Biology

Quarter 3 Test 5 Duration: 45 min.

Grade: Chapter 11: Section 2 Date:

11 Chapter 12: Section 1, 2, 3 March 29, 2017

Name: 7 pages Mark:

_________________ _____/40

Standard & Benchmark: 11.2.02 11.2.03 11.2.05

Question Points
A (Multiple Choice) /16
B (Completion) /6

C (Short Answer) /18

Multiple Choice
Identify the choice that best Educating for Learning Today … Empowering Tomorrow completes the statement or
answers the question.(1 mark each)

1
____ 1. Which series is arranged in order from largest to smallest in size?
a. chromosome, nucleus, cell, DNA, nucleotide
b. cell, nucleus, chromosome, DNA, nucleotide
c. nucleotide, chromosome, cell, DNA, nucleus
d. cell, nucleotide, nucleus, DNA, chromosome

Figure 12-2

____ 2. In which part of the cell does this process shown in Figure 12-2 take place?
a. in the nucleus c. at the ribosomes
b. in food vacuoles d. on the chromosome

____ 3. Structure III in Figure 12-2 represents a(n) ____.

a. gene c. codon
b. amino acid d. DNA molecule

____ 4. The process illustrated in Figure 12-2 is called ____.

a. translation c. monoploidy
b. replication d. transcription

____ 5. Which of the structures in Figure 12-2 are composed of RNA?

a. II and IV c. I and V
b. III and IV d. III and V

Help Wanted
Positions Available in the genetics industry. Hundreds of entry-level
openings for tireless workers. No previous experience necessary. Must be
2
 able to transcribe code in a nuclear environment.
Accuracy and Speed vital for this job in the field of translation. Applicants
must demonstrate skills in transporting and positioning amino acids. Salary
commensurate with experience.
Executive Position available. Must be able to maintain genetic continuity
through replication and control cellular activity by regulation of enzyme
production. Limited number of openings. All benefits.
Supervisor of production of proteins—all shifts. Must be able to follow
exact directions from double-stranded template. Travel from nucleus to the
cytoplasm is additional job benefit.

Table 12-1

____ 6. Applicants for the first job of the Help Wanted ad in Table 12-1, could qualify if they were ____.
a. DNA polymerase c. ribosome
b. RNA polymerase d. nucleus

____ 7. Applicants for the third job of the Help Wanted ad in Table 12-1, "Executive Position," could qualify if they
were ____.
a. DNA c. tRNA
b. mRNA d. rRNA

____ 8. A particular sequence of parent DNA has four purine bases and two pyrimidine bases. According to base-
pairing rules, which of the following sequences could be formed during replication?
a. two cytosine, two adenine, two thymine
b. two cytosine, two adenine, two uracil
c. two adenine, two thymine, one guanine, one cytosine
d. two adenine, two guanine, two cytosine

____ 9. Which of the following sequences of processes correctly reflects the central dogma?
a. protein synthesis, transcription, translation
b. protein synthesis, translation, transcription
c. transcription, translation, protein synthesis
d. translation, transcription, protein synthesis

____ 10. You are a medical researcher trying to create a new antibiotic that will interfere with bacterial DNA
replication without harming the eukaryotic host. You have found several chemicals that prevent DNA from
unwinding and separating. Which of the following is the best chemical to use?
a. a chemical that blocks uracil use
b. a chemical that cannot pass into the cell nucleus
c. a chemical that is neutralized by cytoplasm
d. a chemical that works only in the presence of histones
____ 11. This is a template DNA sequence: 3'AATCGC5'. What would be the complementary DNA strand? Which
direction will it be synthesized?

3
 a. 5'UUAGCG3' to the left c. 5'TTAGCG3' to the right
b. 5'UAAGCG3' to the right d. 5'ATAGCG3' to the right

Table 12-2

____ 12. Three samples of DNA contain the percentages of nitrogenous bases listed in Table 12-2. According to
Chargaff’s law, which two samples probably belong to the same species?
a. 1 and 2
b. 1 and 3
c. 2 and 3
d. cannot tell without data on guanine and thymine

____ 13. You have a building toy set consisting of parts that can be connected together. You are going to use it to
model a piece of DNA. You have decided that each part of DNA will be represented by a different type of toy
piece. You have chosen the following four pieces so far: adenine = large red cube; guanine = large green
cube, thymine = small orange cube; cytosine = small blue cube. How many other types of pieces do you need
to represent the remaining parts both the 3-prime and the 5-prime strands of a section of DNA?
a. 0 c. 2
b. 1 d. 4

____ 14. If a female fruit fly heterozygous for red eyes (XRXr) crossed with a white-eyed male (XrY), what percent of
their offspring would have white eyes?
a. 0% c. 50%
b. 25% d. 75%

____ 15. When roan cattle are mated, 25% of the offspring are red, 50% are roan, and 25% are white. Upon
examination, it can be seen that the coat of a roan cow consists of both red and white hairs. This trait is one
controlled by ____.
a. codominant alleles c. sex-linked genes
b. incomplete dominance d. polygenic inheritance

____ 16. A cross between a white rooster and a black hen results in 100% blue Andalusian offspring. When two of
these blue offspring are mated, the probable phenotypic ratio seen in their offspring would be ____.
a. 100% blue c. 75% blue, 25% white
b. 75% black, 25% white d. 25% black, 50% blue, 25% white

Completion
Complete each statement. (0.5 mark each)

4
 Figure 11-7

1. The gender of the human in the karyotype shown in Figure 11-7 is ______________ and has a total of
____________________ autosomes.

2. The lagging strand is synthesized _______________ during replication.

3. DNA wrapped around a histone protein is one component of a(n) __________________ organism.

4. Similar enzymes interact with the leading and lagging strands in DNA replication. Enzymes involved with the
RNA primer are more active on the lagging strand, as is the enzyme ____________________.

5. During DNA replication, single-stranded binding proteins associate with DNA after the
____________________ enzyme has acted on the DNA.

6. Thymine is a type of _______________ base that has __________ ring(s) and forms _________ bonds.

7. A parent with straight hair marries a person with curly hair and their child has wavy hair. This is a(n) example
of _____________________.

8. If a section of DNA has 12 bases in which 4 of them are Adenines, there would be _______ Cytosines.

9. Hershey and Chase used __________________ to label the DNA.

Short Answer

1. (3 marks) Identify the three types of RNA and state their function.

2. (6 marks) Refer to the following genetic code to answer the following questions.

5
 Figure 12-4

a) Use the genetic code (Figure 12-4) to write the sequence of amino acids this mRNA would build.

CUGACGAUGCUCAACGGCAUAUAACGCGAG

b) What is the name of the bond that joins these amino acids together?

c) How was this mRNA processed from the nucleus to the ribosomes?

d) What is the difference between a codon and an anticodon?

e) What protein synthesized (made) the mRNA from DNA?

3. Two couples, the Pages and the Bakers, had baby boys in the same hospital at the same time. There
(2 marks)
was a mix-up in the hospital nursery. Use the information given in the table below. Which baby belongs to
which family? Explain your answer.

6
 4. Color blindness is a recessive sex linked trait. If a color blind male gets married to a heterozygous
(3 marks)
female, what is the probability that their daughters would be color blind? Show your work.

5. (4 marks) Answer the following questions on the figure below.

5’ a) Use the letter P to label all of the

phosphate groups.
b) Use an S to label all the sugar
molecules.
c) Add the missing bases.
d) Circle and label a codon.
e) Circle and label a nucleotide.
f) Label the orientation of the
strands.
g) How did Franklin contribute to
discovering the structure of this
molecule?

Fasrgah

Answer Section
7
MULTIPLE CHOICE

1. ANS: B
Nucleotides are the subunits of nucleic acids like DNA. DNA coils around histone proteins to form
chromosomes, which are contained in the nucleus of a cell.

Feedback
A Chromosomes are in the nucleus.
B That's correct!
C Check page 329.
D What is a chromosome made of?

PTS: 1 DIF: Bloom's Level B | DOK 2-MOD REF: 329 | 332

NAT: LS_1c TOP: 12-3
2. ANS: C
The process of translation takes place at the ribosomes.

Feedback
A This process happens after messenger RNA leaves the nucleus.
B Where does messenger RNA go when it leaves the nucleus?
C That's correct!
D Chromosomes are made up of DNA and proteins.

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 338

NAT: LS_1c TOP: 12-6
3. ANS: B
A tRNA molecule carries a specific amino acid corresponding to the anticodon of that tRNA molecule.

Feedback
A What is the definition of a gene?
B That's correct!
C You're on the right track, but the anticodon is located somewhere else on this molecule.
D DNA does not have uracil as one of its bases.

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 338

NAT: LS_1c TOP: 12-6
4. ANS: A
Translation is the process by which the mRNA “template” is used to form polypeptides.

Feedback
A That's correct!
B Page 334 shows replication.
C Check the definition of monoploidy.
D Is any DNA involved in the pictured process?

PTS: 1 DIF: Bloom's Level B | DOK 3-MOD REF: 338

NAT: LS_1c TOP: 12-6
5. ANS: A

8
 The mRNA “template” and the tRNA molecule are the only RNA structures. I is an anticodon composed of
nucleotide bases, III is a polypeptide, and V is an amino acid.

Feedback
A That's correct!
B Only one of these is made of RNA.
C What is an anticodon?
D These are related to each other, but they are not made of RNA.

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 336 | 338

NAT: LS_1c TOP: 12-6
6. ANS: B
mRNA is formed from the template strand of DNA, and it carries the “code” from the nucleus to the
ribosomes.

Feedback
A Does DNA leave the nucleus?
B That's correct!
C tRNA carries amino acids.
D Look at page 336.

PTS: 1 DIF: Bloom's Level B | DOK 3-MOD REF: 336

NAT: LS_1c TOP: 12-6
7. ANS: A
DNA is the genetic material that replicates and is passed along when a cell divides. DNA controls the
production of enzymes and other proteins.

Feedback
A That's correct!
B Does mRNA replicate?
C tRNA carries amino acids.
D Check page 333 for clues.

PTS: 1 DIF: Bloom's Level D | DOK 3-MOD REF: 326–333

NAT: LS_1c TOP: 12-1
8. ANS: A
According to base-pairing rules, the number of purine bases formed must match the number of pyrimidine
bases in the parent sequence.

Feedback
A That's correct!
B Does uracil occur in DNA?
C Count the number of purine bases.
D Review base pairing rules on page 329.

PTS: 1 DIF: Bloom's Level E | DOK 3-MOD REF: 329–330 | 333

NAT: LS_2a TOP: 12-2
9. ANS: C
The central dogma states that DNA is transcribed to mRNA, which is translated to a sequence of amino acids
that form a polypeptide.
9
 Feedback
A The central dogma starts with DNA.
B Check page 336.
C That's correct!
D What is the difference between transcription and translation?

PTS: 1 DIF: Bloom's Level B | DOK 3-MOD REF: 336–339

NAT: LS_1c TOP: 12-8
10. ANS: B
The only chemical that will prevent bacterial replication without interfering with eukaryotic replication is one
that cannot enter the eukaryotic nucleus.

Feedback
A Does DNA contain uracil?
B That's correct!
C Both bacteria and eukaryotic cells have cytoplasm.
D Bacterial chromosomes don't have histones.

PTS: 1 DIF: Bloom's Level E | DOK 4-HIGH REF: 335

NAT: IS_1e TOP: 12-3
11. ANS: D
The mRNA strand is being transcribed from the DNA in a right-to-left order. The corresponding base pair to
adenine is uracil in RNA.

Feedback
A Is the mRNA being formed from left-to-right or from right-to-left?
B Review base pairing on page 329.
C You're on the right track.
D That's correct!

PTS: 1 DIF: Bloom's Level D | DOK 3-MOD REF: 337

NAT: LS_1c | LS_2a TOP: 12-7
12. ANS: B
Though the numbers do not match exactly, 1 and 3 have similar percentages of adenine and cytosine.

Feedback
A Keep trying.
B That's correct!
C Which bases pair up in DNA?
D Check page 329 for Chargaff's law.

PTS: 1 DIF: Bloom's Level D | DOK 3-MOD REF: 329

NAT: LS_2a TOP: 12-2
13. ANS: C
The only pieces still needed represent a sugar and a phosphate—the order of those pieces determines the
direction of the strand.

Feedback
A A nucleotide is made of one phosphate, one sugar, and one base.
10
 B A sugar and a phosphate group are two different molecules.
C That's correct!
D What is the difference between the 3-prime strand and the 5-prime strand?

PTS: 1 DIF: Bloom's Level D | DOK 4-HIGH REF: 331

NAT: LS_2a TOP: 12-2
14. ANS: C

Feedback
A Please consider all the factors.
B You are on the right track.
C You are correct.
D Please refer to pages 296-300.

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 296–300

NAT: LS_2b TOP: 11-1
15. ANS: B

Feedback
A You are on the right track.
B You are right!
C Please consider again the inheritance pattern.
D You are heading in the right direction.

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 299–300

NAT: LS_2b TOP: 11-4
16. ANS: D

Feedback
A Please consider again the results of mating two from the second generation.
B You are on the right track.
C Please refer to pages 302-303.
D You are correct.

PTS: 1 DIF: Bloom's Level D | DOK 3-MOD REF: 302–303

NAT: LS_2b TOP: 11-4

COMPLETION

1. ANS: trisomy 21

PTS: 1 DIF: Bloom's Level D | DOK 2-MOD REF: 311

NAT: LS_2c TOP: 11-7
2. ANS: 45

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 311

NAT: LS_2c TOP: 11-7
3. ANS: eukaryotic

11
 PTS: 1 DIF: Bloom's Level B | DOK 2-MOD REF: 332
NAT: LS_2a TOP: 12-3
4. ANS:
DNA ligase
Ligase has more sugar-phosphate backbone gaps to seal on the lagging strand.

PTS: 1 DIF: Bloom's Level D | DOK 3-MOD REF: 333–334

NAT: LS_2a TOP: 12-4
5. ANS:
helicase
Bnding proteins keep the DNA separate after they have been unwound and unzipped.

PTS: 1 DIF: Bloom's Level C | DOK 2-MOD REF: 333

NAT: LS_2a TOP: 12-4

SHORT ANSWER

1. ANS:
First, DNA helicase unwinds and separates the double-stranded DNA molecule like a zipper unzipping. The
weak hydrogen bonds between the complementary nucleotides break and the two DNA strands separate.
Then free nucleotides attach to the exposed nucleotides of the DNA strands, catalyzed by DNA polymerase.
From one DNA molecule there are now two DNA molecules. Each one of the DNA molecules has a strand
from the original DNA and one new strand.

PTS: 1 DIF: Bloom's Level B | DOK 3-MOD REF: 333–335

NAT: LS_2a TOP: 12-4
2. ANS:
A codon is a three-base code for a specific amino acid. An anticodon is a tRNA triplet of nitrogen bases that
bonds to a complementary codon on the messenger RNA.

PTS: 1 DIF: Bloom's Level B | DOK 2-MOD REF: 338

NAT: LS_1c TOP: 12-6
3. ANS:
CUG ACG AUG CUC AAC GGC AUA UAA CGC GAG
Met Leu Asn Gly Ile STOP

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 328

NAT: LS_1c TOP: 12-8
4. ANS:
Baby #2 must belong to the Bakers because only Baby #1 can belong to the Pages.

PTS: 1 DIF: Bloom's Level E | DOK 1-LOW REF: 299–300

NAT: LS_2b TOP: 11-3
5. ANS:
Either Baby #1 or Baby #2 could be theirs. If Mrs. Baker is /Bi and Mr. Baker is /Ai or /A/A, then their baby
could be /Ai, making it Baby #1. If Mrs. Baker is /Bi and Mr. Baker is /Ai, then their baby could be ii, making
it Baby #2.

PTS: 1 DIF: Bloom's Level F | DOK 2-MOD REF: 304

NAT: LS_2b TOP: 11-4

12
PROBLEM

1. ANS:
See Solution 12-6.

PTS: 1 DIF: Bloom's Level C | DOK 3-MOD REF: 329–330 | 338

NAT: LS_1c | LS_2a TOP: 12-2

13