Full Chapter Cancer Biology and Advances in Treatment Phuc Van Pham PDF

Cancer Biology and Advances in
Treatment Phuc Van Pham

Visit to download the full and correct content document:
https://textbookfull.com/product/cancer-biology-and-advances-in-treatment-phuc-van-
pham/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...
Stem Cells Biology and Engineering Phuc Van Pham
https://textbookfull.com/product/stem-cells-biology-and-
engineering-phuc-van-pham/
Cell biology : translational impact in cancer biology

and bioinformatics 1st Edition Mitchell
https://textbookfull.com/product/cell-biology-translational-
impact-in-cancer-biology-and-bioinformatics-1st-edition-mitchell/
Addiction Treatment Katherine Van Wormer
https://textbookfull.com/product/addiction-treatment-katherine-
van-wormer/
What to Eat During Cancer Treatment. 2nd Edition The

American Cancer Society
https://textbookfull.com/product/what-to-eat-during-cancer-
treatment-2nd-edition-the-american-cancer-society/
Cancer Cytogenetics Methods and Protocols Methods in
Molecular Biology 1541 Desconocido
https://textbookfull.com/product/cancer-cytogenetics-methods-and-
protocols-methods-in-molecular-biology-1541-desconocido/
Cancer Stem Cells Methods and Protocols Methods in

Molecular Biology 2777 Papaccio
https://textbookfull.com/product/cancer-stem-cells-methods-and-
protocols-methods-in-molecular-biology-2777-papaccio/
Artificial Intelligence in Cancer: Diagnostic to

Tailored Treatment 1st Edition Smaranda Belciug
https://textbookfull.com/product/artificial-intelligence-in-
cancer-diagnostic-to-tailored-treatment-1st-edition-smaranda-
belciug/
Cancer and the New Biology of Water Thomas Cowan
https://textbookfull.com/product/cancer-and-the-new-biology-of-
water-thomas-cowan/
Kidney Cancer Recent Advances in Surgical and Molecular

Pathology Mukul K. Divatia
https://textbookfull.com/product/kidney-cancer-recent-advances-
in-surgical-and-molecular-pathology-mukul-k-divatia/
Advances in Experimental Medicine and Biology 1292
Innovations in Cancer Research and Regenerative Medicine
Phuc Van Pham Editor
Cancer Biology
and Advances
in Treatment
Advances in Experimental Medicine
and Biology
Volume 1292
Series Editors
WIM E. CRUSIO, Institut de Neurosciences Cognitives et Intégratives
d’Aquitaine, CNRS and University of Bordeaux, Pessac Cedex, France
HAIDONG DONG, Departments of Urology and Immunology, Rochester,
Minnesota, USA
JOHN D. LAMBRIS, University of Pennsylvania, Philadelphia, Pennsylva-
nia, USA
HEINFRIED H. RADEKE, Clinic of the Goethe University Frankfurt Main,
Institute of Pharmacology & Toxicology, Frankfurt am Main, Hessen, Germany
NIMA REZAEI, Tehran University of Medical Sciences, Research Center
for Immunodeficiencies, Children’s Medical Center, Tehran, Iran
JUNJIE XIAO, School of Life Science, Shanghai University, Cardiac Regenera-
tion and Ageing Lab, Institute of Cardiovascular Sciences, Shanghai, China
Innovations in Cancer Research

and Regenerative Medicine
Subseries Editor
PHUC VAN PHAM, Stem Cell Institute, University of Science, Vietnam
National University, Ho Chi Minh City, Vietnam
Innovations in Cancer Research and Regenerative Medicine is based on a bi-
annual conference and its topics, and represents a major contribution to the
emerging science of cancer research and regenerative medicine. The series
publishes review and original research contributions, short reports, conference
proceedings, and guest-edited thematic volumes. Each volume brings together
some of the most preeminent scientists working on cancer biology, cancer
treatment, cancer diagnosis, cancer prevention and regenerative medicine to
share information on currently ongoing work which will help shape future
therapies.
These volumes are invaluable resources for active researchers or clinicians,
those entering related fields, and professionals in industry. All contributions
will be published online first and collected in book volumes. There are no
publication costs.
Innovations in Cancer Research and Regenerative Medicine is a subseries
of Advances in Experimental Medicine and Biology, which has been publish-
ing significant contributions in the field for over 30 years and is indexed in
Medline, Scopus, EMBASE, BIOSIS, Biological Abstracts, CSA, Biological
Sciences and Living Resources (ASFA-1), and Biological Sciences. The 2019
Impact Factor is 2.450. The 5 Year Impact Factor is 2.324.
More information about this subseries at http://www.springer.com/series/15740

Phuc Van Pham
Editor
Cancer Biology and

Advances in Treatment
Editor
Phuc Van Pham
Stem Cell Institute
University of Science, Vietnam National University
Ho Chi Minh, Vietnam
ISSN 0065-2598 ISSN 2214-8019 (electronic)

Advances in Experimental Medicine and Biology
ISSN 2662-3285 ISSN 2662-3293 (electronic)
Innovations in Cancer Research and Regenerative Medicine
ISBN 978-3-030-57253-2 ISBN 978-3-030-57254-9 (eBook)
https://doi.org/10.1007/978-3-030-57254-9
# Springer Nature Switzerland AG 2020

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or
part of the material is concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way,
and transmission or information storage and retrieval, electronic adaptation, computer software, or
by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are
exempt from the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in
this book are believed to be true and accurate at the date of publication. Neither the publisher nor
the authors or the editors give a warranty, expressed or implied, with respect to the material
contained herein or for any errors or omissions that may have been made. The publisher remains
neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Switzerland AG
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
Contents
The BRCA1 and BRCA2 Genes in Early-Onset Breast

Cancer Patients . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Mohamed Saleem, Mohd Bazli Ghazali,
Md Azlan Mohamed Abdul Wahab, Narazah Mohd Yusoff,
Hakimah Mahsin, Ch’ng Ewe Seng, Imran Abdul Khalid,
Mohd Nor Gohar Rahman, and Badrul Hisham Yahaya
Anti-cancer Effect of Xao Tam Phan Paramignya trimera
Methanol Root Extract on Human Breast Cancer Cell Line
MCF-7 in 3D Model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Lam-Huyen Nguyen-Thi, Sinh Truong Nguyen, Thao Phuong Tran,
Chinh-Nhan Phan-Lu, Trung The Van, and Phuc Van Pham
A Novel Nonsense Mutation c.374C>G in CYP21A2 Gene
of a Vietnamese Patient with Congenital Adrenal Hyperplasia . . . 27
Chi Dung Vu, Thanh Van Ta, Ngoc-Lan Nguyen,
Huy-Hoang Nguyen, Thi Kim Lien Nguyen, Thinh Huy Tran,
and Van Khanh Tran
Variation of Mitochondrial DNA HV1 AND HV2 of the
Vietnamese Population . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
Thi Thuy Hang Tran, Duc Hinh Nguyen, Van Khanh Tran,
Quy Linh Nguyen, Hong Anh Trinh, Long Hoang Luong,
Van Anh Tran, Le Anh Tuan Pham, Thu Thuy Nguyen,
Van Bang Nguyen, Thinh Huy Tran, and Thanh Van Ta
Synthesis and Characterization of PLGA-PEG Thymoquinone
Nanoparticles and Its Cytotoxicity Effects in
Tamoxifen-Resistant Breast Cancer Cells . . . . . . . . . . . . . . . . . . . 65
Rozaina Ahmad, Noor Haida Mohd Kaus, and Shahrul Hamid
Adipose-Derived Mesenchymal Stem Cells Promote Growth
and Migration of Lung Adenocarcinoma Cancer Cells . . . . . . . . . 83
Norashikin Zakaria and Badrul Hisham Yahaya
v
vi Contents
Predictive Potential of PD-L1, TYMS, and DCC Expressions

in Treatment Outcome of Colorectal Carcinoma . . . . . . . . . . . . . . 97
Ebenyi Emeka Onwe, Fauzah Abd Ghani, Maha Abdullah,
Malina Osman, Reena Rahayu Md Zin, Arimokwu Nimbi Vivian,
and Norhafizah Mohtarrudin
Clinical Trials with Cytokine-Induced Killer Cells
and CAR-T Cell Transplantation for Non-small Cell
Lung Cancer Treatment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
Le Van Manh Hung, Hieu Trong Ngo, and Phuc Van Pham
Isopanduratin A Isolated from Boesenbergia pandurata Reduces
HepG2 Hepatocellular Carcinoma Cell Proliferation in Both
Monolayer and Three-Dimensional Cultures . . . . . . . . . . . . . . . . . 131
Sinh Truong Nguyen, Nghia Minh Do, Duyen Ho-Khanh Tran,
Ngoc Bao To, Phuc Hong Vo, Mai Thi Thanh Nguyen,
Nhan Trung Nguyen, Hai Xuan Nguyen, Kiet Dinh Truong,
and Phuc Van Pham
Hopea odorata Extract Can Efficiently Kill Breast Cancer
Cells and Cancer Stem-Like Cells in Three-Dimensional
Culture More Than in Monolayer Cell Culture . . . . . . . . . . . . . . . 145
Nhan Lu-Chinh Phan, Khuong Duy Pham, Phong Le Minh,
Mai Thi-Thanh Nguyen, Ngoc Phan Kim, Kiet Dinh Truong,
and Phuc Van Pham
Selective Cytotoxicity of Some Plant Extracts Against
Hepatocellular Carcinoma Cells but Not Mesenchymal Stem
Cells: A Pilot Screening . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
Sinh Truong Nguyen, Nghia Minh Do, Phuc Hong Vo,
Mai Thi Thanh Nguyen, Nhan Trung Nguyen, Hai Xuan Nguyen,
Kiet Dinh Truong, and Phuc Van Pham
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171
Contributors
Maha Abdullah Department of Pathology, Faculty of Medicine and Health

Sciences, Universiti Putra Malaysia, Serdang, Selangor, Malaysia
Rozaina Ahmad Oncological and Radiological Sciences Cluster, Advanced
Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Penang,
Malaysia
Nghia Minh Do Stem Cell Institute, University of Science Ho Chi Minh
City, Ho Chi Minh City, Vietnam
Cancer Research Laboratory, University of Science Ho Chi Minh City, Ho
Chi Minh City, Vietnam
Vietnam National University Ho Chi Minh City, Ho Chi Minh City, Vietnam
Fauzah Abd Ghani Department of Pathology, Faculty of Medicine and Health
Sciences, Universiti Putra Malaysia, Serdang, Selangor, Malaysia
Mohd Bazli Ghazali Regenerative Medicine Cluster, Advanced Medical
and Dental Institute, Universiti Sains Malaysia, Penang, Malaysia
Surgery Department, Seberang Jaya Hospital, Seberang Prai, Malaysia
Shahrul Hamid Oncological and Radiological Sciences Cluster, Advanced
Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Penang,
Malaysia
Le Van Manh Hung Stem Cell Institute, University of Science, Ho Chi Minh
City, Viet Nam
Noor Haida Mohd Kaus School of Chemical Sciences, Universiti Sains
Malaysia, Minden, Penang, Malaysia
Imran Abdul Khalid Surgery Department, Seberang Jaya Hospital, Seberang
Prai, Malaysia
Ngoc Phan Kim Laboratory of Stem Cell Research and Application, Uni-
versity of Science Ho Chi Minh City, Ho Chi Minh City, Vietnam
Viet Nam National University Ho Chi Minh City, Ho Chi Minh City, Vietnam
Long Hoang Luong Hanoi Medical University, Hanoi, Vietnam
vii
viii Contributors
Hakimah Mahsin Pathology Department, Seberang Jaya Hospital, Seberang

Prai, Malaysia
Phong Le Minh Laboratory of Stem Cell Research and Application, Uni-
Norhafizah Mohtarrudin Department of Pathology, Faculty of Medicine
and Health Sciences, Universiti Putra Malaysia, Serdang, Selangor, Malaysia
Hieu Trong Ngo Stem Cell Institute, University of Science, Ho Chi Minh City,
Viet Nam
Duc Hinh Nguyen Hanoi Medical University, Hanoi, Vietnam
Hanoi Medical University Hospital, Hanoi, Vietnam
Hai Xuan Nguyen Vietnam National University Ho Chi Minh City, Ho Chi
Minh City, Vietnam
Faculty of Chemistry, University of Science Ho Chi Minh City, Ho Chi Minh
City, Vietnam
Huy-Hoang Nguyen Institute of Genome Research, Vietnam Academy of
Science and Technology, Hanoi, Vietnam
Mai Thi-Thanh Nguyen Viet Nam National University Ho Chi Minh City,
Ho Chi Minh City, Vietnam
City, Vietnam
Ngoc-Lan Nguyen Institute of Genome Research, Vietnam Academy of
Nhan Trung Nguyen Vietnam National University Ho Chi Minh City, Ho
City, Vietnam
Quy Linh Nguyen Hanoi Medical University, Hanoi, Vietnam
Sinh Truong Nguyen Stem Cell Institute, University of Science, VNUHCM,
Laboratory of Cancer Research, University of Science, VNUHCM, Ho Chi
Minh City, Vietnam
Thi Kim Lien Nguyen Institute of Genome Research, Vietnam Academy of
Lam-Huyen Nguyen-Thi Stem Cell Institute, University of Science,
VNUHCM, Ho Chi Minh City, Vietnam
Minh City, Vietnam
Thu Thuy Nguyen Hanoi Medical University, Hanoi, Vietnam
Contributors ix
Van Bang Nguyen Center for Gene and Protein Research, Vietnam Military
Medical University, Hanoi, Vietnam
Ebenyi Emeka Onwe Department of Pathology, Faculty of Medicine and
Health Sciences, Universiti Putra Malaysia, Serdang, Selangor, Malaysia
Medical Laboratory Science Department, Ebonyi State University, Abakaliki,
Nigeria
Malina Osman Department of Medical Microbiology and Parasitology,
Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang,
Selangor, Malaysia
Khuong Duy Pham Laboratory of Stem Cell Research and Application,
University of Science Ho Chi Minh City, Ho Chi Minh City, Vietnam
Le Anh Tuan Pham Hanoi Medical University, Hanoi, Vietnam
Phuc Van Pham Laboratory of Stem Cell Research and Application, Uni-
Stem Cell Institute, University of Science Ho Chi Minh City, Ho Chi Minh
City, Vietnam
Laboratory of Cancer Research, University of Science Ho Chi Minh City, Ho
Chinh-Nhan Phan-Lu Stem Cell Institute, University of Science, VNUHCM,
Minh City, Vietnam
Nhan Lu-Chinh Phan Laboratory of Stem Cell Research and Application,
University of Science Ho Chi Minh City, Ho Chi Minh City, Vietnam
Stem Cell Institute, University of Science Ho Chi Minh City, Ho Chi Minh
City, Vietnam
Mohd Nor Gohar Rahman Surgery Department, School of Medical Sciences,
Universiti Sains Malaysia, Kubang Kerian, Kelantan, Malaysia
Mohamed Saleem Regenerative Medicine Cluster, Advanced Medical and
Dental Institute, Universiti Sains Malaysia, Penang, Malaysia
Genomix Lab Sdn Bhd, Petaling Jaya, Selangor, Malaysia
Ch’ng Ewe Seng Oncology and Radiological Sciences Cluster, Advanced
Medical and Dental Institute, Universiti Sains Malaysia, Penang, Malaysia
Thanh Van Ta Center for Gene and Protein Research, Hanoi Medical
University, Hanoi, Vietnam
Hanoi Medical University, Hanoi, Vietnam
x Contributors
Ngoc Bao To Stem Cell Institute, University of Science Ho Chi Minh City,
Duyen Ho-Khanh Tran Stem Cell Institute, University of Science Ho Chi
Minh City, Ho Chi Minh City, Vietnam
Thao Phuong Tran Stem Cell Institute, University of Science, VNUHCM,
Thi Thuy Hang Tran Hanoi Medical University, Hanoi, Vietnam
Thinh Huy Tran Center for Gene and Protein Research, Hanoi Medical
Van Anh Tran Hanoi Medical University, Hanoi, Vietnam
Van Khanh Tran Center for Gene and Protein Research, Hanoi Medical
Hong Anh Trinh Center for Gene and Protein Research, Vietnam Military
Medical University, Hanoi, Vietnam
Kiet Dinh Truong Medical Genetic Institute, Ho Chi Minh City, Vietnam
Trung The Van Ho Chi Minh City Medicine and Pharmacy University,
Hospital of Dermatology – Ho Chi Minh City, Ho Chi Minh City, Vietnam
Arimokwu Nimbi Vivian Department of Occupational Safety and Health,
Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang,
Selangor, Malaysia
Phuc Hong Vo Stem Cell Institute, University of Science Ho Chi Minh City,
Cancer Research Laboratory, University of Science Ho Chi Minh City, Ho
Chi Dung Vu Center for Gene and Protein Research, Hanoi Medical
Vietnam National Children Hospital Hanoi, Vietnam, Department of Medical
Genetics, Metabolism & Endocrinology, Hanoi, Vietnam
Md Azlan Mohamed Abdul Wahab Regenerative Medicine Cluster,
Advanced Medical and Dental Institute, Universiti Sains Malaysia, Penang,
Malaysia
Badrul Hisham Yahaya Regenerative Medicine Cluster, Advanced Medi-
cal & Dental Institute (AMDI), Universiti Sains Malaysia, Kepala Batas,
Penang, Malaysia
Narazah Mohd Yusoff Regenerative Medicine Cluster, Advanced Medical
and Dental Institute, Universiti Sains Malaysia, Penang, Malaysia
Contributors xi
Norashikin Zakaria Regenerative Medicine Cluster, Advanced Medical &

Dental Institute (AMDI), Universiti Sains Malaysia, Kepala Batas, Penang,
Malaysia
Reena Rahayu Md Zin Universiti Kembangsaan Malaysia, Kuala Lumpur,
Malaysia
Adv Exp Med Biol – Innovations in Cancer Research and Regenerative Medicine (2020) 3: 1–12
https://doi.org/10.1007/5584_2018_147
# Springer International Publishing AG 2018
Published online: 24 April 2018
The BRCA1 and BRCA2 Genes in Early-Onset

Breast Cancer Patients
Mohamed Saleem, Mohd Bazli Ghazali,

Md Azlan Mohamed Abdul Wahab, Narazah Mohd Yusoff,
Hakimah Mahsin, Ch’ng Ewe Seng, Imran Abdul Khalid,
Mohd Nor Gohar Rahman, and Badrul Hisham Yahaya
Abstract cancer patients. We enrolled 70 patients

diagnosed with early-onset breast cancer. A
Approximately 5–10% of breast cancers are
total of 21 SNPs (11 on BRCA1 and 10 on
attributable to genetic susceptibility.
BRCA2) and 1 dinucleotide deletion on
Mutations in the BRCA1 and BRCA2 genes
BRCA1 were genotyped using nested allele-
are the best known genetic factors to date.
specific PCR methods. Linkage disequilibrium
The goal of this study was to determine the
(LD) analysis was conducted, and haplotypes
structure and distribution of haplotypes of the
were deduced from the genotype data. Two
BRCA1 and BRCA2 genes in early-onset breast
tightly linked LD blocks were observed on
Mohamed Saleem and Mohd Bazli Ghazali authors con-

tribute to the authorship (as the first author) equally.
M. Saleem
Regenerative Medicine Cluster, Advanced Medical and
H. Mahsin
Dental Institute, Universiti Sains Malaysia, Penang,
Pathology Department, Seberang Jaya Hospital, Seberang
Malaysia
Prai, Malaysia
Genomix Lab Sdn Bhd, Petaling Jaya, Selangor, Malaysia e-mail: hakimah@moh.gov.my
e-mail: drsaleem@genomixlab.com
C. E. Seng
M. B. Ghazali Oncology and Radiological Sciences Cluster, Advanced
Regenerative Medicine Cluster, Advanced Medical and Medical and Dental Institute, Universiti Sains Malaysia,
Dental Institute, Universiti Sains Malaysia, Penang, Penang, Malaysia
Malaysia e-mail: eschng@usm.my
Surgery Department, Seberang Jaya Hospital, Seberang I. A. Khalid
Prai, Malaysia Surgery Department, Seberang Jaya Hospital, Seberang
Prai, Malaysia
M. A. M. A. Wahab, N. M. Yusoff, and B. H. Yahaya (*)
Regenerative Medicine Cluster, Advanced Medical and M. N. G. Rahman
Dental Institute, Universiti Sains Malaysia, Penang, Surgery Department, School of Medical Sciences,
Malaysia Universiti Sains Malaysia, Kubang Kerian, Kelantan,
e-mail: azlan.wahab@usm.my; narazah@usm.my; Malaysia
badrul@usm.my e-mail: mngohar@usm.my
1
2 M. Saleem et al.
each of the BRCA1 and BRCA2 genes. Women who inherit mutations in either the
Variant-free haplotypes (TAT-AG for BRCA1 BRCA1 or BRCA2 gene are at a significant risk
and ATA-AAT for BRCA2) were observed at a of developing the disease when compared with
frequency of more than 50% on each gene the general population, and both contribute
along with variable frequencies of derived equally to early-on-set breast cancer (Peto et al.
haplotypes. The variant 30 -subhaplotype CGC 1999). The disease risk in women with these
displayed strong LD with 50 -subhaplotypes mutations has been shown to increase monotoni-
GA, AA, and GG on BRCA1 gene. Haplotypes cally with age, with a lifetime risk of up to 87%
ATA-AGT, ATC-AAT, and ATA-AAC were (Palma et al. 2006).
the variant haplotypes frequent on BRCA2 The spectrum of mutations in BRCA1 and
gene. Although the clinical significance of BRCA2 genes varies significantly between differ-
these derived haplotypes has not yet been ent geographic populations. Molecular suscepti-
established, it is expected that some of these bility screening for early-onset breast cancer,
haplotypes, especially the less frequent therefore, begins with screening a given popula-
subhaplotypes, eventually will be shown to tion for pathological mutations in both BRCA1
be indicative of a predisposition to early- and BRCA2 in a well-defined cohort with the
onset breast cancer. disease. To date, many reports of genetic
associations for individual mutations give a single
Keywords account of the phenotype and are mostly
unreplicated in subsequent studies (Breast Cancer
BRCA1 · BRCA2 · Breast cancer · Early onset
Association Consortium 2006; Loannidis et al.
2001). Identifying the combination of different
variants on a single DNA molecule
(i.e. haplotype determination) is a much more
1 Introduction efficient and informative approach to identifying
the underlying genetic mutants that increase the
Breast cancer is ranked as the most common susceptibility to complex disease traits. The
malignancy (18%) among Malaysians, and it is arrangement of alleles at the polymorphic loci
the most frequently diagnosed cancer (31.3%) in scattered throughout the BRCA1 and BRCA2
Malaysian women irrespective of their ethnic genes is not random: Depending on the linkage
group (Lim et al. 2008). The annual incidence of disequilibrium (LD), the non-random association
breast cancer relative to other malignancies between these mutant alleles exists in a series of
among women aged 15–49 years is 39.1%. In patterns called haplotypes. The linked alleles in
general, a Malaysian woman has a 1 in 20 chance these LD blocks co-segregate as haplotypic units
of developing this complex and heterogeneous of inheritance.
disease in her lifetime (Dahlui et al. 2011), com- The BRCA1 and BRCA2 genes are normally
pared with 1 in 8 in Europe (Wahid 2014). involved in the sophisticated DNA repair process,
Most breast cancer cases are sporadic, but a especially the homologous recombination path-
few are ascribed to inherited germline mutations way of double-strand break (DSB) repair
in a couple of susceptibility genes that segregate mechanisms. The most common germline
with the disease (Arver et al. 2000). Pathological mutations in breast cancer patients occur in
germline mutations in the two tumour suppressor these two genes. The incidence of variants in the
genes, BRCA1 and BRCA2, are the best known coding region of the BRCA1 and BRCA2 genes in
genetic factors known to confer a strong predis- early-onset breast cancer patients from Malaysia
position for familial breast and ovarian cancer in has been accurately determined (Toh et al. 2008).
women (Wooster and Weber 2003; Breast Cancer However, whether the common variants at these
Linkage Consortium 1997). Other less suscepti- loci contribute to a common variant haplotype
ble genes subsume CHEK2, ATM, and TP53. across the exons of BRCA1 and BRCA2 has not
The BRCA1 and BRCA2 Genes in Early-Onset Breast Cancer Patients 3
been determined in a similar cohort of early-onset respective medical records and direct interviews.
breast cancer patients. It is generally accepted that Other data gathered were lymph node status,
haplotype renders more information than single tumour grade and size, and expression of hor-
marker analysis. In this study, we characterised mone receptors.
the structure and distribution of haplotypes on the
BRCA1 and BRCA2 genes in the Malaysian multi-
ethnic population with early-onset breast cancer 2.2 Genetic Marker Selection
and explored the use of these haplotypes for dis-
ease predictability. Toh Kang et al. (2008) sequenced the entire cod-
ing region and splice junctions and characterised
14 mutations in the BRCA1 gene and 17 mutations
2 Methods in the BRCA2 gene in a cohort of early-onset
breast cancer patients from Malaysia (Toh et al.
2.1 Case Selection 2008). Using their findings as the source of the
frequent allele distribution among Malaysian with
Seventy randomly selected unrelated patients early-onset breast cancer, we selected 11 SNPs in
diagnosed with breast cancer at or before the age the BRCA1 gene and 10 SNPs in the BRCA2
of 40 years were recruited into the study from the genes to genotype our cohort. We also genotyped
surgery department of Hospital Seberang Jaya in the 185delAG deletion in BRCA1 exon 2. Tables 1
Penang, Malaysia. The study population was com- and 2 provide details about these SNP markers.
posed of 43 Malays, 19 Chinese, 5 Indians, and
3 subjects from whom ethnicity could not be
ascertained. This retrospective study was 2.3 Molecular Testing
approved by the Human Ethics Committee of
Universiti Sains Malaysia and the Ethics Review For each patient, DNA was extracted from
Board of the Ministry of Health, Malaysia. Writ- EDTA-anticoagulated blood using the DNA iso-
ten informed consent for genetic analysis of blood lation kit from Qiagen (Hilden, Germany)
was obtained from all participants at the time of according to the manufacturer’s instruction.
phlebotomy. Each SNP marker was amplified using 50 ng of
The medical and family histories, genomic DNA with four primers in a single PCR
histopathological diagnoses, and demographic reaction (Table 3). The 185delAG deletion in
variables were obtained by review of the exon 2 of the BRCA1 gene was genotyped using
Table 1 BRCA1 mutations in women with breast cancer before the age of 40 years
Genomic Transcript Allele HWE

SNP (NC_000017.11:g.) NM_007294.3:c) Exon Wild Variant MAF p value
1 Rs1799966 43071077T > C 4837A > G 16 T C 0.458 0.719
2 Rs1060915 43082453A > G 4308T > C 13 A G 0.451 0.563
3 Rs16942 43091983T > C 3548A > G 11 T C 0.444 0.426
4 Rs16941 43092418T > C 3113A > G 11 T C 0.408 0.063
5 Rs273899691 43092600T > C 2931A > G 11 T C 0.00 1.0
6 Rs80356892 43092965T > C 2566T > C 11 A T 0.014 0.014
7 Rs16940 43093220A > G 2311T > C 11 A G 0.408 0.381
8 Rs273898682 43093245T > A 2286A > T 11 T A 0.00 1.0
9 Rs1799949 43093449G > A 2082C > T 11 G A 0.444 0.426
10 Rs4986850 43093454C > T 2077G > A 11 C T 0.007 1.0
11 Rs1800062 43115746C > T 114G > A 3 C T 0.00 1.0
Table 2 BRCA2 mutations in women with breast cancer before the age of 40 years
Marker position on Genomic 500 -30
dbSNP Genomic Transcript
No number NC_000013.11:g NM_007294.3:c Exon Wild Variant MAF HWE
1 RS766173 32332343A > C 856A > C 10 A C 0.064 0.479
2 RS79483201 32332421T > A 943T> A 10 T A 0.014 1.0
3 Rs144848 32332592A > C 1114A > C 10 A C 0.364 0.489
4 RS1801499 32336584T > C 2229T > C 11 T C 0.114 0.072
5 RS1799944 32337326A > G 2971A > G 11 A G 0.015 1.0
6 RS1801406 32337751A > G 3396A > G 11 A G 0.321 0.192
7 RS80358589 32337800A > G 3445A > G 11 A G 0.00 1.0
8 RS543304 32338162T > C 3807T > C 11 T C 0.15 0.939
9 RS202022822 32338933A > G 4578A > G 11 A G 0.0 1.0
10 RS80358755 32339667G > A 5312G > A 11 G A 0.0 1.0
Table 3 Oligonucleotide primers used for genotyping

Ch position BRCA1 Tm
(NC_000017.11:g) Marker Name Oligos 50 >30 ( C)
43071077T > C Rs1799966 FI GTATCAGTAGTATGAGCAGCAGCTGGCCC 62.6
RI AATTGAAAGTTGCAGAATCTGCCCCGA
FO CCAGACACCACCATGGACATTCTTTTGT
RO TTTCAGAGGGAACCCCTTACCTGGAATC
43082453A > G Rs1060915 FI GATTTCGCAGGTCCTCAAGGGCATAA 60.0
RI CAGCTACCCTTCCATCATAAGTGACGCC
FO CAGATGACAACATGAATGACTGCCTTGG
RO CATGGGCATTAATTGCATGAATGTGGTT
43091983T > C Rs16942 FI GGGCTAGGACTCCTGCTAAGCTCTCATT 62.6
RI TCTGCTGTTTTTAGCAAAAGCGTCCATAG
FO TAACAAGTGTTGGAAGCAGGGAAGCTCT
RO CATGCATCTCAGGTTTGTTCTGAGACAC
43092418T > C Rs16941 FI TTCATTAATATTGCTTGAGCTGGATT 53.8
RI AATAACATTAGAGAAAATGTTTTTAACGG
FO CAATTACTTCCAGGAAGACTTTGTTTAT
RO CCATCAAGTCATTTGTTAAAACTAAATG
43092600T > C Rs273899691 FI GATGGGAAAAAGTGGTGGTATACGAGAT 60.0
RI CCAAATAAACATGGACTTTTACAAAACACG
FO GCTTGAGCTGGCTTCTTTAAAAACATTT
RO TGTGAACAAAAGGAAGAAAATCAAGGAA
43092965T > C Rs80356892 FI TTTGAAACCTTGAATGTATTCTGCAACTG 62.6
RI GGAAGAAAGTGAACTTGATGCTCCGT
FO GTTTCGTTGCCTCTGAACTGAGATGATA
RO CATTGGTACCTGGTACTGATTATGGCAC
43093220A > G Rs16940 FI GTGCCATAATCAGTACCAGGTACAAA 60.0
RI AAAGATCTGTAGAGAGTAGCAGTATTTAAC
FO ATTAGACTCATTCTTTCCTTGATTTTCT
RO GATAAAGAAAAAAAAGTACAACCAAATG
43093245T > A Rs273898682 FI ACCAATGAAATACTGCTACTCTCTACACAA 60.0
RI GAGAAAGGGTTTTGCAAACTGAATGA
FO TGTATTCTGCAAATACTGAGCATCAAGT
RO AAGAAGAGTAACAAGCCAAATGAACAGA
43093449G > A Rs1799949 FI GTTAACTTCAGCTCTGGGAAAGTAGCG 61.9
RI AATGAACAGACAAGTAAAAGACATGACCGT
FO TCTTTGGGGTCTTCAGCATTATTAGACA
RO AAAGCACCTAAAAAGAATAGGCTGAGGA
(continued)
Table 3 (continued)
Ch position BRCA1 Tm
(NC_000017.11:g) Marker Name Oligos 50 >30 ( C)
43093454C > T Rs4986850 FI CTTCAGCTCTGGGAAAGTATCGCTTTT 60.0
RI GCCAAATGAACAGACAAGTAAAAGACCTG
FO TGTTTTTGCCTTCCCTAGAGTGCTAACT
RO AGCACCTAAAAAGAATAGGCTGAGGAGG
43115746C > T Rs1800062 FI CAAACTTACTTGCAAAATATGTGGTCAAAT 60.0
RI TGATCAAGGAACCTGTCTCCACACAG
FO AATGGAGTTGGATTTTTCGTTCTCACTT
RO GAACTTGAGGCCTTATGTTGACTCAGTC
BRCA2 (NC_000013.11:g)
32332343A > C RS766173 FI AAGACCACATTGGAAAGTCAATGCTAA 62.5
RI TGTTTCATATACTTCATCTTCTAGGACGTG
FO AAATGCCAAGTACTCAGAATAACCCTTT
RO GGTTTTTAGATTTTTCACATTCATCAGC
32332421T > A RS79483201 FI AAGATAGTTTTTCATTATGTTTTTCTAGAT 55.4
RI TACTTTTTGTAGATTTTTTGTTCTGCT
FO AATGTGCTTCTGTTTTATACTTTAACAG
RO CTTCAGATACAAATGAGTATTTTTCTTT
32332592A > C Rs144848 FI ACTGATCCATTAGATTCAAATGTAGTAC 55.8
RI CTTCCACTCTCAAAGGGCTTCTGGTT
FO CAAGACTAGGAAAAAAATTTTCCATGAA
RO AGGTCTTTTTCTGAAATATTTTGGTCAC
32336584T > C RS1801499 FI CTGCAGCATGTCACCCAGTACAAAAC 63.0
RI AAGTCAGTATCACTGTATTCCACTTTTTAA
FO GAAAAGAAGCTGTTCACAGAATGATTCT
RO AGATTTGTGTTTTGGTTGAATTGTACCT
32337326A > G RS1799944 FI AATACCAGAAAAAAATAATGATTACAGGG 55.8
RI GGACCTAAGAGTCCTGCCCATTTTTT
FO TTTTGTCTTCCAAGTAGCTAATGAAAGG
RO CCTTTTGGCTAGGTGTTAAATTATGGTT
32337751A > G RS1801406 FI AGTCAGTTTGAATTTACTCAGTTTAGACAA 63.0
RI GTACTCTTCTGCAATATGTAGCTTTGC
FO TCAAGCTCTCTGAACATAACATTAAGAA
RO AAGATAAACTTATTGGATGTACCTCTGC
32337800A > G RS80358589 FI GTACATTTGAAGTGCCTGAAAACCCGA 63.0
RI TTCCTCAGAAGTGGTCTTTAAGATAGTAAC
FO TGTGTTGAAATTGTAAATACCTTGGCAT
RO CTAAACAGTTTCACAGCTTTTTGCAGAG
32338162T > C RS543304 FI TTATCTTCAAGTAAATGTCATGATTCTTTT 59.0
RI TGATTTTCTATCTTAAACATTGAACCG
FO TTTACTCAGTTTAGAAAACCAAGCTACA
RO AACTTCCAAAAAAGTTAAATCTGACAAA
32338933A > G RS202022822 FI AGGGACAACCCGAACGTGATGAAACGA 61.9
RI TGAAAACCCAATAGAGTAGGTTCTTTTAC
FO CAAGTGGGAAAAATATTAGTGTCGCCAA
RO TGTACTTTAGGGTCTTTGCCCATTGATG
32339667G > A RS80358755 FI CTCTCAAAAAATAAACTTGATTCGGA 55.8
RI AACATTCTTCAATACTGGCTCAAGAC
FO CAACCAGAAAGAATAAATACTGCAGATT
RO TATTAGATATGGACAATTTAATGGCTGC
FI Forward inner, RI Reverse inner, FO Forward outer, RO Reverse outer
6 M. Saleem et al.
the allele-specific Gap-PCR assay with the follow- association with triple-negative tumours
ing primers: forward inner (wild-type allele) ( p ¼ 0.411).
50 -TGACTTACCAGATGGGACACTC-30 , reverse
inner (Gap primer complementary to 185delGA
deletion) 50 -GCTATGCAGAAAATCTTAGTG- 3.2 SNP Marker Characteristics
30 , forward outer 50 -TTCCCGGACCACAGGA
TTTG-30 , and reverse outer 50 -AGGCCTTGATT Eleven SNPs loci were genotyped on the BRCA1
GGTGTTGGT-30 . gene. Among the 70 early-onset breast cancer
patients, 7.2% (5/70) had variant alleles observed
in 1–3 SNP markers, and 67.1% (47/70) had
variant alleles observed in 4–6 markers. Interest-
2.4 LD and Haplotype Analysis
ingly, 25.7% (18/70) of patients showed homozy-
gosity for the wild-type allele at all 11 markers.
Pairwise LD between the studied markers was
None of the Malaysian patients had the
measured using the statistic D0 . LD blocks were
rs80357713 (185delAG) deletion. Of the
detected using the solid spine algorithm in
remaining 11 polymorphic markers genotyped in
Haploview software. The frequencies of
the BRCA1 gene, 7 were missense and 4 were
haplotypes in the BRCA1 and BRCA2 genes
synonymous mutations. Of these 11 markers,
were deduced from diploid genotypes using the
5 were not used for haplotype determination
accelerated partition-ligation-expectation-
because one (rs80356892) significantly violated
maximisation (EM) algorithm method as
HWE (χ 2 p < 0.05), and the other 4 were either
described by Qin et al. (2002) using Haploview
not polymorphic (rs273899691, rs273898682,
4.2 (Barrett et al. 2005). To evaluate deviation
and rs1800062), or the minor allele frequency
from Hardy-Weinberg equilibrium (HWE), we
(MAF) was less than 1% (rs4986850).
used the χ 2 test with 1 df.
For the BRCA2 gene, at least one heterozygous
individual was detected at ten SNP markers stud-
ied. However, three (rs80358589, rs202022822,
3 Results and rs80358755) of the ten markers studied were
removed from haplotype analysis because they
3.1 Clinical Characteristics were not polymorphic (MAF < 1%) in the sample.
The PCR allele call rate was 100% for all of
Histological examination showed that 56 of the the markers studied on BRCA1 and BRCA2 genes
70 (80%) patients had invasive ductal cell carci- except for rs1799944 at the BRCA2 gene, which
noma, 6 (8.6%) had ductal cell carcinoma in situ, achieved 97.1%. The cohort was assumed to be
and a few others presented with less common selected randomly as all markers, except for one
histological types, including 2 cases of mucinous (rs80356892), were in conformity with HW equi-
and 3 cases of medullary carcinoma. Forty-six librium (χ 2 p > 0.05).
patients had cancer on the right side, and the
remaining 24 had their tumour on the left side.
None of the patients had history of contralateral 3.3 LD and Haplotypes
cancer. Scarff-Bloom-Richardson grades I, II, and
III were present in 8, 30, and 32 cases, respec- Linkage analysis from the BRCA1 genotype data
tively. Ipsilateral lymph node positivity (N+) was revealed two distinct LD blocks based on the
seen in 30 (42.8%) patients. Mastectomy was threshold of D0 > 0.8 (Fig. 1). The SNPs
conducted in 51 (71.8%) of the patients. rs1799966, rs1060915, and rs16942 were in
Twenty-three patients had a triple-negative near complete LD and belong to a 3-
tumour. None of the haplotypes observed in the 0
-subhaplotype block of 20 kb spanning from
BRCA genes showed a statistically significant exon 16 to the 30 region of exon 11. The three
rs16941
rs1799966
rs1060915
rs1799949
rs16942
rs16940
Block 1 (20 kb) Block 2 (0 kb)
1 2 3 4 7 9 B
01
02
03
07
09
97 68 57 93
71 64 TAT .542 AG .542
CGC .437 GA .394
71 96 94
CGT .014 AA .050
97
GG .015
.99
Fig. 1 (a) Pairwise linkage disequilibrium (LD) D0 graph for the six SNPs of the BRCA1 gene as generated by
Haploview. The colour scheme denotes the magnitude of D0 . (b) Haplotypes observed for the BRCA1 gene
subhaplotypes observed in this block were TAT markers was <2.0. The second LD block was
(54.2%), CGC (43.7%), and CGT (1.4%). The present in exon 11 and included rs1799944,
second haplotype block, which spans a 229 bp rs1801406, and rs543304. Although this block
region within exon 11, was represented by exhibited a strong LD, the LOD score for
rs16940 and rs1799949 and had a strong LD rs1799944 with the other two SNPs was <2.0.
value (D0 ¼ 0.93). Four subhaplotypes were Four haplotypes were deduced on each LD
observed in this block: AG (54.2%), GA block at the BRCA2 gene: 50 -subhaplotypes in
(39.4%), AA (5%), and GG (1.5%). The two block 1 were ATA (57.1), ATC (36.4%), CTA
blocks were separated by SNP rs16941, which (5.0%), and CAA (1.4%), and 30 -subhaplotypes
showed decaying LD with the neighbouring poly- in block 2 were AAT (52.9%), AGT (30.6%),
morphic markers. AAC (15.0%), and GGT (1.5%).
For the BRCA2 gene, all 70 patients genotyped
for the 10 markers had at least 1 SNP positive for
a variant allele. Seven markers flanking the 3.4 Family History and Mutation
mutations (rs766173, rs79483201, rs144848,
rs1801499, rs1799944, rs1801406, and Of the 70 patients with breast cancer, 15 had at
rs543304) in the BRCA2 gene were used for LD least 1 affected relative. Of these 15 patients,
and haplotype determinations. These polymor- 5 did not have any variation at any of the loci
phic markers formed two discrete LD blocks genotyped on the BRCA1 gene. However they all
(Fig. 2). The first block containing three markers had variations on the BRCA2 gene. The strongest
(rs766173, rs79483201, and rs144848) spans a heritable component was seen in the Chinese
249 bp region on exon 10 and showed strong ethnic group, as 6 out of 19 (31.6%) had an
LD. However, the LOD score between the affected first- or second-degree relative. Of these
8 M. Saleem et al.
RS79483201
RS766173
RS144848
RS1801499
RS1799944
RS1801406
RS543304
Block 1 (0 kb) Block 2 (0 kb)
1 2 3 4 5 6 8
30 B
01
02
03
05
06
08
35
45 48 23 ATA .571 AGT .306
42 78 ATC .364 AAT .529
2
CTA .050 AAC .150
CAA .014 GGT .015
2
.85
Fig. 2 (a) Pairwise linkage disequilibrium (LD) D0 prime graph for the seven SNPs of the BRCA2 gene as generated by
Haploview. The colour scheme denotes the magnitude of D0 . (b) Haplotypes observed for the BRCA2 gene
six Chinese patients, four were negative for were observed from a geographically distant
mutations at BRCA1 loci, but they all had Manitoba population (Frosk et al. 2007),
mutations on the BRCA2 gene. suggesting that the high-frequency polymorphic
markers on the BRCA1 and BRCA2 genes are
common in distinct global populations. The AG
4 Discussion dinucleotide deletion at rs80357713 at codon
23 (widely known in the literature as 185delAG)
This study was conducted to explore the structure found in BRCA1-linked early-onset breast cancer
and distribution of haplotypes in BRCA1 and patients of Jewish origin (Struewing et al. 1995)
BRCA2 genes in patients with early-onset breast was not observed in our sample cohort.
cancer from the Malaysian multi-ethnic popula- Of the 70 randomly selected patients in our
tion. The allele frequencies observed in our study study, 21.4% of patients had a family history of
revealed discernible differences, especially at the breast cancer. This is slightly higher than the
high-frequency alleles, when compared with a global average of 15% (Madigan et al. 1995;
cohort of similar phenotype from Malaysia but Colditz et al. 1993; Slattery and Kerber 1993).
from a different geographic district (Toh et al. This value means that four out of every five
2008). Moreover, four SNPs—rs273899691 women who developed early-onset breast cancer
(2931A > G) and rs273898682 (2286A > T) on did not have an affected relative. A similar ratio,
BRCA1 and rs80358589 (3445A > G) and 8 out of 9, was reported from a large familial
rs202022822 (4578A > G) on BRCA2—that breast cancer meta-analysis including 52 epidemi-
were shown to have a MAF of 2.7% in the previ- ological studies (Collaborative Group on Hor-
ous sample were not polymorphic in our sample monal Factors in Breast Cancer 2001). Family
due to homozygosity for wild-type allele at these history is a strong risk factor for breast cancer
loci. However, comparable allele frequencies globally in every population. However, it has
been consistently observed that most women with breast cancer. Furthermore, the observation that
a first degree relative with the disease do not this variant haplotype had a high frequency in our
develop breast cancer in their lives, and those early-onset breast cancer patients and that it was
few who develop it are above the age of structurally composed of all variant alleles is con-
50 when the diagnosis was first made (Collabora- sistent with the hypothesis that it is likely to
tive Group on Hormonal Factors in Breast Cancer contribute to genetic predisposition to breast can-
2001). These findings suggest that the risk alleles cer and that it may be involved in the pathogene-
and their haplotypes on BRCA genes segregated sis of tumour formation. The predicted protein
in the general population are by and large low in derived from this haplotype (CGC GA) has a
frequency; thus, the probability of inheriting a glycine, serine and arginine, and leucine and ser-
risk haplotype is relatively low. ine at those positions, which represents a differ-
ence of two amino acid substitutions compared to
the wild type. The exact functional consequence
5 BRCA1 Haplotypes of this variant haplotype, represented by five
nucleotide substitutions, is not clear and may
LD analysis of the six polymorphic markers on vary from truncated protein formation to inactiva-
the BRCA1 gene in the early-onset breast cancer tion of mRNA.
patients revealed that two distinct blocks of The other lower-frequency haplotypes
tightly linked SNP loci defined the haplotype observed in this study may confer a greater risk
structure of the phenotype (Fig. 1). They were for inherited susceptibility to breast cancer as
clustered in two small distinct regions located at these rare haplotypes may only be associated
the 30 end of exon 11 (block 1), including exons with early-onset breast cancer and not distributed
16 and 13, and within exon 11 (block 2). These in the general population.
blocks were separated by bi-alleles at locus
rs16941 (MAF 0.408) that showed decaying LD
with the surrounding SNP loci; this finding is 6 BRCA2 Haplotypes
suggestive of an evolutionary mechanism, possi-
bly selection. Block 1 was represented by two Germline mutations in the BRCA2 gene predis-
missense mutations at rs1799966 and rs16942 pose carriers to early-onset breast cancer. The
and one synonymous mutation at rs1060915, observation that all 70 patients had a variant
whereas the block2 subhaplotype had two synon- allele, at least at 1 locus was a clue to the diversity
ymous mutations at rs16940 and rs1799949. of this gene in the population.
Together, the most common haplomolecule Similar to BRCA1, LD analysis of the geno-
(TAT-AG) from both blocks formed the normal type data from the BRCA2 gene showed two
ancestral haplotype that corresponds to wild-type distinct blocks interrupted by locus rs1801499,
alleles in the references sequence NC_000017.11: which showed decay of the non-random associa-
g. The others were all variant haplotypes. tion with the surrounding SNP markers. As evi-
The most common variant haplomolecule dent by the LD chart (Fig. 2), the reduced
among the five interlinked loci, CGC GA, was association could be due to a plausible degree of
found in nearly 40% of the BRCA1 genes studied recombination at locus rs1801499, whereas the
in our sample. A structurally similar haplotype, increased haplotype diversity was due to the low
named B1, was present at high frequency (25%) minor allele frequencies at rs79483201A (1.4%)
in familial breast cancer patients from the and rs1799944G (1.5%). All three SNP loci that
Manitoba population (Frosk et al. 2007). Despite formed LD block 1 at exon 10 were composed of
the vast geographic and genetic distance between missense substitutions, whereas the LD block
the two cohorts, the presence of a structurally 2 located on exon 11 was composed of one mis-
similar variant haplotype in a similar phenogroup sense and two synonymous loci. Together, these
is phenomenal; it suggests that the haplotype, in two LD blocks defining the variant-free
part, has a high-risk probability for early-onset haplomolecule ATA-AAT was observed at a
10 M. Saleem et al.
frequency of more than 52% of the BRCA2 genes 289. Although its significance in breast cancer is
studied. This mutant-free haplomolecule uncertain, carriers of this allele have nonsignifi-
represents the normal and common haplotype on cant increased risk of lymphoma (Breast Cancer
the BRCA2 gene that is distributed in the general Linkage Consortium 1999).
population. The discovery that BRCA gene mutations con-
The variant haplotypes of the BRCA2 gene fer significant risk for familial early-onset breast
were a complex of different combinations of cancer coupled with increased public literacy
subhaplotypes between LD block 1 (5- about personal genomics has led to widespread
0
-subhaplotype) and block 2 (30 -subhaplotype) demand, especially from the relatives of index
and are derived from the ancestral normal haplo- patients, for genetic profiling of BRCA1 and
type. As shown in Fig. 2, the normal 5- BRCA2 to predict the inherited risk of developing
0
-subhaplotype ATA derived from LD block breast cancer. Some of the variant haplotypes
1 combined with either AGT or AAC from the described herein, especially the less frequent
30 -subhaplotype formed the majority of variant ones, may contribute to risk of early-onset breast
haplotypes. The ATA-AGT arrangement was the cancer in the Malaysian population. The
most common variant haplotype, and it differed realisation that haplotypes play a substantial role
from the normal haplotype by a single-nucleotide in defining the risk of cancer comes from the fact
substitution of unknown significance at the sec- that they are often the starting point for attempts
ond nucleotide of the 30 -subhaplotype to locate the genes involved in disease processes.
(NM_000059.3:c. 3396A > G). The ATA-AAC Recently, haplotypes have been applied for risk
arrangement differed from the normal haplotype assessment for various complex diseases such as
by one nucleotide substitution at the third nucleo- non-small cell lung cancer (NSCLC) and early-
tide of the 30 -subhaplotype (rs543304, onset coronary artery disease (CAD) and
Val1269Val), and it may not pose a risk for myocardial infarction (MI). These studies
early-onset breast cancer because the substitution revealed that a specific interleukin-1B haplotype
is a synonymous polymorphism. Interestingly, correlated well with increased risk of NSCLC
the variant 50 -subhaplotype ATC on block (Landvik et al. 2009) and a rare haplotype in
1 complexed only with the normal 30 - LRP8 conferred significant risk of early-onset
-subhaplotype AAT, and this combination formed CAD/MI (Shen et al. 2014). These findings pro-
another common variant haplotype structure that vide strong empirical support for the hypothesis
differed from the normal haplotype by a single that haplotype analysis could be used as a molec-
missense substitution at the third nucleotide of the ular screening tool to screen BRCA genes to
50 -subhaplotype (rs144848, NM_000059.3:c. assess potential risk and susceptibility for early-
1114A > C); this subhaplotype involves a non- onset breast cancer. However, the usefulness of
conservative amino acid change in the region of these derived haplotypes to predict risk of early-
the protein that interacts with histone onset breast cancer needs to be assessed using a
acetyltransferase (Healey et al. 2000). Baynes powerful association study.
et al. (2007) previously showed that this SNP
(rs144848) is not associated with breast cancer
risk (Baynes et al. 2007); however, in its hetero- 7 Conclusion
zygous genotype state (AC), it has been signifi-
cantly associated with epithelial ovarian cancer In conclusion, we identified common and rare
(Beesley et al. 2007). haplotypes of the BRCA1 and BRCA2 genes in
The rare variant haplomolecule CTA-AGT early-onset breast cancer patients. The high-
differed from the variant-free haplotype by two frequency haplotypes of these two genes may be
nucleotides, one on each subhaplotype. The rare regarded as the common haplotypes distributed in
50 subhaplotype CTA in the BRCA2 gene with the the Malaysian population. The less common
minor allele C (MAF ¼ 0.064) at rs766173 has an derived haplotypes found in the breast cancer
asparagine to histidine substitution at position patients may serve as novel molecular markers
that may be of potential significance in screening Collaborative Group on Hormonal Factors in Breast Can-
to identify patients at high risk for early-onset cer. (2001). Familial breast cancer: Collaborative
reanalysis of individual data from 52 epidemiological
breast cancer. The risk associated with these studies including 58,209 women with breast cancer
haplotypes needs to be evaluated in a prospective and 101,986 women without the disease. Lancet, 358,
case control study designed to validate their 1389–1399.
importance before they are used as molecular Dahlui, M., Ramli, S., & Bulgiba, A. M. (2011). Breast
cancer prevention and control programs in Malaysia.
diagnostic markers for the Malaysian population. Asian Pacific Journal of Cancer Prevention, 12,
1631–1634.
Acknowledgement Authors would like to extend nurses Frosk, P., Burgess, S., Dyck, T., Jobse, R., & Spriggs,
and technical staff in the Department of Surgery, Hospital E. L. (2007). The use of ancestral haplotypes in the
Seberang Jaya, Ministry of Health Malaysia, Hospital molecular diagnosis of familial breast cancer. Genetic
Universiti Sains Malaysia (HUSM) and Clinical Trial Testing, 11, 208–215.
Centre, and Advanced Medical and Dental Institute Healey, C. S., Dunning, A. M., Teare, M. D., Chase, D.,
(AMDI), Universiti Sains Malaysia for helping us in sam- Parker, L., et al. (2000). A common variant in BRCA2
ple collection and patient recruitments. is associated with both breast cancer risk and prenatal
viability. Nature Genetics, 26, 362–364.
Landvik, N. E., Hart, K., Skaug, V., Stangeland, L. B.,
Conflict of Interests None Haugen, A., et al. (2009). A specific interleukin-1B
haplotype correlates with high levels of IL1B mRNA
in the lung and increased risk of non-small cell lung
cancer. Carcinogenesis, 30, 1186–1192.
References Lim, G. C. C., Rampal, S., & Halimah, Y. (2008). Cancer
incidence in peninsular Malaysia 2003–2005. The
Arver, B., Du, Q., Chen, J., Luo, L., & Lindblom, third report of the National Cancer Registry Malaysia.
A. (2000). Hereditary breast cancer: A review. Kuala Lumpur: National Cancer Registry, Malaysia.
Seminars in Cancer Biology, 10, 271–288. Loannidis, J. P., Ntzani, E. E., Trikalinos, T. A., &
Barrett, J. C., Fry, B., Maller, J., & Daly, M. J. (2005). Contopoulos-Ioannidis, D. G. (2001). Replication
Haploview: Analysis and visualization of LD and hap- validity of genetic association studies. Nature Genet-
lotype maps. Bioinformatics, 21, 263–265. ics, 29, 306–309.
Baynes, C., Healey, C. S., Pooley, K. A., Scollen, S., Madigan, M. P., Ziegler, R. G., Benichou, J., Byrne, C., &
Luben, R. N., et al. (2007). Common variants in the Hoover, R. N. (1995). Proportion of breast cancer
ATM, BRCA1, BRCA2, CHEK2 and TP53 cancer cases in the United States explained by well-
susceptibility genes are unlikely to increase breast can- established risk factors. Journal of the National Can-
cer risk. Breast Cancer Research, 9, R27. cer Institute, 87, 1681–1685.
Beesley, J., Jordan, S. J., Spurdle, A. B., Song, H., Ramus, Palma, M., Ristori, E., Ricevuto, E., Giannini, G., &
S. J., et al. (2007). Association between single- Gulino, A. (2006). BRCA1 and BRCA2: The genetic
nucleotide polymorphisms in hormone metabolism testing and the current management options for muta-
and DNA repair genes and epithelial ovarian cancer: tion carriers. Critical Reviews in Oncology/Hematol-
Results from two Australian studies and an additional ogy, 57, 1–23.
validation set. Cancer Epidemiology, Biomarkers & Peto, J., Collins, N., Barfoot, R., Seal, S., Warren, W.,
Prevention, 16, 2557–2565. et al. (1999). Prevalence of BRCA1 and BRCA2 gene
Breast Cancer Association Consortium. (2006). Com- mutations in patients with early-onset breast cancer.
monly studied single-nucleotide polymorphisms and Journal of the National Cancer Institute, 91,
breast cancer: Results from the breast cancer associa- 943–949.
tion consortium. Journal of the National Cancer Insti- Qin, Z. S., Niu, T., & Liu, J. S. (2002). Partition-ligation-
tute, 98, 1382–1396. expectation-maximization algorithm for haplotype
Breast Cancer Linkage Consortium. (1997). Pathology of inference with single-nucleotide polymorphisms.
familial breast cancer: Differences between breast American Journal of Human Genetics, 71, 1242–1247.
cancers in carriers of BRCA1 or BRCA2 mutations Shen, G. Q., Girelli, D., Li, L., Rao, S., Archacki, S., et al.
and sporadic cases. Lancet, 349, 1505–1510. (2014). A novel molecular diagnostic marker for famil-
Breast Cancer Linkage Consortium. (1999). Cancer risks ial and early-onset CAD and MI in the LRP8 gene.
in BRCA2 mutation carriers. Journal of the National Circulation. Cardiovascular Genetics, 7(4), 514–520.
Cancer Institute, 91, 1310–1316. Slattery, M. L., & Kerber, R. A. (1993). A comprehensive
Colditz, G. A., Willett, W. C., Hunter, D. J., Stampfer, evaluation of family history and breast cancer risk. The
M. J., Manson, J. E., et al. (1993). Family history, age, Utah population database. JAMA, 270, 1563–1568.
and risk of breast cancer. Prospective data from the Struewing, J. P., Abeliovich, D., Peretz, T., Avishai, N.,
Nurses’ health study. JAMA, 270, 338–343. Kaback, M. M., et al. (1995). The carrier frequency of
12 M. Saleem et al.
the BRCA1 185delAG mutation is approximately Wahid, M. I. (2014). Breast cancer. Common cancer.
1 percent in Ashkenazi Jewish individuals. Nature Malaysian Oncological Society. http://www.
Genetics, 11, 198–200. malaysiaoncology.org/article.php?aid¼114
Toh, G. T., Kang, P., Lee, S. S., Lee, D. S., Lee, S. Y., Wooster, R., & Weber, B. L. (2003). Breast and ovarian
et al. (2008). BRCA1 and BRCA2 germline mutations cancer. The New England Journal of Medicine, 348,
in Malaysian women with early-onset breast cancer 2339–2347.
without a family history. PLoS One, 3, e2024.
Adv Exp Med Biol – Innovations in Cancer Research and Regenerative Medicine (2020) 3: 13–25
https://doi.org/10.1007/5584_2018_148
# Springer International Publishing AG 2018
Published online: 24 April 2018
Anti-cancer Effect of Xao Tam Phan

Paramignya trimera Methanol Root Extract
on Human Breast Cancer Cell Line MCF-7
in 3D Model
Lam-Huyen Nguyen-Thi, Sinh Truong Nguyen,

Thao Phuong Tran, Chinh-Nhan Phan-Lu, Trung The Van,
and Phuc Van Pham
Abstract spheroid size was tracked, and growth curve

was measured by MTT assay and AlamarBlue
Background: Cancer is one of the leading ®
assay. The necrotic core of MCTS was
causes of death in the world. A great deal of
evaluated by propidium iodide (PI) staining.
effort has been made to discover new agents
Toxicity of doxorubicin (DOX) and
for cancer treatment. Xao tam phan
tirapazamine (TPZ) was then tested on 3D
(Paramignya trimera) is a traditional medicine
model compared to 2D culture condition.
of Vietnam used in cancer treatment for a long
Results: The results showed that the IC50 of
time, yet there is not much scientific evidence
DOX on 3D MCF-7 cells was nearly 50 times
proving its anticancer potency. The study
greater than monolayer MCF-7 cells. In con-
aimed to evaluate the toxicity of Paramignya
trast, TPZ (an agent which is specifically toxic
trimera extract (PTE) on multicellular tumor
under hypoxic conditions) had significantly
spheres (MCTS) of MCF-7 cells using hang-
lower IC50 in 3D condition than in 2D. The
ing drop technique. Methods: Firstly, MCF-7
toxicity tests for PTE showed that PTE
cells were seeded on hanging drop plates,
L.-H. Nguyen-Thi, S. T. Nguyen, and C.-N. Phan-Lu

Stem Cell Institute, University of Science, VNUHCM, Ho
Laboratory of Cancer Research, University of Science,

VNUHCM, Ho Chi Minh City, Vietnam
e-mail: ntlhuyen@hcmus.edu.vn; ntsinh@hcmus.edu.vn; P. Van Pham (*)
plcnhan@hcmus.edu.vn Stem Cell Institute, University of Science, VNUHCM, Ho
T. P. Tran
Stem Cell Institute, University of Science, VNUHCM, Ho Laboratory of Cancer Research, University of Science,
Chi Minh City, Vietnam VNUHCM, Ho Chi Minh City, Vietnam
T. The Van Laboratory of Stem Cell Research and Application,
Ho Chi Minh City Medicine and Pharmacy University, University of Science, VNUHCM, Ho Chi Minh City,
Hospital of Dermatology – Ho Chi Minh City, Ho Chi Vietnam
Minh City, Vietnam e-mail: pvphuc@hcmus.edu.vn
13
14 L.-H. Nguyen-Thi et al.
strongly inhibited MCF-7 cells in both 2D and or cancer-like diseases in recent years, there has
3D conditions. Interestingly, the IC50 of PTE been no official publication in the literature on its
in 3D model was remarkably lower than in 2D anticancer effects.
(IC50 value was 168.9 11.65 μg/ml com- Cell-based assays are considered to be the
pared to 260.8 16.54 μg/ml, respectively). foundation for drug development process, e.g.,
The invasion assay showed that PTE for the development of anticancer drugs. Initial
completely inhibited invasion of MCF-7 cells promising results of new drug candidates in cell-
at 250 μg/mL concentration. Also, flow based assays provide insight and rationale for
cytometry results indicated that PTE effectively further evaluation in animal-based models
induced apoptosis in MCF-7 spheroids in 3D (Charoen et al. 2014; Hutmacher 2010). Although
condition at 250 μg/mL concentration. Conclu- 2D cancer cell culture has a long history of usage,
sion: The results from this study emphasize the in anticancer drug development, there are many
promise of PTE in cancer therapy. limitations which have been reported on in recent
years (Edmondson et al. 2014). Notably, 2D can-
Keywords cer cell culture models fail to mimic the natural
structure of a tumor. This leads to the differences
3D tumor sphere · Anticancer · Apoptosis ·
in the response of monolayer cancer cells (versus
Extract · MCF-7 · Multicellular tumor
natural tumors) to the tested candidate drugs
spheres · Paramignya trimera · Tirapazamine ·
(Edmondson et al. 2014).
Toxicity · TPZ · Xao tam phan
Researchers therefore developed 3D cell cul-
ture models to bridge the gap between 2D cell-
based assays and preclinical animal models/trials.
Abbreviations Thus, a large number of publications have since
demonstrated the promise and benefits of 3D
DOX Doxorubicin model (versus 2D). Notably, 3D models are able
ECM Extracellular matrix to imitate many characteristics of the in vivo
FBS Fetal bovine serum tumor, including cell morphology, proliferation,
MCTS Multicellular tumor spheres cell-cell interactions, cell-ECM interactions, and
PTE Paramignya trimera extract gene/protein expression profiles (Nguyen et al.
PI Propidium iodide 2016; Sutherland 1988). The use of 3D cell
TPZ Tirapazamine models has remarkably increased in the last
decade (Ferro et al. 2014). Numerous 3D cell
culture systems have been developed to meet the
growing need for optimal 3D cell culture, with
each system having distinct advantages and
1 Introduction disadvantages. Among the 3D cell culture
systems, “hanging drop” is an effective technique
Traditional herbal medicines have been used to for 3D cell culture that is used in drug develop-
improve people’s health for over a thousand ment. The hanging drop method is popular due to
years. Plant-derived compounds are being its ability to generate spheroids which are homog-
remarkably recognized as useful complementary enous in size and shape, for the number of cells
medicines in cancer treatment (Yin et al. 2013). required, and for its application for high-
Xao tam phan (Paramignya trimera) is a Viet- throughput screening (Kelm et al. 2003; Pham
namese herbal medicine which was shown to 2015; Timmins and Nielsen 2007).
contain high levels of phenols, saponins, In recent years, 3D cell models (rather than 2D
flavonoids, proanthocyanidins, and antioxidant cell models) have been demonstrated to be more
agents (Nguyen et al. 2017). Although this herb effective at mimicking the structure and
has been widely used for the treatment of cancer characteristics of cancer cells in tumors, hence
Anti-cancer Effect of Xao Tam Phan Paramignya trimera Methanol Root. . . 15
more accurately reflecting the possible in vivo using the AxioVision microscope software (Carl
tumor response (Kijanska 2016; Smith et al. Zeiss).
2012). Being a tropical country, Vietnam has
tremendous potential in cancer drug screening
due to its diversity of herbs. Paramignya trimera 2.3 PI Staining for Necrotic Core
is among the many promising candidates and is Detection
the focus of the study herein. Nonetheless, a 3D
cancer cell model for testing toxicity of extracts Spheroids of MCF-7 cells were transferred from
and compounds is still relatively a new concept. the hanging drop plate onto flat-bottom 96-well
This study aimed to evaluate the toxicity of plates. Cells were then incubated for 1 h in
Paramignya trimera extract (PTE) on 100 μL of cell culture medium supplemented
microtumor spheres of MCF-7, created using with 1 μL of propidium iodide (PI; Sigma-
hanging drop technique. Aldrich, St Louis, MO). After washing with
PBS, spheroids were observed under fluorescent
microscope.
2 Materials and Methods
2.1 3D Cell Culture and Spheroid 2.4 Cell Viability Assay

Formation
The MTT assay and AlamarBlue® assay were
Human breast adenocarcinoma MCF-7 cells were used to evaluate the growth of spheroids as well
obtained from the American Type Culture Col- as discern cell viability. Spheroids were trans-
lection (ATCC, Manassas, VA, USA), were ferred from the hanging drop plate to single
maintained in DMEM-F12 medium wells of a low-attachment 96-well plate (Corning,
supplemented with 10% fetal bovine serum Inc., Corning, NY). For the MTT assay, after 3 h
(FBS; Gibco/Thermo Fisher Scientific, Waltham, of incubation with MTT (Sigma-Aldrich),
MA, USA) and 1% antibiotic (Thermo Fisher formazan crystal was dissolved with 100 μL
Scientific), and then incubated at 37 C in a DMSO (Sigma-Aldrich), and absorbance was
humidified atmosphere of 5% CO2. Cell culture recorded at 570 nm. Cell viability was also
medium was replenished every 2–3 days, and assessed by AlamarBlue® assay (Thermo Fisher
cells were passaged until they reached 65–80% Scientific). The assays were conducted according
confluence. For 3D culture, single-cell suspen- to the manufacturers’ instructions. Briefly, after
sion was collected from trypsinized monolayer 3 h of incubating with AlamarBlue® at a final
of cells. Cells were then diluted to obtain a con- concentration of 10 μg/mL, plates were measured
centration at 50,000 cells/mL. Cell suspensions for fluorescence intensity at 535 nm excitation
were then seeded onto 96-well Perfecta3D® hang- and 595 nm emission by a DTX 880 microplate
ing drop plate (50 μL/well) (3D Biomatrix, Ann reader (Beckman Coulter, Brea, CA).
Arbor, MI, USA).
2.5 Drugs Treatment on MCF-7

2.2 Measurement of Spheroid Spheroids
Growth
A density of 2500 cells/well was seeded for drug
To examine the growth of spheroids over time, testing in both 2D and 3D models. For 2D cell
2500 cells/wells were seeded into the wells. Three samples, the cells were plated in 96-well plate,
spheroids in three different wells were imaged cultured for 24 h, and treated with gradient
every day using light microscopy (Carl Zeiss, concentrations of the drugs. For 3D cell samples,
Germany). The spheroid diameter was calculated after seeding for 3 days, MCF-7 spheroids were
16 L.-H. Nguyen-Thi et al.
transferred to low-attachment 96-well plates and Lakes, NJ). For spheroids, after 48 h of treatment
treated with various concentrations of the drugs with DOX, TPZ, or PTE, cells were trypsinized
for 48 h. and dispersed into single-cell suspension by gen-
Spheroids were treated with DOX at the fol- tle pipetting. The cells were processed as per
lowing concentrations: 10000 μM, 5000 μM, instructions of the AnnexinV-FITC Apoptosis
2500 μM, 1250 μM, 600 μM, 300 μM, and Detection Kit. Flow cytometric evaluation of the
150 μM. Spheroids were treated with TPZ at the cells was conducted using a flow cytometer
following concentrations: 500 μM, 250 μM, (BD Biosciences, CA, USA), equipped with
125 μM, 60 μM, 30 μM, 15 μM, and 7.5μM. CellQuest Pro software.
Lastly, spheroids were treated with PTE at the
following concentrations: 2000 μg, 1000 μg,
500 μg, 250 μg, 125 μg, and 60 μg. 2.8 Statistical Analysis
AlamarBlue® cell viability assay was then
used to determine cell viability. DOX and TPZ The results were presented as mean SD. Statisti-
were chosen for our research study. Sigmoidal cal analyses were performed using GraphPad
dose-response curves for 2D and 3D systems Prism 7.0 (GraphPad Software Inc., San Diego,
were generated using GraphPad Prism 7.0 (San CA, USA). P < 0.05 was considered to be statisti-
Diego, CA, USA), and the IC50 values for each cally significant. IC50 value was calculated by
system were interpolated. GraphPad Prism 7.0 software based on the formu-
lation: Fifty ¼ (Top+Baseline)/2 and Y ¼ Bot-
tom + (Top-Bottom)/(1 + 10^((LogIC50-X)
2.6 Spheroid Invasion Assay *HillSlope + log((Top-Bottom)/(Fifty-Bottom)-1).
After 3 days of cell seeding, spheroids were

formed. These spheroids were then dropped 3 Results
onto flat-bottom 96-well plate containing media
supplemented with DOX at the following 3.1 Successful Development of MCF-
concentrations: 9 μM, 4.5 μM, 2 μM, 1 μM, 0.5 7 Spheroids (3D Cell Culture)
μM, 0.25 μM, and 0 μM. TPZ was evaluated at
the following concentrations: 500 μM, 250 μM, From seeding 2500 cells per well, MCF-7
125 μM, 60 μM, 30 μM, 15 μM, and 0 μM. spheroids were easily formed 2 days of seeding
Lastly, PTE was evaluated at the following and maintained a spheroid shape until day
concentrations: 2000 μg, 1000 μg, 500 μg, 9 (Fig. 1). Spheroid diameter increased over
250 μg, 125 μg, 60 μg, and 0μM. After 48 h of those 9 days (Fig. 2a). Spheroid metabolism
treatment, spheroids were observed to evaluate quickly increased in the first 3 days, followed by
the invasion of cells surrounding the spheroids. a stable stage (from days 4 to 8) before dropping
The area of the invasion zone around the on day 9 (Fig. 2b). The results showed that the
spheroids corresponding to each drug concentra- change in growth curve of MCF-7 spheroids was
tion was then calculated using AxioVision micro- stable for the two different metabolism measuring
scope software (Carl Zeiss, Inc.). methods, MTT and AlamarBlue® assays. Spher-
oid metabolism remarkably increased in the first
3 days, followed by a plateau from days 4 to 7; at
2.7 Apoptosis Detection Assay day 8, cell metabolism rose again before dropping
the next day.
The percentage of apoptosis and of necrosis of Previous studies have shown that the normal
cells induced by the drugs was determined by structure of a tumor is comprised of two main
flow cytometry using the AnnexinV-FITC Apo- elements: necrotic core in the middle and an
ptosis Detection Kit (BD Bioscience, Franklin outer layer of viable cells (Sant and Johnston
Anti-cancer Effect of Xao Tam Phan Paramignya trimera Methanol Root. . . 17
Fig. 1 Development of microtumor spheres of MCF-7 1-day intervals from day 1 to day 9 via light microscopy.
under light microscopy. MCF-7 cells (2500 cells/well) Spheres retained their round shape until day 9 (Magnifica-
were seeded onto a hanging drop plate. Spheroids formed tion: X4)
after 2 days in culture. Spheroid images were captured at
Fig. 2 The growth of

MCF-7 spheroids.
(a) Spheroid diameter
increased steadily over
9 days. After seeding 2500
cells/well, MCF-7 cells
easily formed spheroids at
day 2. Three spheroids were
imaged every day until day
9; their diameters were
calculated using
AxioVision software. The
mean values represent the
growth curve of spheroids.
(b) Change in spheroid
metabolism detected by
MTT and AlamarBlue®
assays. MTT and
AlamarBlue® assays were
used to evaluate the change
in spheroid metabolism.
AlamarBlue® assay records
fluorescent intensity, while
MTT assay records optical
intensity. The curves of
both methods were
compared to verify any
changes in spheroid
growth. The data at each
time point was presented by
value SD, the
experiments were done in
replicates (n ¼ 3). Data was
statistically analyzed using
the GraphPad Prism 7.0
(GraphPad Software, Inc.)
Another random document with
no related content on Scribd:
The Project Gutenberg eBook of Essay on art and
photography
This ebook is for the use of anyone anywhere in the United States
and most other parts of the world at no cost and with almost no
restrictions whatsoever. You may copy it, give it away or re-use it
under the terms of the Project Gutenberg License included with this
ebook or online at www.gutenberg.org. If you are not located in the
United States, you will have to check the laws of the country where
you are located before using this eBook.
Title: Essay on art and photography
Author: A. V. Sutton
Release date: August 29, 2023 [eBook #71518]
Language: English
Original publication: Liverpool: Michael James Witty, 1866
Credits: Charlene Taylor and the Online Distributed Proofreading

Team at https://www.pgdp.net (This file was produced from
images generously made available by The Internet
Archive/American Libraries.)
*** START OF THE PROJECT GUTENBERG EBOOK ESSAY ON

ART AND PHOTOGRAPHY ***
E S S AY
ON
A R T A N D P H O T O G R A P H Y.
1866.
PRINTED BY
M. J. WHITTY
18 CABLE ST.
LIVERPOOL
E S S AY
ON
Art and Photography.
BY
A. V. SUTTON.
LIVERPOOL:
MICHAEL JAMES WHITTY.
MDCCCLXVI.
D e d i c at e d
TO MY
Friends and Patrons.

INTRODUCTION
The idea that occurred to me in drawing in epitome a history of
the amalgamation of Art and Science, and ultimately induced me to
attempt so hazardous a task, was to enable the public to learn the
true course to be pursued in order to give fresh vigour and impulse
for the revival of Fine Arts, and I have endeavoured to exemplify in a
striking manner, as far as my poor abilities admit, the inestimable
advantage the one confers upon the other, which renders the
combination so essential in advancing and developing a better, truer,
and nobler style of art—a style that I feel assured will distinguish for
ever the present generation. With this view, I have gathered
materials from every common report or otherwise, from personal
acquaintance with some of the most distinguished artists of the day,
and it is with regret that I find how immeasurably incompetent I am to
do justice to a subject so worthy of being treated by greater talents
and accomplishments than are granted to me. In sketching the
various changes Photography has undergone ere it reached the
supremacy it now enjoys, owing—principally to the natural instability
of events—and in the rapid survey to which the limits of the Essay
constrain me, I have been compelled to point out defects “both in the
Art and the Science,” without reserve, but with all due respect to the
opinion of others; but while doing so, I trust that I have rendered
justice also.
As a professional artist, the reader may be led to suppose I write
with bias—not so. I have most cautiously avoided any sentiment that
might be so construed, and beg that judgment may be suspended
until these pages have been perused, the perusal of which, I
sincerely trust, may have the desired effect—not actually resulting in
the revival of Fine Arts—but as an auxiliary for paving the way for
others commanding a greater range of knowledge, who may thereby
be induced to embark in the cause I am humbly seeking to advocate.
Liverpool,
Jany., 1866.
ESSAY.
ESSAY.
When Photography was first introduced, it met with a severe
struggle ere gaining the esteem it now happily enjoys. Artists of all
grades unanimously condemned it, looking upon it only in the light of
a vehicle that would carry destruction to their own especial pursuits,
while on those who attempted to practice and advance it fell
anathemas and ridicule. So great was professional prejudice, and so
blind in its apprehension, that it dexterously and successfully biased
and enlisted the opinion of the Press in its favour, which echoed the
assertions that, under the most favourable circumstances,
“Photography could only be a caricature of the subject it portrayed.”
Thus was the combination of Art and Science for a time checked in
its progress, and the artists, now exulting in having temporarily
attained their purpose, watched jealously the science of chemistry,
and depreciated as useless any further inquiry that seemed to
encourage or aid Photography.
The great body of the public, as usual in all such cases,
remained neutral, but fortunately, for the advancement of the new
art, there remained a few who were more sanguine than their
cotemporaries, and generously bestowed their sympathy on the
“oppressed.” They saw in Photography, a great science, then but in
its infancy, but which must ultimately compete with the finer arts; its
peculiar adaptation in copying rendering it still more valuable, not
only to artists, in furthering their own success, by securing
truthfulness and accuracy, but likewise in all the various usages to
which it has since been so successfully applied. Too numerous to
attempt to specify here.
At the period we speak of, Photography was entirely confined to
that class of illiterate men who only pursued it to benefit by its
novelty, and like everything new, particularly when added to
cheapness, produced a great amount of bad taste and unpardonable
vulgarity. It is, no doubt, an art which is peculiarly liable to be
perverted to base and immoral uses, but now that better taste
prevails, no such fears need be entertained. All classes of society
have been benefited by Photography; it has been a generous friend
to the poor as well as to the rich, and all must acknowledge its
superior advantages and merits. Not only has it been fostered and
liberally supported by the munificence of kings, but also in the more
humble walks of life has it been welcomed as a benefactor. Its
patrons of all grades have not only derived pleasure from the novelty
of its fascinations, but inexpressible consolation from the souvenirs it
affords of cherished places, and the memory of those loved ones
who may be far away, or sleeping the “sleep of death.”
It would indeed be deplorable if an art so consecrated to all that
is noble, pure, generous and holy, were again to be jeopardised by
the association of bad taste and worse usages. In England we are
fortunately protected from such an evil; but in other countries,
particularly in France, it still exists to an alarming extent, and until the
authorities there adopt the same measure of punishment as with us,
no one can walk the streets without being subjected to some gross
outrage against propriety and moral feeling. Photography, therefore,
has a double claim upon our affections—to preserve it unscathed
and unsullied, when we find it diverted into new channels that may
endanger its purity and legitimate usefulness. An art which assists
the memory and educates the taste is entitled to encouragement, the
more particularly, when by its aid we can recall in privacy the happy
hours suggested by the contemplation of the sure-reflected
lineaments of a doating mother, an affectionate sister, a tender loving
wife, or a fond and innocent child.
One great reason why Photography is so frequently applied to
unworthy purposes is, owing to its cheapness, for, where there is a
supply of anything novel, combined with cheapness, patrons will
present themselves. This is a public weakness which is to be
regretted, for although competition may be consistent with the “spirit
of the age,” it is an unpardonable error when cheapness is resorted
to as a means to success, in place of trying to excel by artistic or
superior merits alone.
In no stage of Photography have we been further advanced and
initiated into the grand applications of its science than by the
introduction of the “paper process;” it presented to the mind of the
photographer a channel for experimentalising and uniting art proper
with his own, for previously the word Art was foreign to the ear of the
professional photographer; all that was deemed essential in the
pursuit was that you should acquire a knowledge how to produce a
photograph free from all the optical and chemical defects. Light was
only studied to secure the image with brilliancy on the plate, of the
subject or object about to be copied. If it came out clear, clean, and
sharp, the operator was delighted with his success—its artistic merits
were never consulted; no question asked whether the face came out
with the rich, soft, rotundity of nature; whether the light and shade
had given tone and gradation, to add harmony to the picture;
whether the line of the head had been carried to prevent
awkwardness to the figure; whether the eyes did not look askance to
the pose of the head; its artistic superiorities, in fact, were never
looked for, which explains why, at that period, photographs were
taken, as a general rule, simply head-bust, most commonly called
vignettes, or as the Americans would term it, ambrotype. Such were
the productions of the “Glass Age.” But from the time the “paper
process” established itself, Photography at once took its place
among the finer arts, and having gained the victory, the artists that
had disdainfully resented its popularity, ventured to advance into the
new field of enterprise, and not only were they delighted in procuring
such an auxiliary, but they laboured in trying to improve the
application of its science to Portraiture. Though painting renders the
chemical result subordinate, and likewise subservient to the skill of
the artist, when removed from the pressure frame to the easel, yet in
no way does it depreciate Photography as an art which is necessary
to assist in securing with unerring accuracy of outline momentary
indications of character, expression of face, and costume, consisting
of numberless and minute details; all of which are at once portrayed
on a tablet of glass reflected through the Camera; and which, if not
satisfactory to the mind of the operator, he may arrange according to
his own artistic taste, judgment and skill, with a view of securing
pictorial effect and individual character.
It would be utterly impossible to estimate the advantages
Photography has conferred upon all mankind, or to anticipate the still
greater wonders it is yet destined to achieve.
Having sketched the early struggles which Photography had to
surmount to claim a high place for its followers, we now proceed to
examine its distinguishing features. In scrutinizing the works of even
the greatest artists of our day, we are sure to find some fault—some
error. Why is it that imperfection should exist even in works of the
highest rank, grand in conception, beautiful in execution, rich in
modulation, truthfulness of outline and form, and harmonious in
colouring? For the simple reason, that true excellence can only be
found in composition pictures where the creative mind of the artist
has been free to labour in accordance with its own poetic fancy, and
when such perfection exists in portraiture without the aid of
Photography, it will indeed be an exception!
When the practical eye of an artist takes up a Work of Art, he at
once recognizes the forte of the genius in some one particularity.
Say for instance one artist may excel in the master-stroke of
execution, and by a few strokes of the brush give much more artistic
and life-like effect than another would by hours of close application
and the minutest finish—the difference between these two artists
being that the one was a true born artist, and the other a lover of the
art—simply one who had acquired its mechanism from untiring study
and practice. We will again find others who excel in the
amalgamation of colours, others for composition, others for
costumes and drapery—others for the delicacy and transparency of
the flesh tones; and we might still further attempt to specify their
various fortes of particular excellence, by dissecting the human
forms and classify them by their technical terms in anatomy. For
instance, I have known artists who have excelled in the execution of
a face, and yet fail in the representation of the hair—all their heads
conveying to the observer an idea that they were wigged! In other
productions we are at once made sensible that the artist has one
ideal for a nose, and if the picture represents innumerable figures,
they are all possessed of the same type of nasal organ! In others
again, we find the artist manifest in some peculiarity in the eye or in
the mouth; but it is not any of these artistic individualities we ask for
when we are desirous of possessing a faithful likeness of some
loved one, nor do we care to find as we scan their well-remembered
features, the artist’s ideal of a nose, an eye, a mouth, a chin, or
some other member, in place of its, perhaps, more homely
characteristic. In nature we are daily witnessing how the various
types of features, at once the most classic and homely—highest and
lowest, come to mingle so congruously in one face, but such as
nature has thought fit to endow us, such do we want to be faithfully
and accurately delineated, and if such combination of distinctive
specialities of art are required for portraiture, which is rarely, if ever,
found individually, then how inestimable is the aid of Photography!
Many are under the impression that its process exaggerates to such
an extent that the object or subject reproduced is figuratively
distorted, which constituted the opprobium attached to its
productions. This is a mistake. If the operator uses a first-class
instrument, and sufficiently large to secure the same perfect
definition at the extreme margin of the plates as in the centre, and
regulated by the diaphragm with space sufficient for the required
length of focus, no aberation or distortion will be visible. But if a
questionable lens is used, and the aperture too small for the flatness
of “field” required, then the whole model will be more or less
distorted; its receding lines obtruding as to become perfectly blurred
and indistinct; the shadows black, without detail, and the lights hard
and flat. But let it be remembered that this Essay is entirely confined
to the aspirants to Art in its higher branches. Photography in the
hands of a lover of its art, initiated in the theory and practical
knowledge of its science, would not waste valuable time in the
production of such enormities. We have, therefore, only to deal with
its advantages in its higher order of execution; or if we deviate a
while from our theory, it is but to confirm our arguments, and give the
reader an opportunity to discriminate for himself between the two.
But to return to the fallacy of portraiture being confined to the
erroneous pencil of the deceitful imagination of an artist possessing
one or more only of those capabilities essential to the production of

Full Chapter Cancer Biology and Advances in Treatment Phuc Van Pham PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Full Chapter Cancer Biology and Advances in Treatment Phuc Van Pham PDF

Uploaded by

Copyright:

Available Formats

Cancer Biology and Advances in

Treatment Phuc Van Pham

Stem Cells Biology and Engineering Phuc Van Pham

Cell biology : translational impact in cancer biology

Addiction Treatment Katherine Van Wormer

What to Eat During Cancer Treatment. 2nd Edition The

Cancer Stem Cells Methods and Protocols Methods in

Artificial Intelligence in Cancer: Diagnostic to

Cancer and the New Biology of Water Thomas Cowan

Kidney Cancer Recent Advances in Surgical and Molecular

Phuc Van Pham Editor

Innovations in Cancer Research

More information about this subseries at http://www.springer.com/series/15740

Cancer Biology and

ISSN 0065-2598 ISSN 2214-8019 (electronic)

# Springer Nature Switzerland AG 2020

The BRCA1 and BRCA2 Genes in Early-Onset Breast

Predictive Potential of PD-L1, TYMS, and DCC Expressions

Maha Abdullah Department of Pathology, Faculty of Medicine and Health

Hakimah Mahsin Pathology Department, Seberang Jaya Hospital, Seberang

Norashikin Zakaria Regenerative Medicine Cluster, Advanced Medical &

The BRCA1 and BRCA2 Genes in Early-Onset

Mohamed Saleem, Mohd Bazli Ghazali,

Abstract cancer patients. We enrolled 70 patients

Mohamed Saleem and Mohd Bazli Ghazali authors con-

Genomic Transcript Allele HWE

Table 3 Oligonucleotide primers used for genotyping

Anti-cancer Effect of Xao Tam Phan

Lam-Huyen Nguyen-Thi, Sinh Truong Nguyen,

Abstract spheroid size was tracked, and growth curve

L.-H. Nguyen-Thi, S. T. Nguyen, and C.-N. Phan-Lu

Laboratory of Cancer Research, University of Science,

2.1 3D Cell Culture and Spheroid 2.4 Cell Viability Assay

2.5 Drugs Treatment on MCF-7

After 3 days of cell seeding, spheroids were

Fig. 2 The growth of

Title: Essay on art and photography

Release date: August 29, 2023 [eBook #71518]

Original publication: Liverpool: Michael James Witty, 1866

Credits: Charlene Taylor and the Online Distributed Proofreading

*** START OF THE PROJECT GUTENBERG EBOOK ESSAY ON

Art and Photography.

MICHAEL JAMES WHITTY.

Friends and Patrons.

You might also like