Advance Publication

The Journal of Veterinary Medical Science

Accepted Date: 23 April 2020

J-STAGE Advance Published Date: 9 May 2020

©2020 The Japanese Society of Veterinary Science

Author manuscripts have been peer reviewed and accepted for publication but have not yet
been edited.
 1 Bacteriology

2 Full paper

3 Title: Activation of butyrate-producing bacteria as well as bifidobacteria in the cat

4 intestinal microbiota by the administration of 1-kestose, the smallest component of

5 fructo-oligosaccharide

6 Runnning head: 1-KESTOSE ALTERS MICROBIOTA IN CATS

8 Mikako Shinohara1, a, , Masaharu Kiyosue2, a, Takumi Tochio1*, Seiji Kimura2, Yasuhiro

9 Koga3, 4

10

11 1 B Food Science Co., Ltd., Chita, Aichi, Japan

12 2 Nisshin Petfood Inc., Chiyoda-ku, Tokyo, Japan

13 3 Department of Gastroenterology, Tokai University School of Medicine, Isehara

14 259-1193, Japan

15 4 Japanese Society for Probiotic Science, Isehara 259-1143, Japan

16

17 a These authors contributed equally.

18

19 * Corresponding author.

20 Address: B Food Science Co., Ltd., Chita, Aichi, Japan.

21 E-mail address: t-tochio@bfsci.co.jp

22 FAX: +81-562-1629

23

24

1
25 ABSTRACT

26 1-kestose is a structural component of fructo-oligosaccharides and is composed of

27 2 fructose residues bound to sucrose through β2-1 bonds. In the present study, the

28 influence of the ingestion of 1-kestose on the intestinal microbiota was investigated in

29 cats. Six healthy cats were administered 1 g/day of 1-kestose for 8 weeks followed by a

30 2-week wash-out period. Fecal samples were collected from cats after 0, 4, 8, and 10

31 weeks. The intestinal microbiota was examined by a 16S rRNA gene metagenomic

32 analysis and real-time PCR. Short-chain fatty acids were measured by GC/MS. The

33 results suggested that the intestinal bacterial community structure in feline assigned to

34 this study was divided into 2 types: one group mainly composed of the genus

35 Lactobacillus (GA) and the other mainly composed of the genus Blautia with very few

36 bacteria of Lactobacillus (GB). Furthermore, the number of Bifidobacterium slightly

37 increased after the administration of 1-kestose (at 4 and 8 weeks) (p<0.1). The

38 administration of 1-kestose also increased the abundance of Megasphaera, the butyric

39 acid-producing bacteria, at 4 and 8 weeks (p<0.1). Furthermore, an increase in butyric

40 acid levels was observed after the administration of 1-kestose for 4 weeks (p<0.1).

41 These results suggest that 1-kestose activated butyrate-producing bacteria as well as

42 bifidobacteria and propose its potential as a new generation prebiotic.

43

44 KEYWORD

45 Bifidobacterium, butyrate, 1-kestose, Megasphaera, prebiotics

46

2
47 INTRODUCTION

48 Fructo-oligosaccharides (FOS) are oligosaccharides composed of one or more

49 fructose residues bound to sucrose (GF) through β2-1 bonds; those with 1 and 2 fructose

50 residues bound to sucrose are termed 1-kestose (GF2) and nystose (GF3), respectively.

51 Commercially available FOS are mixtures of these components (FOS products), and

52 GF3 is the most abundant FOS component; however, GF2 used in this study is not the

53 dominant FOS component in these mixtures. For example, the percent ratios of GF2,

54 GF3, and fructofuranosyl-nystose (GF4) in a representative synthetic FOS product,

55 Meioligo (Meiji Co., Ltd., Tokyo, Japan) are 32.0, 53.6, and 9.8%, respectively. FOS

56 products are representative oligosaccharides currently being used in Japan and other

57 countries.

58 One of the dominant biological effects of FOS is its promotion of the growth of

59 Bifidobacterium (in vitro [24, 36], animals [28], and humans [5, 20, 40]). Furthermore,

60 the administration of FOS has been associated with a shortened defecation time and

61 improved lipid metabolism [8-10]. Anti-inflammatory activity in the intestines [11] and

62 senescence-associated mental disabilities, delays in aging, including learning disability

63 and memory impairment in senescence-accelerated mice [31], have also been reported

64 in mice.

65 These beneficial effects of FOS are mainly exerted by the following mechanisms:

66 1) the activation of Bifidobacterium and Lactobacillus, and 2) increases in the levels of

67 short-chain fatty acids (SCFA). SCFA, such as acetate, which are produced by these

68 beneficial bacteria using FOS, function not only as an energy source in large intestinal

69 mucosal cells [8], but also a substrate of energy metabolism in white adipose tissue,

70 skeletal muscle, and liver [7, 13, 27]. Consequently, SCFA promote peristalsis in the

3
71 intestines and also exert significant effects on systemic metabolism in the host.

72 The component of FOS products that stimulates the growth of bifidobacteria and

73 production of SCFA by bacteria has not yet been identified. Suzuki et al. [42] examined

74 differences in cultures to which FOS, 1-kestose, or nystose was added, and found that

75 bifidobacteria exhibited the most rapid growth with the greatest production of

76 metabolites, including lactic acid and acetic acid, in the culture with 1-kestose. Previous

77 studies on the assimilation of FOS using 17 strains of Lactobacillus spp. and 15 strains

78 of Bifidobacterium spp. also demonstrated that the assimilation of 1-kestose was the

79 highest among FOS components [16, 33]. Furthermore, a recent study showed that

80 1-kestose activated not only Bifidobacterium spp., but also butyric acid-producing

81 bacteria in the intestines [26]. Based on these findings, not only the genera

82 Lactobacillus and Bifidobacterium, but also butyric acid-producing bacteria exhibit

83 strong 1-kestose-assimilating activities, indicating that 1-kestose is the dominant FOS

84 component responsible for prebiotic effects.

85 Regarding the composition of intestinal microbiota in cats, Firmicutes was

86 identified as the most dominant phylum [3, 19, 35, 41], together with Proteobacteria,

87 Bacteroidetes, Fusobacteria, and Actinobacteria [3, 19, 35, 41]. Previous studies

88 examined the prebiotic effects of FOS and galacto-oligosaccharides (GOS) in cats.

89 Barry et al. [4] fed healthy cats cellulose as a control or a diet containing FOS, and

90 investigated the influence of FOS on the intestinal microbiota. The findings obtained

91 showed that Bifidobacterium spp. levels were higher, whereas Escherichia coli levels

92 were lower in feces in the FOS group than in the cellulose group. Regarding SCFA,

93 butyric acid increased in the FOS group. Kanakupt et al. [23] fed cats diets containing

94 short chain (sc) FOS, GOS, or scFOS + GOS, and then investigated their influence on

4
 95 intestinal bacteria. The findings obtained revealed that Bifidobacterium spp. levels were

96 significantly higher in all groups than in cats fed the diet containing no prebiotics. In a

97 study in which FOS + inulin was administered, Lactobacillales (mostly Lactobacillus

98 spp.) increased in some cats [17]. However, the effects of administering 1-kestose to

99 cats have not yet been examined. Therefore, we herein investigated the influence of

100 1-kestose on the feline intestinal microbiota.

101

102 MATERIALS AND METHODS

103 Animals

104 All experiments were reviewed and approved by the Institutional Animal Welfare

105 Committee (Approval No. NBC-54-008). According to the body condition score (BCS)

106 [2], six healthy adult cats with a normal weight were obtained from KITAYAMA

107 LABES CO., LTD (Chiba, Japan) and then used in the present study. BCS was assessed

108 on a 5-point scale as follows: 1, very thin; 2, thin; 3, ideal; 4, overweight; and 5, obese.

109 The profiles of these cats were shown in Table 1. No markedly abnormal symptoms

110 were observed in the hematology or blood chemistry of the cats at the initiation of the

111 study, as shown in Supplementary Tables 1 and 2.

112

113 Study design

114 The total period of the study was 10 weeks. During the whole study period, cats

115 were fed a diet manufactured by Nisshin Petfood Inc. (Tochigi, Japan). The diet was

116 only supplemented with 1-kestose in the first 8 weeks and this was followed by a

117 2-week wash-out period. The diet consisted of 3.9% moisture, 37.6% protein, 13.6% fat,

118 6.6% ash, and 0.4% crude fiber. Each cat was fed a specific amount of the diet to

5
119 maintain a constant body weight. Feeding was performed between 9 AM and 5 PM, and

120 water was given ad libitum all day. In addition to the daily diet, 1 g/day of 1-kestose

121 was added to the diet every day during the first 8-week period at 9 AM. The maximum

122 permissive dose of 1-kestose in cats was calculated from the maximum permissive dose

123 of 1-kestose in humans [32] according to the report of Reagan-Shaw et al. [34]. As a

124 result, it was found that the maximum permissive dose of the cat (average body weight:

125 3.0kg) used in the present study was 1.89 kg / day. For this reason, about a half amount,

126 1 g, was set as the daily dose. Fresh fecal samples (within 15 min of defecation) were

127 collected from cats after 0, 4, 8, and 10 weeks and stored immediately at – 80°C. Blood

128 samples were also collected from cats after 0, 4, 8, and 10 weeks and analyzed at the

129 LSI Medience Corporation (Tokyo, Japan).

130

131 DNA extraction

132 Genomic DNA was extracted from feces according to the method described by

133 Takahashi et al [43]. Frozen fecal samples were thawed on ice, and 100 mg of each

134 sample was suspended in 4 M guanidium thiocyanate, 100 mM Tris-HCl (pH 9.0), and

135 40 mM EDTA and beaten with zirconia beads using a FastPrep FP100A instrument (MP

136 Biomedicals, Santa Ana, CA, USA). DNA was extracted from bead-treated suspensions

137 using the Magtration System 12GC and GC series MagDEA DNA 200 (Precision

138 System Science, Chiba, Japan). Following estimations of the DNA concentrations of

139 each sample by spectrophotometry using ND-1000 (NanoDrop Technologies,

140 Wilmington, DE USA), the final concentration of DNA in samples was adjusted to 10

141 ng/µl.

142

6
143 Bacterial 16S rRNA gene sequencing and sequence data analysis

144 Fecal bacterial 16S rRNA gene sequence was analyzed by the MiSeq system

145 (Illumina, San Diego, CA, USA) as previously described [43]. The V3-V4

146 hypervariable regions of 16S rRNA were PCR amplified from microbial genomic DNA

147 using universal primers for bacteria (341f/R806) [12, 30] and the dual-index method

148 [21]. Barcoded amplicons were sequenced using the paired-end method with a 2 ×

149 284-bp cycle run on the MiSeq system by MiSeq Reagent kit v.3 (600 Cycles) (Illumina,

150 San Diego, CA, USA). After the alignment, overlapping regions within paired-end reads

151 were merged and primer regions were omitted, which resulted in a 430-bp sequence.

152 Only reads with more than 99% of its sequence having quality value scores of ≥20 were

153 extracted for further analyses [43]. Chimeric sequences detected by Usearch6.1.544_i86

154 were precluded [15]. Based on these sequences, species were identified with an 97%

155 confidence threshold using Metagenome@KIN analysis software (World Fusion, Osaka,

156 Japan) and the TechnoSuruga Lab Microbial Identification database DB-BA 10.0

157 (TechnoSuruga Laboratory, Shizuoka, Japan) [21, 25]. The abundance of each taxon

158 was calculated at both the phylum and genus levels (Supplemental Tables 3, 4, 5, and 6).

159

160 Quantitative analysis of intestinal microbiota in cat feces using real-time PCR

161 Using the same extracted DNA sample as that in bacterial 16S rRNA gene

162 sequencing, a quantitative analysis of the following intestinal organisms was performed

163 by real-time PCR (qPCR) detecting specific gene sequence in each 16S rRNA: all

164 bacteria [30], Bifidobacterium spp. [18], Lactobacillus spp. [39], Clostridium cluster

165 XIV [38], and Clostridium perfringens [44]. A list of the primers used is shown in Table

166 2.

7
167

168 Measurement of SCFA

169 The measurement of SCFA, including acetate, propionate, and butyrate was

170 performed by GC/MS (Shimazu, Kyoto, Japan) on Rtx-1701 columns (Restec,

171 Bellefonte, PA, USA). GC/MS samples were prepared as follows: 50 mg (wet weight)

172 of fecal samples were suspended in 400 µl pure water. The suspension was stirred for 10

173 min and centrifuged at 15,000 × g at 4°C for 5 min. Twenty microliters of 20 mM

174 2-ethyl butyrate, 80 µl of 3N HCl, and 400 µl of diethylether were then added to the

175 supernatant.

176

177 Statistical analysis

178 Statistical analyses were performed using SPSS Statistics 26 software package

179 (SPSS Inc., Chicago, Illinois) and Microsoft Excel (Excel version in Microsoft Office

180 2010 for Windows). The normality of data was examined by the Shapiro-Wilk test. And

181 data were analyzed using Wilcoxon signed-rank test followed by the correction with

182 FDR method (the Benjamini & Hochberg method for adjustments with FDR (BH

183 method)). Differences were considered as significant at P<0.05 and tendency at p <0.1.

184

185 RESULTS

186 Body weight, food intake, hematology, and biochemistry

187 The administration of 1-kestose (1 g/day) did not significantly influence body

188 weight (Supplemental Figure 1) or food intake. The number of platelets was

189 significantly decreased in the period of 1-kestose administration. Most of hematological

190 and blood biochemical parameters were not altered by 1-kestose administrartion

8
191 (Supplemental Table 1 and 2). And no abnormal symptoms including the petechia

192 caused by decreasing the number of platelets were observed throughout the 10-week

193 study period in any cat.

194

195 16S rRNA gene metagenomic analysis of intestinal microbiota

196 The total numbers of reads analyzed for each sample at the different time points (0,

197 4, 8, and 10 weeks) were 81,938±22,246, 31,913±4,332, 36,532±5,761, and

198 36,386±5,770 (AVE±SE), respectively. The microbiota compositions of 6 animals were

199 classified into 2 types based on the analysis at the genus level: Two animals in which

200 the abundance of Lactobacillus was the highest were classified as Group A (GA), and 4

201 in which the abundance of Blautia was the highest with very few Lactobacillus were

202 classified as Group B (GB) (Fig. 1, Table 1). At the beginning of the experiment (0

203 weeks), the abundance of Lactobacillus (phylum Firmicutes) was high (34.4%) in GA.

204 Although its abundance slightly increased and decreased at 4 (38.4%) and 8 (28.6%)

205 weeks after the treatment, respectively, almost no change (31.7%) was noted at 2 weeks

206 after the termination of the 1-kestose treatment (10 weeks). In GB, Blautia accounted

207 for 18.1% at 0 weeks, and its abundance also showed no evident changes after the

208 1-kestose treatment; 14.0, 16.5% and 18.4% at 4, 8, and 10 weeks, respectively. The

209 abundance of Lactobacillus was markedly lower in GB (0.1%) than in GA (34.4%) at 0

210 weeks, while the administration of 1-kestose transiently increased Lactobacillus to 2.4%

211 at 4 weeks. However, its level decreased to 0.1% close to the baseline at 10 weeks.

212 Among the genera representing >0.1% of the total microbiota at 0 weeks, the

213 abundance of four genera including Bifidobacterium (phylum Actinobacteria),

214 Megasphaera (phylum Firmicutes), and Collinsella (phylum Actinobacteria) were

9
215 slightly increased by the administration of 1-kestose (Table 3). The abundance of the

216 genus Megasphaera, a butyric acid-producing bacterium, was 2.9% at 0 week, and

217 significantly increased to 4.3 and 5.9% at 4 and 8 weeks, respectively (p<0.1).

218 The 2-dimentional display of principal coordinate analysis (PCoA) of the overall

219 structure of the intestinal microbiota is shown in Fig. 2. The clear difference observed in

220 the bacterial community composition between GA and GB, which was shown in Fig. 1,

221 was confirmed in the PCoA analysis. Individual samples at 0 week (shown by blue

222 symbols) were clearly separated into “GA” (ID No. 1, 2) and “GB” (ID No. 3, 4, 5, 6)

223 frames in the figure.

224 Moreover, 4 (red), 8 (green), and 10 (purple) weeks after the 1-kestose treatment,

225 the sample symbols for the GA group moved along the horizontal axis, whereas those

226 for the GB group moved along the vertical axis. Samples were all within the original

227 frames of “GA” and “GB”, even after the administration of 1-kestose, and no major

228 change occurred in the basic structure of the bacterial community in either group.

229 Quantitation of the number of intestinal bacteria by real-time PCR

230 Bifidobacterium and Lactobacillus are efficiently activated by FOS in other

231 animals. Clostridium cluster XIV is a representative butyrate-producing bacterial group.

232 Therefore, to quantitatively assess the effects of 1-kestose on these bacteria, their

233 numbers were measured using real-time PCR (Fig. 3).

234 The total number of bacteria did not change in the GA or GB group after the

235 administration of 1-kestose. The number of Bifidobacterium was slightly higher after

236 the administration of 1-kestose at 4 and 8 weeks than at the initiation of the study

237 (p<0.1) when the statistical analysis was performed using all animals (N=6). Slight

238 increases were observed for both GA and GB. However, the number of bacteria returned

10
239 to the pretreatment level at 2 weeks after the discontinuation of 1-kestose (10 weeks). In

240 the other bacteria groups, no significant changes were observed even when all animals

241 were included in the statistical analysis. In summary, the 1-kestose treatment slightly

242 increased the bacterial number of Bifidobacterium (p<0.1) in cats. Furthermore,

243 1-kestose slightly increased the relative abundance of Megasphaera, a butyric

244 acid-producing bacterium (p<0.1).

245 Measurement of SCFA

246 SCFA in feces were measured using GC/MS (Fig. 4). 1-kestose-induced changes in

247 SCFA levels in all animals (N=6) were subjected to a statistical analysis. No significant

248 changes were noted in acetic acid or propionic acid levels, whereas butyric acid levels

249 were slightly higher after the administration of 1-kestose for 4 weeks than at 0 week

250 (p<0.1). Elevated butyric acid levels returned to the pretreatment level after 8 weeks of

251 administration and at 10 weeks (2 weeks after the discontinuation of administration). No

252 increases were observed in the levels of acetate or propionate, even in the group of all

253 animals.

254

255 DISCCUSION

256 In feline assigned to this study, two kinds of gut microbial community composition

257 were confirmed by the 16S rRNA gene metagenomic analysis; one group mainly

258 composed of the genus Lactobacillus (GA) and the other mainly composed of the genus

259 Blautia with few Lactobacillus (GB). When the smallest fructo-oligosaccharide

260 component, 1-kestose, was administered, no significant changes were observed in the

261 abundance or bacterial number of Lactobacillus, whereas slight changes were noted in

262 Bifidobacterium. In addition, 1-kestose increased the abundance of Megasphaera, a

11
263 butyrate-producing bacterium, and intestinal butyric acid levels when GA and GB were

264 analyzed together.

265 In the present study, the microbiota composition of cats were clearly divided into

266 two distinct types including GA and GB. The difference was so evident that was

267 considered the difference of “enterotype”, which had been separated in a human study

268 [1]. The study on the intestinal microbiota in healthy humans revealed that the

269 microbiota may be classified into 3 patterns (enterotypes) with different dominant

270 bacterial groups, and a relationship between these differences in the microbiota and

271 medium- to long-term eating habits has been reported [1]. In addition, a controlled -

272 feeding study of human subjects showed that a minor change of microbiome

273 composition was detected within 24 hours of initiating different diets, but, the

274 enterotype of the subject remained stable during the 10-day study. Therefore, this study

275 also demonstrated the alternative enterotype state was associated with long term (-years)

276 diet [46]. In our study, all cats were fed the same diet during the study period, but the

277 diet up to be enrolled in the present study might be different since each cat had the

278 different background. Therefore, there is a possibility that the difference of the

279 enterotype was formed. Furthermore, marked changes were not observed in the basic

280 composition of the microbiota in GA or GB when the potent prebiotic, 1-kestose, was

281 administered for a relatively short period (8 weeks), which is consistent with the

282 characteristics of “enterotype” proposed in humans. However, this discussion might be

283 weak due to a small number of samples analyzed in the present study.

284 The administration of 1-kestose did not increase the abundance or number of

285 Lactobacillus further in GA, in which Lactobacillus was already dominant. On the other

286 hand, its administration slightly increased the abundance of Lactobacillus in GB, in

12
287 which the population size of the genus Lactobacillus was very low. Hidaka et al.

288 reported a similar phenomenon for the genus Bifidobacterium [20] in a study to

289 investigate the influence of FOS on intestinal bacteria in humans. In that study, subjects

290 with a small number of fecal bifidobacteria showed a 10,000-fold higher count after the

291 FOS treatment than in the initial count. In contrast, the bacterial number did not show

292 any significant changes in subjects with a large number of bifidobacteria.

293 In a real-time PCR assay, the number of Bifidobacterium was slightly higher after

294 the administration of 1-kestose (at 4 and 8 weeks) than at the study initiation (0 week)

295 in all animals (p<0.1). Previous studies reported that the administration of FOS

296 increased the genus Bifidobacterium in cats [4, 23]. Barry et al. [4] fed cats weighing

297 5.7 kg on average a diet containing 4% FOS for 30 days. In that study, 68.7 g/day diet

298 on average was ingested, and 4% FOS was similar to 2.7 g/day of FOS. The logarithmic

299 number of Bifidobacterium in feces 25-26 days after the initiation of the

300 FOS-containing diet was 11.6/g feces, which was 15.8-fold higher than that in the

301 control cellulose group (10.4/g feces). Therefore, the bifidogenic effect of 1 g of FOS

302 was 5.9- times higher than that of the cellulose group. In the present study, the duration

303 of administration of 1-kestose (1 g/day) was 8 weeks, and the number of

304 Bifidobacterium after 4 and 8 weeks of administration increased by 3.0- and 5.5-fold.

305 This result suggested that the bifidogenic effect of 1-kestose was similar to that of FOS

306 and the administration of 1-kestose was demonstrated to increase bifidobacteria in cats,

307 as was confirmed by the FOS administration.

308 The abundance of Megasphaera, butyrate-producing bacteria, was slightly higher

309 after the administration of 1-kestose (at 4 and 8 weeks) than at the initiation of the study

310 (0 week) (p<0.1). M. elsdenii, which was identified in this genus by an analysis at the

13
311 species level in samples, is a lactic acid-assimilating butyric acid-producing bacterium

312 [29]. M. elsdenii is beneficial for ruminants, such as cows and sheep, and its use as a

313 probiotic in rats and pigs has also been reported [22, 47]. A previous study demonstrated

314 that the abundance of the genus Megasphaera (M. elsdenii) in cats aged 18 and 30

315 weeks was at most 0.1 and 0.2%, respectively, but markedly increased to 8.4% at 42

316 weeks [14], with the highest (87-fold) increase among all genera. In the present study,

317 the mean abundance of Megasphaera increased approximately 1.5- and 2-fold after the

318 administration of 1-kestose for 4 and 8 weeks, respectively. Butyrate levels also slightly

319 increased (p<0.1) at 4 weeks when analyzed in the all animals group, which is

320 consistent with the increase observed in the abundance of Megasphaera at 4 weeks.

321 Therefore, 1-kestose-induced elevations in intestinal butyric acid levels in the present

322 study were attributed to increases in butyric acid-producing bacteria, including

323 Megasphaera. In addition, in our previous study in which rats were fed diets containing

324 1-kestose at different concentrations (0.5-5.0%) for 4 weeks, butyric acid levels in cecal

325 contents significantly increased in the groups fed a diet containing 2.5% or more

326 1-kestose [45]. Since evidence to show that 1-kestose stimulates butyrate-producing

327 bacteria to produce butyrate in the intestines has not yet been obtained for prebiotics

328 other than 1-kestose, the use of 1-kestose as a new generation prebiotic is promising for

329 the well-being of cats.

330 SCFA, including acetate, propionate, and butyrate, transiently increased at 4 weeks,

331 but returned to pretreatment levels at 8 weeks in all groups after the 1-kestose treatment.

332 Among these SCFA, only butyrate observed a slight increase (p<0.1) at 4 weeks. These

333 fluctuations in SCFA levels may be explained by “resilience”, which is widely observed

334 in biology. “Resilience” maintains homeostasis in the intestinal microbiota [37]. For

14
335 example, when a component exerting an influence on the microbiota was administered

336 for the same period as the present study, it temporarily influenced the status of intestinal

337 bacteria. However, this influence did not persist, and the status finally returned to the

338 original level through the “resilience” phenomenon. Therefore, by the administration of

339 1-kestose with a higher dose, resilience may have broken through into a new constant

340 phase in which increases in SCFA, particularly butyrate, may persist.

341 Another discussion of fluctuations in SCFA levels may be explained by the

342 incorporation of SCFA through hydrogen-coupled monocarboxylate transporters

343 (MCTs) that is known as a main absorption mechanism in colon epithelial cells [6, 7]. In

344 a previous report, butyric acid increased MCT1 expression and activity in human

345 intestinal epithelial cells [6]. Similarly, increased butyric acid may have activated

346 MCT1 and promoted SCFA absorption in the present study, through which the SCFA

347 level may have returned to the pretreatment level at 8 weeks.

348 The present study demonstrated that 1-kestose activates not only Bifidobacterium,

349 but also the butyric acid-producing genus, Megasphaera in the intestines of cats.

350 Butyric acid levels increased after 4 weeks of the administration of 1-kestose. It is well

351 known that butyrate exerts significant effects on the integrity of immunity as well as

352 energy supply in intestinal epithelial cells. These results suggest that the administration

353 of 1-kestose to cats activates beneficial intestinal bacteria, particularly

354 butyrate-producing bacteria, and, thus, is expected to promote the well-being of cats by

355 maintaining a healthy intestinal microbiota.

356

357 ACKNOWLEDGMENT

358 Author Contributions

15
359 Mikako Shinohara: Methodology, Investigation, Data curation, Visualization,

360 Writing draft preparation. Masaharu Kiyosue: Conceptualization, Methodology, Animal

361 experiment, Investigation, Data curation. Takumi Tochio: Conceptualization,

362 Methodology. Seiji Kimura: Animal experiment, Data curation. Yasuhiro Koga: Writing,

363 Reviewing, and Editing, Supervision.

364 Funding Information

365 This research did not receive any specific grants from funding agencies in the

366 public, commercial, or not-for-profit sectors.

367 Conflicts of Interest

368 Mikako Shinohara and Takumi Tochio are employees of B Food Science Co., Ltd.,

369 which is the producer of 1-kestose used in the present study. Masaharu Kiyosue and

370 Seiji Kimura are employees of Nisshin Petfood Inc..

371

372 REFERENCES

373 1. Arumugam, M., Raes, J., Pelletier, E., Le Paslier, D., Yamada, T., Mende, D. R.,

374 Fernandes, G. R., Tap, J., Bruls, T., Batto, J. M., Bertalan, M., Borruel, N., Casellas,

375 F., Fernandez, L., Gautier, L., Hansen, T., Hattori, M., Hayashi, T., Kleerebezem,

376 M., Kurokawa, K., Leclerc, M., Levenez, F., Manichanh, C., Nielsen, H. B.,

377 Nielsen, T., Pons, N., Poulain, J., Qin, J., Sicheritz-Ponten, T., Tims, S., Torrents, D.,

378 Ugarte, E., Zoetendal, E. G., Wang, J., Guarner, F., Pedersen, O., de Vos, W. M.,

379 Brunak, S., Doré, J.; MetaHIT Consortium, Antolín, M., Artiguenave, F., Blottiere,

380 H. M., Almeida, M., Brechot, C., Cara, C., Chervaux, C., Cultrone, A., Delorme, C.,

381 Denariaz, G., Dervyn, R., Foerstner, K. U., Friss, C., van de Guchte, M., Guedon,

382 E., Haimet, F., Huber, W., van Hylckama-Vlieg, J., Jamet, A., Juste, C., Kaci, G.,

16
383 Knol, J., Lakhdari, O., Layec, S., Le Roux, K., Maguin, E., Mérieux, A., Melo

384 Minardi, R., M'rini, C., Muller, J., Oozeer, R., Parkhill, J., Renault, P., Rescigno, M.,

385 Sanchez, N., Sunagawa, S., Torrejon, A., Turner, K., Vandemeulebrouck, G., Varela,

386 E., Winogradsky, Y., Zeller, G., Weissenbach, J., Ehrlich, S. D. and Bork, P. 2011.

387 Enterotypes of the human gut microbiome. Nature. 473: 174-180.

388 2. Baldwin, K., Bartges, J., Buffington, T., Freeman, L. M., Grabow, M., Legred, J.

389 and Ostwald, D. Jr. 2010. AAHA nutritional assessment guidelines for dogs and

390 cats. J. Am. Anim. Hosp. Assoc. 46: 285-96.

391 3. Barko, P. C., McMichael, M. A., Swanson, K. S. and Williams, D. A. 2018. The

392 Gastrointestinal Microbiome: A Review. J. Vet. Intern. Med. 32: 9-25.

393 4. Barry, K. A., Wojcicki, B. J., Middelbos, I. S., Vester, B. M., Swanson, K. S. and

394 Fahey, G. C. Jr. 2010. Dietary cellulose, fructooligosaccharides, and pectin modify

395 fecal protein catabolites and microbial populations in adult cats. J Anim Sci. 88:

396 2978-2987.

397 5. Bouhnik, Y., Flourié, B., Riottot, M., Bisetti, N., Gailing, M. F., Guibert, A., Bornet,

398 F. and Rambaud, J. C. 1996. Effects of fructo-oligosaccharides ingestion on fecal

399 bifidobacteria and selected metabolic indexes of colon carcinogenesis in healthy

400 humans. Nutr. Cancer. 26: 21-29.

401 6. Borthakur, A., Saksena, S., Gill, R. K., Alrefai, W. A., Ramaswamy, K. and Dudeja,

402 P. K. 2008. Regulation of monocarboxylate transporter 1 (MCT1) promoter by

403 butyrate in human intestinal epithelial cells: involvement of NF-kappaB pathway. J

404 Cell Biochem. 103: 1452-1463.

405 7. Brown, A. J., Goldsworthy, S. M., Barnes, A. A., Eilert, M. M., Tcheang, L.,

406 Daniels, D., Muir, A. I., Wigglesworth, M.J., Kinghorn, I., Fraser, N. J., Pike, N. B.,

17
407 Strum, J. C., Steplewski, K. M., Murdock, P. R., Holder, J. C., Marshall, F. H.,

408 Szekeres, P. G., Wilson, S., Ignar, D. M., Foord, S. M., Wise, A. and Dowell, S. J.

409 2003. The Orphan G protein-coupled receptors GPR41 and GPR43 are activated by

410 propionate and other short chain carboxylic acids. J. Biol. Chem. 278:

411 11312-11319.

412 8. Canfora, E. E., Jocken, J. W. and Blaak, E. E. 2015. Short-chain fatty acids in

413 control of body weight and insulin sensitivity. Nat. Rev. Endocrinol. 11: 577-591.

414 9. Cani, P. D., Neyrinck, A. M., Maton, N. and Delzenne, N. M. 2005. Oligofructose

415 promotes satiety in rats fed a high-fat diet: involvement of glucagon-like Peptide-1.

416 Obes. Res. 13: 1000-1007.

417 10. Cani, P. D., Knauf, C., Iglesias, M. A., Drucker, D. J., Delzenne, N. M. and

418 Burcelin, R. 2006. Improvement of glucose tolerance and hepatic insulin sensitivity

419 by oligofructose requires a functional glucagon-like peptide 1 receptor. Diabetes.

420 55: 1484-90.

421 11. Capitán-Cañadas, F., Ocón, B., Aranda, C. J., Anzola, A., Suárez, M. D., Zarzuelo,

422 A., de Medina, F. S. and Martínez-Augustin, O. 2016. Fructooligosaccharides exert

423 intestinal anti-inflammatory activity in the CD4+ CD62L+ T cell transfer model of

424 colitis in C57BL/6J mice. Eur. J. Nutr. 55: 1445-1454.

425 12. Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Lozupone, C. A.,

426 Turnbaugh, P. J., Fierer, N. and Knight, R. 2011, Global patterns of 16S rRNA

427 diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. U. S.

428 A. 108: 4516–4522.

429 13. Cummings, J. H., Pomare, E. W., Branch, W. J., Naylor, C. P. and Macfarlane, G. T.

430 1987. Short chain fatty acids in human large intestine, portal, hepatic and venous

18
431 blood. Gut. 28: 1221-1227.

432 14. Deusch, O., O'Flynn, C., Colyer, A., Swanson, K. S., Allaway, D. and Morris, P. A.

433 2015. Longitudinal Study of the Feline Faecal Microbiome Identifies Changes into

434 Early Adulthood Irrespective of Sexual Development. PLOS ONE, 10: e0144881.

435 15. Edgar, R. C., Haas, B. J., Clemente, J. C., Quince, C. and Knight, R. 2011.

436 UCHIME 3mproves sensitivity and speed of chimera detection. Bioinformatics. 27:

437 2194–2200.

438 16. Endo, A., Nakamura, S., Konishi, K., Nakagawa, J. and Tochio, T. 2016. Variations

439 in prebiotic oligosaccharide fermentation by intestinal lactic acid bacteria. Int. J.

440 Food. Sci. Nutr. 67: 125-132.

441 17. Garcia-Mazcorro, J. F., Barcenas-Walls, J. R., Suchodolski, J. S. and Steiner, J. M.

442 2017. Molecular assessment of the fecal microbiota in healthy cats and dogs before

443 and during supplementation with fructo-oligosaccharides (FOS) and inulin using

444 high-throughput 454-pyrosequencing. PeerJ. 5: e3184.

445 18. Gueimonde, M., Tölkkö, S., Korpimäki, T. and Salminen, S. 2004. New real-time

446 quantitative PCR procedure for quantification of bifidobacteria in human fecal

447 samples. Appl, Environ. Microbiol. 70: 4165–4169.

448 19. Handl, S., Dowd, S. E., Garcia-Mazcorro, J. F., Steiner, J. M. and Suchodolski, J. S.

449 2011. Massive parallel 16S rRNA gene pyrosequencing reveals highly diverse fecal

450 bacterial and fungal communities in healthy dogs and cats. FEMS. Microbiol. Ecol.

451 76: 301-310.

452 20. Hidaka, H., Eida, T., Takizawa, T., Tokunaga, T. and Tashiro, Y. 1986. Effects of

453 Fructooligosaccharides on Intestinal Flora and Human Health. Bifidobact.

454 Microflora. 5: 37-50.

19
455 21. Hisada, T., Endoh, K. and Kuriki, K. 2015. Inter- and intra-individual variations in

456 seasonal and daily stabilities of the human gut microbiota in Japanese. Arch.

457 Microbiol. 197: 919–934.

458 22. Hashizume, K., Tsukahara, T., Yamada, K., Koyama, H. and Ushida, K. 2003.

459 Megasphaera elsdenii JCM1772T normalizes hyperlactate production in the large

460 intestine of fructooligosaccharide-fed rats by stimulating butyrate production. J.

461 Nutr. 133: 3187-3190.

462 23. Kanakupt, K., Vester Boler, B. M., Dunsford, B. R. and Fahey, G.C. Jr. 2011.

463 Effects of short-chain fructooligosaccharides and galactooligosaccharides,

464 individually and in combination, on nutrient digestibility, fecal fermentative

465 metabolite concentrations, and large bowel microbial ecology of healthy adults cats.

466 J. Anim. Sci. 89: 1376-1384.

467 24. Kaplan, H. and Hutkins, R. W. 2000. Fermentation of fructooligosaccharides by

468 lactic acid bacteria and bifidobacteria. Appl. Environ. Microbiol. 66: 2682-2684.

469 25. Kasai, C., Sugimoto, K., Moritani, I., Tanaka, J., Oya, Y., Inoue, H., Tameda, M.,

470 Shiraki, K., Ito, M., Takei, Y. and Takase, K. 2015. Comparison of the gut

471 microbiota composition between obese and non-obese individuals in a Japanese

472 population, as analyzed by terminal restriction fragment length polymorphism and

473 next-generation sequencing. BMC. Gastroenterol. 15: 100.

474 26. Koga, Y., Tokunaga, S., Nagano, J., Sato, F., Konishi, K., Tochio, T., Murakami, Y.,

475 Masumoto, N., Tezuka, J. I., Sudo, N., Kubo, C. and Shibata, R. 2016.

476 Age-associated effect of kestose on Faecalibacterium prausnitzii and symptoms in

477 the atopic dermatitis infants. Pediatr. Res. 80: 844-851.

478 27. Le Poul, E., Loison, C., Struyf, S., Springael, J. Y., Lannoy, V., Decobecq, M. E.,

20
479 Brezillon, S., Dupriez, V., Vassart, G., Van Damme, J., Parmentier, M. and Detheux,

480 M. 2003. Functional characterization of human receptors for short chain fatty acids

481 and their role in polymorphonuclear cell activation. J. Biol. Chem. 278:

482 25481-25489.

483 28. Mao, B., Li, D., Zhao, J., Liu, X., Gu, Z., Chen, Y. Q., Zhang, H. and Chen, W.

484 2015. Metagenomic insights into the effects of fructo-oligosaccharides (FOS) on

485 the composition of fecal microbiota in mice. J. Agric. Food. Chem. 63: 856-863.

486 29. Marounek, M., Fliegrova, K. and Bartos, S. 1989. Metabolism and some

487 characteristics of ruminal strains of Megasphaera elsdenii. Appl. Environ. Microbiol.

488 55: 1570–1573.

489 30. Muyzer, G., de Waal, E. C. and Uitterlinden, A. G. 1993. Profiling of complex

490 microbial populations by denaturing gradient gel electrophoresis analysis of

491 polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ.

492 Microbiol. 59: 695–700.

493 31. Nakamura, S., Kondo, N., Yamaguchi, Y., Hashiguchi, M., Tanabe, K., Ushiroda, C.,

494 Kawahashi-Tokuhisa, M., Yui, K., Miyakoda, M. and Oku, T. 2014. Daily feeding

495 of fructooligosaccharide or glucomannan delays onset of senescence in SAMP8

496 mice. Gastroenterol. Res. Pract. 2014: 303184.

497 32. Oku, T., Nakamura, M., Hashiguchi-Ishiguro, M., Tanabe, K. and Nakamura, S.

498 2009. Bioavailability and Laxative Threshold of 1-kestose in Human Adults. Dyn

499 Biochem Process Biotechnol Mol Biol. 3: 90-95.

500 33. Ose, R., Hirano, K., Maeno, S., Nakagawa, J., Salminen, S., Tochio, T. and Endo, A.

501 2018. The ability of human intestinal anaerobes to metabolize different

502 oligosaccharides: Novel means for microbiota modulation? Anaerobe. 51: 110-119.

21
503 34. Reagan-Shaw, S., Nihal, M. and Ahmad, N. 2008. Dose translation from animal to

504 human studies revisited. FASEB J. 22:659-61.

505 35. Ritchie, L. E., Steiner, J. M. and Suchodolski, J. S. 2008. Assessment of microbial

506 diversity along the feline intestinal tract using 16S rRNA gene analysis. FEMS.

507 Microbiol. Ecol. 66: 590-598

508 36. Rossi, M., Corradini, C., Amaretti, A., Nicolini, M., Pompei, A. and Zanoni, S.

509 2005. Matteuzzi D. Fermentation of fructooligosaccharides and inulin by

510 bifidobacteria: a comparative study of pure and fecal cultures. Appl. Environ.

511 Microbiol. 71: 6150-6158.

512 37. Sommer, F., Anderson, J. M., Bharti, R., Raes, J. and Rosenstiel, P. 2017. The

513 resilience of the intestinal microbiota influences health and disease. Nat. Rev.

514 Microbiol. 15: 630-638.

515 38. Song, Y., Liu, C. and Finegold, S. M. 2004. Real-time PCR quantitation of

516 clostridia in feces of autistic children. Appl. Environ. Microbiol. 70: 6459–6465.

517 39. Songjinda, P., Nakayama, J., Tateyama, A., Tanaka, S., Tsubouchi, M., Kiyohara, C.,

518 Shirakawa, T. and Sonomoto, K. 2007. Differences in developing intestinal

519 microbiota between allergic and non-allergic infants: A Pilot Study in Japan. Biosci.

520 Biotechnol. Biochem. 71: 2338–2342.

521 40. Souza, D. D. S., Tahan, S., Weber, T. K., Araujo-Filho, H. B. and de Morais, M. B.

522 2018. Randomized, Double-Blind, Placebo-Controlled Parallel Clinical Trial

523 Assessing the Effect of Fructooligosaccharides in Infants with Constipation.

524 Nutrients. 10. pii: E1602.

525 41. Suchodolski, J. S., Foster, M. L., Sohail, M. U., Leutenegger, C., Queen, E. V.,

526 Steiner, J. M. and Marks, S. L. 2005. The Fecal Microbiome in Cats with Diarrhea.

22
527 PLOS ONE. 10: e0127378.

528 42. Suzuki, N., Aiba, Y., Hiroyuki, T., Fukumori, Y. and Koga, Y. 2006. Superiority of

529 1-1-kestose, the Smallest Fructo-oligosaccharide, to a Synthetic Mixture of

530 Fructo-oligosaccharides in the Selective Stimulating Activity in Bifidobacteria.

531 Biosci. Microflora. 25: 109-116.

532 43. Takahashi, S., Tomita, J., Nishioka, K., Hisada, T. and Nishijima, M. 2014.

533 Development of a prokaryotic universal primer for simultaneous analysis of

534 Bacteria and Archaea using next-generation sequencing. PLOS ONE. 9: e105592.

535 44. Takahashi, S., Yoshida, Y., Nakanishi, N., Tsukahara, T. and Ushida, K. 2008.

536 Quantitative real-time PCR monitoring of Escherichia coli and Clostridium

537 perfringens with oral administration of Lactobacillus plantarum strain Lq80 to

538 weaning piglets. Anim. Sci. 79: 737-744.

539 45. Tochio, T., Kitaura, Y., Nakamura, S., Sugawa, C., Takahashi, M., Endo, A. and

540 Shimomura, Y. 2016. An alteration in the cecal microbiota composition by feeding

541 of 1-1-kestose results in a marked increase in the cecal butyrate content in rats.

542 PLOS ONE. 11: e0166850.

543 46. Wu, G. D., Chen, J., Hoffmann, C., Bittinger, K., Chen, Y. Y., Keilbaugh, S. A.,

544 Bewtra, M., Knights, D., Walters, W. A., Knight, R., Sinha, R., Gilroy, E., Gupta, K.,

545 Baldassano, R., Nessel, L., Li, H., Bushman, F. D. and Lewis, J. D. 2011. Linking

546 long-term dietary patterns with gut microbial enterotypes. Science. 334: 105-108.

547 47. Yoshida, Y., Tsukahara, T. and Ushida, K. 2009. Oral administration of

548 Lactobacillus plantarum Lq80 and Megasphaera elsdenii iNP-001 induces efficient

549 recovery from mucosal atrophy in the small and the large intestines of weaning

550 piglets. Anim. Sci. J. 80: 709-715.

23
494 FIGURE LGENDS

495

496 Figure 1. Intestinal microbiota composition analysis at the genus level

497 The mean abundance of the top 34 taxa, with values of 0.1% or higher during the study period,

498 in all samples at each time point (0, 4, 8, and 10 weeks). The group in which the abundance of the

499 genus Lactobacillus at the study initiation was the highest was designated as Group A (GA) and

500 the group in which the abundance of the genus Blautia was the highest with few Lactobacillus was

501 designated as Group B (GB).

502
22
503

504 Figure 2. Two-dimensional PCoA analysis of microbiota in all samples

505 A plot of the first primary component (PC1) on the horizontal axis and the second primary

506 component (PC2) on the vertical axis, and each plot represents the microbiota structure of

507 individual samples. Plots were differently colored as follows: 0 weeks, blue; 4 weeks, red; 8 weeks,

508 green; and 10 weeks, purple. The number (1-6) beside the symbol indicates the ID numbers of cats.

509 Circles and diamonds represent group A (GA) and group B (GB) samples, respectively.

510

23
511

512 Figure 3. Quantitation of intestinal bacteria using real-time PCR

513 Green circles and orange diamonds represent group A (GA) and group B (GB) samples,

514 respectively. The short horizontal bars indicate the median. The black bars indicate the median of

515 all samples (GA+GB). To distinguish the 1-kestose administration period (0-8 weeks) and 2 weeks

516 after completion (10 weeks), a vertical broken line was added to the graph. The week in which a

517 slight difference was noted (p<0.1) in the statistical analysis is indicated by “*”.

518

24
519

520 Figure 4. Short-chain fatty acids (SCFA) measurement

521 The measurement of SCFA was performed using samples from group A (GA), group B (GB),

522 and both groups. The 1-kestose administration period (0 – 8 weeks) is indicated by the following

523 colors: GA, green; GB, orange; All, gray. The follow-up period is shown with white. Values are

524 presented by AVE±SE. In a statistical analysis of each week versus 0 weeks, the week at which a

525 slight increase was noted (p<0.1) is indicated by “*”.

526

25
 Table 1. Profiles of cats used in the present study
a) b) c)
ID No Strain Sex Age (year) Body weight (kg) BCS Group
1 Narc:Catus M 10 3.76 3 A
2 Narc:Catus M 10 2.97 3 A
3 Narc:Catus F 12 2.31 3 B
4 Narc:Catus M 13 3.02 3 B
5 Narc:Catus F 13 2.56 3 B
6 NIBS F 10 3.53 3 B
a) M, male; F, female
b) Body condition score (BCS); assessed on a 5-point scale (1, very thin; 2, thin; 3,
ideal; 4, overweight; 5, obese)
c) Group; Grouping was performed according to the type of intestinal microbiota
527 composition, as shown in Figure 1.

528

26
 Table 2. List of primers used for real-time PCR

Target Primer name Oligonucleotide sequence

341f CCTACGGGAGGCAGCAG
All Bacteria
534r ATTACCGCGGCTGCTGG
BifiLM26F GATTCTGGCTCAGGATGAACGC
Bifidobacterium spp.
Bif228R CTGATAGGACGCGACCCCAT
LactoR'F CACAATGGACGMAAGTCTGATG
Lactobacillus spp.
LBFR CGCCACTGGTGTTCTTCCAT
CXIV-F1 GAWGAAGTATYTCGGTATGT
Clostridium cluster XIV
CXIV-R2 CTACGCWCCCTTTACAC
Cperf 165F CGCATAACGTTGAAAGATGG
Clostridium perfringens
529 Cperf269R CCTTGGTAGGCCGTTACCC

530

27
 Table 3. Changes in the abundance of taxa exhibiting a slight increase in both GA and GB
Average abundance (% ) (Minimum% - Maximum%)
Genus 0 weeks 4 weeks 8 weeks 10 weeks
11.9 a) 14.4 9.8 10.6
Lactobacillus b)
( 0.0 - 43.2 ) ( 0.1 - 48.3 ) ( 0.1 - 39.5 ) ( 0.0 - 52.7 )
2.4 5.9 6.5 0.8
Bifidoabcterium
( 0.2 - 8.1 ) ( 0.2 - 26.9 ) ( 1.3 - 20.6 ) ( 0.1 - 3.5 )
2.9 4.3* 5.9* 1.1
Megasphaera
( 0.1 - 9.4 ) ( 0.6 - 11.3 ) ( 2.3 - 12.0 ) ( 0.0 - 5.4 )
9.4 11.3 13.5 7.6
Collinsella
( 7.1 - 12.6 ) ( 6.8 - 18.4 ) ( 7.7 - 21.9 ) ( 3.97 - 13.7 )
a) Average
b) Minimum-Maximum
531 *p<0.1 (versus 0 weeks)

532

28
533

534 Supplemental Figure 1. Changes in body weight of cats

535

29
 Supplemental Table 1. The hematology values of cats
Standard ID
Parameter 0 weeks 4 weeks 8 weeks 10 weeks Group
value No.
1 62 65 59 70
GA
2 101 92 96 80
2 3 68 57 79 75
White blood cells (10 /μl ) 55-195
4 89 88 81 106
GB
5 93 92 87 77
6 99 81 85 135
1 936 942 970 950
GA
2 1038 1027 1124 1077
3 874 769 770 742
Red blood cells (×104/μl ) 500-1000 4 958 841 860 826
GB
5 782 802 842 702
6 995 902 935 910
1 12.1 12.0 12.4 11.6
GA
2 14.0 13.4 14.4 13.6
3 12.6 11.2 10.7 9.6
Hemoglobin (g/dl ) 8.0-15.0
4 12.5 10.9 11.4 10.7
GB
5 11.3 11.9 12.1 9.8
6 14.1 13.5 14.1 13.2
1 36.2 36.4 37.6 35.0
GA
2 42.5 42.8 45.6 41.9
3 40.4 35.8 33.3 30.1
Hematocrit (%) 24.0-45.0
4 37.7 33.6 34.9 32.6
GB
5 39.3 40.9 41.7 34.3
6 43.7 41.7 44.6 41.1
1 24.8 19.1 19.2 18.7
GA
2 36.0 23.3 17.2 18.1
3 16.0 ND 17.8 18.1
Platelets (×104/μl ) 30.0-80.0
4 32.3 30.5 29.3 26.8
GB
5 28.9 17.7 23.0 31.7
6 35.8 25.3 16.2 19.9
536 ND, not detected

537

538

30
 Supplemental table 2-1. The blood chemistry values of the cats
Standard ID
Parameter 0 weeks 4 weeks 8 weeks 10 weeks Group
value No.
1 12 14 13 16
GA
2 17 21 16 18
3 30 27 34 27
Triglyceride (mg/dl ) 14-120
4 21 22 29 30
GB
5 14 16 14 20
6 16 18 16 16
1 103 102 110 116
GA
2 102 98 105 116
3 147 130 152 151
Total cholesterol (mg/dl ) 98-264
4 146 134 150 157
GB
5 96 96 103 114
6 80 76 81 89
1 86 83 95 85
GA
2 89 125 116 134
3 161 119 82 263
Blood glucose (mg/dl ) 58-132
4 86 98 94 130
GB
5 92 98 81 198
6 71 95 88 83
1 11 13 10 19
GA
2 12 9 7 7
3 134 53 69 88
GOT (IU/l ) 6-48
4 22 21 24 21
GB
5 29 30 29 32
6 16 15 21 16
1 40 54 49 57
GA
2 46 44 37 38
3 240 178 227 187
GPT (IU/l ) 20-122
4 44 45 54 43
GB
5 88 81 90 84
6 58 75 84 69
1 1 1 1 1
GA
2 1 1 1 1
3 1 1 1 1
γ-GTP (IU/l ) 0-2
4 1 1 1 1
GB
5 1 1 1 1
6 1 1 1 1
1 0.0 0.0 0.1 0.0
GA
2 0.0 0.0 0.0 0.0
3 0.0 0.0 0.0 0.0
Bilirubin (mg/dl ) 0.0-0.1
4 0.0 0.0 0.0 0.0
GB
5 0.0 0.0 0.0 0.0
6 0.0 0.0 0.0 0.0
1 7.1 7.1 7.6 7.6
GA
2 6.4 6.4 6.1 6.4
3 6.6 6.4 7.3 6.4
Total protein (g/dl ) 6.1-8.4
4 7.4 7.3 7.7 7.3
GB
5 6.2 6.3 6.7 6.2
6 6.9 7.0 7.4 7.1
1 3.4 3.4 3.6 3.6
GA
2 3.3 3.3 3.2 3.4
3 3.4 3.3 3.8 3.2
Albumin (g/dl ) 2.9-4.3
4 3.4 3.4 3.5 3.4
GB
5 3.3 3.4 3.6 3.3
539 6 3.5 3.5 3.7 3.5
31
540

541

32
 Supplemental table 2-2. The blood chemistry values of the cats
Standard ID
Parameter 0 weeks 4 weeks 8 weeks 10 weeks Group
value No.
1 61 75 92 90
GA
2 85 142 123 133
3 81 75 82 92
ALP (IU/l ) 30-228
4 71 61 67 71
GB
5 66 71 72 79
6 36 50 42 39
1 28 25 27 28
GA
2 18 14 19 18
3 32 25 37 31
Urea nitrogen (mg/dl ) 17-40
4 24 24 26 25
GB
5 27 25 29 27
6 24 23 26 24
1 1.2 1.2 1.2 1.3
GA
2 0.7 0.6 0.7 0.7
0.8-2.2 3 1.3 1.2 1.3 1.3
Creatinine (mg/dl )
4 1.0 1.0 1.0 1.1
GB
5 1.3 1.2 1.1 1.2
6 1.3 1.2 1.1 1.2
1 154 153 153 156
GA
2 153 154 154 159
3 155 156 157 152
Na (mmol/l ) 148-155
4 153 153 153 151
GB
5 156 154 158 154
6 156 156 159 156
1 4.4 4.3 3.9 4.6
GA
2 4.6 4.2 4.1 4.2
3 4.2 3.7 4.5 4.5
K (mmol/l ) 3.5-5.2
4 4.6 4.5 4.4 4.7
GB
5 4.8 4.4 4.8 4.1
6 4.2 3.8 4.5 3.8
1 122 120 121 124
GA
2 122 120 121 125
3 123 119 123 122
Cl (mmol/l ) 115-124
4 123 120 122 123
GB
5 123 123 126 124
6 124 123 125 125
1 2.2 2.2 2.3 2.2
GA
2 2.3 2.4 2.3 2.4
3 1.9 1.9 2.0 2.0
Mg (mg/dl ) 2.2-2.9
4 2.3 2.3 2.4 2.3
GB
5 2.2 2.2 2.3 2.2
6 2.4 2.3 2.5 2.3
1 9.1 8.8 9.0 8.9
GA
2 8.9 8.8 8.9 9.0
3 9.3 9.5 10.4 8.7
Ca (mg/dl ) 9.0-11.2
4 9.2 9.2 9.2 9.0
GB
5 9.4 10.3 10.0 9.0
6 10.0 9.9 10.7 9.8
1 4.7 4.6 4.9 4.9
GA
2 4.3 3.7 4.4 4.6
3 5.4 4.4 5.9 4.4
P (mg/dl ) 2.6-6.2
4 4.1 4.3 4.2 4.6
GB
5 4.0 5.7 5.3 3.9
542 6 5.1 4.7 4.9 4.9
33
 Supplemental table 3. Intestinal microbiota composition analysis at the phylum level in GA
Average abundance (%) (Minimum% - Max%)
Phylum
0 weeks 4 weeks 8 weeks 10 weeks
62.43 63.41 58.50 62.19
Firmicutes
( 57.52 - 67.33 ) ( 60.16 - 66.66 ) ( 45.19 - 71.82 ) ( 43.52 - 80.86 )
8.13 10.53 16.62 8.12
Actinobacteria
( 7.74 - 8.52 ) ( 8.73 - 12.32 ) ( 11.13 - 22.12 ) ( 6.99 - 9.26 )
9.08 5.32 3.02 9.02
Bacteroidetes
( 4.97 - 13.19 ) ( 5.09 - 5.55 ) ( 2.70 - 3.33 ) ( 1.55 - 16.49 )
0.56 0.43 0.22 1.01
Proteobacteria
( 0.36 - 0.77 ) ( 0.32 - 0.54 ) ( 0.21 - 0.22 ) ( 0.08 - 1.95 )
0.18 0.01 0.02 0.17
Fusobacteria
( 0.04 - 0.31 ) ( 0.01 - 0.02 ) ( 0.01 - 0.02 ) ( 0.03 - 0.31 )
0.02 0.01 0.02 0.03
Verrucomicrobia
543 ( 0.02 - 0.02 ) ( 0.01 - 0.01 ) ( 0.01 - 0.03 ) ( 0.02 - 0.04 )

544

545

34
 Supplemental table 4. Intestinal microbiota composition analysis at the phylum level in GB
Average abundance (%) (Minimum% - Max%)
Phylum
0 weeks 4 weeks 8 weeks 10 weeks
45.32 37.99 39.68 42.42
Firmicutes
( 43.33 - 47.57 ) ( 32.20 - 47.30 ) ( 34.04 - 45.65 ) ( 35.26 - 48.40 )
14.80 21.17 22.58 9.57
Actinobacteria
( 9.61 - 21.46 ) ( 9.16 - 46.00 ) ( 11.77 - 34.72 ) ( 4.50 - 19.36 )
9.19 12.29 9.65 14.98
Bacteroidetes
( 6.26 - 14.68 ) ( 3.94 - 17.27 ) ( 5.95 - 12.48 ) ( 6.72 - 20.21 )
0.47 0.92 0.70 1.08
Proteobacteria
( 0.25 - 0.72 ) ( 0.24 - 1.28 ) ( 0.22 - 1.12 ) ( 0.38 - 1.48 )
0.13 0.30 0.17 0.48
Fusobacteria
( 0.03 - 0.31 ) ( 0.04 - 0.47 ) ( 0.04 - 0.31 ) ( 0.06 - 0.64 )
0.07 0.04 0.04 0.06
Verrucomicrobia
546 ( 0.03 - 0.16 ) ( 0.02 - 0.06 ) ( 0.02 - 0.04 ) ( 0.03 - 0.12 )

547

548

35
 Supplemental table 5-1. Intestinal microbiota composition analysis at the genus level in GA
Average abundance (%) (Minimum% - Max%)
Genus
0 weeks 4 weeks 8 weeks 10 weeks
35.44 38.37 28.59 31.69
Lactobacillus
( 27.67 - 43.21 ) ( 28.48 - 48.25 ) ( 17.67 - 39.51 ) ( 10.67 - 52.72 )
11.82 8.84 8.74 14.26
Blautia
( 11.60 - 12.05 ) ( 6.86 - 10.81 ) ( 7.14 - 10.35 ) ( 11.77 - 16.76 )
7.54 7.87 9.49 7.36
Collinsella
( 7.08 - 8.00 ) ( 6.83 - 8.91 ) ( 7.68 - 11.29 ) ( 6.46 - 8.26 )
8.57 5.06 2.77 8.18
Prevotella
( 4.11 - 13.03 ) ( 4.80 - 5.31 ) ( 2.51 - 3.04 ) ( 1.49 - 14.88 )
5.98 5.00 4.45 8.08
Clostridium hiranonis
( 5.81 - 6.16 ) ( 4.80 - 5.20 ) ( 3.96 - 4.95 ) ( 7.15 - 9.02 )
5.21 7.12 5.50 3.00
Megasphaera
( 1.01 - 9.40 ) ( 2.98 - 11.27 ) ( 2.27 - 8.74 ) ( 0.63 - 5.36 )
0.34 2.4 6.8 0.4
Bifidobacterium
( 0.31 - 0.38 ) ( 1.59 - 3.12 ) ( 3.05 - 10.55 ) ( 0.27 - 0.51 )
0.05 0.07 7.35 0.07
Streptococcus
( 0.05 - 0.06 ) ( 0.04 - 0.10 ) ( 0.27 - 14.43 ) ( 0.06 - 0.08 )
0.00 0.00 0.00 0.06
Turicibacter
( 0.00 - 0.00 ) ( 0.00 - 0.00 ) ( 0.00 - 0.00 ) ( 0.00 - 0.11 )
0.53 0.55 0.50 0.56
Lachnoclostridium
( 0.27 - 0.79 ) ( 0.48 - 0.63 ) ( 0.36 - 0.63 ) ( 0.26 - 0.87 )
0.93 0.46 0.32 1.08
Faecalibacterium
( 0.91 - 0.96 ) ( 0.44 - 0.49 ) ( 0.17 - 0.47 ) ( 0.40 - 1.75 )
0.51 0.34 0.45 1.17
Ruminococcus
( 0.32 - 0.71 ) ( 0.26 - 0.41 ) ( 0.24 - 0.66 ) ( 0.59 - 1.74 )
0.51 0.31 0.57 0.20
Subdoligranulum
( 0.23 - 0.78 ) ( 0.18 - 0.43 ) ( 0.40 - 0.74 ) ( 0.12 - 0.27 )
0.25 0.30 0.11 0.10
Megamonas
( 0.12 - 0.37 ) ( 0.26 - 0.35 ) ( 0.03 - 0.19 ) ( 0.02 - 0.18 )
0.01 0.15 0.07 0.01
Paeniclostridium
( 0.00 - 0.02 ) ( 0.13 - 0.16 ) ( 0.03 - 0.11 ) ( 0.00 - 0.02 )
0.17 0.17 0.24 0.24
Slackia
( 0.14 - 0.19 ) ( 0.16 - 0.19 ) ( 0.19 - 0.28 ) ( 0.18 - 0.30 )
0.18 0.10 0.12 0.36
Tyzzerella
549 ( 0.03 - 0.33 ) ( 0.04 - 0.15 ) ( 0.00 - 0.24 ) ( 0.03 - 0.69 )

550

551

36
 Supplemental table 5-2. Intestinal microbiota composition analysis at the genus level in GA
Average abundance (%) (Minimum% - Max%)
Genus
0 weeks 4 weeks 8 weeks 10 weeks
0.33 0.13 0.06 0.56
Bacteroides
( 0.05 - 0.60 ) ( 0.12 - 0.14 ) ( 0.06 - 0.07 ) ( 0.01 - 1.11 )
0.22 0.15 0.08 0.42
Desulfovibrio
( 0.09 - 0.35 ) ( 0.15 - 0.15 ) ( 0.07 - 0.10 ) ( 0.04 - 0.80 )
0.14 0.10 0.02 0.46
Enterococcus
( 0.09 - 0.18 ) ( 0.03 - 0.18 ) ( 0.02 - 0.03 ) ( 0.07 - 0.86 )
0.03 0.48 0.21 0.36
Clostridium
( 0.02 - 0.04 ) ( 0.06 - 0.91 ) ( 0.15 - 0.27 ) ( 0.02 - 0.69 )
0.12 0.09 0.08 0.09
Parabacteroides
( 0.07 - 0.16 ) ( 0.03 - 0.16 ) ( 0.03 - 0.13 ) ( 0.04 - 0.13 )
0.18 0.01 0.01 0.16
Fusobacterium
( 0.04 - 0.31 ) ( 0.01 - 0.01 ) ( 0.01 - 0.02 ) ( 0.03 - 0.29 )
0.11 0.17 0.35 0.05
Lactonifactor
( 0.03 - 0.19 ) ( 0.09 - 0.26 ) ( 0.21 - 0.48 ) ( 0.03 - 0.06 )
0.02 0.02 0.03 0.15
Paraprevotella
( 0.01 - 0.03 ) ( 0.00 - 0.05 ) ( 0.01 - 0.06 ) ( 0.00 - 0.29 )
0.07 0.08 0.05 0.35
Anaerobiospirillum
( 0.00 - 0.14 ) ( 0.00 - 0.15 ) ( 0.00 - 0.09 ) ( 0.00 - 0.70 )
0.18 0.15 0.11 0.11
Butyricicoccus
( 0.13 - 0.23 ) ( 0.12 - 0.18 ) ( 0.09 - 0.13 ) ( 0.04 - 0.18 )
0.16 0.15 0.09 0.13
Catenibacterium
( 0.07 - 0.25 ) ( 0.08 - 0.21 ) ( 0.03 - 0.15 ) ( 0.08 - 0.19 )
0.23 0.12 0.05 0.18
Sutterella
( 0.22 - 0.24 ) ( 0.09 - 0.15 ) ( 0.03 - 0.08 ) ( 0.01 - 0.35 )
0.03 0.02 0.05 0.04
Alistipes
( 0.01 - 0.06 ) ( 0.02 - 0.02 ) ( 0.03 - 0.07 ) ( 0.00 - 0.07 )
0.03 0.05 0.05 0.06
Adlercreutzia
( 0.03 - 0.04 ) ( 0.04 - 0.07 ) ( 0.02 - 0.07 ) ( 0.03 - 0.08 )
0.10 0.18 0.18 0.12
Allisonella
( 0.02 - 0.19 ) ( 0.15 - 0.21 ) ( 0.02 - 0.35 ) ( 0.06 - 0.18 )
0.02 0.03 0.02 0.03
Actinomyces
( 0.02 - 0.02 ) ( 0.02 - 0.04 ) ( 0.02 - 0.03 ) ( 0.02 - 0.04 )
0.01 0.23 0.51 0.00
Acidaminococcus
552 ( 0.00 - 0.02 ) ( 0.00 - 0.46 ) ( 0.00 - 1.03 ) ( 0.00 - 0.00 )

553

554

37
 Supplemental table 6-1. Intestinal micobiota composition analysis at the genus level in GB
Average abundance (%) (Minimum% - Max%)
Genus
0 weeks 4 weeks 8 weeks 10 weeks
0.09 2.44 0.43 0.06
Lactobacillus
( 0.04 - 0.20 ) ( 0.09 - 8.58 ) ( 0.10 - 0.89 ) ( 0.04 - 0.07 )
18.08 13.95 16.49 18.36
Blautia
( 14.06 - 22.05 ) ( 9.95 - 19.02 ) ( 10.73 - 19.3 ) ( 16.01 - 22.62 )
10.39 12.96 15.55 7.67
Collinsella
( 8.66 - 12.58 ) ( 7.78 - 18.44 ) ( 9.60 - 21.90 ) ( 3.97 - 13.72 )
8.04 11.24 8.68 13.67
Prevotella
( 4.981 - 13.55 ) ( 3.811 - 15.52 ) ( 5.605 - 11.01 ) ( 4.869 - 19.29 )
11.19 6.57 8.42 10.77
Clostiridum hiranonis
( 4.27 - 17.82 ) ( 3.03 - 8.87 ) ( 3.73 - 13.35 ) ( 8.94 - 11.99 )
1.69 2.96 6.13 0.21
Megasphaera
( 0.11 - 5.03 ) ( 0.631 - 5.642 ) ( 3.207 - 12.02 ) ( 0.014 - 0.569 )
3.38 7.60 6.38 1.00
Bifidobacterium
( 0.17 - 8.06 ) ( 0.16 - 26.85 ) ( 1.33 - 20.60 ) ( 0.07 - 3.54 )
0.24 3.93 1.65 4.12
Streptococcus
( 0.08 - 0.49 ) ( 0.07 - 15.35 ) ( 0.05 - 6.34 ) ( 0.11 - 15.94 )
7.30 2.08 0.57 2.63
Turicibacter
( 0.00 - 17.27 ) ( 0.00 - 8.18 ) ( 0.00 - 2.26 ) ( 0.00 - 10.51 )
1.42 0.93 0.82 1.05
Lachnoclostridium
( 1.20 - 1.68 ) ( 0.45 - 1.22 ) ( 0.38 - 1.03 ) ( 0.76 - 1.34 )
0.56 0.73 0.56 0.83
Faecalibacterium
( 0.16 - 1.17 ) ( 0.18 - 1.38 ) ( 0.08 - 1.15 ) ( 0.09 - 1.33 )
0.85 0.44 0.42 0.85
Ruminococcus
( 0.61 - 1.34 ) ( 0.34 - 0.60 ) ( 0.21 - 0.62 ) ( 0.58 - 1.05 )
1.11 0.38 0.53 0.26
Subdoligranulum
( 0.12 - 2.49 ) ( 0.10 - 0.89 ) ( 0.17 - 0.91 ) ( 0.07 - 0.71 )
0.04 1.66 1.40 0.06
Megamonas
( 0.01 - 0.07 ) ( 0.01 - 4.64 ) ( 0.19 - 3.66 ) ( 0.00 - 0.21 )
1.07 0.20 0.69 0.87
Paeniclostridium
( 0.36 - 1.85 ) ( 0.00 - 0.65 ) ( 0.25 - 1.30 ) ( 0.00 - 2.43 )
0.68 0.40 0.38 0.67
Slackia
( 0.48 - 0.85 ) ( 0.27 - 0.54 ) ( 0.24 - 0.47 ) ( 0.28 - 1.79 )
0.23 0.37 0.42 0.83
Tyzzerella
555 ( 0.14 - 0.40 ) ( 0.01 - 0.77 ) ( 0.01 - 1.04 ) ( 0.73 - 0.99 )

556

557

38
 Supplemental table 6-2. Intestinal micobiota composition analysis at the genus level in GB
Average abundance (%) (Minimum% - Max%)
Genus
0 weeks 4 weeks 8 weeks 10 weeks
0.29 0.32 0.29 0.56
Bacteroides
( 0.23 - 0.39 ) ( 0.06 - 0.63 ) ( 0.07 - 0.51 ) ( 0.17 - 1.33 )
0.20 0.39 0.32 0.73
Desulfovibrio
( 0.11 - 0.43 ) ( 0.02 - 0.64 ) ( 0.08 - 0.61 ) ( 0.15 - 0.95 )
0.34 0.00 0.06 0.33
Enterococcus
( 0.03 - 1.02 ) ( 0.00 - 0.01 ) ( 0.01 - 0.17 ) ( 0.03 - 0.57 )
0.31 0.15 0.20 0.20
Clostridium
( 0.01 - 0.67 ) ( 0.00 - 0.27 ) ( 0.02 - 0.40 ) ( 0.01 - 0.67 )
0.27 0.29 0.24 0.25
Parabacteroides
( 0.15 - 0.45 ) ( 0.02 - 0.52 ) ( 0.07 - 0.38 ) ( 0.16 - 0.36 )
0.12 0.29 0.16 0.48
Fusobacterium
( 0.03 - 0.30 ) ( 0.03 - 0.46 ) ( 0.04 - 0.31 ) ( 0.04 - 0.64 )
0.12 0.23 0.22 0.25
Lactonifactor
( 0.02 - 0.28 ) ( 0.02 - 0.71 ) ( 0.02 - 0.75 ) ( 0.02 - 0.89 )
0.23 0.24 0.27 0.34
Paraprevotella
( 0.09 - 0.54 ) ( 0.02 - 0.51 ) ( 0.12 - 0.64 ) ( 0.06 - 0.68 )
0.06 0.32 0.22 0.22
Anaerobiospirillum
( 0.01 - 0.13 ) ( 0.00 - 0.55 ) ( 0.00 - 0.46 ) ( 0.06 - 0.44 )
0.12 0.18 0.10 0.17
Butyricicoccus
( 0.03 - 0.26 ) ( 0.03 - 0.27 ) ( 0.07 - 0.12 ) ( 0.05 - 0.27 )
0.06 0.25 0.06 0.09
Catenibacterium
( 0.01 - 0.08 ) ( 0.08 - 0.47 ) ( 0.02 - 0.12 ) ( 0.01 - 0.12 )
0.05 0.12 0.08 0.03
Sutterella
( 0.02 - 0.07 ) ( 0.00 - 0.30 ) ( 0.00 - 0.20 ) ( 0.02 - 0.04 )
0.25 0.08 0.08 0.09
Alistipes
( 0.09 - 0.36 ) ( 0.01 - 0.16 ) ( 0.04 - 0.13 ) ( 0.03 - 0.19 )
0.13 0.11 0.11 0.13
Adlercreutzia
( 0.09 - 0.16 ) ( 0.05 - 0.18 ) ( 0.06 - 0.19 ) ( 0.11 - 0.15 )
0.02 0.09 0.12 0.04
Allisonella
( 0.00 - 0.03 ) ( 0.07 - 0.11 ) ( 0.01 - 0.21 ) ( 0.00 - 0.10 )
0.14 0.05 0.09 0.05
Actinomyces
( 0.09 - 0.23 ) ( 0.02 - 0.09 ) ( 0.05 - 0.15 ) ( 0.02 - 0.09 )
0.00 0.06 0.11 0.00
Acidaminococcus
558 ( 0.00 - 0.01 ) ( 0.00 - 0.23 ) ( 0.00 - 0.42 ) ( 0.00 - 0.00 )

559

39