherin antibodies (Abcam) diluted at 1:200 in PBS at
room temperature for 1 hour respectively. The embryos
were then washed three times in PBS, further incubated for
1 hour at 38  C with fluorescein isothiocyanate-conjugated
goat anti-rabbit or goat anti-mouse antibodies, and then
washed three times in PBS at room temperature. Finally, all
embryos were mounted on slides with antifade solution
(Dabco) and observed using a confocal laser scanning
microscope (C1/TE2000-U; Nikon, Tokyo, Japan).
2.6. Real-time quantitative reverse transcription polymerase
chain reaction
Total RNA was isolated from 50 embryos (eight-cell)
using TRIzol reagent (Invitrogen). The RNA was dissolved in
10 mL Rnase-free water; 3 mL from each group was reverse
transcribed into cDNA with a cDNA reverse transcription kit
(High-Capacity cDNA Reverse Transcription kit; Applied
Biosystems). Previously validated primers were used to
examine the relative transcript abundance of E-cadherin,
b-catenin, and the cytoskeletal protein F-actin [30–33]. The
primers are summarized (Table 1).
A total of 1.5 mL cDNA from the reverse transcription
reaction was added to a mixture of SYBR premix Ex taqTMII
(Takara), 0.5 mL forward primer (0.4 mM), and 0.5 mL reverse
primer (0.4 mM), and deionized water (20 mL total volume).
The optimized parameters for the thermal cycler were as
follows: activation at 94  C for 15 minutes followed by
40 cycles of 94  C for 15 seconds, 60  C for 25 seconds,
and 72  C for 30 seconds. The temperature was then
gradually increased (0.5  C/s) to 95  C to generate the
melting curve. For these studies, b-actin was used as an
endogenous reference. For each treatment, real time poly-
merase chain reaction (PCR) assays were carried out in
triplicate. The PCR products were then analyzed by gener-
ating a melting curve to check the specificity and to identify
the amplification product. Sizes of PCR products were
further confirmed using gel electrophoresis on a standard
Gelred (Biotium)-stained 1.5% agarose gel and visualized by
exposure to ultraviolet light. The mRNA expression levels
were calculated using the 2-ddCt method [34].
2.7. Western blot analyses
Total protein was extracted from 50 embryos (eight-cell)
for each group. Embryos were lysed in 200 mL lysis buffer.
Half of each protein sample was used to determine the

Table 2
Effects of oocyte vitrification on embryo development after parthenogenetic activation.

Group Oocytes, N Eight-cell (%  SEM) Blastocyst (%  SEM) Cells in blastocyst stage, N

Total ( SEM) ICM ( SEM)

Control 349 313 (89.68  6.50)a 191 (61.03  1.08)a 97.46  2.23a 35.61  1.85a
Toxicity 379 332 (87.59  3.09)a 186 (56.02  6.56)a 93.95  3.67a 33.85  1.78a
Vitrification 434 346 (79.72  4.18)b 111 (32.08  4.55)b 79.84  2.94b 25.36  1.37b

The blastocyst rate was the percentage of total eight-cell embryos that reached the blastocyst stage.
Abbreviation: ICM, inner cell mass.
a,b
Within a column, means without a common superscript differed (P < 0.05).
 Y. Zeng et al. / Theriogenology 80 (2013) 34–40
Table 3
Effects of oocyte vitrification on embryo compaction.
Group Eight-cell embryos, N Embryo compactions after parthenogenetic activation of eight-cell embryos, N (%  SEM)
72 h
Control 74 0 (0  0)
Toxicity 84 0 (0  0)
Vitrification 65 0 (0  0)
a,b
Within a column, means without a common superscript differed (P < 0.05).
protein concentration using the BCA protein assay kit
(Vigorous, Beijing, China) and the remainder analyzed
using Western blot. Proteins were separated using poly-
acrylamide gel electrophoresis (condensed concentration
of the polyacrylamide was 5% and the separate concentra-
tion was 12.5%) and blotted onto polyvinylidene fluoride
membranes. Blots were blocked using a solution made with
nonfat dried milk and then incubated with mouse mono-
clonal (CH19) anti–pan-cadherin (1:1000 dilution; Abcam,
ab6528) or rabbit polyclonal anti–beta-catenin primary
antibodies (1:200 dilution; Abcam, ab83295). Thereafter,
blots were incubated with horseradish peroxidase-
conjugated secondary antibodies, and target bands were
visualized using chemiluminescent detection (1:10000;
Jackson, Lancaster, PA, USA).
2.8. Statistical analyses
Experiments assessing embryo development were
repeated five times. The PCR and Western blot experiments
were repeated at least three times, and imunostaining was
done for at least 60 embryos (eight-cell) for each group.
Percentage data were subjected to arcsine transformation
before statistical analysis. The data were analyzed using
one-way ANOVA combined with the least significant
difference test, with P < 0.05 considered significant.
3. Results
3.1. Effect of oocyte vitrification on bovine parthenogenetic
embryo development
Rates of eight-cell embryos and blastocysts were
examined to evaluate the effect of vitrification on devel-
opment potential of bovine oocytes after parthenogenetic
activation. Development rates of the oocytes to eight-cell
embryos and eight-cell embryo to blastocysts in the vitri-
fication group were lower compared with those in the
control and toxicity groups (eight-cell developmental rate:
79.72% vs. 89.68% and 87.59%; P < 0.05; eight-cell embryo
to the blastocyst stage developmental rate: 32.08% vs.
61.03% and 56.02%; P < 0.05; Table 2). Moreover, the total
number of cells in 7-day-old blastocysts in the vitrification
group was also lower (79.84 vs. 97.46 and 93.95: P < 0.05).
Embryos at different morphological stages were coun-
ted and data are presented in Table 3. Embryo compaction
was assessed by their development to compacted morulae
in which no cell outlines were visible [35]. In control and
toxicity groups, most embryos (72.97% and 73.81%) had
finished compaction by 108 hours. However, embryo
compaction in the vitrification group seemed delayed and
37
84 h 96 h 108 h 120 h
0 (0  0)a 28 (36.99  10.51)a 54 (72.97  15.8)a 54 (72.97  2.21)a
6 (7.14  6.98)b 38 (45.23  3.69)a 62 (73.81  5.39)a 65 (76.21  16.16)a
0 (0  0)a 6 (9.09  5.13)b 16 (24.24  8.33)b 31 (45.45  17.94)b
therefore assessment of maximum compaction proportion
(45.45%) was proponed to 120 hours (Table 3).
3.2. Effect of oocyte vitrification on the distribution of
E-cadherin, b-catenin, and F-actin in parthenogenetic
eight-cell embryos
There were no significant differences among the three
groups in distribution of E-cadherin and F-actin in eight-
cell embryos (Fig. 1), whereas fluorescence intensity and
localization of b-catenin between two cells in the vitrifi-
cation group was decreased (P < 0.05).
3.3. Effect of oocyte vitrification on mRNA and protein
expression of E-cadherin and b-catenin in parthenogenetic
eight-cell embryos
The relative expression of b-catenin at the mRNA and
protein levels in parthenogenetic eight-cell embryos in the
vitrification group was lower (P < 0.05) than that in the
toxicity and control groups (Fig. 2). There was no significant
difference in relative abundance of E-cadherin among the
vitrification, toxicity, and control groups (P > 0.05).
4. Discussion
The present study was designed to examine the effects
of vitrification on bovine oocyte development in vitro.
Development was delayed in parthenogenesis embryos
derived from vitrified bovine oocytes. In particular, the
compaction timing of eight-cell embryos was delayed by
oocyte vitrification; furthermore, impaired b-catenin
function might be responsible for this phenotype. The
timing of embryonic development is associated with the
quality and development potential of in vitro-produced
embryos [35,36]. In this study, the time needed for embryo
compaction was approximately 12 hours longer in the
vitrification group compared with the control and toxicity
groups. Furthermore, vitrification decreased blastocyst
rates from eight-cell embryos, number of cells, and ICM
number in blastocysts. Although the ICM number was
closely related to the differential staining procedure such as
incubation time of embryo in Triton, it was often used to
assess the embryo quality [28,37] combined with other
criteria such as embryo morphology and blastocyst rate.
This finding was also demonstrated in previous reports
[38,39] showing that bovine embryos that grow more
rapidly are more competent and viable than slower-
developing embryos [40,41]. Taken together, we inferred
that vitrification might disrupt the developmental timing
of bovine oocytes, and therefore influences their
38 Y. Zeng et al. / Theriogenology 80 (2013) 34–40

Fig. 1. Localization of cadherin, b-catenin, and F-actin in parthenogenetic eight-cell embryos. Fresh oocytes (A, D, and G); oocytes with toxicity treatment (B, E,
and H); vitrified-warmed oocytes (C, F, and I). Scale bar, 50 mm. Average fluorescence intensity value of intercellular E-cadherin and b-catenin and F-actin (J)
(P <0.05).

subsequent embryonic development. Oocyte quality can be most genes including E-cadherin [42]. The mRNA molecule
evaluated by examining global transcript abundance and is a single strand, consisting of a dipole water molecule
protein levels stored in the cytoplasm. In previous studies, balance base, and ribose, phosphates that form secondary
cryopreserved oocytes had reduced levels of transcripts for and tertiary structures. During cryopreservation, extrusion

Fig. 2. (A) Relative abundance of E-cadherin and b-catenin transcript in eight-cell embryos. (B) Western blot analysis of pan-cadherin and b-catenin protein level
in eight-cell embryos (P < 0.05).
 Y. Zeng et al. / Theriogenology 80 (2013) 34–40
of water surrounding mRNA could generate mRNA
unfolding and facilitate RNAase access, leading to lysis of
molecules [12]. Katernal products mainly supported early
cleavage [43] but might also affect future development of
the embryo.
Adherens junctions are formed during the eight-cell
stage in bovine embryos [29]. Cell adhesion proteins such
as E-cadherin, b-catenin, and the cytoskeletal protein
F-actin have major roles in cell connection [44–47]. Cell–
cell adhesion in early blastomeres was mainly caused by
the extracellular, calcium dependent, homotypic interac-
tions between E-cadherin molecules, but the strength of E–
cadherin-mediated blastomere adhesion is regulated by
intercellular anchorage of its intracellular domain to the
actin cytoskeleton through catenin molecules [44]. In
cattle, E-cadherin mediates compaction of the individual
blastomeres in the eight-cell stage embryo, and this
adhesion triggers trophectoderm specification [45,47].
Therefore we investigated whether vitrification of oocytes
affected the levels of these proteins and their mRNA in
embryos and examined its impact on embryo compaction.
When vitrified bovine oocytes were parthenogenetically
activated in this study, an abnormal distribution and
decreased expression of b-catenin was observed in the
parthenogenetic eight-cell embryos, potentially interrupt-
ing normal cell connections. This interruption in the
present study was associated with an arrest in embryonic
development and a lower blastocyst rate.
Vitrification affected not only oocyte cellular compo-
nents [48], but also nuclear material, because a significant
rate of DNA fragmentation was found in bovine frozen or
vitrified oocytes analyzed using a Comet assay regardless of
cryopreservation method [13]. This might be reflected by
the decreased expression of b-catenin in mRNA and protein
levels in this study. The fluorescence intensity of b-catenin
in the parthenogenetic embryo cell junctions decreased
significantly in the vitrification group compared with that
of the toxicity and control groups. In addition to decreased
expression, the weakened fluorescence in the present
study had two possible explanations. First, vitrification
increases oxidative stress in the cell [49,50], consequently
leading to a change in b-catenin phosphorylation status
and destabilizing the E-cadherin/b-catenin/a-catenin
complex; E-cadherin and b-catenin form a conglutination
E-cadherin/b-catenin/a-catenin complex, which is usually
in an inactive state and be activated when compaction
starts [23,51]. Second, membrane damage because of
vitrification might directly cause abnormal distribution of
b-catenin at cell junctions. A high concentration of cryo-
protectant was an important factor that affects vitrification
efficiency and usually analyzed separately. Therefore, we
added the toxicity group in our experiment. In summary,
the changes we observed in the present study were
because of the cooling/warming procedure not cryopro-
tectant toxicity.
5. Conclusions
The abnormal distribution and decreased expression of
b-catenin in bovine parthenogenetic eight-cell embryos
derived from vitrified-warmed oocytes might
39
responsible for delayed embryo compaction and the
subsequent lower rate of embryo development.
Acknowledgments
This work was supported by the National Key Tech-
nology R&D Program (2011BAD19B01) and the National
“863” Project Foundation of China (2011AA100303). The
authors thank NPG language editing for proofreading the
manuscript and Dr Yang Qien (Washington State University,
USA) for his valuable suggestions.
References
[1] ESHRE Task Force on Ethics and Law, Dondorp W, de Wert G,
Pennings G, Shenfield F, Devroey P, et al. Oocyte cryopreservation
for age-related fertility loss. Hum Reprod 2012;27:1231–7.
[2] Dovey S. Oocyte cryopreservation: advances and drawbacks.
Minerva Ginecol 2012;64:485–500.
[3] Seidel Jr GE. Modifying oocytes and embryos to improve their
cryopreservation. Theriogenology 2006;65:228–35.
[4] Papis K, Shimizu M, Izaike Y. Factors affecting the survivability of
bovine oocytes vitrified in droplets. Theriogenology 2000;54:651–8.
[5] Vieira AD, Mezzalira A, Barbieri DP, Lehmkuhl RC, Rubin MI, Vajta G.
Calves born after open pulled straw vitrification of immature bovine
oocytes. Cryobiology 2002;45:91–4.
[6] Hou YP, Dai YP, Zhu SE, Zhu HB, Wu TY, Gong GC, et al. Bovine
oocytes vitrified by the open pulled straw method and used for
somatic cell cloning supported development to term. Theriogenol-
ogy 2005;64:1381–91.
[7] Diez C, Munoz M, Caamano J, Gomez E. Cryopreservation of the
bovine oocyte: current status and perspectives. Reprod Domest
Anim 2012;47(Suppl 3):76–83.
[8] Saragusty J, Arav A. Current progress in oocyte and embryo cryo-
preservation by slow freezing and vitrification. Reproduction 2011;
141:1–19.
[9] Demant M, Trapphoff T, Frohlich T, Arnold GJ, Eichenlaub-Ritter U.
Vitrification at the pre-antral stage transiently alters inner mito-
chondrial membrane potential but proteome of in vitro grown and
matured mouse oocytes appears unaffected. Hum Reprod 2012;27:
1096–111.
[10] Hotamisligil S, Toner M, Powers RD. Changes in membrane integrity,
cytoskeletal structure, and developmental potential of murine
oocytes after vitrification in ethylene glycol. Biol Reprod 1996;55:
161–8.
[11] Chamayou S, Bonaventura G, Alecci C, Tibullo D, Di Raimondo F,
Guglielmino A, et al. Consequences of metaphase II oocyte cryo-
preservation on mRNA content. Cryobiology 2011;62:130–4.
[12] Hyttel P, Vajta G, Callesen H. Vitrification of bovine oocytes with the
open pulled straw method: ultrastructural consequences. Mol
Reprod Dev 2000;56:80–8.
[13] Stachowiak EM, Papis K, Kruszewski M, Iwanenko T,
Bartlomiejczyk T, Modlinski JA. Comparison of the level(s) of DNA
damage using Comet assay in bovine oocytes subjected to selected
vitrification methods. Reprod Domest Anim 2009;44:653–8.
[14] Li L, Bennett SA, Wang L. Role of E-cadherin and other cell adhesion
molecules in survival and differentiation of human pluripotent stem
cells. Cell Adh Migr 2012;6:59–70.
[15] Fleming TP, Sheth B, Fesenko I. Cell adhesion in the preimplantation
mammalian embryo and its role in trophectoderm differentiation
and blastocyst morphogenesis. Front Biosci 2001;6:D1000–7.
[16] Nganvongpanit K, Muller H, Rings F, Gilles M, Jennen D, Holker M,
et al. Targeted suppression of E-cadherin gene expression in bovine
preimplantation embryo by RNA interference technology using
double-stranded RNA. Mol Reprod Dev 2006;73:153–63.
[17] Kim JB, Islam S, Kim YJ, Prudoff RS, Sass KM, Wheelock MJ, et al.
N-cadherin extracellular repeat 4 mediates epithelial to mesenchymal
transition and increased motility. J Cell Biol 2000;151:1193–206.
[18] Nagafuchi A, Takeichi M. Transmembrane control of cadherin-
mediated cell adhesion: a 94 kDa protein functionally associated
with a specific region of the cytoplasmic domain of E-cadherin. Cell
Regul 1989;1:37–44.
[19] Kemler R, Ozawa M. Uvomorulin-catenin complex: cytoplasmic
anchorage of a Ca2þ-dependent cell adhesion molecule. BioEssays
be 1989;11:88–91.
40 Y. Zeng et al. / Theriogenology 80 (2013) 34–40
[20] Pauken CM, Capco DG. Regulation of cell adhesion during embry-
onic compaction of mammalian embryos: roles for PKC and beta-
catenin. Mol Reprod Dev 1999;54:135–44.
[21] Natale DR, Watson AJ. Rac-1 and IQGAP are potential regulators of
E-cadherin-catenin interactions during murine preimplantation
development. Gene Expr Patterns 2002;2:17–22.
[22] van Roy F, Berx G. The cell-cell adhesion molecule E-cadherin. Cell
Mol Life Sci 2008;65:3756–88.
[23] Ohsugi M, Butz S, Kemler R. Beta-catenin is a major tyrosine-
phosphorylated protein during mouse oocyte maturation and
preimplantation development. Develop Dynamic 1999;216:168–76.
[24] Yonemura S. Cadherin-actin interactions at adherens junctions. Curr
Opin Cell Biol 2011;23:515–22.
[25] Camous S, Heyman Y, Meziou W, Menezo Y. Cleavage beyond the
block stage and survival after transfer of early bovine embryos
cultured with trophoblastic vesicles. J Reprod Fertil 1984;72:479–85.
[26] Barnes FL. Early cleavage and the maternal zygotic transition in
bovine embryos. Theriogenology 1990;33:141–152.
[27] Rosenkrans Jr CF, Zeng GQ, McNamara GT, Schoff PK, First NL.
Development of bovine embryos in vitro as affected by energy
substrates. Biol Reprod 1993;49:459–62.
[28] Thouas GA, Korfiatis NA, French AJ, Jones GM, Trounson AO.
Simplified technique for differential staining of inner cell mass and
trophectoderm cells of mouse and bovine blastocysts. Reprod Bio-
med Online 2001;3:25–9.
[29] Poehland R, Tomek W, Becker F, Kurth J, Kanitz W, Bhojwani S.
Qualitative and quantitative differences of cytoskeleton proteins in
embryos produced in vitro, in vivo, and by somatic nuclear transfer.
Mol Reprod Dev 2008;75:1109–19.
[30] Shirai T, Konnai S, Ikebuchi R, Okagawa T, Suzuki S, Sunden Y, et al.
Molecular cloning of bovine lymphocyte activation gene-3 and its
expression characteristics in bovine leukemia virus-infected cattle.
Vet Immunol Immunopathol 2011;144:462–7.
[31] Yan Z, Ma YZ, Liu DJ, Cang M, Wang R, Bao S. Targeted suppression
of connexin 43 in ovine preimplantation embryos by RNA inter-
ference using long double-stranded RNA. Asian-Australas J Anim Sci
2010;23:456–64.
[32] Tesfaye D, Lonergan P, Hoelker M, Rings F, Nganvongpanit K,
Havlicek V, et al. Suppression of connexin 43 and E-cadherin tran-
scripts in in vitro derived bovine embryos following culture in vitro
or in vivo in the homologous bovine oviduct. Mol Reprod Dev 2007;
74:978–88.
[33] Kim G, Okumura M, Bosnakovski D, Ishiguro T, Park CH, Kadosawa T,
et al. Effects of ascorbic acid on proliferation and biological prop-
erties of bovine chondrocytes in alginate beads. Jap J Vet Res 2003;
51:83–94.
[34] Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T))
method. Methods 2001;25:402–8.
[35] Van Soom A, Boerjan ML, Bols PE, Vanroose G, Lein A, Coryn M,
et al. Timing of compaction and inner cell allocation in bovine
embryos produced in vivo after superovulation. Biol Reprod 1997;
57:1041–9.
[36] Bavister BD. Culture of preimplantation embryos: facts and artifacts.
Hum Reprod Update 1995;1:91–148.
[37] Maluf M, Perin PM, Foltran Januario DA, Nascimento Saldiva PH.
In vitro fertilization, embryo development, and cell lineage
segregation after pre- and/or postnatal exposure of female mice
to ambient fine particulate matter. Fertil Steril 2009;92:
1725–35.
[38] Diez C, Duque P, Gomez E, Hidalgo CO, Tamargo C, Rodriguez A,
et al. Bovine oocyte vitrification before or after meiotic arrest:
effects on ultrastructure and developmental ability. Theriogenology
2005;64:317–33.
[39] Dinnyes A, Lonergan P, Fair T, Boland MP, Yang X. Timing of the first
cleavage post-insemination affects cryosurvival of in vitro-produced
bovine blastocysts. Mol Reprod Dev 1999;53:318–24.
[40] Lonergan P, Dinnyes A, Fair T, Yang X, Boland M. Bovine oocyte and
embryo development following meiotic inhibition with butyr-
olactone I. Mol Reprod Dev 2000;57:204–9.
[41] Modina S, Abbate F, Germana GP, Lauria A, Luciano AM. Beta-cat-
enin localization and timing of early development of bovine
embryos obtained from oocytes matured in the presence of follicle
stimulating hormone. Anim Reprod Sci 2007;100:264–79.
[42] Succu S, Bebbere D, Bogliolo L, Ariu F, Fois S, Leoni GG, et al. Vitri-
fication of in vitro matured ovine oocytes affects in vitro pre-
implantation development and mRNA abundance. Mol Reprod
Dev 2008;75:538–46.
[43] Fair T, Hyttel P, Greve T. Bovine oocyte diameter in relation to
maturational competence and transcriptional activity. Mol Reprod
Dev 1995;42:437–42.
[44] Trejo A, Ambriz D, Navarro-Maldonado MC, Mercado E, Rosado A.
Presence and distribution of E-cadherin in the 4-cell golden
hamster embryo. Effect of maternal age and parity. Zygote 2008;
16:271–7.
[45] Nakano H, Shimada A, Imai K, Takahashi T, Hashizume K. The
cytoplasmic expression of E-cadherin and beta-catenin in bovine
trophoblasts during binucleate cell differentiation. Placenta 2005;
26:393–401.
[46] McLachlan RW, Kraemer A, Helwani FM, Kovacs EM, Yap AS. E-
cadherin adhesion activates c-Src signaling at cell-cell contacts. Mol
Biol Cell 2007;18:3214–23.
[47] Kohan-Ghadr HR, Smith LC, Arnold DR, Murphy BD, Lefebvre RC.
Aberrant expression of E-cadherin and beta-catenin proteins in
placenta of bovine embryos derived from somatic cell nuclear
transfer. Reprod Fertil Dev 2012;24:588–98.
[48] Succu S, Leoni GG, Bebbere D, Berlinguer F, Mossa F, Bogliolo L, et al.
Vitrification devices affect structural and molecular status of in vitro
matured ovine oocytes. Mol Reprod Dev 2007;74:1337–44.
[49] Parrish AR, Catania JM, Orozco J, Gandolfi AJ. Chemically induced
oxidative stress disrupts the E-cadherin/catenin cell adhesion
complex. Toxicol Sci 1999;51:80–6.
[50] Gupta MK, Uhm SJ, Lee HT. Effect of vitrification and beta-
mercaptoethanol on reactive oxygen species activity and in vitro
development of oocytes vitrified before or after in vitro fertilization.
Fertil Steril 2010;93:2602–7.
[51] Ao A, Erickson RP. Injection of Antisense RNA specific for E-cadherin
demonstrates that E-cadherin facilitates compaction, the first dif-
ferentiative step of the mammalian embryo. Antisense Res Dev
1992;2:153–63.