VECTOR-BORNE AND ZOONOTIC DISEASES

Volume 20, Number 6, 2020

ª Mary Ann Liebert, Inc.
DOI: 10.1089/vbz.2019.2544

Detection of Leptospira interrogans

in Hedgehogs from Central China

Xiao-Juan Ma,1 Xiao-Qing Gong,1 Xiao Xiao,1,2 Jian-Wei Liu,1 Hui-Ju Han,1
Xiang-Rong Qin,1 Si-Cong Lei,1 Xiao-Lan Gu,1 Hao Yu,1 and Xue-Jie Yu1

Abstract
Downloaded by 189.110.77.17 from www.liebertpub.com at 08/21/21. For personal use only.

Background: Leptospira is the causative agent of leptospirosis, a zoonotic disease of global importance. To
have a better understanding on the host species of Leptospira, we investigated the prevalence of Leptospira
species in hedgehogs in Central China.
Materials and Methods: Hedgehogs were captured in Hubei Province, China in May and October, 2018. Total
DNA was extracted from the kidney tissues of hedgehogs for determining the Leptospira species by PCR
amplification of the rrs2, secY, and flaB genes with genus-specific primers.
Results: PCR amplification indicated that the positive rate of hedgehogs to the rrs2, secY, and flaB genes were
19.5% (8/41), 12.2% (5/41), and 9.8% (4/41), respectively. The homology of the partial sequence of rrs2, secY,
and flaB genes were 99.0–100% among the Leptospira strains from hedgehogs. Phylogenetic analysis revealed
that Leptospira species detected in this study clustered together with Leptospira interrogans.
Conclusions: We detected L. interrogans from hedgehogs in Central China, suggesting hedgehogs are the hosts
of L. interrogans.

Keywords: hedgehogs, China, Leptospira

Introduction et al. 2012), and at least 75% of leptospirosis cases are caused
by L. interrogans (Hu et al. 2014). Numerous studies indi-

L eptospira is one of the two genera in the family Lep-

tospiraceae and is the causative agent of leptospirosis, a
zoonotic disease of global importance (Bharti et al. 2003). In
recent decades, leptospirosis has been recognized as one of
the most widespread zoonosis emerging worldwide, although
previously it is considered to be prevalent mainly in urban
regions of tropical and subtropical countries, including those
located in Latin America, the Middle East, Europe, Africa,
Australia, and Asia (Bharti et al. 2003, Cox et al. 2005,
Victoriano et al. 2009, Lagadec et al. 2012, Adler 2015,
Dietrich et al. 2015). Studies led by the World Health Or-
ganization on the global burden of human leptospirosis
estimated >1 million severe cases with >60,000 deaths an-
nually (Mwachui et al. 2015, Torgerson et al. 2015). In
China, leptospirosis is also a common and widespread zoo-
notic disease reported in 29 out of 34 provinces (Zhang et al.
2012), and is listed as a class B notifiable infectious disease
(Hu et al. 2014).
Leptospira interrogans and L. borgpetersenii are the pre-
dominant pathogenic species causing leptospirosis (Zhang
cated that rodents and insectivora are the important reservoirs
of Leptospira (Rahelinirina et al. 2010, Ayral et al. 2016),
whereas other small mammals such as bats are reported to
carry Leptospira as well (Han et al. 2018, Zhao et al. 2019).
Leptospira serovars usually do not cause disease in reservoir
hosts (Ko et al. 2009), but humans can acquire infections by
contact with infected animals, animal tissue, animal excre-
tions, or by having abrasions, cuts in the skin, or conjunc-
tiva coming into contact with contaminated water and food
(Waitkins 1985).
Hedgehogs have been studied for their association with
zoonotic pathogens in Europe (Kozuch et al. 1967, Majeed
et al. 1989). However, hedgehogs as the natural reservoir
of zoonotic-borne pathogens have been largely neglected in
China. In this study, we determined the infection rate of
hedgehogs with Leptospira to evaluate the role of hedgehogs
in the epidemiology of Leptospira in Xianning City, Hubei
Province of China, which is an endemic area of leptospirosis
with incidence of leptospirosis 0.038/100,000 in 2011 (NBS
of Xianning City, 2011).

1
State Key Laboratory of Virology, School of Health Sciences, Wuhan University, Wuhan, China.
2
Lab Animal Research Center, Hubei University of Chinese Medicine, Wuhan, China.

427
 428 MA ET AL.

Materials and Methods Ethical approval

Sample collection This study was approved by the Ethics Committee of
Wuhan University (2018010). Hedgehogs were handled in
Hedgehogs were captured during May and October of
accordance with good animal practices required by the
2018 in forested sites near cesspools from Xianning City
Animal Ethics Procedures and Guidelines of the People’s
(2953¢N 11413¢E), which is located in Central China.
Republic of China.
Hedgehogs were identified through morphological observa-
tion. Hedgehogs were euthanized with an overdose of chloral
Results
hydrate and their kidneys were collected.
Hedgehog collection
DNA extraction and PCR amplification A total of 41 hedgehogs were collected from Xianning
City, of which 22 were collected in May and 19 were col-
Total DNA was extracted from kidney tissues of hedge- lected in October. Hedgehogs were identified through mor-
hogs using QIAamp DNA Mini Kit (Qiagen, Germany) ac- phological observation as Erinaceus amurensis.
cording to the manufacturer’s instructions. Leptospira in
hedgehogs were amplified with nested PCR by using the 16S
Detection of Leptospira spp. in hedgehogs by PCR
ribosomal RNA gene (rrs2), the flagellin B gene (flaB),
and preprotein translocase gene (secY) primers (Table 1). Leptospira species were tested by PCR using kidney spec-
Nuclease-free water was used as a negative control in each set imens from 41 hedgehogs. In total, 19.5% (8/41) of hedgehogs
Downloaded by 189.110.77.17 from www.liebertpub.com at 08/21/21. For personal use only.

of PCR. Both primary and nested PCRs were performed
under the following conditions: 1 denaturing cycle for 5 min
at 95C followed by 35 cycles of denaturation for 30 s at
95C, annealing for 30 s at 55C, extension for 90 s (primary
PCR) or 1 min (nested PCR) at 72C and an additional final
extension for 10 min at 72C.
PCR products were analyzed using 1.2% agarose gel
electrophoresis and detected with ethidium bromide under
UV light. PCR products with expected sizes were excised
from gels with a Gel Extraction Kit (TSINGKE, Beijing,
China) and cloned into pMD19-T vectors (TaKaRa, Kusatsu,
Shiga, Japan). Leptospira DNA in plasmid was sequenced on
both directions.
Phylogenetic analysis
Sequences of rrs2, flab, and secY genes were searched
using BLAST in the GenBank database (www.ncbi.nlm.nih
.gov/BLAST). After alignment by ClustalW with MEGA 7.0
(http://megasoftware.net/), phylogenetic trees were construc-
ted with maximum likelihood method of MEGA 7.0, and
bootstrap values were calculated with 1000 replicates.
were positive to Leptospira with one of three genes and the
positive rate of all hedgehogs to rrs2, secY, and flaB genes
were 19.5% (8/41), 12.2% (5/41), and 9.8% (4/41), respec-
tively. Among the eight positive samples, three hedgehogs
were positive for all three genes.
Sequencing and phylogenetic analysis
BLAST analysis showed that the homology of the partial
sequences of rrs2, secY, and flaB genes were 99.0–100%
among the Leptospira strains from hedgehogs, respectively.
Phylogenetic analysis revealed that the Leptospira spp. de-
tected in this study clustered together with L. interrogans
(Figs. 1–3).
Sequences from this study were deposited in GenBank
with accession numbers: MK396786-MK396793 (rrs2gene),
MK403978-MK403982 (secY gene), and MK403983-
MK403986 (flaB gene).
Discussion
China is heavily affected by leptospirosis with several
pandemics in the past (Shi and Jiang 2000). Since

Table 1. PCR Primers Used for Amplification of Leptospira interrogans

Product Target
Primer Sequences (5¢/3¢) length (bp) gene Reference
Leptorrs1st-F CAAGTCAAGCGGAGTAGCAATAC 642 rrs2 Ogawa et al. (2015)
Leptorrs1st-R CAACTGGTAGACAACGTTTAGGGC
Leptorrs2nd-F AATCTTCCTYYGAGTCTGGGATAAC
Leptorrs2nd-R TTCACTACCCACGCTTTCGTGCCTC
G1-1st GAGAACCSGGACGAATTCCTGGAATG 285 secY Ogawa et al. (2015)
G2-1st GGTTCAACTTTTCTCYACCGAYACRATGG
G1-2nd CTGAATCGCTGTATAAAAGT
G2-2nd GGAAAACAAATGGTCGGAAG
G1-1st-k GTATGAGAACCSGGACGAATTCCTGG 329 secY Ogawa et al. (2015)
G2-1st-k GGTTCAACTTTTCTCYACCGAYACRATGG
G1-k GCTAAYTCYGCAGGRTTRAACTGAAT
G2-k GTGAGAAAGGTTCCTCTRCAGTA
LEPflaBF1 TCTCACCGTTCTCTAAAGTTCAAC 732 flaB Koizumi et al. (2008)
LEPflaBR1 CTGAATTCGGTTTCATATTTGCC
LEPflaBF2 TGTGCACAAGACGATGAAAGC
LEPflaBR2 AACATTGCCGTACCACTCTG
 FIG. 1. Phylogenetic tree
based on rrs2 gene of Lep-
tospira. The tree was con-
structed by using maximum
likelihood method with
MEGA 7.0 (www.megasoft
ware.net). Bootstrap values
were performed with 1000
replicates. The percentage of
trees in which the associated
taxa clustered together is
shown next to the branches.
Sequences of Leptospira were
shown with the GenBank
accession number. The se-
Downloaded by 189.110.77.17 from www.liebertpub.com at 08/21/21. For personal use only.

quences obtained in this study

were shown with the corre-
sponding hedgehog number
and marked by black dots.
Scale bar indicates nucleo-
tide substitutions per site.

FIG. 2. Phylogenetic tree

based on flaB gene of Lep-
tospira. The tree was con-
structed by using maximum
likelihood method with
MEGA 7.0 (www.megasoft
ware.net). Bootstrap values
were performed with 1000
replicates. The percentage of
trees in which the associated
taxa clustered together is
shown next to the branches.
Sequences of Leptospira
were shown with the Gen-
Bank accession number. The
sequences obtained in this
study were shown with the
corresponding hedgehog
number and marked by black
dots. Scale bar indicates nu-
cleotide substitutions per site.

429
 430 MA ET AL.

FIG. 3. Phylogenetic tree

based on secY gene of Lep-
tospira. The tree was con-
structed by using maximum
likelihood method with MEGA
7.0 (www.megasoftware.net).
Bootstrap values were per-
formed with 1000 replicates.
The percentage of trees in
which the associated taxa
clustered together is shown
next to the branches. Se-
quences of Leptospira were
shown with the GenBank
accession number. The se-
quences determined in this
study were shown with the
Downloaded by 189.110.77.17 from www.liebertpub.com at 08/21/21. For personal use only.

corresponding hedgehog num-

ber and marked by black dots.
Scale bar indicates nucleotide
substitutions per site.

leptospirosis became a reportable disease in 1955 in China,
>2.4 million cases have been documented nationwide (Shi
et al. 1995, Shi 1999). More than 200 animal species, in-
cluding Pisces, Amphibia, Reptilia, and Avesand Mammalia,
have been found to be carriers of Leptospira worldwide
(Adler et al. 1980, Anon 1999). Rodents and some domestic
animals such as pigs, cattle, and dogs are the most important
hosts that carry and spread this disease (Li et al. 2012, Zhang
et al. 2012). In China, 67 species of wild and domesticated
animal species have been confirmed as hosts of Leptospira
(Zhang et al. 2012). Our study confirms that the hedgehog is
highly positive to Leptospira, suggesting that hedgehogs
could serve as an important source of Leptospira that infects
humans and domesticated animals. These findings highlight
the importance of Leptospira surveillance in hedgehogs.
The infection rates of Leptospira in wild and domesticated
animals are varied in different places around the world. In
Bangladesh, 13.1% (61/465) of trapped rodents were infected
with pathogenic Leptospira (Krijger et al. 2019); in Cam-
bodia, the infection rate of Leptospira in rodents was 11.1%
(n = 642) (Ivanova et al. 2012); in Malaysia, the infection rate
in rodents was 11.0% (n = 357) (Benacer et al. 2016); in
China, it was 56.7% (34/60) in bats (Zhao et al. 2019) and
4.4% (3/69) in flying squirrels (Xiao et al. 2019). Previously
Leptospira has been isolated from hedgehogs in several Eu-
ropean countries, including France, Italy, The Netherlands,
and Scotland, Israel, and New Zealand (Vander Hoeden
1958, Broom and Coghlan 1960, Babudieri and Farina 1964,
Wolff and Bohlander 1965, Brockie and Till 1977, Ayral
et al. 2016). Our study found that hedgehogs were heavily
infected with Leptospira in Central China, which is consis-
tent with previous reports on other animals in China. All
Leptospira spp. detected in this study were L. interrogans. At
least 75% of Chinese leptospirosis patients were caused by
serovars of L. interrogans (Ren et al. 2003, Hu et al. 2014).
In China, most leptospirosis cases (80.3%) typically occur
in the summer and early autumn. All hedgehogs in our study
were collected in May and October, which is consistent with
reports from countries in both temperate and tropical zones
(Slack et al. 2006, Topic et al. 2010). We found that the
infection does not seem to harm adult hedgehogs as even
animals with active infections appeared to be in good health,
consistent with the report that Leptospira serovars usually do
not cause disease in their natural host (Ko et al. 2009).
Hedgehogs are considered to be a tonic in traditional Chinese
medicine, thus this species is frequently taken from the wild
and eaten across Central China, and people may be infected
in the process of capturing or slaughtering hedgehogs (Krij-
ger et al. 2019). Therefore, increased awareness and protec-
tive measures are needed to prevent Leptospira infections.
Conclusions
Our study indicated that hedgehogs were heavily infected
with Leptospira, suggesting that hedgehogs are the reser-
voir of Leptospira in China, and people who capture and
handle wild hedgehogs are at risk of becoming infected by
Leptospira.
Author Disclosure Statement
No conflicting financial interests exist.
Funding Information
This study was supported by the National Natural Science
Funds of China (Nos. 31570167 and 81971939).
 LEPTOSPIRA IN HEDGEHOGS FROM CHINA 431

References transmission: Asystematic review. PLoS Negl Trop Dis 2015;

9:e0003843.
Adler B. History of leptospirosis and Leptospira. Curr Top
NBS of Xianning City. Statistical Yearbook of Xianning City.
Microbiol Immunol 2015; 387:1–9.
China Statistics Press, 2011.
Adler B, Faine S, Muller HK, Green DE. Maturation of humoral
Ogawa H, Koizumi N, Ohnuma A, Mutemwa A, et al. Mole-
immune response determines the susceptibility of guinea-pigs
cular epidemiology of pathogenic Leptospira spp. in the
to leptospirosis. Pathology 1980; 12:529–538.
straw-colored fruit bat (Eidolon helvum) migrating to Zambia
Anon. Leptospirosis worldwide, 1999. Wkly Epidemiol Rec
from the Democratic Republic of Congo. Infect Genet Evol
1999; 74:237–242.
2015; 32:143–147.
Ayral F, Djelouadji Z, Raton V, Zilber A, et al. Hedgehogs and
Rahelinirina S, Leon A, Harstskeerl RA, Sertour N, et al. First
Mustelid species: Major carriers of pathogenic Leptospira, a
isolation and direct evidence for the existence of large small-
survey in 28 animal species in France. PLoS One 2016; 11:
mammal reservoirs of Leptospira spp. in Madagascar. PLoS
0162549.
One 2010; 5:e14111.
Babudieri B, Farina R. The leptospirae of the Italian hedgehog.
Ren SX, Fu G, Jiang XG, Zeng R, et al. Unique physiological
Pathol Microbiol 1964; 27:103–116.
and pathogenic features of Leptospira interrogans revealed
Benacer D, Mohd ZS, Sim SZ, Mohd KM, et al. Determination
by whole-genome sequencing. Nature 2003; 422:888–893.
of Leptospira borgpetersenii serovar Javanica and Leptospira
Shi MH. Research progress of leptospirosis and problems to be
interrogans serovar Bataviae as the persistent Leptospira
solved. Pract Prev Med 1999; 04:241–243.
serovars circulating in the urban rat populations in Peninsular
Shi MH, Jiang XG. Research progress of leptospirosis epide-
Malaysia. Parasit Vectors 2016; 9:117.
miology in China in the past 50 years. Chin J Epidemiol
Bharti AR, Nally JE, Ricaldi JN, Matthias MA, et al. Leptos-
Downloaded by 189.110.77.17 from www.liebertpub.com at 08/21/21. For personal use only.

2000; 03:68–70.
pirosis: A zoonotic disease of global importance. Lancet In-
Shi MH, Yu ES, Liang ZX, Tu YF, et al. Epidemic character-
fect Dis 2003; 3:757–771.
istics and influencing factors of leptospirosis in China. Chin J
Brockie RE, Till DG. Leptospira ballum isolated from hedge-
Zoonoses 1995; 11:3–7.
hogs. N Z Vet J 1977; 25:28–30.
Slack AT, Symonds ML, Dohnt MF, Smythe LD. The epide-
Broom JC, Coghlan JD. Leptospira bratislava isolated from a
miology of leptospirosis and the emergence of Leptospira
hedgehog in Scotland. Lancet 1960; 1:1326–1327.
borgpetersenii serovar Arborea in Queensland, Australia,
Cox TE, Smythe LD, Leung LK. Flying foxes as carriers of
1998–2004. Epidemiol Infect 2006; 134:1217–1225.
pathogenic Leptospira species. J Wildl Dis 2005; 41:753–757.
Topic MB, Habus J, Milas Z, Tosev EC, et al. Human lepto-
Dietrich M, Muhldorfer K, Tortosa P, Markotter W. Leptospira
spirosis in Croatia: Current status of epidemiology and clin-
and Bats: Story of an emerging friendship. PLoS Pathog
ical characteristics. Trans R Soc Trop Med Hyg 2010; 104:
2015; 11:e1005176.
202–206.
Han HJ, Liu JW, Qin XR, Zhao M, et al. Pathogenic Leptospira
Torgerson PR, Hagan JE, Costa F, Calcagno J, et al. Global
species in insectivorous bats, China, 2015. Emerg Infect Dis
burden of leptospirosis: Estimated in terms of disability ad-
2018; 24:1123–1126.
justed life years. PLoS Negl Trop Dis 2015; 9:e0004122.
Hu W, Lin XA, Yan J. Leptospira and leptospirosis in China.
Van Der Hoeden J. Leptospiral infections in hedgehogs. J Infect
Curr Opin Infect Dis 2014; 27:432–436.
Dis 1958; 103:225–238.
Ivanova S, Herbreteau V, Blasdell K, Chaval Y. Leptospira and
Victoriano AF, Smythe LD, Gloriani-Barzaga N, Cavinta LL,
rodents in Cambodia: Environmental determinants of infec-
et al. Leptospirosis in the Asia Pacific region. BMC Infect Dis
tion. Am J Trop Med Hyg 2012; 86:1032–1038.
2009; 9:147.
Ko AI, Goarant C, Picardeau M. Leptospira: The dawn of the
Waitkins S. Leptospirosis. Br Med J (Clin Res Ed) 1985; 290:
molecular genetics era for an emerging zoonotic pathogen.
468.
Nat Rev Microbiol 2009; 7:736–747.
Wolff JW, Bohlander HJ. Leptospiral infections of hedgehogs
Koizumi N, Muto M, Yamamoto S, Baba Y, et al. Investigation
in the Netherlands. Trop Geogr Med 1965; 17:9–16.
of reservoir animals of Leptospira in the northern part of
Xiao X, Zhou SH, Jiang N, Tian DZ, et al. First record of
Miyazaki Prefecture. Jpn J Infect Dis 2008; 61:465–468.
Leptospira and Blastocystis infections in captive flying
Kozuch O, Gresikova M, Nosek J, Lichard M, et al. The role
squirrels (Trogopterus xanthipes) from Enshi County, China.
of small rodents and hedgehogs in a natural focus of tick-
Acta Tropica 2019; 197:105065.
borne encephalitis. Bull World Health Organ 1967; 36:
Zhang C, Wang H, Yan J. Leptospirosis prevalence in Chinese
61–66.
populations in the last two decades. Microbes Infect 2012; 14:
Krijger IM, Ahmed A, Goris MGA, Groot Koerkamp PWG,
317–323.
et al. Prevalence of Leptospira infection in rodents from
Zhao M, Xiao X, Han HJ, Wang LJ, et al. Leptospira in bats
Bangladesh. Int J Environ Res 2019; 16:2113.
from Hubei Province, China, 2018. J Wildl Dis 2019;55:940–
Lagadec E, Gomard Y, Guernier V, Dietrich M, et al. Patho-
943.
genic Leptospira spp. in bats, Madagascar and Union of the
Comoros. Emerg Infect Dis 2012; 18:1696–1698. Address correspondence to:
Li SJ, Zhang CC, Li XW, Tian KC, et al. Molecular typing of Xue-Jie Yu
Leptospira interrogans strains isolated from Rattus tanezumi2 State Key Laboratory of Virology
in Guizhou Province, Southwest of China. Biomed Environ School of Health Sciences
Sci 2012; 25:542–548. Wuhan University
Majeed SK, Morris PA, Cooper JE. Occurrence of the lung- Wuhan 430071
worms Capillaria and Crenosoma spp. in British hedgehogs Hubei
(Erinaceus europaeus). J Comp Pathol 1989; 100:27–36. China
Mwachui MA, Crump L, Hartskeerl R, Zinsstag J, et al. En-
vironmental and behavioural determinants of leptospirosis E-mail: yuxuejie@whu.edu.cn