American Society of Hematology

Self-Assessment Program Adam Cuker

Visit to download the full and correct content document:
https://textbookfull.com/product/american-society-of-hematology-self-assessment-pro
gram-adam-cuker/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...

SESAP 17 Surgical Education and Self Assessment Program

17th Edition American College Of Surgeons

https://textbookfull.com/product/sesap-17-surgical-education-and-
self-assessment-program-17th-edition-american-college-of-
surgeons/

Self Assessment Review of Microbiology Immunology 12th

Edition

https://textbookfull.com/product/self-assessment-review-of-
microbiology-immunology-12th-edition/

The Sociology of the Individual Relating Self and

Society Relating Self and Society 1st Edition Athanasia
Chalari

https://textbookfull.com/product/the-sociology-of-the-individual-
relating-self-and-society-relating-self-and-society-1st-edition-
athanasia-chalari/

Live Intentionally 90 Day Self Improvement Program

Harsh Strongsman

https://textbookfull.com/product/live-intentionally-90-day-self-
improvement-program-harsh-strongsman/
Self esteem a proven program of cognitive techniques
for assessing improving maintaining your self esteem
Fourth Edition Fanning

https://textbookfull.com/product/self-esteem-a-proven-program-of-
cognitive-techniques-for-assessing-improving-maintaining-your-
self-esteem-fourth-edition-fanning/

Neurosurgery Self-Assessment Questions and Answers

Rahul Shah

https://textbookfull.com/product/neurosurgery-self-assessment-
questions-and-answers-rahul-shah/

Self Esteem A Proven Program of Cognitive Techniques

for Assessing Improving and Maintaining Your Self
Esteem 4th Edition Matthew Mckay

https://textbookfull.com/product/self-esteem-a-proven-program-of-
cognitive-techniques-for-assessing-improving-and-maintaining-
your-self-esteem-4th-edition-matthew-mckay/

Surgery PreTest Self-Assessment and Review, 14E Lillian

Kao

https://textbookfull.com/product/surgery-pretest-self-assessment-
and-review-14e-lillian-kao/

The Retina A Guide to Self Assessment Melvin J Gouder

https://textbookfull.com/product/the-retina-a-guide-to-self-
assessment-melvin-j-gouder/
 Table of Contents

Chapter Page
1 Molecular basis of hematology 1

2 Consultative hematology I : hospital- based and selected outpatient topics 26

3 Consultative hematology II : women’s health issues 61

4 Hematopoietic growth factors 96

5 Iron physiology, iron overload, and the porphyrias 115

6 Acquired underproduction anemias 138

7 Thalassemia, sickle cell disease, and other hemoglobinopathies 161

8 Hemolytic anemias excluding hemoglobinopathies 186

9 Thrombosis and thrombophilia 217

10 Bleeding disorders 260

11 Disorders of platelet number and function 291

12 Laboratory hematology 321

13 Transfusion medicine 350

14 Cellular basis of hematopoiesis and stem cell transplantation 386

15 Clinical hematopoietic cell transplantation and adoptive cell therapy 408

16 Inherited marrow failure syndromes and myeloid disorders 454

17 Chronic myeloid leukemia 486

18 Myeloproliferative neoplasms 510

19 Acquired marrow failure syndromes: aplastic anemia, PNH, and MDS 546

20 Acute myeloid leukemia 580

21 Acute lymphoblastic leukemia and lymphoblastic lymphoma 593

22 Hodgkin lymphoma 621

23 Non- Hodgkin lymphoma 651

24 Chronic lymphocytic leukemia/small lymphocytic lymphoma 700

 1
Basic concepts 1
Analytic techniques 9
Clinical applications of DNA
technology in hematology 18
Glossary 22
Bibliography 25
The online version of this
chapter contains an educational
multimedia component on normal
hematopoiesis.
Conflict-of-interest disclosure:
Dr. Gruber declares no competing
financial interest. Dr. Abdel-Wahab
declares no competing financial interest.
Off-label drug use: Dr. Gruber:
not applicable. Dr. Abdel-Wahab:
not applicable.
Molecular basis of hematology
TANJA A. GRUBER AND OMAR ABDEL-WAHAB
Basic concepts
Advances in recombinant DNA technology over the past several decades have
substantially altered our view of biologic processes and have immediate rele-
vance to our understanding of both normal hematopoietic cell function and
hematologic pathology. A complete review of molecular genetics is beyond the
scope of this chapter, but it is intended as a review of the concepts of the mo-
lecular biology of the gene, an introduction to epigenetics and genomics, an
outline of noncoding RNAs, concepts relevant for immunotherapeutic treat-
ment approaches, and an explanation of the terminology necessary for under-
standing the role of molecular biology in breakthrough discoveries. Emerging
diagnostic and therapeutic approaches in hematology are reviewed. The con-
cepts outlined in the following sections also are illustrated in Figure 1-1; in ad-
dition, boldface terms in the text are summarized in the glossary at the end of
this chapter. Several examples of how these concepts and techniques are applied
in clinical practice are included.
Anatomy of the gene
Structure of DNA
DNA is a complex, double-stranded molecule composed of nucleotides. Each
nucleotide consists of a purine (adenine or guanine) or pyrimidine (thymine
or cytosine) base attached to a deoxyribose sugar residue. Each strand of DNA
is a succession of nucleotides linked through phosphodiester bonds between
the 5′ position of the deoxyribose of one nucleotide and the 3′ position of the
sugar moiety of the adjacent nucleotide. The two strands are connected through
hydrogen bonds between strict pairs of purines and pyrimidines; that is, adenine
must be paired with thymine (A-T) and guanine must be paired with cytosine
(G-C). This is known as Watson-Crick base pairing. Consequently, the two
strands of DNA are said to be complementary, in that the sequence of one
strand determines the sequence of the other through the demands of strict base
pairing. The two strands are joined in an antiparallel manner so that the 5′ end
of one strand is joined with the 3′ end of the complementary strand. The strand
containing the codons for amino acid sequences is designated as the sense strand,
whereas the opposite strand that is transcribed into messenger RNA (mRNA) is
referred to as the antisense strand.
1
2 1. Molecular basis of hematology

Nucleus

Coding Noncoding
sequence (intervening 3’ coding
5’ (exon) sequence, intron) strand
DNA
3’ 5’ noncoding
Transcription
strand
mRNA 5’ Exon Intron
3’
precursor
5’ CAP 3’ Poly (A),
modification and
Processing shortening of
transcript

Processed 5’ CAP Poly (A)-3’

mRNA
transcript
Nuclear “pore” 5’ CAP Poly (A)-3’ Cytoplasm
mRNA
Transport to
cytoplasm

Initiation factors,
Translation tRNA, ribosomes

5’ CAP Poly (A)-3’

Completed apoprotein

Cofactors and other subunits

Microsomes, Golgi, etc.

Completed functioning protein

Figure 1-1 Flow of ge­ne­tic information from DNA to RNA to protein. DNA is shown as a double-­stranded array of
alternating exons (red) and introns (pink). Transcription, posttranscriptional pro­cessing by splicing, polyadenylation, and capping are
described in the text. The mature transcript passes from the nucleus to the cytoplasm, where it is translated and further modified to
form a mature protein. Reproduced with permission from Hoffman R et al, eds., Hematology: Basic Princi­ples and Practice, 6th ed.
(Philadelphia, PA: Saunders Elsevier, Inc; 2013:5).

trol the timing and the level of its expression, is termed a

Structure of the gene
DNA dictates the biologic functions of the organism by
the flow of ge­ne­tic information from DNA to RNA to
protein. The functional ge­ne­tic unit responsible for the pro-
duction of a given protein, including the ele­ments that con-
gene. The gene contains several critical components that
determine both the amino acid structure of the protein it
encodes and the mechanisms by which the production of
that protein may be controlled. The coding sequence,
which dictates protein sequence, is contained within
Basic concepts
­exons; ­these stretches of DNA may be interrupted by in-
tervening noncoding sequences, or introns. In addition,
t­ here are flanking sequences in the 5′ and 3′ ends of the
coding sequences that often contain impor­tant regulatory
ele­ments that control the expression of the gene.
Genes are arrayed in a linear fashion along chromo-
somes, which are long DNA structures complexed with
protein. Within chromosomes, DNA is bound in chro-
matin, a complex of DNA with histone and non-­histone
proteins that “shield” the DNA from the proteins that
activate gene expression. The ends of chromosomes are
capped by complexes of repetitive DNA sequences and as-
sociated proteins known as telomeres. The DNA replica-
tion machinery cannot effectively replicate the very ends
of chromosomes, and thus shortening occurs with each
cell division, ultimately leading to chromosomal instabil-
ity and cellular senescence. Telomeres are therefore criti-
cal to protecting chromosome ends from degradation and
fusion, and mutations in genes encoding components of
the telomere complex are associated with the bone mar-
row failure syndrome dyskeratosis congenita. Furthermore,
inappropriate activation of the enzymes that maintain telo-
meres (“telomerase”) is associated with numerous cancers,
including hematologic malignancies.
Flow of ge­ne­tic information
Transcription
RNAs are mostly single-­ stranded molecules that differ
from DNA in two ways: by a sugar backbone composed
of ribose rather than deoxyribose, and by containing the
pyrimidine uracil rather than thymine. The first step in
the expression of protein from a gene is the synthesis of
a pre-­messenger RNA (pre-­mRNA). The transcrip-
tion of pre-­mRNA is directed by RNA polymerase II,
which in conjunction with other proteins generates an
RNA copy of the DNA sense strand. The introns are then
removed by a complex pro­cess called mRNA splicing.
This pro­cess involves the recognition of specific sequences
on ­either side of the intron which allow its excision in
a precise manner that maintains the exon sequence. The
mRNA may then undergo modifications at the 5′ and
3′ ends (capping and polyadenylation, respectively).
­A lthough RNA splicing is largely restricted to the nucleus,
it also can occur in the cytoplasm of platelets and neutro-
phils activated by external stimuli.
Splicing of mRNA is a critical step in gene expression,
with impor­tant implications for understanding hemato-
logic disease. Splicing is controlled by the spliceosome,
a large complex of proteins (100 to 300) and five small
3
nuclear ribonuclear proteins (snRNPs). mRNA splicing
is an impor­tant mechanism for generating diversity in the
proteins produced by a single gene. Some genes exhibit
alternative splicing, a pro­cess by which certain exons
are included in or excluded from the mature mRNA, de-
pending on which splice sequences are used in the ex-
cision pro­cess. For example, this is the means by which
some erythroid-­specific proteins of heme synthesis (ami-
nolevulinic acid synthase) and energy metabolism (pyru-
vate kinase) are generated, contrasting with the alterna-
tively pro­cessed genes in the liver and other tissues. This
permits functional diversity of the products of the same
gene and is one of several determinants of tissue speci-
ficity of cellular proteins. Mutations in the sequences of
­either introns or exons can derange the splicing pro­cess by
­either creating or destroying a splice site so that the intron
sequence is not removed or the exon sequence eliminated.
If abnormal splicing results in a premature stop codon
(nonsense mutation), then a surveillance pathway known
as nonsense-­mediated decay may result in degrada-
tion of the abnormal mRNA. This mechanism generally
applies to stop codon mutations in the first one-­third to
one-­half of the mRNA and works to prevent synthesis of
mutant peptides. When mutations occur in the last one-­
third of the mRNA molecule, abnormal peptides may be
produced.
Mutations affecting the spliceosome machinery are
found in a variety of hematopoietic malignancies. For
example, splicing ­factor mutations (SF3B1, U2AF1, and
SRSF2) are found in approximately 10% of patients with
chronic lymphocytic leukemia and 50% of patients with
myelodysplastic syndrome (MDS), as well as related myeloid
malignancies. ­These mutations have now been shown to
alter splicing in a manner distinct from loss-­of-­function, but
the connection between ­these changes in splicing and clonal
hematopoietic disorders is not yet well understood.
Translation
The mature mRNA is transported from the nucleus to the
cytoplasm, where it undergoes translation into protein.
The mRNA is “read” in a linear fashion by ribosomes,
which are structures composed of ribonucleoprotein that
move along the mRNA and insert the appropriate amino
acids, carried by transfer RNAs (tRNAs), into the na-
scent protein. The amino acids are encoded by three base
triplets called codons, the ge­ne­tic code. The four bases
can encode 64 pos­si­ble codons; b­ ecause ­there are only 20
amino acids used in protein sequences, more than one
codon may encode the same amino acid. For this reason,
the ge­ne­tic code has been termed degenerate. An amino
4 1. Molecular basis of hematology
acid may be encoded by more than one codon; however,
any single codon encodes only one amino acid. The be-
ginning of the coding sequence in mRNA is encoded by
AUG codon that has variable translation initiation activ-
ity determined by the neighboring nucleotide sequences
(Kozak sequence). In addition, ­there are three termina-
tion codons (UAA, UAG, and UGA) that signal the end
of the protein sequence.
Single-­base-­pair alterations in the coding sequence of
genes (point mutations) may have a range of effects on the
resultant protein. ­Because the ge­ne­tic code is degenerate,
some single-­base-­pair changes may not alter the amino acid
sequence, or they may change the amino acid sequence in
a manner that has no effect on the overall function of the
protein; ­these are predicted to be phenotypically ­silent mu-
tations. In other cases, mutations may lead to a loss or gain
of protein function, or may result in the acquisition of a
new function (missense mutation). Sickle cell disease
is an example of a single base-­pair change, resulting in an
amino acid alteration that critically changes the chemi-
cal characteristics of the globin molecule. Other mutations
may change a codon to a termination codon, resulting in
premature termination of the protein (nonsense muta-
tion). Fi­nally, single or multiple base-­pair insertions or dele-
tions can disrupt the reading frame of genes. ­These frame-
shift mutations render the gene incapable of encoding
normal protein. ­These latter two abnormalities account for
some β-­thalassemias and for polycythemia due to a gain of
function in the erythropoietin receptor. Clinically impor­
tant mutations also may occur in the noncoding region of
genes, such as in the regulatory ele­ments upstream of the
initiation codon or within intronic splicing sites.
Control of gene expression
With the exception of lymphocytes (which undergo
unique changes in the DNA encoding immunoglobulin or
the T-­cell receptor) and germ cells (which contain only half
of the DNA of somatic cells), each nucleated cell in an in-
dividual has the same diploid DNA content. Consequently,
biologic pro­cesses are critically dependent on gene regu-
lation, the control of gene expression such that proteins
are produced only at the appropriate time within the ap-
propriate cells. Gene regulation is the result of a complex
interplay of specific sequences within a gene locus, chro-
matin, and regulatory proteins (transcription f­actors) that
interact with ­those sequences to increase or decrease the
transcription from that gene.
DNA sequences that lie in proximity to and regulate
the expression of genes, which encode protein, are termed
cis-­acting regulatory ele­ments. Nearly all genes have
a site for binding RNA polymerase II that is within the
first 50 bases 5′ to the structural gene and is called the
promoter region. Other sequences that regulate the level
of transcription of the gene are located at less predict-
able distances from the structural gene. Such sequences
may increase (enhancers) or decrease (silencers) expres-
sion. A special type of enhancer is the locus control re-
gion, which was first defined in the β-­globin cluster of
genes on chromosome 11. It is located approximately 50
kilobases (kb) upstream from the β-­globin gene, controls
all genes within the β-­globin locus, and also has a strong
tissue-­specific activity (erythroid-­specific).
Control of gene expression is exerted through the in-
teraction of the cis-­acting ele­ments described previously
with proteins that bind to t­hose sequences. T ­ hese nuclear
DNA binding proteins are termed trans-­acting ­factors
or transcription f­ actors. Most of ­these proteins have a
DNA-­binding domain that can bind directly to regulatory
sequences within the gene locus; many of them contain
common motifs, such as zinc fin­gers or leucine zip-
pers, which are shared by many transcription f­actors. In
addition, they frequently have unique domains that allow
them to interact with other transcription f­actors. Thus, a
complex pattern exists whereby the expression of dif­fer­ent
transcription ­factors, which may interact both with one
another and with specific regions of DNA to increase or
decrease transcription, determines the unique tissue and
stage-­specific expression of the genes within a given cell.
Epigenet­ics
For a gene to be expressed, chromatin must be unwound
and the DNA made more accessible to regulatory proteins.
This is controlled by epige­ne­tic pro­cesses or modifications
to the genome that regulate gene expression without al-
tering the under­lying nucleotide sequence. ­These changes
may be modulated by environmental f­actors and may be
heritable. Epige­ne­tic modulation of gene expression was
first recognized in studies of glucose-6-­phosphate dehydro-
genase (G6PD), a protein encoded by an X-­linked gene.
Ernest Beutler deduced the princi­ple of random embry-
onic X chromosome inactivation from studies of G6PD
deficiency. His observations and the studies of Mary Lyon
and Susumu Ohno on the mechanism of dosage compen-
sation in mammals led to an understanding of X chromo-
some inactivation in females. This was the first example
of stochastic epige­ne­tic silencing in h
­ umans, demonstrat-
ing that ­human females are mosaics of the activity of X
chromosome–­encoded genes. Using this princi­ple in tu-
mor tissue derived from females led to early demonstrations
that neoplastic diseases are, for the most part, clonal. Two
common forms of epige­ne­tic changes are DNA methyla-
tion and histone modifications.
 Basic concepts 5

active copies of the Prader-­Willi–­associated genes and re-

DNA methylation sult in Prader-­Willi syndrome.
In addition to being complexed with protein, DNA is As DNA methylation modulates gene activity, acquired
modified by the addition of methyl groups to cytosine changes in methylation patterns are thought to contribute
residues (resulting in 5-­ methylcytosine) through en- to functional alterations in hematopoietic stem cells dur-
zymes called DNA methyltransferases. Methylation nor- ing aging. Hematopoietic stem cells display an age-­related
mally occurs throughout the genome and is associated decline in function and a relative loss of lymphoid differ-
with alterations in gene expression and pro­cesses such as entiation potential, and ­these changes are associated with
X-­chromosome inactivation, imprinting, aging, and car- site-­specific changes in DNA methylation. Furthermore,
cinogenesis. It is generally a marker of an inactive gene, aberrant methylation may contribute to cancer. For ex-
and changes in gene expression often can be correlated ample, mutations in enzymes affecting DNA methylation,
with characteristic changes in the degree of methyla- most notably the DNA methyltransferase DNMT3A, are
tion of the 5′ regulatory sequences of the gene. DNA common in acute myeloid leukemia (AML). Mutations
methylation can silence genes through two mechanisms. in DNMT3A are found in approximately 20% of adult
In the first, the methylation mark itself can impair bind- AML patients and are associated with poor outcomes. ­These
ing of transcription ­factors to the gene. Second, methylated mutations appear to be acquired early in the evolution of
DNA can be bound by proteins known as methyl-­CpG-­ the disease, thus likely serving as initiators of the disease.
binding domain proteins that recruit additional chroma- Other enzymes affecting DNA methylation, including
tin remodeling proteins to the locus, which then modify TET2 and IDH1/2, are also recurrently mutated in AML,
histones leading to the formation of compact, inactive further illustrating the role of aberrant methylation in the
chromatin termed h ­ eterochromatin. In contrast to 5′ regu- pathogenesis of this disease. Of note, oxidation of methyl-
latory sequences where methylation is typically associated ated cytosines (5-­methylcytosine) by members of the ten-­
with gene silencing, methylation of intragenic cytosine resi- eleven translocation (TET) protein ­family results in the
dues often coincides with active transcription of the gene formation of 5-­hydroxymethylcytosine, 5-­formylcytosine,
within which they lie. The function and mechanism of and 5-­carboxylcytosine. While the role of ­these epige­ne­
gene body methylation are not well understood. tic marks is not clearly understood, their levels are often
Mendelian ge­ne­tics is based on the princi­ple that the altered in cancers (including AML), suggesting that they
phenotype is the same w ­ hether an allele is inherited from may contribute to the pathogenesis of disease. Given the
the ­mother or the ­father, but this does not always hold prominent role of abnormal methylation in hematologic
true. Some ­human genes are transcriptionally active on malignancies, small molecule inhibitors of DNA meth-
only one copy of a chromosome (such as the copy inher- yltransferases (eg, 5-­azacitidine, decitabine) are used in the
ited from the f­ ather), whereas the other copy on the chro- treatment of disorders that are characterized by aberrant
mosome inherited from the m ­ other is transcriptionally DNA methylation (eg, MDS, AML).
inactive. This mechanism of gene silencing is known as
imprinting, and ­these transcriptionally silenced genes are Histone modification
said to be “imprinted.” When genes are imprinted, they Histones are DNA packaging proteins that or­ga­nize DNA
are usually heavi­ly methylated in contrast to the nonim- into structural units called nucleosomes. Octamers of the
printed copy of the allele, which typically is not methyl- core histones—­H2A, H2B, H3, and H4—­make up the
ated. A classic example of imprinting is the inheritance of nucleosome around which 147 bp of DNA is wrapped,
Prader-­Willi and Angelman syndromes, which are associ- and histone H1 binds the “linker” DNA between nucleo-
ated with a 4-­megabase (Mb) deletion of chromosome 15. somes. Histones are subject to multiple modifications—­
This region contains the gene associated with Angelman including methylation, acetylation, ubiquitination, phos-
syndrome, UBE3A, which encodes a ligase essential for phorylation, and o ­ thers. The par­tic­u­lar combination of
ubiquitin-­mediated protein degradation during brain de- histone modifications at any given locus is thought to
velopment. This gene is imprinted on the paternal allele. confer a “histone code,” regulating pro­cesses such as gene
In addition, the region contains multiple genes associated expression, chromosome condensation, and DNA repair.
with Prader-­Willi syndrome, which are imprinted on the Like methylation, histone modifications regulate gene ac-
maternal allele. Thus, maternal inheritance of a mutation tivity, and therefore disruptions of the normal pattern of
or deletion in UBE3A removes the single active copy of ­these modifications can contribute to cancer and other
the gene and results in Angelman syndrome, and paternal diseases. For example, hypoacetylation of histones H3 and
inheritance of deletions in this region remove the only H4 is associated with silencing of the cell cycle regulator

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 6 1. Molecular basis of hematology

p21WAF1, a gene whose expression is reduced in multiple

Nucleus Cleavage
tumor types. Aberrant expression levels of histone deacet-
ylases, the enzymes that remove acetyl groups from his- “Cropping”
AAAAA
tone tails, are common in hematopoietic malignancies, and
histone deacetylase inhibitors are being tested in a variety
of t­hese diseases. The first of ­these inhibitors, vorinostat, Cytosol
is used in the treatment of cutaneous T-­cell lymphoma. In Cleavage
addition to altered expression levels of histone-­modifying
“Dicing”
enzymes, several fusion genes associated with hematologic
malignancies aberrantly recruit histone modifiers to target
Argonaute and
genes, resulting in altered transcription (eg, the association other proteins RISC
of MLL fusion proteins with the DOT1L enzyme that 3’ 5’

methylates histones and the histone acetyltransferase p300 Extensive match Less extensive match
with AML1-­ETO). Targeting histone modifiers therapeu-
tically, therefore, has potential utility for a variety of cancers. mRNA
AAAAA
mRNA
AAAAA

“Splicing”
Noncoding RNAs
It has been estimated that only approximately 1% to 2% AAAAA

of the genome encodes protein, but a much larger fraction ATP

is transcribed. This transcribed RNA that does not en-
code protein is referred to as noncoding RNA (ncRNA)
and is grouped into an increasingly large number of dif­fer­
ent classes, including microRNAs, small nucleolar RNAs
(snoRNAs), small interfering RNAs (siRNAs), Piwi-­
interacting RNAs (piRNAs), long noncoding RNAs
(lncRNAs), and many o ­ thers. Although each of t­hese
classes of ncRNAs differs in size, biogenesis pathway, and
specific function, they share a common ability to recognize
target nucleotide sequences through complementarity and
regulate gene expression. The most well-­described class of
ncRNAs are microRNAs (miRs), whose biogenesis path-
way is illustrated in Figure 1-2. Following transcription, a
portion of this RNA (the pri-­microRNA) forms hairpin
loops that are cleaved by the enzymes Drosha and Dicer
into short 21-­to 23-bp double-­stranded RNAs. T ­ hese
short double-­stranded RNAs contain both sense strands
and antisense strands that correspond to coding sequences
in mRNAs. ­These mature miRs then are incorporated
into a larger complex known as an RNA-­induced si-
lencing complex (RISC). The miR is then unwound
in a strand-­specific manner, and the single-­stranded RNA
locates mRNA targets by Watson-­Crick base pairing. Gene
silencing results from cleavage of the target mRNA (if
­there is complementarity at the scissile site) or transla-
tional inhibition (if ­there is a mismatch at the scissile site).
This gene-­silencing pathway is known as RNA interfer-
ence. As mediators of gene expression, miRs and other
ncRNAs are expressed in a tissue-­specific manner and play
impor­tant regulatory roles in development and differentia-
tion. Accordingly, dysregulation or mutations in ncRNAs
are associated with vari­ous diseases, including cancer. In
ADP RISC released
AAAAA Translation reduced
Transfer of mRNA into
P-bodies and eventual
Rapid mRNA degradation degradation
Figure 1-2 MicroRNA production. Production of microRNA
begins with transcription of the microRNA gene to produce a
stem-­loop structure called a pri-­microRNA. This molecule is
pro­cessed by Drosha (“cropping”) to produce the shorter pre-­
microRNA. The pre-­microRNA is exported from the nucleus; the
cytoplasmic Dicer enzyme cleaves the pre-­microRNA (“dicing”)
to produce a double-­stranded mature microRNA. The mature
microRNA is transferred to RISC (RNA-­induced silencing
complex), where it is unwound by a helicase. Complementary
base pairing between the microRNA and its target mRNA directs
RISC to destroy the mRNA (if completely complementary) or
halt translation (if a mismatch exists at the scissile site). Reproduced
with permission from Alberts B et al, Molecular Biology of the
Cell, 5th ed. (New York, NY: Garland Science; 2007).
hematopoiesis, numerous miRs that influence cell fate de-
cisions have been identified. miR-223, for example, plays
a central role in myeloid differentiation, and reduced ex-
pression of miR-223 is common in AML. Conversely, the
expression of miR-125b, which is expressed in normal
hematopoietic stem cells and whose targets include genes
involved in regulating cell proliferation, differentiation,
and survival, is increased in a variety of myeloid and lym-
phoid malignancies.
Molecular basis of neoplasia
Normal cellular growth and differentiation depends on
the precise control of gene expression, and alterations in

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 Basic concepts
the quantity or timing of gene expression can affect the
survival and function of a cell. When such alterations oc-
cur in certain types of genes known as oncogenes or tu-
mor suppressor genes, the cell may gain abnormal growth
or survival properties, and accumulations of such muta-
tions may lead to cancer.
Oncogenes
Oncogenes are genes that have the potential to cause can-
cer, and they arise from mutations in their normal counter­
parts termed proto-­oncogenes. Proto-­ oncogenes generally
code for proteins or ncRNAs that regulate such pro­cesses
as proliferation and differentiation, and activating muta-
tions or epige­ne­tic modifications that increase the ex-
pression or enhance the function of ­these genes confers a
growth or survival advantage on a cell. The first described
oncogene, termed SRC, was discovered in the 1970s and is
a member of a f­amily of tyrosine kinases that regulate cell
proliferation, motility, adhesion, survival, and differentiation.
Activating mutations in the SRC ­family kinases are associ-
ated with the pathogenesis of multiple types of neoplasias;
including cancers of the colon, breast, blood, head and neck,
and ­others. Another classic example of an oncogene is the
BCR-­ABL1 fusion gene found in chronic myelogenous
leukemia (CML). This fusion results from a translocation
between the BCR gene on chromosome 9 and the ABL1
proto-­oncogene on chromosome 22 and confers constitu-
tive activation of ABL1 and enhanced cell proliferation.
Pharmacologic targeting of the activity of oncogenes, such
as the use of the tyrosine kinase inhibitor imatinib to treat
CML, can be an effective therapeutic approach.
Tumor suppressors
In contrast to oncogenes, tumor suppressors are genes
that encode proteins or ncRNAs whose normal function
is to inhibit tumor development through the promotion
of such pro­cesses as apoptosis, DNA repair, cell cycle inhi-
bition, cell adhesion, and o­ thers. Loss of the expression or
function of ­these genes is associated with cancer, and gen-
erally both copies of the tumor suppressor gene must be
altered to promote neoplasia. Thus, most tumor suppres-
sors follow the “two-­hit hypothesis” proposed by ­Alfred
Knudson in his study of the retinoblastoma-­ associated
tumor suppressor gene RB1. This gene encodes a protein
that functions to regulate cell cycling and survival. ­Because
both copies of the gene must be mutated for retinoblas-
toma to manifest, individuals that inherit a mutant allele
(requiring just one more “hit” in the remaining normal
allele for loss of gene function) generally develop disease
­earlier than t­hose that must acquire “hits” in both alleles.
Familial cancer syndromes often result from the inheri-
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
7
tance of heterozygous mutations in tumor suppressor genes.
For example, Li-­Fraumeni syndrome results from inherited
mutations in the cell cycle regulator TP53 and is associated
with the early onset of multiple tumor types; including os-
teosarcoma, breast cancer, leukemia, and o
­ thers. When mu-
tations occur in the remaining normal allele, termed “loss
of heterozygosity,” tumor growth is initiated. In some cases,
loss of just one copy of a gene (“haploinsufficiency”) has
been shown to contribute to cancer development. For
example, loss of one copy of the ribosomal gene RPS14 in
patients with 5q-­syndrome leads to aberrant ribosomal
protein function and a block in erythroid differentiation.
Neoplasia and the immune system
The immune system defends and protects an individual
through the detection of “nonself ” antigens from e­ ither
pathogens or infected/malignant cells, followed by ex-
pansion of effector cells that destroy them, as well as the
development of immunological memory for subsequent
defense. The ability of cancer to evade or escape the im-
mune system is a hallmark of the disease and forms the
basis of so-­called immunotherapeutic approaches. T ­ hese
approaches include increasing the immunogenicity of can-
cer cells, as well as enhancing the immune response to the
cells through a variety of mechanisms—­including admin-
istration of cytokines, blocking negative regulators of
T-­cell function, and engineered cellular therapies. Two
of the most successful approaches to date are immune
checkpoint inhibitors and chimeric antigen recep-
tor T (CAR T) cells, both of which enhance T-­cell re-
sponses to tumor cells.
T cells initiate an immune response through the recog-
nition of antigenic tumor peptides presented by the major
histocompatibility complex (MHC) protein on the surface
of ­either antigen-­presenting or tumor cells by the T-­cell
receptor (TCR). TCR engagement alone is insufficient
to activate T cells; they require an additional costimulatory
signal by the CD80/B7 protein that engages with CD28
on T cells. In contrast, engagement of the CTLA-4 protein
expressed on T cells by CD80/B7 leads to cell cycle arrest.
This pro­cess modulates early steps in T-­cell activation. Dur-
ing long-­term antigen exposure, T cells upregulate PD-1,
which inhibits T cells upon interaction with PD-­L1 that is
expressed on tumor cells. Thus CTLA-4 modulates early
T-­cell activation, whereas PD-1 functions in the effector
phase. Immune checkpoint inhibitors that target both of
­these stages have been developed. Anti-­CTLA-4 mono-
clonal antibodies modulate early steps in T-­cell activation,
whereas monoclonal antibodies directed against PD-1 or
PD-­L1 act to reverse inhibition of T cells that are pre­sent
in the tumor microenvironment (Figure 1-3A).
 A Antigen-presenting cell Naive T cell Effector T cell Cancer cell
Tumor-associated Tumor-associated
peptide peptide

MHC TCR TCR MHC

CD80 CD28 PD-1

Costimulatory PD-L1
signal Inhibitory
CD80 signal

Inhibitory CTLA-4
signal
Anti-PD-L1
Anti-PD-1 antibody
antibody

CD3ζ
Leukopheresis
First-generation CART
Transduction
with CAR retroviral
construct
Costimulatory domain 1
CD3ζ
Peripheral Second-
blood T cells generation
CART
Costimulatory domain 2
CD3ζ
Third-
generation
CART

Preconditioning
chemotherapy

Infusion of CART

Figure 1-3 Immunotherapy approaches to malignancies. (A) Immune checkpoint inhibitors. Antigen-­presenting cells and cancer
cells pre­sent MHC-­bound antigens to T cells. Recognition of the MHC-­bound antigen by the TCR, in addition to CD80 engagement
with CD28, leads to T-­cell activation as indicated by the “+” symbol. In contrast, engagement of CD80 with the CTLA-4 protein leads
to T-­cell inhibition (“−” symbol). PD-­L1 expression on cancer cells can associate with PD-1 on T cells, leading to inhibition in the T-­cell
effector phase. Antibodies to CTLA-4, PD-1, or PD-­L1 block T-­cell inhibition, enhancing the T-­cell response to cancer cells. (B) CAR
T-­cell therapy. T cells are harvested from patients by pheresis followed by culture, transduction with a retrovirus carry­ing the ge­ne­tic
information to encode a chimeric antigen receptor (CAR), and expansion. Patients receive a preconditioning chemotherapy regimen that
results in lymphodepletion prior to CAR T-­cell infusion. This has been demonstrated to be beneficial for enhanced in vivo CAR T-­cell
expansion. The three generations of CARs are shown. First-­generation CARs carry an extracellular domain that recognizes CD19 with
an intracellular domain derived from the TCR (CD3 zeta). Second-­generation CARs include a costimulatory domain to enhance T-­cell
activation upon engagement. Third-­generation CARs carry two additional costimulatory domains.

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 Analytic techniques
As opposed to enhancing T-­cell function by inhibiting
negative regulators, CAR T-­cell approaches isolate T cells
from patients and modify them ex vivo with chimeric re-
ceptors that both target the cell to the tumor and then
activate them upon target cell recognition (Figure 1-3B).
Thus, recognition of a tumor cell by the patient’s immune
system is not necessary—­the cells are removed and engi-
neered for tumor cell recognition and effector function,
followed by infusion back into the patient. The CAR is
introduced into cells through infection with a lentivirus
that carries the gene encoding the CAR, which consists
of an extracellular antigen-­recognition domain linked to
an intracellular signaling domain. First-­generation CARs
had only the CD3 zeta intracellular domain of the T-­cell
receptor. Second-­and third-­ generation CARs include
additional costimulatory signaling domains that have re-
sulted in enhanced per­sis­tence and proliferation once the
cells ­were infused back into the patient. A variety of anti-
gens have been evaluated for CAR T-­cell therapy. CD19-­
directed cells have repeatedly demonstrated significant
antitumor responses in patients with B-­lineage acute lym-
phoblastic leukemia (ALL), leading to FDA approval for
this indication in c­ hildren and young adults.
While the clinical advances in anti-­CD19 CAR ­T-­cell
therapy have demonstrated the clinical feasibility of this
approach and provided evidence of the clinical importance
of CAR T-­cell therapy, a major challenge in the wider ap-
plication of CAR T cells to other diseases is in the iden-
tification of appropriate antigens for CAR T cells. Anti-
­CD19 CAR T cells have been successful b­ ecause CD19 is
broadly expressed in B-­cell malignancies and B-­cell aplasia
is tolerated. Ideally, however, CAR T cells should target a
tumor-­restricted antigen to avoid the toxicity that may
result in an immune reaction against healthy tissues. In
addition, the antigen should be broadly expressed on the
majority of tumor cells and differentially expressed on tu-
mor cells compared with essential normal tissue. Identifying
such tumor-­associated antigens for myeloid malignancies
has been a significant challenge to date.
It is impor­tant to note that checkpoint inhibitors and
CAR T cells have the capacity to elicit expected and un-
expected toxicities. Anticipating and managing t­hese tox-
icities are essential in the successful application of ­these
therapies. For CAR T cells, the major toxicities encoun-
tered include: cytokine release syndrome, neurologic tox-
icity, “on-­target/off-­tumor” recognition, and anaphylaxis.
Theoretical toxicities of off-­target antigen recognition are
pos­si­ble and may be seen as further novel CAR T-­cell
antigens are studied in clinical t­rials. For immune check-
point blockade, toxicities impacting the skin, gut, endocrine,
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
9
lung, and musculoskeletal systems are relatively common.
The most common toxicities reported to affect each of
­these systems include rash, pruritus and/or vitiligo, diar-
rhea resulting from colitis, acute hypophysitis resulting in
hypopituitarism, pneumonitis, and inflammatory arthritis.
In contrast, cardiovascular, hematologic, renal, neurologic,
and ophthalmologic toxicities occur much less frequently
in the setting of checkpoint blockade. Consensus recom-
mendations for the identification and management of cyto-
kine release syndrome, as well as immune-­related adverse
events from checkpoint inhibitors, have been published by
numerous groups.
Analytic techniques
Digestion, amplification, and separation
of nucleic acids
DNA may be cut, or digested, into predictable, small frag-
ments using restriction endonucleases. Each of t­hese
bacterially derived enzymes recognizes a specific sequence
of 4 to 8 bp in double-­stranded DNA. ­These recognition
sequences are usually palindromic (eg, they read the same
sequence 5′ to 3′ on opposite strands). The DNA is cleaved
by the enzyme on both strands at the site of the recogni-
tion sequence. ­A fter restriction endonuclease digestion,
DNA fragments may be separated by size using agarose
gel electrophoresis, with the smallest fragments ­running
faster (closer to the bottom of the gel) and the largest frag-
ments moving more slowly (closer to where the samples
­were loaded). DNA can be visualized in the gel by staining
with ­either a fluo­rescent dye or the chemical ethidium bro-
mide, both of which insert themselves between the DNA
strands and fluoresce upon exposure to ­lasers and/or ultra-
violet light. A desired fragment of DNA may be isolated
and then purified from the gel. Some restriction enzymes
generate overhanging single-­ stranded tails, known as
“sticky ends.” Complementary overhanging segments may
be used to join, or ligate, pieces of DNA to one another
(Figure 1-4). T ­ hese methods form the foundation of re-
combinant DNA technology.
Polymerase chain reaction
The polymerase chain reaction (PCR) is a power­ful tech-
nique for amplifying small quantities of DNA of known
sequence. Two oligonucleotide primers are required:
one is complementary to a sequence on the 5′ strand of
the DNA to be amplified and the other is complementary
to the 3′ strand. The DNA template is denatured at high
temperature; the temperature then is lowered for the prim-
 10 1. Molecular basis of hematology

A Restriction enzyme digestion

Enzyme Recognition sequence Digestion products Overhang

5’ GAA T T C 3’ 5’ G 3’ 5’ A A T T C 3’
EcoRI 5’
3’ C T T AAG 5’ 3’ C T T AA 5’ 3’ G 5’

5’ GAG C T C 3’ 5’ G A G C T 3’ 5’ C 3’
SacI 3’
3’ C T C GAG 5’ 3’ C 5’ 3’ T C GAG 5’

5’ C AG C T G 3’ 5’ C A G 3’ 5’ C T G 3’
PvuII Blunt
3’ G T C GA C 5’ 3’ G T C 5’ 3’ GA C 5’

B Ligation of “sticky ends”

GAA T T C GAA T T C

C T T AAG C T T AAG

Cut with EcoRI

Figure 1-4 Restriction endonuclease digestion.
(A) Diagram of typical restriction enzyme recogni-
tion sequences and the pattern of cleavage seen G AA T T C G AA T TC
upon digestion with that enzyme. (B) Means by
which restriction enzyme can be exploited to form C T T AA G C T T AA G
recombinant proteins. Digestion of the two frag- DNA ligase
ments with the enzyme EcoRI results in four frag-
ments. Ligation with DNA ligase can regenerate the
GAA T T C GAA T T C
original fragments but can also result in recombinant
fragments in which the 5′ end of one fragment is C T T AAG C T T AAG
ligated to the 3′ end of the second fragment. This
recombinant DNA can then be used as a template GAA T T C GAA T T C
for generation of recombinant protein in expression
vectors. C T T AAG C T T AAG

ers to be annealed to the DNA. The DNA then is extended
with a temperature-­stable DNA polymerase (such as Taq
polymerase), resulting in two identical copies of the original
DNA from each piece of template DNA. The products are
denatured, and the pro­cess is repeated. The primary prod-
uct of this reaction is the fragment of DNA bound by the
two primers. Thus, small quantities of input DNA may
be used to synthesize large quantities of a specific DNA
sequence. This technique has superseded many blotting
techniques for prenatal diagnosis and cancer diagnostics.
Using multiple primer pairs in the same reaction, multi-
plex PCR can efficiently amplify several fragments si­mul­
ta­neously.
Reverse transcriptase PCR (RT-­PCR) is a modifi-
cation of the PCR technique that allows the detection and
amplification of expressed RNA transcripts. Complemen-
tary DNA (cDNA) is generated from RNA using reverse
transcriptase, an enzyme that mediates the conversion of
RNA to DNA. The resultant cDNA is then subjected to
routine PCR amplification. ­Because cDNA is generated
from pro­cessed mRNA transcripts, no intronic sequences
are obtained. RNA is much less stable than DNA; thus, am-
plification of mRNA from tissue or blood requires careful
preservation of source tissue or blood samples.
Quantitative PCR is another modification of the PCR
technique. The most commonly used method is real-­time
PCR, in which a fluorogenic tag is incorporated into an
oligonucleotide that w ­ ill anneal to the internal sequence
of the Taq DNA polymerase-­generated PCR product.
This tag consists of a fluo­rescent “reporter” and a “silenc-
ing” quencher dye at opposite ends of the oligonucleotide.
When annealed to the internal sequence of the PCR prod-
uct, fluorescence from the reporter is quenched ­because
the silencer is in proximity. A
­ fter completion of each cycle
of PCR amplification, the reporter is not incorporated
in the product but is cleaved by Taq DNA polymerase
(­because this enzyme also has exonuclease activity). This
fluorogenic tag is released, generating a fluo­rescent signal
(Figure 1-5). Real-­time PCR detects the number of cy-
cles when amplification of the product is exponential and
expresses this as a ratio to standard ­house­keeping RNA,
such as ribosomal RNA or glyceraldehyde-3-­phosphate
dehydrogenase mRNA. This number can be converted
to the number of molecules of mRNA pre­sent in the test

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 Analytic techniques
A R
Primer Probe
Denature
3’
R Q
Primer Probe
Anneal
3’
Primer
Taq
Extend
3’
B Diagnosis 1 month
Fluorescence
Cycles
Figure 1-5 Real-­time PCR. (A) Sample DNA (or cDNA) is de-
natured, and target-­specific primers are annealed to begin the PCR
amplification (shown for one strand). An oligonucleotide probe
complementary to a sequence within the PCR product is included
in the reaction. The probe contains a fluorophore (R) covalently
attached to the 5′ end and a quencher (Q) at the 3′ end. As the
Taq polymerase extends the nascent strand, its 5′-­to-3′ exonuclease
activity degrades the probe, releasing the fluorophore from the
quencher and allowing the fluorophore to fluoresce. An example
of this fluo­rescent readout is shown in panel B, which depicts the
relative fluorescence intensity from amplification of the BCR-­ABL
fusion transcript (yellow line) to an endogenous control transcript
(green line) in a patient with chronic myelogenous leukemia before
and ­after treatment with a tyrosine kinase inhibitor. The cycle
number at which fluorescence crosses a threshold (horizontal dot-
ted line) is inversely proportional to the amount of template DNA
or cDNA. Although the control template is consistently detected
throughout therapy, the BCR-­ABL transcript abundance is lower
at 1 month (higher cycle threshold) and undetectable at 3 months
into therapy.
sample. This technique is used widely to mea­sure minimal
residual disease (MRD) or to monitor clearance of BCR/
ABL transcripts in patients treated with tyrosine kinase
inhibitors.
The power of PCR lies in its ­great sensitivity, but this is
also a potential weakness b­ ecause small amounts of con-
taminating DNA or RNA from other sources can cause
false-­positive results. Clinical laboratories that use PCR for
critical diagnostic tests require elaborate quality assurance
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
11
protocols to prevent inappropriate diagnosis. Equally trou-
Q
blesome are false-­negative results that result from inap-
propriate primer design, degraded RNA, or inappropriate
temperature par­ameters for the annealing of primers.
5’
The amplified sequence of interest then can be rapidly
evaluated for presence of mutation(s) by direct sequenc-
ing, restriction enzyme digestion (if a suitable enzyme that
discriminates between mutant and wild-­type alleles is avail-
5’
able), allele-­specific PCR (discussed ­later in this chapter), or
other techniques.
R
Q Hybridization techniques
DNA is chemically stable in its double-­stranded form. This
5’ tendency of nucleic acids to assume a double-­stranded
structure is the basis for the technique of nucleic acid
hybridization. If DNA is heated or chemically denatured,
3 months the hydrogen bonds are disrupted and the two strands
separate. If the denatured DNA is then placed at a lower
temperature in the absence of denaturing chemicals, the
single-­stranded species ­will reanneal in such a way that the
complementary sequences are again matched and the hy-
drogen bonds re-­form. If the denatured DNA is incubated
with radioisotope-­or fluorogen-­ labeled, single-­
stranded
complementary DNA or RNA, the radiolabeled species
­will anneal to the denatured, unlabeled strands. This hy-
bridization pro­cess can be used to determine the presence
and abundance of an identical DNA species. The tech-
nique of molecular hybridization is the basis for Southern
blotting and many other molecular techniques.
Southern blotting (Figure 1-6) is used to detect
specific DNA sequences. In this procedure, electropho-
retically separated DNA fragments are separated to a filter
membrane and subsequent fragment detection by probe
hybridization. Restriction fragment-­length polymor-
phism (RFLP) analy­sis is a Southern blot-­based tech-
nique with many useful applications in hematology. Using
this technique, inherited disease-­associated alleles may be
identified and traced by the presence of inherited muta-
tions or variations in a DNA sequence that create or abol-
ish restriction sites. Rarely, a single-­base, disease-­causing
DNA mutation w ­ ill coincidentally fall within a recogni-
tion sequence for a restriction endonuclease. If a probe for
the mutated fragment of DNA is hybridized to total cel-
lular DNA digested with that enzyme, then the detected
DNA fragment w ­ ill be a dif­fer­ent size. The β-­globin point
mutation resulting in hemoglobin S may be detected in
this way. More commonly, ge­ne­tic diseases are not the re-
sult of single base-­pair mutations that con­ve­niently abolish
or create restriction enzyme sites. A similar technique may
be used, however, to detect the presence of an RFLP that
is linked to a disease locus within a f­amily or group, but
 12 1. Molecular basis of hematology

A
Cleave with Transfer to
restriction enzyme nitrocellulose Hybridize to probe
x
Probe
DNA B A

Electrophorese x
Autoradiograph
on agarose gel

B Detection of protein
Separate proteins using immunostain
by size using Transfer proteins with antibody specific
electrophoresis to membrane to protein of interest

Protein
extracts

Autoradiograph

Figure 1-6 Common hybridization techniques in molecular biology. (A) Southern blot analy­sis of DNA. DNA is cleaved with a
restriction endonuclease, electrophoresed through an agarose gel, and transferred to nitrocellulose. The probe, as illustrated at the bottom
of the figure, lies on a piece of DNA of length x when DNA is digested with an enzyme that cleaves at sites A and B. Hybridization
of the probe to the blot, with appropriate washes and exposure to radiograph, shows a single band of length x on the autoradiogram.
(B) Western blot detection of protein. Proteins are extracted from cells and then separated by gel electrophoresis to separate proteins based
on length of denatured polypeptide (or occasionally based on 3D structure of native proteins). The separated proteins are then transferred
to a membrane where they are stained with antibodies to detect a protein of interest. Detection antibodies for Western blot are commonly
conjugated to an enzyme which allows for detection of the protein of interest in the membrane using a variety of methodologies such as
colorimetric or chemiluminescent detection.

that does not directly detect the molecular abnormality
responsible for the disease. This is ­because ­there are nor-
mal variations in the DNA sequence among individuals
that are inherited but ­silent in that they do not cause dis-
ease. ­These polymorphisms may be located in intronic
sequences or near the gene of interest. They are surrogates
that can be used to identify the region of DNA contain-
ing the ge­ne­tic variant in question. B ­ ecause RFLPs are
transmitted from parent to offspring, they are extremely
useful in the diagnosis of many ge­ne­tic diseases.
Hybridization techniques also can be applied to RNA.
Although RNA is generally an unstable single-­stranded spe-
cies, it is stabilized when converted to the double-­stranded
form. Therefore, if placed ­under hybridization conditions,
RNA ­will complex with complementary, single-­stranded
nucleic acid species in the same fashion as DNA. North-
ern blotting is analogous to Southern blotting, but it in-
volves electrophoresis of RNA with subsequent transfer
and hybridization to a probe. Whereas Southern blotting
detects the presence of a gene or its integrity, Northern blot
analy­sis detects the level of expression of a gene within a
specific cell type.
Protein can be detected by the blotting technique re-
ferred to as Western blotting (Figure 1-6). Proteins are
detected by specific antibodies directed against the pro-
tein of interest. A labeled anti-­immunoglobulin antibody
raised in another species then can be used to detect the
specific antibody bound to the blot.
Cytoge­ne­tic techniques
Uniform, nonrandom chromosomal abnormalities, termed
clonal abnormalities, can be detected in malignant cellular
populations by metaphase cytoge­ne­tics, or chromosomal
analy­sis. Conventional cytoge­ne­tic techniques can detect
numeric chromosomal abnormalities (too many or too
few chromosomes), as well as deletion or translocation of
relatively large chromosomal fragments among chromo-
somes. Certain chromosomal translocations are considered
pathognomonic of specific diseases, such as the t(15;17) in
acute promyelocytic leukemia. Normally, chromosomes
cannot be seen with a light microscope, but during cell
division they become condensed and can be analyzed. To
collect cells with their chromosomes in this condensed
state, bone marrow or tumor tissue may be briefly main-
tained in culture and then exposed to a mitotic inhibi-
tor, which blocks formation of the spindle and arrests cell
division at the metaphase stage. Thus, cytoge­ne­tic studies
require dividing cells.
Conventional cytoge­ne­tic studies have several limita-
tions. First, t­hese studies require active cell division, which

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 Analytic techniques
may not be feasible for some clinical samples. Second, the
technique is insensitive to submicroscopic abnormalities.
Fi­nally, b­ ecause only a very small number of cells are ana-
lyzed, the technique is relatively insensitive for mea­sure­
ment of MRD burden.
Fluorescence in situ hybridization (FISH) studies
complement conventional cytoge­ne­tic analy­sis by adding
con­ ve­
nience, specificity, and sensitivity. This technique
applies the princi­ples of complementary DNA hybridiza-
tion. A specific single-­stranded DNA probe correspond-
ing to a gene or chromosomal region of interest is labeled
for fluo­rescent detection. One or more probes are then
incubated with the fixed cellular sample and examined by
fluorescence microscopy. FISH probes have been devel-
oped that can identify specific disease-­defining transloca-
tions, such as the t(15;17) that characterizes acute promy-
elocytic leukemia. A probe corresponding to the PML
gene on chromosome 15 is labeled with a fluo­ rescent
marker, such as rhodamine, which is red. Another fluo­
rescent marker, such as fluorescein, which is green, is linked
to a probe corresponding to the RARα gene on chromo-
some 17. When the t(15;17) chromosomal translocation is
pre­sent, the two genes are juxtaposed, the two probes are
in proximity, and the fluo­rescent signals merge to generate
a yellow signal. The specificity of FISH is highly depen-
dent on the probes that are used. Numeric abnormalities,
such as monosomy and trisomy, may be identified using
centromere-­specific probes.
The major advantage of FISH is that it can analyze
known cytoge­ ne­
tic abnormalities in nondividing cells
(interphase nuclei); thus, peripheral blood slides can be
directly pro­cessed. FISH studies are most useful when as-
sessing for the presence of specific molecular abnormali-
ties associated with a par­tic­u­lar clinical syndrome or tumor
type and are approximately 1 order of magnitude more
sensitive than morphology and conventional cytoge­ne­tic
studies in detecting residual disease. FISH panels are now
available to detect recurrent ge­ne­tic changes in leukemias,
lymphomas, and multiple myeloma. ­These panels are par-
ticularly useful in predicting prognosis when conventional
cytoge­ne­tic studies are noninformative.
Since their introduction nearly 30 years ago, FISH tech-
niques have evolved rapidly for use in hematologic dis-
orders. For example, double-­fusion FISH (D-­FISH) uses
differentially labeled large probes that each span one of
the two translocation breakpoints. This allows simul-
taneous visualization of both fusion products and reduces
false-­negative results. Another technique known as break-­
apart FISH uses differentially labeled probes targeting the
regions flanking the breakpoint. Thus, in normal cells, the
signals appear fused but they split upon translocation. This
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
13
technique has been used to detect MYC translocations in
Burkitt lymphoma and CCND1 translocations in man-
tle cell lymphoma. Labeling probes with unique com-
binations of fluorophores in multiplex FISH (M-­FISH)
not only has permitted simultaneous detection of e­ very
chromosome but also now has been used to analyze spe-
cific chromosomal regions and can detect subtle rear-
rangements.
Array-­based techniques
DNA microarrays are composed of oligonucleotide
probes spanning sites of known single-­nucleotide poly-
morphisms (SNPs). Fluorescently labeled single-­stranded
DNA from a test sample is hybridized on the array to de-
termine, for a specific region in the genome, which DNA
sequence undergoes complementary base pairing with the
sample. The pattern of hybridization signals is analyzed
using computer software, providing a detailed profile of
ge­ne­tic variation specific to an individual’s DNA. With
current technology, a single microarray has sufficient den-
sity to analyze variation at >1 million polymorphic sites.
­These data can be analyzed in several ways. First, the gen-
otypes at each site can be used in genome-­wide associa-
tion studies in which the allele frequencies at each SNP are
compared in disease cases and unaffected controls. Second,
the intensity of fluo­rescent signals from multiple adjacent
sites can be used to infer changes in the abundance of
DNA across the genome. Changes in DNA content may
include inherited copy number variants or somatically
acquired deletions and amplifications pre­ sent in tumor
samples. Fi­nally, long stretches of homozygosity that reflect
acquired partial uniparental disomy, a recurrent abnor-
mality pre­sent in a variety of myeloid malignancies, can
be identified. In a variation of this technique, the relative
abundance of methylated versus unmethylated DNA can
be detected in samples by pretreating DNA with chemicals
(eg, bisulfite) that convert methylated cytosine bases be-
fore hybridization on an array.
In comparative genomic hybridization (CGH),
DNA extracted from a test sample (eg, tumor) and a
matched normal control (eg, buccal wash) is differentially
labeled and hybridized to a microarray composed of oli-
gonucleotide probes. The ratio of test to control fluores-
cence is quantified using digital image analy­sis. Similar to
SNP arrays, amplifications in the test DNA are identi-
fied as regions of increased fluorescence ratio, and losses
are identified as areas of decreased ratio. In array CGH,
resolution of the analy­sis is restricted by probe size and
the density of probes on the array. T ­ hese and other tech-
niques permit high-­resolution, genome-­wide detection of
genomic copy number changes. Careful analy­sis of AML
 14
genomes using ­these approaches has revealed few somatic
copy number changes that are not detectable by routine
cytoge­ne­tics. In contrast, ALL genomes are characterized
by recurring copy number alterations, frequently involving
the loss of the genes required for normal lymphoid devel-
opment (eg, PAX5, IKZF1).
RNA expression arrays allow for comprehensive
characterization of the gene expression patterns within
the cells of interest, referred to as a gene expression
profile. This technique has been used to classify disease,
predict response to therapy, and dissect pathways of disease
pathogenesis. To perform t­ hese assays, mRNA is extracted
from samples, and double-­stranded cDNA is synthesized
from the RNA template. Then, biotinylated complemen-
tary RNA (cRNA) is generated from the cDNA template
by in vitro transcription using biotin-­labeled nucleotides.
The biotinylated cRNA is fragmented and incubated with
probes in a solution or hybridized to a microarray. Hybrid-
ization is then detected using a streptavidin-­phycoerythrin
stain, and the fluorescence intensity of each feature of the
array is quantified.
Two main computational approaches have been used
to analyze microarray data: unsupervised and supervised
learning. Unsupervised learning methods cluster sam-
ples based on gene expression similarities without a priori
knowledge of class labels. Hierarchical clustering and self-­
organizing maps are two commonly used algorithms of
unsupervised learning. One potential application of un-
supervised learning is for discovery of previously unrec-
ognized disease subtypes. The strength of this method is
that it provides an unbiased approach to identifying classes
within a data set. A weakness is that t­hese data sets are
complex, and the structure uncovered by clustering may
not reflect the under­lying biology of interest. The second
computational approach, supervised learning, uses known
class labels to create a model for class prediction. For ex-
ample, a training data set is used to create an expression
profile for tumor samples from patients with “cured” ver-
sus “relapsed” disease. ­These profiles then are applied to
an in­de­pen­dent data set to validate the ability to make the
prognostic distinction. In ­either method, it is impor­tant
to demonstrate statistical significance and ensure that the
tested samples are compared with the appropriate controls.
Once differentially expressed genes are defined, then it is
also often helpful to next determine w ­ hether the differen-
tially expressed genes that are identified belong to specific
pathways of known biological significance. This is com-
monly done through the use of the GO (Gene Ontology)
or KEGG (Kyoto Encyclopedia of Genes and Genomes)
Pathway analy­sis database. Also, a statistical methodology
known as GSEA (gene set enrichment analy­sis) is also com-
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
1. Molecular basis of hematology
monly used to determine if the differentially expressed
genes are statistically enriched in previously published and
defined gene sets publicly deposited in prior microarray or
RNA-­seq datasets.
The main limitation of microarray expression technol-
ogy is that it analyzes only mRNA abundance. It does not
reveal impor­tant translational and posttranslational modi-
fications and protein–­protein interactions. Purity of the
cell population is also essential for ­these analyses, and one
must ensure that the control and analyzed cells are homo-
geneous, of the same cell type, and at comparable stages
of differentiation. It is advisable that any significant dif-
ference in mRNA expression detected using microarray
technology be confirmed using an orthogonal approach
(eg, real-­time PCR).
Sequence-­based studies
Analy­ sis of DNA sequence variation by conventional
techniques (eg, Sanger sequencing) is being replaced rap-
idly by a variety of novel high-­throughput technologies
(collectively termed next-­generation [next-­gen] se-
quencing). ­These developments have greatly accelerated
the pace and lowered the cost of large-­scale sequence pro-
duction. At the core of each of ­these technologies is the
preparation of DNA fragment libraries, which are then
clonally amplified and sequenced by synthesis in multiple
parallel reactions (Figure 1-7). Sequencing both ends of
the DNA templates (“paired-­end reads”) improves the ef-
ficiency of data production and facilitates the identifica-
tion of insertions, deletions, and translocations. With ­these
approaches, the search for inherited and somatic muta-
tions associated with hematologic malignancies and con-
genital blood disorders has evolved from a candidate gene
approach to unbiased surveys of all coding and noncoding
regions of the genome.
The DNA libraries used for ­these sequencing reactions
can be prepared from ­whole genomes or from selected
regions of interest. For example, the regions of the genome
that encode proteins (the exome) can be enriched by
hybridizing DNA to oligonucleotide probes before li-
brary construction. Exome sequencing is preferred for
many studies (compared with ­whole genome sequenc-
ing) b­ ecause the cost of sequence production is lower and
the interpretation of sequence variants in protein-­coding
genes is more tractable. A limitation of exome sequencing
is that it cannot detect structural variants (such as dele-
tions, amplifications, and rearrangements). In addition, the
use of DNA from tissue uninvolved in the disease pro­cess
is very impor­tant for w­ hole exome or genome sequenc-
ing to identify potential somatic alterations specific for
the disease tissue, given the large number of sequence
 Analytic techniques
A
Exome capture probes Hybridization of probes
and library fragments
Biotinylated probes
Bind hybrids
to streptavidin
magnetic beads
Off-target capture
Wash and elute
Normal
Tumor
variants that are often generated by sequencing the en-
tire exome or genome. Also, some protein-­coding genes
are not yet annotated and therefore w ­ ill be excluded from
commercially available reagents used to capture the target
DNA. ­These assays can be restricted further to panels of
genes by first amplifying the genes of interest (by PCR) or
by hybridizing the DNA to oligonucleotide probes cover-
ing the region of interest, followed by next-­gen sequencing.
This is an efficient and cost-­effective approach to interrogate
a number of targets in parallel from a single sample (eg, genes
that are recurrently mutated in hematologic malignancies).
Further modifications of the workflow allow for detection
of chromatin marks across the genome (eg, transcription
­factor binding sites, histone modifications) by using anti-
bodies to immunoprecipitate the region of interest, followed
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
15
Random
next-generation
sequencing library
Genomic DNA
Apply magnetic field
Amplify recovered library fragments and sequence
Figure 1-7 Next-­gen sequencing. (A) A library of genomic
DNA fragments is shown at the upper right. This library can be
used d­ irectly for sequencing (­whole genome) or hybridized with
probes (shown in upper left) to enrich for targets in candidate genes
or all coding genes (­whole exome). Reproduced with permission
from Mardis E, Nat Rev Gastroenterol Hepatol. 2012;9:477–486.
(B) Sequence reads from a tumor sample (bottom panel) and
matched normal tissue (upper panel) visualized in the Integrated
Genome Viewer (Robinson JT et al, Nat Biotechnol. 2011;29:24–26.).
Each gray bar represents a single 75-­to 100-bp sequence read.
A nucleotide substitution shown in red at the position indicated
by the arrow is pre­sent in ~50% of tumor reads, suggesting that a
heterozygous somatic mutation is pre­sent in the tumor sample.
by next-­ gen sequencing (ChIP-­Seq). Next-­generation
sequencing-­based assays can also be used to identify vari­
ous epige­ne­tic marks. For example, bisulfite sequencing is
used to quantify the extent of cytosine methylation across
the genome. In this method, sodium bisulfite exposure
converts unmethylated cytosines to uracil, leaving meth-
ylated cytosines unaffected. RNA templates can be used
to generate DNA libraries for sequencing (RNA-­seq), al-
lowing for the quantification of RNA abundance and for
the detection of chimeric RNAs or alternatively spliced
products. Fi­nally, multiple approaches to determine chro-
matin accessibility and long-­range protein–­protein inter-
actions have been developed using next-­gen sequencing.
Assay for transposase-­accessible chromatin using sequencing
(ATAC-­seq) utilizes a mutated hyperactive transposase, an
 16
enzyme that catalyzes the movement of transposon DNA
ele­ments to other parts in the genome. The high activity
of the mutant enzyme allows for highly efficient cutting
of exposed DNA and simultaneous ligation of adapters.
Adapter-­ligated DNA fragments are then isolated, ampli-
fied by PCR and used for next-­gen sequencing. By iso-
lating exposed DNA, the technique identifies areas of the
genome where the chromatin is accessible, an indicator of
genomic regions ­free of nucleosomes. Thus, enrichment
of sequences indicates absence of DNA-­binding proteins or
nucleosomes in the region. T ­ hese regions can be further
categorized into regulatory ele­ments—­such as promoters,
enhancers, and insulators—by integrating further genomic
and epigenomic data, including information about histone
modifications or evidence for active transcription. Chro-
mosome conformation capture techniques are a set of mo-
lecular biology methods used to analyze the spatial organ­
ization of chromatin in a cell. ­These methods quantify
the number of interactions between genomic loci that are
nearby in three-­dimensional space but may be separated
by long distances in the linear genome. Such interactions
may result from biological functions, such as promoter–­
enhancer interactions. Hi-­C is one of t­hese techniques
that quantifies interactions between all pos­si­ble pairs of
fragments si­mul­ta­neously. Briefly, cell genomes are cross-­
linked with a fixative to “freeze” interactions between
genomic loci. The genome is then cut into fragments
using restriction enzymes and a ligase is added to cross-­
link interacting fragments. Interacting loci fragments then
undergo library preparation followed by high throughput
sequencing.
Although the cost of sequence production has fallen
dramatically in recent years, the storage, analy­sis, and in-
terpretation of t­hese large data sets still pose significant
challenges.
Methods to study protein abundance
Proteins are the effectors of most cellular functions. Ge­
ne­tic defects perturb normal cellular functions ­because
they result in changes in the level or function of the pro-
teins they encode. Characterizing proteins expressed on
cell surfaces and within cells is critical for identifying he-
matopoietic and immune cell subsets and is a cornerstone
of diagnosing a wide variety of hematologic malignancies.
Evaluation of protein expression abundance for diagnos-
tic and therapeutic purposes is routinely performed us-
ing flow cytometry of suspension cells as well as im-
munohistochemistry (IHC) analy­sis of tissue sections.
In addition, an enzyme-­ linked immunosorbent as-
say (ELISA) can be utilized to detect proteins such as
peptides, proteins, antibodies and hormones in liquid or
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
1. Molecular basis of hematology
tissue material. Many proteins undergo extensive post-
translational modifications that influence their activity and
function, including cleavage, chemical modification such
as phosphorylation and glycosylation, and interaction with
other proteins. T ­ hese posttranslational events are not en-
coded by the genome and are not revealed by genomic
analy­sis or gene expression profiling. Proteomics is the
systematic study of the entire complement of proteins de-
rived from a cell population.
IHC, flow cytometry, and ELISA analyses are heavi­ly uti-
lized in clinical diagnostic hematopathology. IHC analy­
sis is the pro­cess of visualizing the expression of a protein
within a section of tissue through the use of antibodies
selective to a specific antigen. Most commonly, the anti-
body utilized in IHC is conjugated to an enzyme, such
as peroxidase, which catalyzes a color-­producing reaction
allowing visualization of the antibody-­antigen interaction.
­Because IHC is performed on a tissue section, the archi-
tecture of the tissue and cellular relationships in tissue is
well preserved. In addition, IHC is performed on tissue that
has been preserved through the pro­cess of fixation, most
commonly using paraformaldehyde, allowing IHC analy­sis
on archival tissue. IHC immunophenotyping is routinely
used to differentiate subtypes of acute leukemias and lym-
phomas using panels of defined antibodies.
Similar to IHC, in ELISA, proteins are incubated with
an antibody linked to an enzyme where the abundance
of the protein is indicated by the extent of the enzymatic
activity. Unlike IHC, however, ELISA is performed on any
source where protein can be extracted and is routinely
used to detect peptides, proteins, antibodies and hormones
in clinical materials.
In contrast to IHC and ELISA, flow cytometry is uti-
lized to characterize protein expression on cells obtained
viably in single cell suspension. In flow cytometry, anti-
bodies conjugated to a fluo­rescent protein bind to a cell
surface (and/or in a cell that has been permeabilized for
detection of proteins within a cell) and are passed through
an electronic detection apparatus to enumerate the number
of cells expressing that protein. In this manner, panels of
antibodies with dif­fer­ent fluo­rescent proteins are utilized
to characterize numbers of proteins si­mul­ta­neously on
peripheral blood, bone marrow aspirate, and tissue fluid
samples. In addition, flow cytometry provides quantitative
information and has a level of sensitivity that allows it to
be used for testing of minimal residue disease following
treatment (described below). For both flow cytometry and
IHC, variations of ­these techniques have been developed
recently using antibodies conjugated to metal ions which
allows for the use of much larger number of antibodies
si­mul­ta­neously.
 Analytic techniques 17

Proteomic analy­sis relies on complex bioinformatic or functional means. For example, the promoter region
tools applied to mass spectroscopy data. In general, t­hese of a gene can be joined to the green fluo­rescent protein
techniques require some sort of separation of peptides, cDNA, and expression of this reporter can be assessed in
usually by liquid chromatography, followed by ionization vari­ous tissues in the resultant transgenic mouse. Use of
of the sample and mass spectrometry. In matrix-­associated such a reporter gene w ­ ill show the normal distribution
­laser desorption/ionization–­time of flight mass spectrom- and timing of the expression of the gene from which the
etry, the time of flight of the ions is detected and used to promoter ele­ ments are derived. ­ These transgenic mice
calculate a mass-­to-­charge ratio. The spectrum of mass-­ contain multiple copies of exogenous genes that have in-
to-­charge ratios pre­sent within a sample reflects the pro- serted randomly into the genome of the recipient and thus
tein constituents within the sample. Supervised or unsu- may not mimic physiologic levels or spatiotemporal ex-
pervised learning approaches, as described previously, are pression of the gene. In contrast, the endogenous ge­ne­
then used to identify patterns within the data. More re- tic locus of a gene can be manipulated in totipotent em-
cently, protein microarrays have been developed. Analyti- bryonic stem (ES) cells by targeted recombination between
cal protein microarrays are composed of a high density of the locus and a plasmid carry­ing an altered version of
affinity reagents (eg, antigens, antibodies) that can be used that gene that changes or disrupts its function. If a plas-
to detect the presence of specific proteins in a mixture. mid contains that altered gene with enough flanking DNA
Functional protein microarrays contain a large number of identical to that of the normal gene locus, homologous
immobilized proteins; ­these arrays can be used to examine recombination w ­ ill occur at a low rate; however, cells
protein-­ protein, protein-­lipid, protein–­
nucleic acid, and undergoing the desired recombination can be enriched by
enzyme-­substrate interactions. Although all of t­hese tech- including a se­lection marker in the plasmid, such as the
nologies hold enormous potential, clinical applications neomycin re­sis­tance gene. The correctly targeted ES cell
have yet to be realized. is then introduced into the blastocyst of a developing em-
bryo. The resultant animals ­will be chimeric, in that only
Animal models some of the cells in the animal w ­ ill contain the targeted
Analy­sis of both inherited and acquired diseases by reverse gene. If the new gene becomes part of the germline, off-
ge­ne­tics has resulted in the identification of many disease-­ spring can be bred to yield mice carry­ing the mutation in
related genes for which the function is unknown. Once a all cells. Knockout mice (homozygous for a null allele)
disease-­related gene has been identified, ­either by linkage can illuminate the function of the targeted gene by ana-
mapping (eg, the gene for cystic fibrosis) or by identifying lyzing the phenotype of mice that lack the gene product.
rearranged genes (eg, the BCR gene at the breakpoint of Similar approaches can be used to replace a normal mouse
the Philadelphia chromosome), the challenge lies in iden- gene in ES cells with a version containing a point muta-
tifying the function of the protein encoded by that gene tion, deletion, or other ge­ne­tic variant to model abnor-
and characterizing how changes in the gene can contribute malities detected in patients with hematologic disorders.
to the disease phenotype. Understanding the role of ­these Many genes of interest participate in pathways that are
genes and their encoded proteins has been aided greatly by vital for viability or fertility; thus, constitutive knockout
the development of techniques to alter or introduce ­these mice cannot be generated. Conditional gene modification
genes in mice using recombinant DNA technology. using Cre-­loxP technology allows the gene of interest to
Mice can be produced that express an exogenous gene be altered in specific tissues or at specific times during
and thereby provide an in vivo model of the gene’s func- development or postnatal life. This is accomplished by
tion. Linearized DNA is injected into a fertilized mouse inserting the altered gene with flanking DNA containing
oocyte pronucleus, and the oocyte is then reimplanted loxP sites. If mice with paired loxP sites integrated into
into a pseudopregnant mouse. The resultant transgenic their genome are bred with a second strain of mice that
mice then can be analyzed for phenotypes induced by the express an enzyme called Cre recombinase, recombina-
exogenous gene. Placing the gene ­under the control of a tion w ­ ill take place between the loxP sites, removing or
strong constitutive promoter, which is active in all tis- rearranging the desired portion of the gene. Furthermore,
sues, allows for the assessment of the effect of widespread expression of the Cre recombinase can be regulated in a
overexpression of the gene. Alternatively, placing the gene tissue-­specific manner by using an appropriate promoter
­ ill elucidate the function or in a temporally restricted manner by using a promoter
­under a tissue-­specific promoter w
of that gene in an isolated tissue. A third approach is to use that is induced by treatment of the mice with a drug (such
the control ele­ments of the gene to drive the expression of as tetracycline). The use of transgenic, knockout, and con-
a gene that can be detected by chemical, immunologic, ditional knockout mice has been invaluable in elucidating

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 18
the function of large numbers of genes implicated in the
pathogenesis of both inherited and acquired diseases.
Transgenic technology, however, is laborious, time con-
suming, and expensive. Some of t­hese disadvantages can
be circumvented by using rapidly reproducing and inex-
pensive organisms, such as zebrafish or yeast. Like trans-
genic mice, however, ­these models may not recapitulate
human-­specific pathophysiology. Newer technology using
dedifferentiated somatic cells reprogrammed to become
totipotent cells may overcome some of ­these obstacles.
­T hese cells, called induced pluripotent stem (iPS)
cells, are produced by reprogramming adult somatic cells
to become embryonic-­like cells, which, in turn, can be
further differentiated along specific lineages. The concrete
demonstration that iPS cells may be used to treat disease
was replacement of the sickle globin gene with a normal
β-­globin gene in mice. Corrected iPS cells from sickle mice
­were differentiated into hematopoietic progenitors in vitro,
and ­these cells ­were transplanted into irradiated sickle mice
recipients. Erythroid cells derived from ­these progenitors
synthesized high levels of ­human hemoglobin A and cor-
rected the sickle cell disease phenotype. ­Human iPS cells
have been produced and hold ­great promise as research
tools and possibly as a source of tissue replacement.
Given the time required for conventional gene target-
ing using homologous recombination, ­there has been ­great
­interest in the recent development of genome editing
using zinc fin­ger nucleases, transcription activator–​
like effector nucleases (TALENs), and CRISPR/Cas
(clustered regulatory interspaced short palindromic
repeat/Cas-­ based RNA-­ guided DNA endonucle-
ases). Each of t­hese techniques makes use of a nuclease
that induces DNA breaks and then stimulates DNA repair
in a way that allows for creation of specific mutations and/
or inclusions of novel sequences of DNA. The nucleases
are linked to sequence-­specific DNA binding modules
that allow for creation of mutations in specific locations
of the genome. ­These techniques have allowed for rapid
generation of knockout and knockin mice in embryonic
or somatic stem cells to rapidly create genet­ically engi-
neered animal models.
Clinical applications of DNA technology
in hematology
Molecular biology has revolutionized the understanding
of molecular pathogenesis of disease in ways that have
profoundly affected the diagnostic armamentarium of the
hematologist. Several examples of how molecular studies
are used for diagnosis and clinical decision-­making in he-
matology are described in this section.
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
1. Molecular basis of hematology
Applications to germline (inherited) mutations
Hemoglobinopathies and thalassemias
One of the best examples of the use of molecular techniques
in benign hematology is in the diagnosis of hemoglobin-
opathies and thalassemia. Although the most common
hemoglobin variants (ie, Hb S, Hb C, Hb D) typically
are diagnosed using nonmolecular methods, such as high-­
performance liquid chromatography or protein electro-
phoresis, molecular testing can be useful in several settings,
including the characterization of uncommon variants,
­
­family screening studies, and prenatal diagnosis. Hemoglo-
bin variants may be detected by a variety of techniques,
including PCR using allele-­specific primers designed
to detect specific mutations or sequencing studies of the
HBA1/A2 and HBB loci. Molecular techniques are par-
ticularly valuable in the diagnosis of α-­thalassemia, which
usually is caused by one of several variably sized deletions
that result in the loss of one or both HBA genes in the α-­
globin locus. In the neonatal period, α-­thalassemia may be
recognized by the presence of Hb Barts (4 tetramers) on
electrophoresis or high-­ performance liquid chromatog-
raphy, but laboratory diagnosis ­after the neonatal period
requires molecular techniques. Deletions of the α-­globin
locus can be detected by gap-­ PCR, which uses PCR
primers that bind to ­either side of a deletion breakpoint. In
the absence of the corresponding deletion, the primers are
too far apart to yield an amplifiable product. When a dele-
tion is pre­sent, however, an abnormal amplicon is detected.
Pharmacogenomics
Pharmacogenomics is the study of how inherited ge­ne­tic
variation affects the body’s response to drugs. The term
comes from the words pharmacology and genomics and is thus
the intersection of both disciplines. For instance, homozy-
gous germline polymorphisms in the thiopurine methyl-
transferase (TPMT) gene result in loss of functional protein
and predispose ALL patients to severe hematologic toxicity
­unless the dose of mercaptopurine is reduced by 90% to
95% of normal. Heterozygote individuals also require dose
reductions to a lesser extent than homozygotes. PCR-­
based studies may be performed to identify the presence
of alleles associated with decreased TPMT function.
Applications to somatic (acquired) molecular
abnormalities
The power of molecular biology to provide impor­tant
insights into the basic biology of disease is perhaps most
dramatically shown by the evolving concepts of malig-
nancy. Several examples of how molecular techniques
have enhanced our understanding of the pathogenesis of
 Clinical applications of DNA technology in hematology
hematologic malignancies, as well as their diagnosis and
treatment, are provided in the following sections.
Gene rearrangement studies in lymphoproliferative
disease: T-­cell and B-­cell rearrangements
During the development of a mature lymphoid cell from
an undifferentiated stem cell, somatic rearrangements of the
immunoglobulin and T-­cell receptor loci take place, result-
ing in an extensive repertoire of composite genes that cre-
ates im­mense immunoglobulin and T-­cell diversity. ­These
somatic rearrangements result in deletion of intervening
DNA sequences between gene segments in the immuno-
globulin and T-­cell receptor loci. The details of this pro­cess
in lymphocyte ontogeny are further outlined in Chapter 21.
Rearrangements in immunoglobulin and T-­cell recep-
tor genes can be detected by ­either Southern blotting or
PCR; however, PCR-­based approaches using standardized,
comprehensive primer sets such as t­hose developed by the
EuroClonality consortium (so called BIOMED-2 prim-
ers) are now preferentially used in the clinical setting due
to the fact that they are more rapid, require less DNA, and
can be performed on archived formalin-­fixed, paraffin-­
embedded (FFPE) tissue. PCR-­based techniques targeting
IGH and IGK loci for B-­cell rearrangements and TCRG
and TCRB for T-­cell rearrangements are used to confirm
the presence of clonal lymphocyte populations in the pe-
ripheral blood, such as in T-­cell large granular lymphocyte
disorders, and also are power­ful ancillary techniques for
hematopathologists in the diagnosis of lymphoprolifera-
tive disorders from FFPE tissue (Figure 1-8). Despite their
power, molecular clonality studies should be carefully in-
terpreted in the context of the clinical, morphologic, and
immunophenotypic diagnosis. Clonal proliferations may
occur in some reactive conditions as well as in malignant
neoplasms. For example, clonal T-­ cell populations may
be detected in the setting of viral infections, such as with
Epstein-­Barr virus or cytomegalovirus, and clonal B-­cell
populations may be detected in some benign lymphoid
proliferations, such as marked follicular hyperplasia. Fur-
thermore, false-­positive PCR results may occur in several
circumstances; for example, when very small tissue sam-
ples are used, a few reactive T cells in the sample might re-
sult in the appearance of oligoclonal bands. False-­negative
results may occur as a result of tissue sampling, poor PCR
amplification, or lack of detection of specific rearrange-
ments using standardized primer sets.
Identification of cryptic translocations in
pediatric leukemia: prognostic significance
Several fusion events in pediatric acute leukemia that
carry prognostic significance are not detected by standard
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
19
cytoge­ne­tic techniques and require molecular testing for
identification. Examples include the ETV6-­RUNX1
­fusion that is pre­sent in ~20% of ­children with pre–­B-­cell
ALL and confers a favorable prognosis, as well as high-­
risk fusion events found in AML—­such as MLL-­AF10,
CBFA2T3-­GLIS2, NUP98-­KDM5A, and NUP98-­NSD1,
among o ­ thers. ­These can be detected by FISH, RT-­PCR,
or next-­gen sequencing approaches such as RNA-­seq or
whole genome sequencing. The identification of t­hese
­
lesions is impor­tant b­ ecause they impact the intensity of
chemotherapy treatment given to the patient up front, as
well as the recommendation for stem cell transplant in first
remission.
Prognostically significant mutations in normal
karyotype acute myeloid leukemia
Up to 40% of AML cases have no chromosomal abnor-
malities vis­ib­ le by conventional karyotyping. The prog-
nosis in ­these cases can be further refined by molecular
testing for mutations in vari­ous recurrently mutated genes,
including NPM1, FLT3, CEBPA, DNMT3A, and ­others.
NPM1 mutations, usually a 4-bp insertion in exon 12,
are found in approximately 35% of cases of AML. FLT3
mutations include variably sized duplications (internal tan-
dem duplications) or point mutations in the kinase do-
main and are found in approximately one-­third of AML
cases. Mutations in CEBPA are diverse and can be found
in approximately 10% of AML cases. Cases of AML with
a normal karyotype and a mutant NPM1/wild-­type FLT3
genotype or harboring biallelic CEBPA mutations are as-
sociated with a favorable prognosis. Furthermore, studies
have suggested that AML with mutated NPM1 or mutated
CEBPA each represent distinct clinicopathologic entities.
Using multivariate analy­sis, mutations in DNMT3A have
emerged as power­ful predictors of poor prognosis in AML.
Currently, a l­imited number of genes are routinely tested
in AML patients by conventional (Sanger) sequencing or
PCR assays. The use of next-­gen sequencing panels has
allowed for improved prognostic assessment and treatment
se­lection based on testing a larger number of recurring
mutations in myeloid neoplasms, including AML, MDSs,
and myeloproliferative neoplasms.
Minimal residual disease monitoring
The development of PCR has markedly increased the
sensitivity of tests available for the monitoring of MRD
in myeloid and lymphoid neoplasms. With the availability
of real-­time PCR, the relative abundance of specific tran-
scripts can now be monitored to assess trends of increase
or decrease over time. For example, real-­time quantitative
RT-­PCR is used routinely in CML to risk-­stratify patients
 20 1. Molecular basis of hematology

A VH DH JH

6 VH-FR1 primers JH primer

CTGTGCAAGAGCGGGCTATGGTTCAGGGAGTTATGGCTACTACGGTATGGACGTCTGG
CTGTGCAAGAGGACGAAACAGTAACTGCCTACTACTACTACGGTATGGACGTCTGG
CTGTGCAAGAGAGATAGTATAGCAGCTCGTACAACTGGTTCGACTCCTGG
B Heteroduplex analysis CTGTGCAAGAAGATCCGGGCAGCTCGTTTTGCTTTTGATATCTGG

Monoclonal
Monoclonal
CTGTGCAAGAGCCTCTCTCCACTGGGATGGGGGGCTACTGG

Polyclonal
Monoclonal cells CTGTGCAAGAGCAGCAGCTCGGCCCCCTTTGACATACTGG
Monoclonal in polyclonal Polyclonal CTGTGCAAGAGGACTTTGGATGCTTTGATATCTGG
cells background cells CTGTGCAAGAGGGTGGGAGCTACTAGACTACTGG

MW

H2O
CTGTGCAAGGGTAGCTAAACCTTTGACTACTGG
CTGTGCAATATCTACTTTGACTACTGG

Heteroduplexes C GeneScanning
Polyclonal

Denaturation (94°C)/renaturation (4°C)

Homoduplexes Monoclonal

Figure 1-8 Schematic diagram of heteroduplex analy­sis and GeneScanning of PCR products, obtained from rearranged
Ig and TCR genes. (A) Rearranged Ig and TCR genes (IGH in the example) show heterogeneous junctional regions with re­spect to
size and nucleotide composition. Germline nucleotides of V, D, and J gene segments are given in large capitals and randomly inserted
nucleotides in small capitals. The junctional region heterogeneity is employed in heteroduplex analy­sis (size and composition) and Gene­
Scanning (size only) to discriminate between products derived from monoclonal and polyclonal lymphoid cell populations. (B) In hetero-
duplex analy­sis, PCR products are heat denatured (5 min, 94°C) and subsequently rapidly cooled (1 h, 4°C) to induce duplex (homo-­or
heteroduplex) formation. In cell samples consisting of clonal lymphoid cells, the PCR products of rearranged IGH genes give rise to
homoduplexes a­ fter denaturation and renaturation, whereas in samples that contain polyclonal lymphoid cell populations the single-­strand
PCR fragments w ­ ill mainly form heteroduplexes, which result in a background smear of slowly migrating fragments upon electrophoresis.
(C) In GeneScanning, fluorochrome-­labeled PCR products of rearranged IGH genes are denatured prior to high-­resolution fragment
analy­sis of the resulting single-­stranded fragments. Monoclonal cell samples give rise to PCR products of identical size (single peak),
whereas in polyclonal samples many dif­fer­ent IGH PCR products are formed, which show a characteristic Gaussian size distribution.
Reprinted by permission from Macmillan Publishers Ltd (van Dongen J, et al. Leukemia. 2003;17:2257–2317).

based on transcript quantity rather than simply the pres-
ence or absence of a transcript (as discussed previously
in this chapter). The accuracy and reliability of real-­time
quantitative PCR as a mea­sure of BCR-­ABL1 transcript
level depends on the quality control procedures carried
out by the laboratory. Normalization of the results to an
appropriate control gene is required to compensate for
variations in RNA quality and the efficiency of the r­ everse
transcriptase reaction. BCR and ABL1 have been used as
control genes, and both seem to be suitable b­ ecause they
are expressed at low levels and have similar stability to
BCR-­ABL1. The introduction of internationally recog-
nized reference standards now has allowed for reporting of
results on the International Scale, which allows for direct
comparisons of results among laboratories, even t­hose using
dif­fer­ent control genes. A major molecular response to ima-
tinib has been defined as a 3-­log reduction in BCR-­ABL1
transcripts (BCR-­ABL1/reference gene) compared with a
standardized baseline obtained from patients with untreated
newly diagnosed CML, corresponding to 0.1% on the In-
ternational Scale.
In similar fashion, PCR analy­sis of immunoglobulin or
T-­cell receptor gene rearrangements allow the detection of
residual disease in the blood or bone marrow of patients
who have under­gone treatment of a lymphoid malignancy.
­Because each gene rearrangement is unique, however, the
PCR detection of gene rearrangements at this level of sen-
sitivity is ­labor intensive. PCR of tumor tissue is performed
using primers based on consensus sequences shared by the
variable and joining regions of the appropriate locus (immu-
noglobulin or T-­cell receptor genes). The specific rearrange-
ment must then be sequenced so that an oligo­nucleotide

Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf

by Manea Alqarni
 Clinical applications of DNA technology in hematology
specific to the unique rearrangement in that patient’s tu-
mor can be synthesized. PCR can then be performed us-
ing this allele-­specific oligonucleotide, with adequate
sensitivity to detect 1 in 106 cells. As t­hese assays become
increasingly available, they w
­ ill play an impor­tant role in es-
timating prognosis and determining eligibility for autolo-
gous transplantation and other therapeutic modalities.
In addition to MRD monitoring by molecular moni-
toring of DNA/cDNA retrieved from hematopoietic cells,
flow cytometric analy­sis to detect residual leukemic cells
in peripheral blood or bone marrow has also been heavi­ly
used for MRD monitoring in ALL and more recently in
pediatric AML (amongst other hematological malignan-
cies). Studies in pediatric T-­lineage ALL demonstrate that
while molecular techniques are more sensitive than flow
cytometry in detecting residual disease, this fails to predict
relapse more accurately. Similarly, in pediatric AML, MRD
levels of 0.01% by flow cytometry do not identify patients
at lower risk for relapse compared to ­those that achieve
less than 0.1% following induction chemotherapy, sug-
gesting that a threshold that predicts relapse exists beyond
which higher levels of sensitivity do not provide prognos-
tic relevance. Further efforts to understand the sensitivity
of flow cytometric MRD detection relative to molecular
techniques are underway. As the two techniques are com-
plementary, and ­there exist cases that are not suitable for
one or the other, both approaches can be used in tandem
to provide optimal prognostic information.
Expression profiling: applications to diagnosis
and treatment
Gene expression microarray studies have facilitated the
classification of lymphomas and outcome prediction for
specific patient populations with this disease. For example,
expression profiling was used to create a prediction model
that identified two categories of patients with diffuse large
B-­cell lymphoma: germinal center and activated B-­cell
types, which carry favorable and unfavorable prognoses, re-
spectively. In addition, expression profiling studies have iden-
tified genes overexpressed in patients with poor prognosis,
some of which may represent potential therapeutic targets.
Applications to stem cell transplantation
­ uman leukocyte antigen typing for stem cell
H to the discovery that naturally occurring double-­stranded
transplantation
Molecular techniques have been impor­tant to the further
understanding of the diversity of ­human leukocyte antigen
(HLA) genotypes. Serologic testing for HLA antigens often
identifies broad groups of cross-­reactive antigens. ­Because
­there is an increased incidence of severe graft-­versus-­host
disease in patients who receive transplantations from sero-
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
21
logically compatible but genotypically incompatible unre-
lated donors, it is impor­tant to identify the individual an-
tigens within ­these cross-­reactive groups. Genotypic HLA
typing can be achieved by PCR amplification of the HLA
locus, followed by hybridization to specific oligonucleotides
corresponding to the dif­fer­ent alleles within a given cross-­
reactive group. Such genotyping is much more predictive of
successful transplantation and the risk of graft-­versus-­host
disease than serologic study or the mixed lymphocyte as-
say, and it has supplanted t­hese assays for the identification
of optimal donors, especially unrelated donors. Compre-
hensive genotyping using SNP arrays may improve HLA
matching. This is discussed in detail in Chapter 12.
Analy­sis of bone marrow engraftment
When donor and recipient are of opposite sex, the as-
sessment of donor engraftment is based on conventional
cytoge­ne­tics and is relatively straightforward. When do-
nor and recipient are of the same sex, RFLP analy­sis of
donor and recipient bone marrow allows the detection of
polymorphic markers to distinguish DNA from the do-
nor and recipient. ­A fter transplantation, RFLP analy­sis of
recipient peripheral blood cells then can be used to docu-
ment engraftment, chimerism, graft failure, and disease re-
lapse. In most centers, PCR amplification and genotyping
of short tandem repeat or variable number tandem repeat
sequences that are polymorphic between donor and re-
cipient pairs are now used to assess chimerism.
Applications to novel therapies
Antisense and RNA interference therapy
The recognition that abnormal expression of oncogene
products plays a role in malignancy has led to the pro-
posal that suppression of that expression might reverse
the neoplastic phenotype. One way of blocking mRNA ex-
pression is through the use of antisense oligonucleotides.
­These are short pieces of single-­stranded DNA or RNA, 17
to 20 bases long, which are synthesized with a sequence
complementary to the transcription or the translation ini-
tiation site in the mRNA. T ­ hese short single-­stranded spe-
cies enter the cell freely, where they complex to the mRNA
through the complementary sequence. Investigation of the
mechanism of action of antisense oligonucleotides led
RNA molecules suppress gene expression better than an-
tisense sequences and helped to unravel the mechanism
of RNA interference. RNA interference has significant
advantages over antisense therapy in that much lower con-
centrations are required. Numerous studies are u ­ nder way
in hematologic diseases; however, methods for delivery of
siRNAs are still far from perfect. In one study, adult stem
 22
cells from sickle cell patients ­were infected with a viral
vector carry­ing a therapeutic γ-­globin gene harboring an
embedded siRNA precursor specific for sickle β-­globin.
The newly formed red blood cells made normal hemo-
globin and suppressed production of sickle β-­globin. In
another study, a retroviral system for stable expression of
siRNA directed to the unique fusion junction sequence
of ETV6-­PDGFRB resulted in profound inhibition of
ETV6-­PDGFRB expression and inhibited proliferation
of ETV6-­PDGFRB–­transformed cells. When applied to
mice, this strategy slowed tumor development and death
in mice injected with ­these cells compared with cells not
containing the siRNA. Stable siRNA expression sensi-
tized transformed cells to the PDGFRB inhibitor ima-
tinib, suggesting that stable expression of siRNAs, which
target oncogenic fusion genes, may potentiate the effects
of conventional therapy for hematologic malignancies.
Gene therapy
The application of gene therapy to ge­ne­tic hematologic
disorders has long been an attractive concept. In most cases,
this involves insertion of normal genes into autologous
hematopoietic stem cells with subsequent transplantation
back into the patient. Candidate hematologic diseases for
such therapy include hemophilia, sickle cell disease, thal-
assemia, and severe combined immune deficiency syn-
drome. Rapid advances in technology for the separation
of hematopoietic stem cells and techniques of gene trans-
fer into ­those cells have advanced efforts ­toward this goal,
and many clinical t­rials have been completed. Although
significant methodologic hurdles remain, research in this
field continues to move forward. It should be recognized,
however, that correction of such diseases as hemophilia,
sickle cell disease, and thalassemia requires efficient gene
transfer to a large number of hematopoietic stem cells with
high levels of expression of the β-­globin gene in erythroid
precursors. Long-­term repopulating stem cells have been
relatively resistant to ge­ne­tic modification; thus, many in-
vestigators have focused on gene therapy applications in
which low levels of expression could restore patients to
health. A major impediment to successful gene therapy
has been the lack of gene delivery systems that provide
safe, efficient, and durable gene insertion and that can
specifically target the cells of interest. An impor­ tant
safety concern with viral vectors that integrate into the
host genome is the potential to activate oncogenes or in-
activate tumor suppressor genes by insertional mutagen-
esis. Currently used approaches include retroviral vectors,
adenoviral vectors, other viral vectors, and nonviral vec-
tors. One of the more recent successes in the field that has
overcome ­these challenges has been recently reported for
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
1. Molecular basis of hematology
hemophilia B. High expression levels of a functional ­factor
IX was found in patients treated with a single injection of
adeno-­associated viral vector containing a hyperfunctional
­factor IX variant gene. All participants in the study had
sustained ­factor IX levels one-­third of the normal value,
with dramatically reduced annual bleeding rates.
Glossary
alleles Alternative forms of a par­tic­u­lar gene.
allele-­specific oligonucleotide An oligonucleotide whose se-
quence matches that of a specific polymorphic allele. For ex-
ample, oligonucleotides matching the sequence of unique im-
munoglobulin or T-­cell receptor gene rearrangements that are
used for polymerase chain reaction (PCR) detection of minimal
residual disease (MRD).
alternative splicing Selective inclusion or exclusion of certain
exons in mature RNA by utilization of a varied combination of
splicing signals.
antisense oligonucleotides Oligonucleotides with a base se-
quence complementary to a stretch of DNA or RNA coding
sequence.
ATAC seq High-­throughput sequencing approach to mea­sure
DNA accessibility.
capping Addition of the nucleotide 7-­methylguanosine to the
5′ end of mRNA. This is a structure that appears to stabilize the
mRNA.
chimera An organism containing two or more dif­fer­ent popu-
lations of genet­ically distinct cells (as in chimeric mice gener-
ated by microinjection of embryonic stem cells into a develop-
ing blastocyst or chimerism of donor and recipient cells a­fter
allogeneic stem cell transplantation). Also used to describe tran-
scripts that fuse coding sequences from dif­fer­ent genes as a result
of chromosomal rearrangements.
chimeric antigen receptor T cells (CAR T cells) Genet­
ically modified T cells engineered to express an artificial T-­cell
receptor that recognizes a specific tumor-­associated antigen.
ChIP-­Seq A combination of chromatin immunoprecipitation
followed by next-­gen sequencing used to identify protein-­DNA
interactions.
chromatin A complex of genomic DNA with histone and non­
histone proteins.
chromosome A large linear DNA structure tightly complexed
to nuclear proteins.
cis-­acting regulatory ele­ments Sequences within a gene locus,
but not within coding sequences, that are involved in regulating
the expression of the gene by interaction with nuclear proteins.
clonal Arising from the expansion of a single cell.
coding sequence The portion of the gene contained within ex-
ons that encodes the amino acid sequence of the protein product.
 Glossary
codon The 3-­nucleotide code that denotes a specific amino acid.
comparative genomic hybridization (CGH) A technique
allowing for the detection of subtle chromosomal changes (dele-
tions, amplifications, or inversions that are too small to be de-
tected by conventional cytoge­ne­tics techniques).
complementary Sequence of the second strand of DNA that
is determined by strict purine–­pyrimidine base pairing (A-­T;
G-­C).
complementary DNA (cDNA) Double-­stranded DNA prod-
uct from an RNA species. The first strand is synthesized by re-
verse transcriptase to make a DNA strand complementary to the
mRNA. The second strand is synthesized by DNA polymerase
to complement the first strand.
constitutive promoter A promoter that drives high-­level ex-
pression in all tissues.
copy number variant A segment of DNA at least 1 kb in
length that varies in copy number between individuals.
CRISPR/Cas (clustered regulatory interspaced short
palindromic repeat/Cas-­ based RNA-­ guided DNA en-
donucleases) A technology which combines the Cas DNA
nuclease with the sequence-­specific DNA recognition module
of CRISPR to create targeted ge­ne­tic alterations in DNA.
cytoge­ne­tics The study of the chromosomal makeup of a cell.
degenerate Characteristic of the ge­ne­tic code whereby more
than one codon can encode the same amino acid.
Dicer A component of the pro­cessing mechanism that gener-
ates microRNAs and siRNAs.
Drosha A component of the pro­cessing mechanism for forma-
tion of microRNAs.
enhancer A cis-­acting regulatory sequence within a gene locus
that interacts with nuclear protein in such a way as to increase
the expression of the gene.
enzyme-­linked immunosorbent assay (ELISA) A method
used to detect and quantify proteins (such as peptides, pro-
teins, antibodies and hormones) using an antibody linked to an
­enzyme.
epigenet­ics Changes in gene expression caused by mechanisms
other than alteration of the under­lying DNA sequence. Includes
DNA methylation and histone modification. The changes are
heritable in ­daughter cells but can be modified pharmacologi-
cally (eg, methyltransferase inhibitors, histone deacetylase inhibi-
tors) or by normal enzymatic pro­cesses.
exome The set of all protein-­coding portions of genes (exons)
in the genome.
exon The portion of a structural gene that encodes protein.
flanking sequences DNA sequences lying 5′ and 3′ of a struc-
tural gene that frequently contain impor­
tant regulatory ele­
ments.
flow cytometry A method to quantify protein expression on
cells using antibody where the cell with antibody bound are
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
23
passed in a single suspension through a machine with a ­laser to
detect abundance.
fluorescence in situ hybridization (FISH) High-­resolution
mapping of genes by hybridization of chromosome spreads to
biotin-­labeled DNA probes and detection by fluorescent-­tagged
avidin.
frameshift mutation A mutation within the coding sequence
of a gene that results from deletion or insertion of a nucleo-
tide that disrupts the 3-­base codon structure of the gene, thereby
altering the predicted amino acid sequence of the protein en-
coded by that gene.
gene A functional ge­ne­tic unit responsible for the production
of a given protein, including the ele­ments that control the tim-
ing and the level of its expression.
gene expression profile Analy­sis of the global expression of a
collection of cells using hybridization of mRNA to microarrays.
gene regulation A pro­cess controlling the timing and level of
expression of a gene.
ge­ne­tic code The system by which DNA encodes specific
proteins through 3-­nucleotide codons, each encoding a specific
amino acid.
genomics The study of the entire DNA sequence of organisms
and interactions among vari­ous ge­ne­tic loci.
Hi-­C A next-­generation sequencing approach to identify long-­
range chromatin interactions genome wide.
homologous recombination Alteration of ge­ne­tic material
by alignment of closely related sequences. In targeting genes by
homologous recombination, plasmids that contain altered genes
flanked by long stretches of DNA that match the endogenous
gene are introduced into embryonic stem cells. A rare recombi-
nation event ­will cause the endogenous gene to be replaced by
the mutated gene in the targeting plasmid. This is the means by
which knockout mice are obtained.
immune checkpoint inhibitors Monoclonal antibodies di-
rected against molecules that mediate T-­cell inhibitory signals
such as CTLA-4, PD-1 and its ligand PD-­L1.
immunohistochemistry (IHC) A method of detecting pro-
teins in tissue sections using antibodies linked to substrates that
allow for visual detection of antibody-­protein binding abun-
dance in situ.
imprinting A ge­ne­tic pro­cess in which certain genes are ex-
pressed in a parent-­of-­origin–­specific manner.
induced pluripotent stem (iPS) cells A type of pluripotent
stem cell derived from a somatic cell that is generated by expos-
ing the somatic cell to ­factors that reprogram it to a pluripotent
state.
intron An intervening sequence of noncoding DNA that in-
terrupts coding sequence contained in exons.
knockin mouse A mouse in which nucleotides have been in-
serted into the mouse genome to allow expression of protein not
normally encoded by the mouse genome.
 24
knockout mouse A mouse in which both of the copies of a
gene have been disrupted by a targeted mutation. Such muta-
tions are achieved by homologous recombination using plasmids
containing the mutated gene flanked by long stretches of the
normal endogenous gene sequence. Mice that are heterozygous
in the germline for the targeted allele can be bred to generate
mice that lack both copies of the normal (wild-­type) gene.
leucine zipper Leucine-­rich side chains shared by a group
of transcription f­actors that allow protein-­protein and protein-­ polyadenylation Alteration of the 3′ end of mRNA by the
DNA interactions.
linkage mapping Analy­sis of a gene locus by study of inheri- appear to protect the mRNA from premature degradation.
tance pattern of markers of nearby (linked) loci.
methylation DNA modification by addition of methyl groups
to cytosine residues within genomic DNA. Hypermethylation
of clustered CpG groups in promoter regions (CpG islands) is
a characteristic of transcriptionally inactive DNA; reduction in
methylation is generally associated with increased transcriptional
activity.
microarray A glass slide or silicon chip on which cDNAs or
oligonucleotides have been spotted to allow for the simultane-
ous analy­sis of expression of hundreds to thousands of individual
mRNAs. Hybridization of labeled cDNAs from a tissue of in-
terest allows the generation of a gene expression profile.
microRNAs Small RNA molecules encoded in the genomes
of plants and animals. ­These highly conserved, approximately
21-­mer RNAs regulate the expression of genes both by chang-
ing stability of mRNAs as well as by translational interference.
missense mutation A mutation within the coding sequence
of a gene that results from a single nucleotide change which
alters the encoded amino acid leading to a change in protein
function.
next-­generation (next-­gen) sequencing Massively parallel
sequence production from single-­molecule DNA templates.
noncoding sequences DNA sequences that do not directly
encode protein.
nonsense mutation A nucleotide change converting an amino
acid coding codon to a stop codon.
nonsense-­mediated decay Nonsense mutation (premature
stop codon) of one allele of an mRNA may result in degrada-
tion of the abnormal mRNA.
Northern blotting Analy­sis of RNA expression by gel elec-
trophoresis, transfer to nitrocellulose or nylon filter, and hybrid-
ization to a single-­stranded probe.
nucleic acid hybridization A technique of nucleic acid
analy­
sis via association of complementary single-­
stranded
­species.
nucleotide A basic building block of nucleic acids, composed
of a sugar moiety linked to a phosphate group and a purine or
pyrimidine base.
oligonucleotide A short single-­stranded DNA species, usually
composed of 15 to 20 nucleotides.
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
1. Molecular basis of hematology
oncogene Cellular gene involved with normal cellular growth
and development, the altered expression of which has been im-
plicated in the pathogenesis of the malignant phenotype.
partial uniparental disomy A situation in which two copies
of a chromosome, or part of a chromosome, are derived from
one parent and no copies derive from the other parent. In a
somatic cell, this can result in progeny with two copies of the
wild-­type allele or two copies of the mutant allele.
addition of a string of adenosine nucleotides (“poly-­A tail”) that
polymorphism A phenotypically s­ ilent mutation in DNA that
is transmitted from parent to offspring.
pre-­messenger RNA Unpro­cessed primary RNA transcript
from DNA, including all introns.
promoter Region in the 5′ flanking region of a gene that is
necessary for its expression; includes the binding site for RNA
polymerase II.
proteomics The systematic study of the entire complement of
proteins derived from a cell population.
purine ­Either of two of the bases found in DNA and RNA:
adenine and guanine.
pyrimidine One of the following bases found in DNA and
RNA: cytosine and thymine in DNA; cytosine and uracil in RNA.
quantitative PCR PCR in which the product is quantitated
in comparison to the PCR product resulting from a known
quantity of template. This allows quantitation of the template in
the reaction; it can, for example, allow an estimate of the degree
of contamination with tumor cells in a cell population.
real-­time PCR An automated technique for performing
quantitative PCR using a fluorogenic reporter to detect levels of
target sequences during early cycles of the PCR reaction.
restriction endonucleases Enzymes produced by bacteria that
cleave double-­stranded DNA at specific recognition sequences.
restriction fragment-­ length polymorphism (RFLP) A
polymorphism in which a s­ilent mutation occurs within the
recognition sequence for a restriction endonuclease. This results
in an alteration in the size of the DNA fragment resulting from
digestion of DNA from that DNA locus.
reverse transcriptase An enzyme encoded by retroviruses that
mediates conversion of RNA to complementary DNA.
reverse transcriptase polymerase chain reaction (RT-­PCR)
Amplification of RNA sequences by conversion to cDNA by
reverse transcriptase, followed by the polymerase chain reac-
tion.
ribosome A ribonuclear protein complex that binds to mRNA
and mediates its translation into protein by reading the ge­ne­tic
code.
RNA expression array An array-­based technique used to de-
termine the abundance of each of the known mRNAs (the gene
expression profile) in a group of cells.
 Bibliography
RNA-­ induced silencing complex (RISC) A multiprotein
complex that combines with microRNAs to target complemen-
tary mRNA for degradation or translation inhibition.
RNA polymerase II An enzyme that mediates transcription of
most structural genes.
RNA-­seq Next-­gen sequencing using RNA templates.
silencer A cis-­acting regulatory sequence within a gene locus
that interacts with nuclear protein in such a way as to decrease
the expression of the gene.
single-­nucleotide polymorphism (SNP) Naturally occur-
ring inherited ge­ne­tic variation between individuals at the level
of single nucleotides.
small interfering RNAs (siRNAs) Small RNAs that act
in concert with large multiprotein RISCs to cause cleavage of
complementary mRNA or prevent its translation.
Southern blotting Analy­sis of DNA by gel electrophoresis,
transfer to nitrocellulose or nylon filter, and hybridization to
single-­stranded probe.
splicing The pro­cess by which intron sequences are removed
from pre-­mRNAs.
telomeres Nucleoprotein structures at the ends of chromosomes
that protect chromosome ends from degradation and fusion.
termination codon One of three codons that signal the ter-
mination of translation.
trans-­acting ­factor A protein that interacts with cis-­acting reg-
ulatory region within a gene locus to regulate transcription of
that gene. Also called transcription f­actor.
transcription The pro­cess by which pre-­mRNA is formed from
the DNA template.
transcription activator–­like effector nucleases (TALENs)
Artificial restriction enzymes with sequence-­ specific DNA
binding activity which can be utilized to create specific ge­ne­tic
alterations in DNA.
transcription ­factor A protein that interacts with cis-­acting
regulatory region within a gene locus to regulate transcription
of that gene. Also called trans-­acting ­factor.
transfer RNA (tRNA) Small RNA molecules that bind to
the ribosome and covalently bind specific amino acids, allowing
translation of the ge­ne­tic code into protein.
transgenic mouse A mouse that expresses an exogenous gene
(transgene) introduced randomly into its genome. Linearized
DNA is injected into the pronucleus of a fertilized oocyte, and
the zygote is reimplanted. Resultant mice ­will carry the trans-
gene in all cells.
translation The pro­cess by which protein is synthesized from
an mRNA template.
translocation breakpoint Site of junction of two aberrantly
juxtaposed (translocated) chromosomal fragments.
tumor suppressor A gene that promotes tumor development
when deleted or inactivated.
Downloaded from https://ashpublications.org/books/chapter-pdf/10582/ashsap7.ch01.pdf
by Manea Alqarni
25
Western blotting Detection of specific proteins via binding of
specific antibody to protein on a nitrocellulose or nylon mem-
brane.
zinc fin­ger A structural feature shared by a group of transcrip-
tion ­factors. Zinc fin­gers are composed of a zinc atom associated
with cysteine and histidine residues; the fin­gers appear to inter-
act directly with DNA to affect transcription.
zinc fin­ger nucleases Artificial restriction enzymes generated
by fusing a zinc fin­ger DNA binding domain to a DNA-­cleavage
domain for use in creating specific genomic alterations in DNA.
Bibliography
Alizadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse
large B-­cell lymphoma identified by gene expression profiling.
Nature. 2000;403(6769):503–511. One of the first papers to demonstrate
diversity in gene expression among diffuse large B-­cell lymphomas and the
fact that gene expression reflects tumor proliferation rate, host response, and
differentiation state of the tumor.
George LA, S­ ullivan SK, Giermasz A et al. Hemophilia B gene ther-
apy with a high-­specific-­activity f­actor IX variant. N Engl J Med.
2017;377(23):2215–2227. Successful example of the use of gene therapy
for the treatment of hemophilia.
Goodwin S, McPherson JD, McCombie WR. Coming of age: ten
years of next-­generation sequencing technologies. Nat Rev Genet.
2016;17(6):333–351. Review of next-­generation sequencing techniques
and methodologies.
Hammond SM. Dicing and slicing: the core machinery of the RNA
interference pathway. FEBS Lett. 2005;579(26):5822–5829. A review
describing the discovery of the RNA interference pathway and discussion of
­future lines of work.
Hanna J, Wernig M, Markoulaki S, et al. Treatment of sickle cell
anemia mouse model with iPS cells generated from autologous skin.
Science. 2007;318(5858):1920–1923. Using a humanized sickle cell
anemia mouse model, t­hese investigators showed that mice can be rescued
­after transplantation with corrected hematopoietic progenitors obtained in vi-
tro from autologous iPS cells.
Hughes T, Branford S. Molecular monitoring of BCR-­ABL as a
guide to clinical management in chronic myeloid leukaemia. Blood
Rev. 2006;20(1):29–41. A description of the use of real-­time PCR to
monitor BCR-­ABL transcripts in chronic myeloid leukaemia.
Jackson HJ, Rafiq S, Brentjens RJ. Driving CAR T-­cells forward. Nat
Rev Clin Oncol. 2016;13(6):370–383. A review of CAR T cells.
Plongthongkum N, Diep DH, Zhang K. Advances in the profiling
of DNA modifications: cytosine methylation and beyond. Nat Rev
Genet. 2014;15(10):647–661. A review of DNA cytosine methylation and
other modifications of DNA cytosines.
Sander JD, Joung JK. CRISPR-­Cas systems for editing, regulating
and targeting genomes. Nat Biotechnol. 2014;32(4):347–355. A review
of CRISPR-­Cas technology for genome-­editing.
Volpi EV, Bridger JM. FISH glossary: an overview of the fluorescence
in situ hybridization technique. BioTechniques. 2008;45(4):385–409.
A succinct review of the many FISH strategies available.
 2
The role of the hematology
consultant 26
Consultation for surgery and
invasive procedures 27
Common inpatient consultations 34
Consultation for hematologic
complications of solid organ
transplantation 41
Common outpatient hematology
consultations 44
Hematology consultations in
pediatric patients 50
Bibliography 59
The online version of this
chapter contains educational
multimedia components on normal
hematopoiesis and the mechanism
of action of anticoagulants.
26
Consultative hematology I:
hospital-based and selected
outpatient topics
NATHAN T. CONNELL
AND SHANNON L. CARPENTER
The role of the hematology consultant
A hematology consultant provides expert advice about the diagnosis and man-
agement of benign or malignant hematologic disorders to requesting physicians
and other health care providers. A consultation request might involve an adult
general medical patient, a child or adolescent, a pregnant woman, a periopera-
tive patient, or an individual who is critically ill. Other consultative respon-
sibilities of the hematologist may include serving on committees that maintain
a formulary, developing clinical practice guidelines, establishing policies and
procedures for transfusion services, or monitoring quality and efficiency. The
setting of a consultation can be inpatient or outpatient and the timing emer-
gent, urgent, subacute, or more planned. Imperative to an effective and efficient
consultation, both the referring clinician and the hematology consultant must
have a clear understanding of the extent of the clinical questions being asked,
which in turn will guide the aim and comprehensiveness of the consult. In the
era of rising health care costs, expert hematology consultation must seek to be
cost effective by curtailing unwarranted diagnostic and therapeutic measures.
With that in mind, the American Society of Hematology (ASH) Choosing
Conflict-of-interest (COI) disclosure: Dr. Connell: Membership on Board of Directors:
The Michael H. Flanagan Foundation. Dr. Carpenter: Consultant: CSL Behring, Kedrion
Biopharmaceuticals, HEMA Biologics, Novo Nordisk Phar maceuticals, Inc., Bayer,
Genentech. Membership on Board of Directors: Hemostasis Thrombosis Research Society,
American Thrombosis and Hemostasis Network. Grant Funding: Shire, CSL Behring.
Off-label drug use: Drs. Carpenter and Connell: corticosteroids and rituximab for use
in TTP; ATIII and activated protein C for DIC; cyclophosphamide, corticosteroids, IVIG,
and rituximab for CAPS; corticosteroids, intravenous immunoglobulin, rituximab, and
thrombopoietin receptor agonists for pediatric ITP; rituximab for adult ITP and TTP;
granulocyte-stimulating factor outside of severe congenital neutropenia. Desmopressin for
use in platelet function disorders; desmopressin, recombinant FVIIa, prothrombin complex
concentrate, activated prothrombin complex concentrate, fibrin glue, ε-aminocaproic acid,
and tranexamic acid for use in surgical bleeding and reversal of direct oral anticoagulants;
IVIG for posttransfusion purpura; IVIG for drug-induced ITP; conjugated estrogens for use
in uremic bleeding; hemoglobin-based oxygen carriers for anemia in patients who refuse
blood products; IVIG and erythropoietin for use in parvovirus-associated pure red cell
aplasia; angiotensin-converting enzyme inhibitors and angiotensin receptor blockers for use
in post–renal transplant erythrocytosis; rituximab for use in CD20+ posttransplant lympho-
proliferative disorders.
Consultation for surgery and invasive procedures
Wisely campaign seeks to identify and educate clinicians
on commonly performed tests or procedures within the
realm of hematology that are unnecessary, not supported
by evidence, duplicative, and potentially harmful (http://­
www​.­hematology​.­org​/­Clinicians/​ ­Guidelines-​ ­Quality/​ ­502​
.­aspx). A clinical hematologist must understand the princi­
ples of effective consultation and the extreme importance
of interphysician communication (­Table 2-1). Con­sul­tants
need to communicate effectively—­not only with other staff
physicians and con­sul­tants, but also with ancillary members
of the health care team, ­house staff, fellows, students, and the
patient and f­ amily. A commitment to effective communi-
cation ensures maximal compliance with recommendations
and the highest quality of multidisciplinary patient care.
This chapter discusses some of the most common he-
matological consultations, including preoperative manage-
ment of hematological disorders, inpatient and outpatient
consultations, and specific issues pertaining to pediatric he-
matology.
Consultation for surgery
and invasive procedures
CLINIC AL C ASE
A 34-­year-­old female with systemic lupus erythematosus
(SLE) has been referred to your hematology clinic for periop-
erative management of her anticoagulation. She was recently
diagnosed with antiphospholipid syndrome (APLS) during
the workup for a large right ­middle ce­re­bral artery infarct
3 months ago. She is on warfarin with an international
normalized ratio (INR) goal of 2.0 to 3.0 with approximately
80% time in therapeutic range. She now requires a tooth
extraction for an abscessed tooth that has not responded to
medical therapy. In light of the patient’s APLS and history
of cerebrovascular accident, you judge her thrombotic risk
to be high if warfarin is interrupted. ­Because of the risk of
infection progressing, the surgery cannot be delayed. The
oral surgeon is concerned about the patient’s bleeding risk.
You advise the patient to continue warfarin at the current
dose and prescribe an adjuvant mouthwash containing
ε-­aminocaproic acid to control local bleeding.
Perioperative management
of antithrombotic therapy
Hematologists are often consulted to provide recommen-
dations on temporary interruption of antithrombotics for
a surgery or procedure (see video file in online edition on
mechanism of action of anticoagulants). The perioperative
27
management of patients taking antiplatelet or anticoagulant
drugs is based on (i) an assessment of risk for periop-
erative bleeding and (ii) an assessment of the patient’s risk
for thromboembolism. ­These considerations are used to
deter­mine ­whether antithrombotic therapy should be in-
terrupted prior to surgery and, if so, ­whether bridging anti-
coagulation should be considered.
Assessment of risk for perioperative bleeding
Bleeding risk is related to both surgical and host f­actors.
Surgical ­factors include the location and extent of the
intervention, the vascularity and fibrinolytic activity of
the surgical bed, the compressibility of the site and the
ability to achieve surgical hemostasis, and the possibil-
ity that the procedure may induce a hemostatic defect
(eg, platelet dysfunction due to cardiopulmonary bypass).
Host ­factors include the presence of an under­lying con-
genital or acquired hemostatic defect and use of drugs
that affect hemostasis.
A focused medical history should include a detailed per-
sonal history of abnormal bleeding; response to prior he-
mostatic challenges, such as surgeries, trauma, and child-
birth; and comorbidities or use of medi­cations that could
affect hemostasis. Patients should be queried specifically
about common procedures such as tooth extraction and
tonsillectomy, which they may not think to mention ­unless
prompted. Vari­ous bleeding assessment tools have been
published with varying degrees of sensitivity and specific-
ity for inherited bleeding disorders and may help guide
who should undergo additional testing. A careful ­family
history of bleeding is crucial, particularly in patients who
may not have under­gone extensive prior hemostatic chal-
lenges themselves. A targeted physical examination for
stigmata of bleeding and evidence of comorbid condi-
tions that may affect hemostasis, such as liver disease or a
connective tissue or vascular disorder, should be performed
as a complement to the history.
Preoperative hemostatic laboratory testing (ie, aPTT/
PT) is neither cost effective nor informative in patients
without a personal or ­family history suggestive of a bleed-
ing disorder. However, if the history or physical exami-
nation is suggestive of a bleeding diathesis, preoperative
testing should include a platelet count, prothrombin time
(PT), and activated partial thromboplastin time (aPTT).
Normal initial testing does not exclude a clinically impor­
tant bleeding diathesis such as a platelet function defect,
von Willebrand disease, mild f­actor deficiency, or a fibri-
nolytic disorder, and further testing should be guided by
the clinical history and the results of the initial laboratory
evaluation. Once a diagnosis has been established, a plan for
perioperative hemostatic management should be developed
Another random document with
no related content on Scribd:
“She is from Havana,” said a Frenchman, who was at hand, working.
“The Raven, Captain Sudlip.”
“Captain Sudlip!” came from several of the boys.
“Was his full name Jason Sudlip?” questioned Professor Strong, with
equal interest.
“Yes. Then you knew him?”
“We did. But we didn’t know he was captain of a schooner like this.”
“It was a new command for him. At the last moment the regular
captain of the Raven was taken sick and Captain Sudlip took his
place. Poor fellow, it was a fatal trip for him.”
“Is Captain Sudlip dead?” questioned Darry.
“Not dead, but horribly burnt. They have taken him to the hospital at
Roseau, on the island of Dominica, but the doctors say he cannot
live.”
The Frenchman resumed his work, and the craft containing our
friends moved off down the coast. For some minutes nobody spoke.
Then Darry heaved a long sigh.
“It’s horrible!” he murmured. “Horrible! Captain Sudlip wasn’t our
friend, but I pity him.”
“And so do I pity him,” put in Sam. “I trust his case isn’t as bad as
reported.”
This was all that was said, but nobody forgot the matter until a long
time after. It may be as well to state here that the captain was in a
very bad way and that he died inside of the week.
It was utterly impossible to think of going ashore at St. Pierre, and
fearful of another eruption which might cost them their lives,
Professor Strong procured passage on a little ferry steamer which
had formerly run regularly between the fallen city and Fort de
France.
Turning southward again made the hearts of Mark and Frank sink
like lead within their bosoms. Their thoughts were constantly on their
parents.
“I can’t give my father up—I simply can’t!” said Frank to his chum, in
a choking voice. “It’s too awful to think of!”
“I feel exactly the same, Frank,” answered the older youth. “But what
more can we do?”
“I am going to make more inquiries when we reach Fort de France.”
“Oh, I shall do that, too.”
On the way down the coast they fell in with many vessels, all going
to St. Pierre to give aid to those who, alas, were beyond human
needs. These craft moved along silently, nobody feeling in the humor
to even discuss the situation.
As soon as they landed at the capital city they started for the post-
office, to learn if anything in the shape of a letter had been left for
one or another of the party. They found the streets crowded with
people of all nationalities and for the first time learned how Fort de
France had received a shower of dust and stones, and how
everybody had been terrorized and business brought to a standstill.
“It’s a fearful state of affairs,” said Sam. “They won’t recover from this
for years.”
“St. Pierre will never recover, Samuel,” returned the professor. “The
eruption has——”
Professor Strong stopped short, for a cry from Mark had interrupted
him. The youth was pointing up a street to their left.
“See! see! There is a crowd of negroes and they are beating a white
man! If somebody don’t help the white fellow they will kill him!”
They started forward, and were soon on the edge of the crowd which
numbered fully a dozen colored men. In the very midst was the white
man Mark had mentioned. His hat was off, his collar and tie loose,
his shirt torn, and he was fighting desperately. One cheek was
bleeding from a long cut and his left arm hung limply at his side.
“It is Dan Markel!” ejaculated Darry. “Dan Markel, the fellow who
once swindled Hockley!”
The crowd around the man was yelling fiercely and striking at every
available opportunity. Dan Markel was yelling in return, but nobody
appeared to listen to him.
“We must do something, or he’ll surely be killed,” said Frank.
By this time Professor Strong was close to the crowd. “Stop!” he
called out, in French. “Stop! What does this mean?”
“He is a rascal!” said one native, wrathfully. “He is not fit to live!”
“He robbed the dead,” said another. “We saw him doing it—up at the
Ladarosa plantation.”
“Let me go!” screamed Markel, in English. “It’s all a mistake.”
By this time the crowd was growing larger, and the shouting
continued, until to make out what one individual was saying was
impossible. Those nearest to Markel continued to strike at the man
from Baltimore, until he went down from a blow on the head, and
several in the crowd fell on top of him.
It was at this critical moment that several gens-d’armes appeared.
They were doing police duty in that neighborhood, and at once set to
work to restore peace. But it was not without great difficulty that they
succeeded in quieting the negroes, who insisted upon it that Dan
Markel be arrested.
“He is a looter—a robber of the dead,” said one of the natives. And
then he explained that he was an assistant foreman on the Ladarosa
plantation not far from St. Pierre. The master of the plantation had
been killed, along with several others of the household, while the
negroes had fled to a rocky cave for safety. On returning to the
house two days after the first eruption they had found Dan Markel
there and in the act of stealing the silverware and jewelry. Markel
had escaped them but they remembered his face well.
The man from Baltimore tried to deny this story, saying he had
reached Fort de France from La Guayra that morning, but on being
searched some jewelry which the negroes identified was found in his
pockets. He was at once marched off to the local jail, there to await
trial, the natives following the gens-d’armes to see that the prisoner
did not get away.
“It will go hard with Markel,” said Darry. “Robbery under such
circumstances becomes a double crime.”
“In some countries such looters would be hung,” answered Professor
Strong. “You may depend upon it that Markel will get the full penalty
of the law.”
“This will please Hockley,” came from Sam. “He was always sorry
the rascal got away. I wonder if Hockley is still up at the hotel?” he
continued.
“I shouldn’t be surprised if he got out of Fort de France when that
shower of dust and stones came,” returned Mark. “He was scared to
death as it was.”
A short while later found them at the post-office asking for letters.
Owing to the general disorder it was half an hour before any mail
was handed out.
The first communication proved to be from Hockley, and was
addressed to Professor Strong. It was short, and had evidently been
written while the youth was in an excited frame of mind. It ran as
follows:
“Dear Professor: It looks now as if this island was
doomed and I don’t propose to be burnt up or be drowned.
There is a steamer sailing from here to Port-of-Spain,
Trinidad, and other ports in South America, and I have
secured passage. If I stop off at Port-of-Spain you can
look for me at the hotel at which we stopped before, and if
I go further I will leave word in a letter at the post-office.
Have cabled my father to send necessary money.”
“I knew Hockley wouldn’t stay,” said Darry. “I’ll wager he was almost
paralyzed with terror.” And he was right. Hockley had acted so
thoroughly scared that he had made himself the laughing stock of all,
both at the hotel and on board the steamer on which he had secured
passage. It was to be some time before they would see their tall
traveling companion again.
 CHAPTER XXXIII
A HAPPY MEETING—CONCLUSION

The letter from Hockley read, they waited patiently until some mail
matter which had just come in should be sorted out. This took the
best part of an hour—a wait which to Mark and Frank seemed an
age.
But at last the little window was opened once more and the crowd
surged forward. Professor Strong was well to the front and presently
they saw him turn from the window with half a dozen
communications held aloft.
“Letters!” cried Frank. “Oh, if only they bring good news!”
The professor was soon beside them. There were letters for all, but
just then the interest was concentrated on a communication
addressed to Mark and another addressed to Frank. Both bore the
postmark of Kingstown, St. Vincent.
“My father’s handwriting!” cried Mark, in a trembling voice.
“And this is in my father’s hand!” came from Frank, falteringly. His
hand shook so he could not open the envelope. “Yo—you read it,
professor.”
Professor Strong did so. The communication had been written the
day before and ran in this wise:
“My dear son Frank:
“I am writing this in the hope that you are safe despite the
fearful volcano eruptions which have taken place in this
quarter of the globe. I know you were bound for St. Pierre,
but I have learned that by the goodness of an all-wise
Providence the Vendee escaped the eruption that
destroyed St. Pierre and all the shipping in that harbor.
 “Mr. Robertson and myself have had a narrow escape
from death, and we do not yet know if we are entirely safe,
for the volcano on this island is now as active as that on
Martinique. We were within four miles of Mont Pelee when
the eruption of May 8th occurred. We escaped by what
was little short of a miracle, and were lucky enough to get
on a trading vessel bound for this port. I had my lower
limbs and feet considerably burnt, and Mr. Robertson
suffered from burns on his feet and on his left arm. But
none of the burns are serious, and we are resting here
quite comfortably. If we were well enough we would set
out in search of you, but as it is neither of us can do any
walking at present.
“I am sending this letter in duplicate to half a dozen ports
in this territory, and Mr. Robertson is sending similar letters
addressed to Mark. As soon as you receive a letter let me
hear from you, as both of us are anxious for news. And
also send word home if you are safe. Address me at the
Windsor Hotel, Kingstown, Island of St. Vincent.”
“Oh, how glad I am that they are safe!” murmured Frank, and then
he looked at Mark, who had been reading his own letter. There were
tears in the eyes of both and that look meant more than any words of
mine can tell.
“I must go to Kingstown at once,” said Mark. “I can’t be satisfied until
I see for myself just how they are faring.”
“And I will go with you,” answered Frank. “Perhaps the burns are
worse than we imagine. I know father. He wouldn’t want to worry
me.”
The matter was talked over by all, and in the end Professor Strong
agreed to see about passage to St. Vincent. Darry and Sam wanted
to keep with Frank and Mark, and the whole party sailed southward
the next morning at sunrise.
The run to St. Vincent, past the Island of St. Lucia, which, strange to
say, had entirely escaped the eruptions on both sides of it, was
made without anything unusual occurring. While still some miles
north of the island for which they were bound they could see the
smoke of La Soufriere and through the marine glasses took note of
some of the terrible damage done.
“It is very fortunate that no large city was located near this volcano,”
said Professor Strong. “No living thing could have escaped such an
outburst as has taken place here.”
When the vessel reached Kingstown harbor the boys could scarcely
wait to get ashore. They learned that the Windsor Hotel was in a
suburb, and hired a carriage to take them to the hostelry.
“There is father now!” cried Frank, as they entered the beautiful
grounds, and he pointed to a figure reclining in an invalid chair on
the veranda.
“And my father is there, too!” exclaimed Mark.
In another moment they were out of the carriage and rushing up the
veranda steps. As they came closer both Mr. Newton and Mr.
Robertson sat up to greet them.
“My boy!” cried Mr. Newton, and flung his arms around Frank. “My
own boy!”
“Mark!” came from Mr. Robertson, and his face broke out into a
warm smile of welcome. “We were just talking about you and
wondering if we would get a letter.”
“You don’t know how glad I am to see you, even like this, father,”
answered Mark. “We were afraid you had been burnt up.”
“Yes, and we went on a regular search for both of you,” broke in
Frank.
“And they came pretty close to losing their own lives in that search,”
came from the professor, as he shook hands.
“Then you went ashore—” began Mr. Newton, in wonder.
“Yes, we went volcano exploring,” said Darry.
“And we climbed Mont Pelee,” finished Sam. “I don’t believe we’ll
ever want to do it again.”
“No,” finished Mark. “Once was enough. Now we are all safe away
from it, I never want to see the island of Martinique again.”
And the others agreed with him.
Let me add a few words more, and then we will bring to a close this
tale of sight-seeing and adventures in the West Indies.
What Mr. Newton and Mr. Robertson had written in their letters
concerning their injuries was true. Although painful, none of the
burns were serious, and they were both doing as well as could be
expected. In a few days each was able to walk a little, and inside of a
month both were practically as well as ever.
For the time being all business in Martinique, and a good part of that
in St. Vincent, came to a standstill, and this being so nothing could
be done regarding the dyewood scheme the two gentlemen had had
in mind. Consequently the pair returned to the United States at the
first available opportunity.
“Take good care of yourselves in the future, boys,” said Mr.
Robertson, on leaving.
“And let the active volcanoes alone,” added Mr. Newton.
And all of the party agreed to heed the advice.
During the time spent in St. Vincent the boys made one trip
northward toward La Soufriere. But though they inspected the great
volcano from a distance they took good care to keep out of the zone
of fire.
“It’s a fearful spot,” said Mark. “Worse even than around Mont Pelee.
It’s a regular Inferno on earth,” and the others said the same.
At last came the day for the young explorers to leave St. Vincent.
Anxious to learn what had become of Hockley, who had not
answered a letter sent to Trinidad by him, Professor Strong engaged
passage on a vessel bound for Port-of-Spain.
“Hurrah, we are off at last!” cried Darry, as they set sail. “Good-bye to
the West Indies.”
“After all, the trip through the islands wasn’t so bad,” said Sam. “We
saw lots of interesting things.”
“I guess we shall see even more interesting things in the future,”
came from Mark.
“Of course, our sight-seeing isn’t half over yet,” added Frank. He was
right, and what the immediate future held in store for our young
friends will be told in the next volume of this “Pan-American Series.”
In that book we shall meet all our boys and the professor once more,
and learn of many things as interesting, curious, or exciting as those
related in these pages.
But for the present we will leave them, and also these ill-fated
islands of the Lesser Antilles, the fate of which even to-day seems
uncertain. Our friends made a happy group as they steamed rapidly
southward, and here let us say good-bye.
THE END
 TRANSCRIBER’S NOTES:
Obvious typographical errors have been corrected.
Inconsistencies in hyphenation have been
standardized.
Archaic or variant spelling has been retained.
New original cover art included with this eBook is
granted to the public domain.
*** END OF THE PROJECT GUTENBERG EBOOK THE YOUNG
VOLCANO EXPLORERS ***

Updated editions will replace the previous one—the old editions

will be renamed.

Creating the works from print editions not protected by U.S.

copyright law means that no one owns a United States copyright
in these works, so the Foundation (and you!) can copy and
distribute it in the United States without permission and without
paying copyright royalties. Special rules, set forth in the General
Terms of Use part of this license, apply to copying and
distributing Project Gutenberg™ electronic works to protect the
PROJECT GUTENBERG™ concept and trademark. Project
Gutenberg is a registered trademark, and may not be used if
you charge for an eBook, except by following the terms of the
trademark license, including paying royalties for use of the
Project Gutenberg trademark. If you do not charge anything for
copies of this eBook, complying with the trademark license is
very easy. You may use this eBook for nearly any purpose such
as creation of derivative works, reports, performances and
research. Project Gutenberg eBooks may be modified and
printed and given away—you may do practically ANYTHING in
the United States with eBooks not protected by U.S. copyright
law. Redistribution is subject to the trademark license, especially
commercial redistribution.

START: FULL LICENSE

THE FULL PROJECT GUTENBERG LICENSE
 PLEASE READ THIS BEFORE YOU DISTRIBUTE OR USE THIS WORK

To protect the Project Gutenberg™ mission of promoting the

free distribution of electronic works, by using or distributing this
work (or any other work associated in any way with the phrase
“Project Gutenberg”), you agree to comply with all the terms of
the Full Project Gutenberg™ License available with this file or
online at www.gutenberg.org/license.

Section 1. General Terms of Use and

Redistributing Project Gutenberg™
electronic works
1.A. By reading or using any part of this Project Gutenberg™
electronic work, you indicate that you have read, understand,
agree to and accept all the terms of this license and intellectual
property (trademark/copyright) agreement. If you do not agree to
abide by all the terms of this agreement, you must cease using
and return or destroy all copies of Project Gutenberg™
electronic works in your possession. If you paid a fee for
obtaining a copy of or access to a Project Gutenberg™
electronic work and you do not agree to be bound by the terms
of this agreement, you may obtain a refund from the person or
entity to whom you paid the fee as set forth in paragraph 1.E.8.

1.B. “Project Gutenberg” is a registered trademark. It may only

be used on or associated in any way with an electronic work by
people who agree to be bound by the terms of this agreement.
There are a few things that you can do with most Project
Gutenberg™ electronic works even without complying with the
full terms of this agreement. See paragraph 1.C below. There
are a lot of things you can do with Project Gutenberg™
electronic works if you follow the terms of this agreement and
help preserve free future access to Project Gutenberg™
electronic works. See paragraph 1.E below.
1.C. The Project Gutenberg Literary Archive Foundation (“the
Foundation” or PGLAF), owns a compilation copyright in the
collection of Project Gutenberg™ electronic works. Nearly all the
individual works in the collection are in the public domain in the
United States. If an individual work is unprotected by copyright
law in the United States and you are located in the United
States, we do not claim a right to prevent you from copying,
distributing, performing, displaying or creating derivative works
based on the work as long as all references to Project
Gutenberg are removed. Of course, we hope that you will
support the Project Gutenberg™ mission of promoting free
access to electronic works by freely sharing Project
Gutenberg™ works in compliance with the terms of this
agreement for keeping the Project Gutenberg™ name
associated with the work. You can easily comply with the terms
of this agreement by keeping this work in the same format with
its attached full Project Gutenberg™ License when you share it
without charge with others.

1.D. The copyright laws of the place where you are located also
govern what you can do with this work. Copyright laws in most
countries are in a constant state of change. If you are outside
the United States, check the laws of your country in addition to
the terms of this agreement before downloading, copying,
displaying, performing, distributing or creating derivative works
based on this work or any other Project Gutenberg™ work. The
Foundation makes no representations concerning the copyright
status of any work in any country other than the United States.

1.E. Unless you have removed all references to Project

Gutenberg:

1.E.1. The following sentence, with active links to, or other

immediate access to, the full Project Gutenberg™ License must
appear prominently whenever any copy of a Project
Gutenberg™ work (any work on which the phrase “Project
Gutenberg” appears, or with which the phrase “Project
Gutenberg” is associated) is accessed, displayed, performed,
viewed, copied or distributed:

This eBook is for the use of anyone anywhere in the United

States and most other parts of the world at no cost and with
almost no restrictions whatsoever. You may copy it, give it
away or re-use it under the terms of the Project Gutenberg
License included with this eBook or online at
www.gutenberg.org. If you are not located in the United
States, you will have to check the laws of the country where
you are located before using this eBook.

1.E.2. If an individual Project Gutenberg™ electronic work is

derived from texts not protected by U.S. copyright law (does not
contain a notice indicating that it is posted with permission of the
copyright holder), the work can be copied and distributed to
anyone in the United States without paying any fees or charges.
If you are redistributing or providing access to a work with the
phrase “Project Gutenberg” associated with or appearing on the
work, you must comply either with the requirements of
paragraphs 1.E.1 through 1.E.7 or obtain permission for the use
of the work and the Project Gutenberg™ trademark as set forth
in paragraphs 1.E.8 or 1.E.9.

1.E.3. If an individual Project Gutenberg™ electronic work is

posted with the permission of the copyright holder, your use and
distribution must comply with both paragraphs 1.E.1 through
1.E.7 and any additional terms imposed by the copyright holder.
Additional terms will be linked to the Project Gutenberg™
License for all works posted with the permission of the copyright
holder found at the beginning of this work.

1.E.4. Do not unlink or detach or remove the full Project

Gutenberg™ License terms from this work, or any files
containing a part of this work or any other work associated with
Project Gutenberg™.
 1.E.5. Do not copy, display, perform, distribute or redistribute
this electronic work, or any part of this electronic work, without
prominently displaying the sentence set forth in paragraph 1.E.1
with active links or immediate access to the full terms of the
Project Gutenberg™ License.

1.E.6. You may convert to and distribute this work in any binary,
compressed, marked up, nonproprietary or proprietary form,
including any word processing or hypertext form. However, if
you provide access to or distribute copies of a Project
Gutenberg™ work in a format other than “Plain Vanilla ASCII” or
other format used in the official version posted on the official
Project Gutenberg™ website (www.gutenberg.org), you must, at
no additional cost, fee or expense to the user, provide a copy, a
means of exporting a copy, or a means of obtaining a copy upon
request, of the work in its original “Plain Vanilla ASCII” or other
form. Any alternate format must include the full Project
Gutenberg™ License as specified in paragraph 1.E.1.

1.E.7. Do not charge a fee for access to, viewing, displaying,

performing, copying or distributing any Project Gutenberg™
works unless you comply with paragraph 1.E.8 or 1.E.9.

1.E.8. You may charge a reasonable fee for copies of or

providing access to or distributing Project Gutenberg™
electronic works provided that:

• You pay a royalty fee of 20% of the gross profits you derive from
the use of Project Gutenberg™ works calculated using the
method you already use to calculate your applicable taxes. The
fee is owed to the owner of the Project Gutenberg™ trademark,
but he has agreed to donate royalties under this paragraph to
the Project Gutenberg Literary Archive Foundation. Royalty
payments must be paid within 60 days following each date on
which you prepare (or are legally required to prepare) your
periodic tax returns. Royalty payments should be clearly marked
as such and sent to the Project Gutenberg Literary Archive
Foundation at the address specified in Section 4, “Information
 about donations to the Project Gutenberg Literary Archive
Foundation.”

• You provide a full refund of any money paid by a user who

notifies you in writing (or by e-mail) within 30 days of receipt that
s/he does not agree to the terms of the full Project Gutenberg™
License. You must require such a user to return or destroy all
copies of the works possessed in a physical medium and
discontinue all use of and all access to other copies of Project
Gutenberg™ works.

• You provide, in accordance with paragraph 1.F.3, a full refund of

any money paid for a work or a replacement copy, if a defect in
the electronic work is discovered and reported to you within 90
days of receipt of the work.

• You comply with all other terms of this agreement for free
distribution of Project Gutenberg™ works.

1.E.9. If you wish to charge a fee or distribute a Project

Gutenberg™ electronic work or group of works on different
terms than are set forth in this agreement, you must obtain
permission in writing from the Project Gutenberg Literary
Archive Foundation, the manager of the Project Gutenberg™
trademark. Contact the Foundation as set forth in Section 3
below.

1.F.

1.F.1. Project Gutenberg volunteers and employees expend

considerable effort to identify, do copyright research on,
transcribe and proofread works not protected by U.S. copyright
law in creating the Project Gutenberg™ collection. Despite
these efforts, Project Gutenberg™ electronic works, and the
medium on which they may be stored, may contain “Defects,”
such as, but not limited to, incomplete, inaccurate or corrupt
data, transcription errors, a copyright or other intellectual
property infringement, a defective or damaged disk or other
medium, a computer virus, or computer codes that damage or
cannot be read by your equipment.

1.F.2. LIMITED WARRANTY, DISCLAIMER OF DAMAGES -

Except for the “Right of Replacement or Refund” described in
paragraph 1.F.3, the Project Gutenberg Literary Archive
Foundation, the owner of the Project Gutenberg™ trademark,
and any other party distributing a Project Gutenberg™ electronic
work under this agreement, disclaim all liability to you for
damages, costs and expenses, including legal fees. YOU
AGREE THAT YOU HAVE NO REMEDIES FOR NEGLIGENCE,
STRICT LIABILITY, BREACH OF WARRANTY OR BREACH
OF CONTRACT EXCEPT THOSE PROVIDED IN PARAGRAPH
1.F.3. YOU AGREE THAT THE FOUNDATION, THE
TRADEMARK OWNER, AND ANY DISTRIBUTOR UNDER
THIS AGREEMENT WILL NOT BE LIABLE TO YOU FOR
ACTUAL, DIRECT, INDIRECT, CONSEQUENTIAL, PUNITIVE
OR INCIDENTAL DAMAGES EVEN IF YOU GIVE NOTICE OF
THE POSSIBILITY OF SUCH DAMAGE.

1.F.3. LIMITED RIGHT OF REPLACEMENT OR REFUND - If

you discover a defect in this electronic work within 90 days of
receiving it, you can receive a refund of the money (if any) you
paid for it by sending a written explanation to the person you
received the work from. If you received the work on a physical
medium, you must return the medium with your written
explanation. The person or entity that provided you with the
defective work may elect to provide a replacement copy in lieu
of a refund. If you received the work electronically, the person or
entity providing it to you may choose to give you a second
opportunity to receive the work electronically in lieu of a refund.
If the second copy is also defective, you may demand a refund
in writing without further opportunities to fix the problem.

1.F.4. Except for the limited right of replacement or refund set

forth in paragraph 1.F.3, this work is provided to you ‘AS-IS’,
WITH NO OTHER WARRANTIES OF ANY KIND, EXPRESS
OR IMPLIED, INCLUDING BUT NOT LIMITED TO
WARRANTIES OF MERCHANTABILITY OR FITNESS FOR
ANY PURPOSE.

1.F.5. Some states do not allow disclaimers of certain implied

warranties or the exclusion or limitation of certain types of
damages. If any disclaimer or limitation set forth in this
agreement violates the law of the state applicable to this
agreement, the agreement shall be interpreted to make the
maximum disclaimer or limitation permitted by the applicable
state law. The invalidity or unenforceability of any provision of
this agreement shall not void the remaining provisions.

1.F.6. INDEMNITY - You agree to indemnify and hold the

Foundation, the trademark owner, any agent or employee of the
Foundation, anyone providing copies of Project Gutenberg™
electronic works in accordance with this agreement, and any
volunteers associated with the production, promotion and
distribution of Project Gutenberg™ electronic works, harmless
from all liability, costs and expenses, including legal fees, that
arise directly or indirectly from any of the following which you do
or cause to occur: (a) distribution of this or any Project
Gutenberg™ work, (b) alteration, modification, or additions or
deletions to any Project Gutenberg™ work, and (c) any Defect
you cause.

Section 2. Information about the Mission of

Project Gutenberg™
Project Gutenberg™ is synonymous with the free distribution of
electronic works in formats readable by the widest variety of
computers including obsolete, old, middle-aged and new
computers. It exists because of the efforts of hundreds of
volunteers and donations from people in all walks of life.

Volunteers and financial support to provide volunteers with the

assistance they need are critical to reaching Project
Gutenberg™’s goals and ensuring that the Project Gutenberg™
collection will remain freely available for generations to come. In
2001, the Project Gutenberg Literary Archive Foundation was
created to provide a secure and permanent future for Project
Gutenberg™ and future generations. To learn more about the
Project Gutenberg Literary Archive Foundation and how your
efforts and donations can help, see Sections 3 and 4 and the
Foundation information page at www.gutenberg.org.

Section 3. Information about the Project

Gutenberg Literary Archive Foundation
The Project Gutenberg Literary Archive Foundation is a non-
profit 501(c)(3) educational corporation organized under the
laws of the state of Mississippi and granted tax exempt status by
the Internal Revenue Service. The Foundation’s EIN or federal
tax identification number is 64-6221541. Contributions to the
Project Gutenberg Literary Archive Foundation are tax
deductible to the full extent permitted by U.S. federal laws and
your state’s laws.

The Foundation’s business office is located at 809 North 1500

West, Salt Lake City, UT 84116, (801) 596-1887. Email contact
links and up to date contact information can be found at the
Foundation’s website and official page at
www.gutenberg.org/contact

Section 4. Information about Donations to

the Project Gutenberg Literary Archive
Foundation
Project Gutenberg™ depends upon and cannot survive without
widespread public support and donations to carry out its mission
of increasing the number of public domain and licensed works
that can be freely distributed in machine-readable form
accessible by the widest array of equipment including outdated
equipment. Many small donations ($1 to $5,000) are particularly
important to maintaining tax exempt status with the IRS.

The Foundation is committed to complying with the laws

regulating charities and charitable donations in all 50 states of
the United States. Compliance requirements are not uniform
and it takes a considerable effort, much paperwork and many
fees to meet and keep up with these requirements. We do not
solicit donations in locations where we have not received written
confirmation of compliance. To SEND DONATIONS or
determine the status of compliance for any particular state visit
www.gutenberg.org/donate.

While we cannot and do not solicit contributions from states

where we have not met the solicitation requirements, we know
of no prohibition against accepting unsolicited donations from
donors in such states who approach us with offers to donate.

International donations are gratefully accepted, but we cannot

make any statements concerning tax treatment of donations
received from outside the United States. U.S. laws alone swamp
our small staff.

Please check the Project Gutenberg web pages for current

donation methods and addresses. Donations are accepted in a
number of other ways including checks, online payments and
credit card donations. To donate, please visit:
www.gutenberg.org/donate.

Section 5. General Information About Project

Gutenberg™ electronic works
Professor Michael S. Hart was the originator of the Project
Gutenberg™ concept of a library of electronic works that could
be freely shared with anyone. For forty years, he produced and
distributed Project Gutenberg™ eBooks with only a loose
network of volunteer support.

Project Gutenberg™ eBooks are often created from several

printed editions, all of which are confirmed as not protected by
copyright in the U.S. unless a copyright notice is included. Thus,
we do not necessarily keep eBooks in compliance with any
particular paper edition.

Most people start at our website which has the main PG search
facility: www.gutenberg.org.

This website includes information about Project Gutenberg™,

including how to make donations to the Project Gutenberg
Literary Archive Foundation, how to help produce our new
eBooks, and how to subscribe to our email newsletter to hear
about new eBooks.