Molecular and Cellular Probes 43 (2019) 86–91

Contents lists available at ScienceDirect

Molecular and Cellular Probes

journal homepage: www.elsevier.com/locate/ymcpr

One-step multiplex real-time RT-PCR for detection and typing of dengue T

virus
Myung-Jin Muna,1, Joon-Yong Baeb,1, Jin Hyuck Kima, Soo Bok Kima, Ilseob Leeb, Jin Il Kimb,
Mee Sook Parkb, Man-Seong Parkb, Yong Suk Nama,∗
a
Kogenebiotech Co., Ltd, Seoul, Republic of Korea
b
Department of Microbiology, Institute for Viral Diseases, College of Medicine, Korea University, Seoul, Republic of Korea

ARTICLE INFO ABSTRACT

Keywords: Previous studies reported that severity of dengue is associated with multiple factors, including secondary in-
Dengue virus fection, age, viral load and infecting serotype and genotype. In addition, other studies have reported that a
Serotyping dengue virus-2 (DENV-2) infection is associated with a prognosis of more severe clinical manifestations than
TaqMan probe DENV-1 and DENV-4 infections. For these reasons, the ability to identify the DENV serotypes is critical for
Real-time PCR
optimal patient diagnosis and epidemiological studies. In this study, we developed a TaqMan probe-based, one-
step real-time reverse transcriptase-polymerase chain reaction (RT-PCR) system for detection and serotyping
DENV. Our linear dynamic range (101 to 107 copies/reaction) showed the R2 values of DENV-1, 2, 3 and 4 as
0.998, 0.998, 0.994, and 0.998, respectively. The detection limits of DENV-1, 2, 3, and 4, were 10 copies/
reaction, 100 copies/reaction, 10 copies/reaction, and 100 copies/reaction, respectively. Specificity test results
indicated that this system is specific for DENV-1, 2, 3, and 4 and does not react with other viruses. Finally, we
validated our results with five different real-time PCR instruments. Our results showed that the Ct values of the
four serotype templates were similar in five real-time PCR instruments. Thus, this system provides an accurate
method for detection and serotyping of DENV, which can be applied in diagnostics, surveillance, and epide-
miology. Dengue can be found in many nations with varying socioeconomic and monetary resources. The results
of our validation analyses using five different real-time PCR instruments suggest that this method can easily and
confidently be used world-wide.

Dengue is a mosquito-borne disease caused by the dengue virus epidemiological studies.

(DENV). In the last 50 years, the incidence of dengue infection has
increased 30-fold, and the World Health Organization (WHO) has es-
timated that 96 million cases of dengue occur annually [1,2]. Fur-
thermore, the geographical area of DENV transmission has expanded,
and DENV is now present in Asia, Africa, and the Americas [3]. Un-
differentiated fever, dengue fever (DF), and dengue hemorrhagic fever
(DHF) constitute the three types of dengue infection [1], and dengue
shock syndrome (DSS) is a severe form of DHF (grade III and grade IV)
[1]. Yung et al. suggested that the severity of dengue is associated with
multiple factors, including secondary infection, age, viral load and in-
fecting serotype and genotype [4]. Some studies have reported that
infection by DENV-2 is associated with a more severe clinical profile
than infection with DENV-1 or DENV-4 [5,6]. For these reasons, the
identification of DENV serotypes is very important not only for the
clinical profiling of individual patients but also for surveillance and
In the past, DENV detection methods included enzyme-linked im-
munosorbent assay (ELISA), and conventional PCR (cPCR). However,
ELISA is a multi-step procedure, and cPCR is at increased risk of con-
tamination and false-positive results [7]. Among the available detection
methods, real-time RT-PCR has the advantages of providing sensitive
and accurate results in a short period of time [7]. For these reasons,
many researchers use real-time RT-PCR for the detection of flavi-
viruses’, including DENV [7–10].
In this study, we developed a TaqMan probe-based one-step RT-PCR
system for detection and serotyping DENV and for the detection of
multi-infections. Additionally, we validated our TaqMan probe-based
detection system using five different real-time PCR instruments. Our
real-time RT-PCR detection system will be a useful diagnostic tool for
detecting multiple types of flaviviruses in human suspected of an in-
fections, and for the surveillance of the viruses among the arthropod

∗
Corresponding author. RM1101, C-dong, 168, Gasan digital 1-ro, Geumcheon-gu, Seoul, 08507, Republic of Korea.
E-mail address: kogene@kogene.co.kr (Y.S. Nam).
1
Equally contribution.

https://doi.org/10.1016/j.mcp.2018.10.001
Received 9 May 2018; Received in revised form 2 October 2018; Accepted 2 October 2018
Available online 03 October 2018
0890-8508/ © 2018 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY license
(http://creativecommons.org/licenses/BY/4.0/).
M.-J. Mun et al. Molecular and Cellular Probes 43 (2019) 86–91

Fig. 1. Alignment results of DENV-1, 2, 3 and 4. Nucleotide sequence collection and alignment have used Genious software. (a)DENV-1 (b) DENV-2, (c) DENV-3 and
(d) DENV-4.

Table 1
Primer and probe sequences used in this study.
Name Sequence (‘5 - > 3’) Nucleotide position Size (bp)

DENV-1 F1 GYTTCCTGTGAGCCATTGTGAA 2463–2582 120

DENV-1 F2 GATTTAGCAACATTCTRGATGTCATGTT
DENV-1 R1 GAAACCCAATACATTTCATGAGTAGAATT
DENV-1 R2 TACATTTCATGRGTRGAATTTCTTGAG
DENV-1 probe FAM-ACTGCYGACACAATRTTTCCTGTTCCACATG-BHQ1

DENV-2 F1 TGCCCAACACAAGGRGAACC 1175–1304 130

DENV-2 R1 GCRCAGGTCACAATGCCYCC
DENV-2 probe JOE-TGGTRGACAGAGGATGGGGRAATGGAT-BHQ1

DENV-3 F1 CGGGAAAACCGTCTATCAATATGC 117–197 81

DENV-3 R1 TGAGAATCTCTTCGCCAACTGTG
DENV-3 probe ROX- AACGCGTGAGAAACCGTGTGTCAACTG-BHQ2

DENV-4 F1 GGTGAAGAGATTCTCRACYGGACT 185–288 104

DENV-4 R1 TGCTGTTGGYGGGATGGAAA
DENV-4 probe Cy5-TCYGGGAAAGGACCCTTACGGATGGTG-TAO

Table 2 vectors and epidemiological studies, as well.

The results of specificity test for one-step real-time RT-PCR assay. For the primer and probe design, NS5 gene sequences of DENV-1
Name Number of copies Detection (3001 sequences), the envelope gene of DENV-2 (2965 sequences), the
capsid gene of DENV-3 (2813 sequences), and the capsid gene of DENV-
4 (610 sequences), were obtained from NCBI GenBank database and
4
Dengue 1 virus 10 copies/㎕ +
Dengue 2 virus 104 copies/㎕ +
aligned using Genious Software (Genious 10.0.8, Biomatters Ltd.,
Dengue 3 virus 104 copies/㎕ +
Dengue 4 virus 104 copies/㎕ +
Auckland, New Zealand) (Fig. 1). Highly conserved regions of these
Yellow fever virus 104 copies/㎕ – genes were identified, and the primers and probes were designed
Tick borne encephalitis virus 104 copies/㎕ – against the conserved regions using primer express 3.0.1 (ThermoFisher
Japanese encephalitis virus 106 copies/㎕ – Scientific, Walthman, USA). Furthermore, we have theoretically con-
West Nile virus 104 copies/㎕ –
firmed binding possibility between primer/probe and human RNA
chikungunya virus 104 copies/㎕ –
Zika virus 104 copies/㎕ – using NCBI nucleotide blast. For DENV-1, we have used two pair pri-
mers for increased detection coverage. The 5′ ends of the DENV-1, 2, 3
and 4 probes were labeled FAM, JOE, ROX, and Cy5 respectively. Ad-
ditionally, the 3′ ends of the DENV-1, 2 and 3 probes were labeled with

87
M.-J. Mun et al. Molecular and Cellular Probes 43 (2019) 86–91

Fig. 2. Linear dynamic range of one-step TaqMan real-time RT PCR. Standard curve constructed with ten-fold serial dilutions of in vitro transcribed RNA (a)DENV-1
(b) DENV-2, (c) DENV-3 and (d) DENV-4.

Table 3
The amplification sensitivity of one-step real-time RT-PCR assay.
Copies/reactions Ct mean ± SD*

DENV-1 DENV-2 DENV-3 DENV-4

1 × 107 18.95 ± 0.02 20.18 ± 0.04 17.99 ± 0.11 18.28 ± 0.04

1 × 106 22.44 ± 0.07 23.66 ± 0.08 21.21 ± 0.10 21.51 ± 0.08
1 × 105 25.75 ± 0.04 26.99 ± 0.01 24.43 ± 0.10 24.77 ± 0.12
1 × 104 29.01 ± 0.07 30.25 ± 0.06 26.91 ± 0.04 28.13 ± 0.03
1 × 103 32.36 ± 0.24 33.57 ± 0.12 31.18 ± 0.11 31.44 ± 0.19
1 × 102 34.94 ± 0.17 37.18 ± 0.42 34.28 ± 0.33 34.67 ± 0.58
1 × 101 38.27 ± 0.06 not detected 36.21 ± 0.51 not detected

*SD: standard deviation.

Black Hole Quencher (BHQ, Genotech, Daejeon, Korea). BHQ of DENV-
1, 2 and 3 were BHQ1, BHQ1 and BHQ2, respectively. The 3’ end of the
DENV- 4 probe was labeled with a dual labeled TAO quencher (In-
tegrated DNA Technologies, Coralville, USA). Information regarding
the primer/probe sequences is summarized in Table 1.
We performed specificity tests against several members of the fla-
vivirus genus, including DENV-1, 2, 3, and 4; Zika virus (ZIKV); chi-
kungunya virus (CHIKV); tick-borne encephalitis virus (TBEV); yellow
fever virus (YFV); West Nile virus (WNV); and Japanese encephalitis
virus (JEV). An Amplirun® RNA (Vircell, Granada, Spain) control was
used with the DENV-1, 2, 3, 4, ZIKV, CHIKV, TBEV, YFV and WNV. JEV
(RNA) was obtained from National Culture Collection for Pathogens
(NCCP; Osong, Republic of Korea). All real-time RT-PCR reactions were
performed in a total volume of 20 ㎕ containing 1㎕ of primer/probe
(DENV-1: 250 nM each primer/200 nM probe, DENV-2: 400 nM each
primer/300 nM probe, DENV-3: 250 nM each primer/200 nM probe,
DENV-4: 400 nM each primer/300 nM probe), 5X RT reaction buffer
(Solgent, Seoul, republic of Korea), 12.5X enzyme mix (Solgent, Seoul,
republic of Korea), 5 ㎕ of template RNA, and RNase free water. A
Quant studio 6 (ThermoFisher Scientific, Waltham, USA) was used with
the following protocol: reverse transcription at 50 °C for 30 min, initial
denaturation at 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and of
60 °C for 1 min. The specificity test results showed that our real-time
RT-PCR system successfully amplified DENV-1, 2, 3, and 4.
Furthermore, our system did not amplify other members of the flavi-
virus genus, including ZIKV, CHIKV, TBEV, YFV, WNV, and JEV
(Table 2).
The RNA standard control was prepared for the linearity test using

88
M.-J. Mun et al. Molecular and Cellular Probes 43 (2019) 86–91

Table 4
Validation results of one-step real-time RT-PCR assay in five real-time PCR instruments.
Threshold 7500 standard real-time PCR Threshold CFX96

DENV-1 DENV-2 DENV-3 DENV-4 DENV-1 DENV-2 DENV-3 DENV-4

50,000 50,000 50,000 50,000 200 250 200 400

Copies/reactions Ct mean ± SD* Copies/reactions Ct mean ± SD*

1 × 106 22.28 ± 0.09 23.51 ± 0.10 20.69 ± 0.05 21.47 ± 0.08 1 × 106 22.45 ± 0.06 23.46 ± 0.09 21.08 ± 0.06 21.51 ± 0.04
1 × 104 28.97 ± 0.03 30.25 ± 0.07 26.83 ± 0.57 28.14 ± 0.06 1 × 104 28.93 ± 0.10 30.10 ± 0.10 27.47 ± 0.06 28.08 ± 0.03
1 × 102 34.76 ± 0.07 36.02 ± 0.38 33.61 ± 0.56 34.41 ± 0.36 1 × 102 35.33 ± 0.74 36.35 ± 0.24 34.08 ± 0.60 34.68 ± 0.41

Threshold MX 3005p Threshold LC480

DENV-1 DENV-2 DENV-3 DENV-4 DENV-1 DENV-2 DENV-3 DENV-4
700 300 700 500 2 5 0.6 1
Copies/reactions Ct mean ± SD* Copies/reactions Ct mean ± SD*

6
1 × 10 22.27 ± 0.32 23.62 ± 0.11 20.76 ± 0.01 21.31 ± 0.04 1 × 106 22.29 ± 0.04 23.45 ± 0.28 20.52 ± 0.08 21.31 ± 0.04
1 × 104 28.96 ± 0.20 30.08 ± 0.59 27.28 ± 0.07 27.84 ± 0.13 1 × 104 28.80 ± 0.05 29.94 ± 0.13 27.01 ± 0.05 27.84 ± 0.08
1 × 102 34.97 ± 0.29 35.93 ± 0.37 33.77 ± 0.42 34.48 ± 0.14 1 × 102 34.51 ± 0.28 37.04 ± 1.23 33.10 ± 0.28 34.52 ± 0.55

Threshold Quant studio 6

DENV-1 DENV-2 DENV-3 DENV-4

150,000 150,000 150,000 150,000

Copies/reactions Ct mean ± SD*

6
1 × 10 22.44 ± 0.07 23.66 ± 0.08 21.19 ± 0.11 21.49 ± 0.09
1 × 104 29.00 ± 0.06 30.20 ± 0.07 26.90 ± 0.04 28.12 ± 0.04
1 × 102 34.92 ± 0.22 37.06 ± 0.39 34.25 ± 0.34 34.67 ± 0.60

*SD: standard deviation.

Table 5 master mix, and ∼50 ng of plasmid DNA. The PCR protocol was as
The precision analysis of one-stem real-time RT-PCR assay. follows: initial denaturation at 95 °C for 10 min, 40 cycles of 95 °C for
Target Concentrationa No. of replicate Ct mean ± SDb %CVc
15 s, and 60 °C for 1 min. The amplified PCR product was purified using
the MinElute PCR purification kit (Qiagen, Hilden, Germany) followed
DENV 1 High 30 21.55 ± 0.26 1.2 by an in vitro transcription assay using a MEGAScript T7 kit (Ther-
Middle 30 28.37 ± 0.32 1.12 moFisher Scientific, Waltham, USA). Next, we treated Turbo DNase I
Low 30 34.53 ± 0.34 0.98
(ThermoFisher Scientific, Waltham, USA), followed by removal of free
DENV 2 High 30 22.78 ± 0.16 0.19 nucleotides using RNeasy micro kit (Qiagen, Hilden, Germany). Then,
Middle 30 29.66 ± 0.16 0.53 we measured the RNA concentration using a microvolume spectrometer
Low 30 35.84 ± 0.46 1.2 (Colibri, Germany). The copy number of the in vitro transcribed RNA
was calculated according to the general formula [copy number (copies/
DENV 3 High 30 20.44 ± 0.08 0.39
Middle 30 27.39 ± 0.10 0.36 ㎕) = 6.02 × 1023 x concentration (ng/㎕)/length of ssRNA (bp) x
Low 30 33.94 ± 0.57 1.68 340 × 109]. The linearity test of our primer/probe system of 10-fold
serial-diluted in vitro transcribed RNA for DENV-1, 2, 3, and 4 was
DENV 4 High 30 20.55 ± 0.08 0.38 performed in triplicate. The in vitro transcribed RNA copy range fell
Middle 30 27.29 ± 0.08 0.29
Low 30 33.87 ± 0.36 1.06
between 101 to 107 copies/reaction. The R2 and efficiency were cal-
culated. The R2 values of DENV-1, 2, 3 and 4 were 0.998, 0.998, 0.994,
a
Amount of High, middle and low were 106 copies/reaction, 104 copies/ and 0.998, respectively. Furthermore, the efficiency percent values (Eff
reaction and 102 copies/reaction, respectively. %) of DENV-1, 2, 3, and 4 were 105.4, 99.8, 108.9, and 101.3, re-
b
Standard deviation. spectively. Additionally, the detection limits of DENV-1, 2, 3, and 4
c
Coefficient of variation. were 10 copies/reaction, 100 copies/reaction, 10 copies/reaction, and
100 copies/reactions, respectively (Fig. 2 and Table 3). Furthermore,
in vitro transcription assay. The target regions of DENV-1 to 4 were standard deviation of Ct values for DENV-1, 2, 3 and 4 were < 0.3, <
amplified using RT-PCR from four Amplirun® dengue virus RNA con- 0.5, < 0.6 and < 0.6, respectively.
trols (DENV-1: MBC055, DENV-2: MBC056, DENV-3: MBC057, and Next, we tested our real-time RT-PCR system using various real-time
DENV-4: MBC058; Vircell, Spain). Forward and reverse primer sets for PCR instruments, including the Quantstudio 6 (ThermoFisher Scientific,
the amplification are listed in Table 1. The purified PCR product was Waltham, USA), the CFX96 (Bio-Rad, Hercules, USA), the LightCycler
cloned into the pGEM T-Easy vector (Promega, Spain), which was 480 (Roche, Basel, Swiss), the Agilent MX3005p (Agilent Technologies,
transformed into Escherichia coli competent cells. The insert was am- Santa Clara, USA), and the Applied Biosystems 7500 standard
plified using the T7 primer (Forward primer: GTAATACGACTCACTAT (ThermoFisher Scientific, Waltham, USA). We set a different threshold
AGGGCGAATTG and Reverse primer: TGGGAGCTCTCCCATATGGTC). line for each instrument to be able to compare the results from the
The PCR reaction against the T7 promoter product was performed using various real-time PCR instruments (Table 4). Our validation results
a GeneAmp PCR System 9700 (ThermoFisher Scientific, Waltham, USA) showed that the Ct values of the four serotype templates were similar in
in a total volume of 20 ㎕ containing 500 nM of each primer, DNA all five real-time PCR instruments (Table 4).

89
M.-J. Mun et al.
Fig. 3. Linear dynamic range of one-step TaqMan real-time RT PCR with DENVs in PBS and in human serum. Standard curves constructed with ten-fold serial
dilutions of DENV-1 to 4 in PBS and in human serum are overlaid for comparison. Line: PBS, dotted line: serum.
The test reproducibility was evaluated using in vitro transcribed
RNA (high, middle and low concentration), under the condition of one
per day over 5 days by two operators using Quantstudio 5
(ThermoFisher Scientific, Waltham, USA). Our results showed that the
range of the values of coefficient of variation (%CV) of the three con-
centrations for DENV-1, 2, 3 and 4 were 0.98–1.2, 0.19 to 1.2, 0.36 to
1.68 and 0.29 to 1.06, respectively (Table 5).
To overcome the limitation of using in vitro transcribed RNA, we
next determined sensitivity of our system using actual DENVs. The four
serotypes of DENV were provided by the Korean Bank for Pathogenic
Viruses (KBPV, Seongbuk-gu, Seoul, Republic of Korea). The viruses
were propagated in Vero cells and the titers were determined by plaque
assay. The viruses were 10-fold serially diluted in PBS or in normal
human serum from 100 to 0.01 PFU per condition for RNA extraction.
Viral RNA extraction was carried out using QIAamp Viral RNA Mini Kit
(Qiagen, #52904), and RT-PCR was performed in triplicates using
Applied Biosystems 7500 Real-time PCR instrument system. There was
a linearity between the Ct values and the input virus numbers with R2 of
0.99–1 and 0.97–0.99 for DENV-1 to 4 in PBS and in serum, respec-
tively. %CVs of the triplicates were lower than 5% for all DENV ser-
otypes and virus concentrations (Fig. 3). Although sensitivity of de-
tection for DENV-1 and 2 in serum was slightly lower than that in PBS,
sensitivity of detection for DENV-3 and 4 in serum should be considered
practically identical with that in PBS. These results are confirmative of
applicability of our system to diagnoses of patient sera.
DENV is steadily expanding geographically. Currently, approxi-
mately 3 billion people live in DENV-affected regions and 20,000
deaths occur every year [11]. To combat this threat, each DENV-af-
fected region should be developing and implementing monitoring sys-
tems for epidemiological research and infection surveillance. Recently,
many studies in a variety of countries, including Sweden, the USA,
90
Molecular and Cellular Probes 43 (2019) 86–91
Brazil, and so on, have used diverse real-time PCR instruments and
reported the efficacy of the TaqMan probe-based qPCR method for
DENV detection [10,12,13]. However, comparison test of real-time PCR
platform using salmonella showed that some TaqMan probe-based de-
tection systems were inconsistent across instruments due to the dif-
ferent techniques used by different companies [14]. For this reason, it is
important that any new probe-based qPCR assay be validated and op-
timized in a variety of instruments so that investigators, regardless of
location or instrumentation, can produce accurate measurements.
In this study, we developed a one-step real-time RT-PCR method for
DENV serotype identification, and we tested our method with five real-
time PCR instruments. Our triplicate testing of a 10-fold diluted tem-
plate showed that the standard deviation for the triplicates < 0.6 for
the templates of all four DENV, and the correlation coefficient (R2)
values were > 0.99. The sensitivity of our detection system was de-
termined in a series of 10-fold dilutions of the in vitro transcribed RNA
and actual DENVs in PBS and in human serum as well. The results using
in vitro transcribed RNA indicate that the detection limits of DENV-1, 2,
3, and 4 were 10 copies/reaction, 100 copies/reaction, 10 copies/re-
action, and 100 copies/reaction, respectively. Our specificity data
showed that our primers/probes were specific for DENV and did not
amplify other flaviviruses’. Furthermore, our instrument comparison
test yielded similar results across five real-time PCR instruments. Taken
together, these results suggest that our TaqMan probe-based real-time
RT-PCR system for a DENV serotype detection is very sensitive, accu-
rate, and stable and can be confidently applied to a variety of real-time
PCR instruments.
This system will be useful for the detection of DENV serotypes in a
variety of conditions involving epidemiological studies, surveillance
system, and diagnostic efforts. Furthermore, our methodology was va-
lidated with five real-time PCR instruments. These results suggest that
M.-J. Mun et al.
this TaqMan probe-based real-time RT-PCR assay can be reliably used
to diagnose Dengue in a variety of situations.
Conflicts of interest
The authors declare no conflict of interests.
Acknowledgements
This research was supported by the Bio & Medical Technology
Development Program of the National Research Foundation (NRF)
funded by the Korean government (MSIT) (No. 2015M3A9B6073834).
References
[1] WHO, Dengue Guidelines for Diagnosis, Treatment, Prevention and Control: New
Edition, (2009), pp. 1–147 http://www.who.int/rpc/guidelines/9789241547871/
en/.
[2] S. Bhatt, P.W. Gething, O.J. Brady, J.P. Messina, A.W. Farlow, C.L. Moyes,
J.M. Drake, J.S. Brownstein, A.G. Hoen, O. Sankoh, M.F. Myers, D.B. George,
T. Jaenisch, G.R. Wint, C.P. Simmons, T.W. Scott, J.J. Farrar, S.I. Hay, The global
distribution and burden of dengue, Nature 496 (7446) (2013) 504–507.
[3] M.G. Guzman, S.B. Halstead, H. Artsob, P. Buchy, J. Farrar, D.J. Gubler,
E. Hunsperger, A. Kroeger, H.S. Margolis, E. Martinez, M.B. Nathan, J.L. Pelegrino,
C. Simmons, S. Yoksan, R.W. Peeling, Dengue: a continuing global threat, Nat. Rev.
Microbiol. 8 (12 Suppl) (2010) S7-16.
[4] C.F. Yung, K.S. Lee, T.L. Thein, L.K. Tan, V.C. Gan, J.G. Wong, D.C. Lye, L.C. Ng,
Y.S. Leo, Dengue serotype-specific differences in clinical manifestation, laboratory
parameters and risk of severe disease in adults, Singapore, Am. J. Trop. Med. Hyg.
91
Molecular and Cellular Probes 43 (2019) 86–91
92 (5) (2015) 999–1005.
[5] A. Balmaseda, S.N. Hammond, L. Perez, Y. Tellez, S.I. Saborio, J.C. Mercado,
R. Cuadra, J. Rocha, M.A. Perez, S. Silva, C. Rocha, E. Harris, Serotype-specific
differences in clinical manifestations of dengue, Am. J. Trop. Med. Hyg. 74 (3)
(2006) 449–456.
[6] C.R. Vicente, K.H. Herbinger, G. Froschl, C. Malta Romano, A. de Souza Areias
Cabidelle, C. Cerutti Junior, Serotype influences on dengue severity: a cross-sec-
tional study on 485 confirmed dengue cases in Vitoria, Brazil, BMC Infect. Dis. 16
(2016) 320.
[7] L.J. Chien, T.L. Liao, P.Y. Shu, J.H. Huang, D.J. Gubler, G.J. Chang, Development of
real-time reverse transcriptase PCR assays to detect and serotype dengue viruses, J.
Clin. Microbiol. 44 (4) (2006) 1295–1304.
[8] D. Cecilia, M. Kakade, K. Alagarasu, J. Patil, A. Salunke, D. Parashar, P.S. Shah,
Development of a multiplex real-time RT-PCR assay for simultaneous detection of
dengue and chikungunya viruses, Arch. Virol. 160 (1) (2015) 323–327.
[9] J.J. Waggoner, L. Gresh, A. Mohamed-Hadley, G. Ballesteros, M.J. Davila, Y. Tellez,
M.K. Sahoo, A. Balmaseda, E. Harris, B.A. Pinsky, Single-reaction multiplex reverse
transcription PCR for detection of Zika, chikungunya, and dengue viruses, Emerg.
Infect. Dis. 22 (7) (2016) 1295–1297.
[10] B.W. Johnson, B.J. Russell, R.S. Lanciotti, Serotype-specific detection of dengue
viruses in a fourplex real-time reverse transcriptase PCR assay, J. Clin. Microbiol. 43
(10) (2005) 4977–4983.
[11] Pan American Health Organization, Dengue: Guidelines for Patient Care in the
Region of the Americas, 2. Ed., (2016).
[12] E. Alm, G. Lindegren, K.I. Falk, N. Lagerqvist, One-step real-time RT-PCR assays for
serotyping dengue virus in clinical samples, BMC Infect. Dis. 15 (2015) 493.
[13] T.M. Conceicao, A.T. Da Poian, M.H. Sorgine, A real-time PCR procedure for de-
tection of dengue virus serotypes 1, 2, and 3, and their quantitation in clinical and
laboratory samples, J. Virol Methods 163 (1) (2010) 1–9.
[14] E. Reynisson, M.H. Josefsen, M. Krause, J. Hoorfar, Evaluation of probe chemistries
and platforms to improve the detection limit of real-time PCR, J. Microbiol.
Methods 66 (2) (2006) 206–216.