Plant, Cell and Environment (2009) 32, 336–348
Ice recrystallization inhibition proteins (IRIPs) and freeze
tolerance in the cryophilic Antarctic hair grass
Deschampsia antarctica E. Desv.
ULRIK P. JOHN1,2,3, RENATA M. POLOTNIANKA1,2,3, KAILAYAPILLAI A. SIVAKUMARAN1,2, ORINDA CHEW1,2,
LEANNE MACKIN1, MICHAEL J. KUIPER4, JONATHAN P. TALBOT1,2, GREGORY D. NUGENT1,3, JULIE MAUTORD1,2,
GUSTAVO E. SCHRAUF5 & GERMAN C. SPANGENBERG1,2,3
1
Department of Primary Industries, Biosciences Research Division, 2Australian Centre for Plant Functional Genomics,
3
Victorian Centre for Plant Functional Genomics, Victorian AgriBiosciences Centre, 1 Park Drive, Bundoora, Vic. 3086,
Australia, 4Victorian Partnership for Advanced Computing, Carlton Sth, Vic. 3053, Australia and 5Facultad de Agronomia,
Universidad de Buenos Aires, Buenos Aires, Argentina
ABSTRACT
Antarctic hair grass (Deschampsia antarctica E. Desv.),
the only grass indigenous to Antarctica, has well-developed
freezing tolerance, strongly induced by cold acclimation.
Here, we show that in response to low temperatures, D.
antarctica expresses potent recrystallization inhibition (RI)
activity that, inhibits the growth of small ice crystals into
potentially damaging large ones, is proteinaceous and
localized to the apoplasm. A gene family from D. antarc-
tica encoding putative homologs of an ice recrystallization
inhibition protein (IRIP) has been isolated and character-
ized. IRIPs are apoplastically targeted proteins with two
potential ice-binding motifs: 1–9 leucine-rich repeats
(LRRs) and c. 16 ‘IRIP’ repeats. IRIP genes appear to be
confined to the grass subfamily Pooideae and their prod-
ucts, exhibit sequence similarity to phytosulphokine recep-
tors and are predicted to adopt conformations with two
ice-binding surfaces. D. antarctica IRIP (DaIRIP) tran-
script levels are greatly enhanced in leaf tissue following
cold acclimation. Transgenic Arabidopsis thaliana express-
ing a DaIRIP has novel RI activity, and purified DaIRIP,
when added back to extracts of leaves from non-acclimated
D. antarctica, can reconstitute the activity found in accli-
mated plants. We propose that IRIP-mediated RI activity
may contribute to the cryotolerance of D. antarctica, and
thus to its unique ability to have colonized Antarctica.
Key-words: abiotic stress; Antarctica; cold acclimation;
IRIP.
INTRODUCTION
As a consequence of exothermy, many plant species are
vulnerable to extremes of temperature. These include expo-
sure to sub-zero temperatures that have multiple deleteri-
ous impacts on plant cells. As temperatures drop below
Correspondence: U. P. John. Fax: +61 3 9479 3618; e-mail:
ulrik.john@dpi.vic.gov.au
336
doi: 10.1111/j.1365-3040.2009.01925.
freezing, ice crystal formation initially takes place extracel-
lularly, in the apoplasm. This leads to an elevation of intra-
cellular solute concentration as water is lost by osmosis to
the extracellular ice, resulting in severe dehydration. Des-
iccation, in which as much as 90% of intracellular water
may be lost at -10 °C, induces multiple forms of membrane
damage (Thomashow 1999). Furthermore, extracellular ice
formation obstructs gas and solute exchange, and growing
ice crystals cause cell lysis.
Plants, and other organisms that are exposed to sub-zero
temperatures, have evolved varied mechanisms to confer
tolerance to freezing stress, including deployment of variant
isozymes (McCown et al. 1969), synthesis of osmopro-
tectants and compatible solutes (Anchordoguy et al. 1987)
and modification of membrane lipid composition (Uemura,
Joseph & Steponkus 1995). A particular characteristic of
tolerance to freezing, and to temperature stresses in
general, is the phenomenon of acquired tolerance. For
freezing stress, this is termed cold acclimation, whereby
transition to low, non-freezing temperature can confer tol-
erance of subsequent exposure to otherwise lethal sub-zero
temperatures.
A common response of cold- and freezing-tolerant
organisms to reduced temperature is the production of anti-
freeze proteins (AFPs). AFPs have an affinity for ice, by
virtue of structural complementarity, thereby inhibiting its
growth. Adsorption of AFPs onto ice surfaces has two dis-
tinct effects: thermal hysteresis (TH) and recrystallization
inhibition (RI). TH results from a non-colligative freezing
point depression as ice-front growth becomes restricted to
sterically unfavourable spaces between AFPs (Raymond &
DeVries 1977). This broadens the gap between the melting
and freezing points of ice, this range being the measure of
TH. AFPs mediate the effect of RI by interfering with the
migration of ice boundaries that normally thermodynami-
cally favour the creation of large, ice crystals at the expense
of smaller ones (Knight, DeVries & Oolman 1984). AFPs
have been isolated from a number of freeze-tolerant
plant species, including bittersweet nightshade (Solanum
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd
 IRIPs and cryotolerance in Antarctic hair grass D. antarctica 337
dulcamara), winter rye (Secale cereale), carrot (Daucus
carota) and perennial ryegrass (Lolium perenne L.)
(Urrutia, Duman & Knight 1992; Antikainen & Griffith
1997; Worrall et al. 1998; Sidebottom et al. 2000). The AFP
from L. perenne functions as an ice recrystallization inhibi-
tion protein (IRIP) and, like the products of many cold-
inducible genes from plants (Lin et al. 1990; Thomashow
1999), remains soluble following boiling (Sidebottom et al.
2000).
Antarctic hair grass (Deschampsia antarctica E. Desv.) is
one of only two angiosperm species to have overcome the
geographical and environmental impediments to coloniza-
tion of the Antarctic continent. It grows in favourable loca-
tions along the western coast of the Antarctic Peninsula. D.
antarctica is an overwintering species with a short growing
season, which, at Palmer Station (64°47′S), is typically from
November to March (Day et al. 1999). In respect of low
temperature stress, on Léonie Island in northern Marguer-
ite Bay (67°36′S) towards the southern limit of distribution
of D. antarctica (Smith & Poncet 1987), air temperatures
below -30 °C have been recorded during the austral winter.
During the growing season, when plants are most vulner-
able to freezing stress, episodes of temperatures down to
-15 °C can occur early in the growing season (see Montiel,
Smith & Keiller 1999). Laboratory studies have demon-
strated that D. antarctica has a well-developed, cold-
acclimation response, and that significant cellular damage
only occurs in plants exposed to temperatures substantially
below those at which they freeze (Bravo et al. 2001).
Despite its well-developed freezing tolerance, no bio-
chemical or physiological mechanisms have so far been
identified in D. antarctica that can coherently account for
this capacity. We show here that cold acclimation in D.
antarctica induces potent protein-based RI activity, particu-
larly in the apoplasm. We have isolated and characterized a
gene family in D. antarctica encoding putative homologs of
the IRIP from L. perenne. IRIP gene transcript levels are
greatly elaborated in response to cold acclimation. The pro-
teins they encode have a distinctive domain organization,
and homology modelling predicts that they adopt structures
with two ice-binding surfaces. Furthermore, when expressed
in heterologous systems, D. antartica IRIPs (DaIRIPs)
exhibit RI activity, and purified DaIRIP is sufficient to
restore activity, present in cold-acclimated D. antarctica
leaves. We propose that enhancement of the expression,
copy number, structure and RI activity of DaIRIP genes
and their products, by comparison to homologs in L.
perenne and other Poaceae species, may have contributed to
the cryotolerance of D. antarctica and thus its unique ability
to colonize Antarctica.
MATERIALS AND METHODS
Plant propagation and growth conditions
Antarctic hair grass (D. antarctica E. Desv.) plants were
germinated from seeds obtained from the soil seed bank in
the vicinity of Jubany station, King George Island (62°14′S,
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
58°40′W). A vegetatively propagated single isolate (Da2)
was used for all investigations. Perennial ryegrass (L.
perenne L.) plants were of cultivar Impact. Doubled haploid
L. perenne plants, isolate DH297 of cultivar Verna, were
obtained from S.J. Dalton (Institute of Grassland and Envi-
ronmental Research, Aberystwyth, UK). Plants were grown
in soil in 16/8 h light/dark, 250 mmol m-2 s-1 photosynthetic
photon flux intensity and cold acclimated by transfer from
22 to 5 °C for 2 weeks. Aerial and subterranean parts were
collected and snap frozen in liquid N2.
Extraction of total cellular and apoplastic
fluids, DNA and RNA
Total cellular (Doucet et al. 2000) and apoplastic (Hon et al.
1994) extracts in freshly prepared extraction buffer [50 mm
Tris pH 7.4, 20 mm ascorbate, 10 mm ethylenediaminetet-
raacetic acid (EDTA)] were frozen in liquid N2 and stored
at -80 °C. To avoid non-specific effects in RI assays (below)
no protease inhibitors were added, but extracts were
handled on ice. This approach was validated by comparing
the banding profile of extracts on Coomassie-stained
sodium dodecyl sulphate–polyacrylamide gel electrophore-
sis (SDS–PAGE) gels in the presence and absence of 2 mm
phenylmethanesulphonylfluoride (PMSF) (Sigma, St Louis,
MO, USA) in ethanol and 1/100 dilution of protease inhibi-
tor cocktail (Sigma). All extracts were aliquoted, frozen in
liquid N2 and stored at -80 °C. RNA and DNA were
extracted using RNeasy and DNeasy Plant Mini Kits
(Qiagen, Hilden, Germany), respectively.
Ice RI assays
Soluble protein content was quantified using the Bio-Rad
protein assay (Bio-Rad, Mississauga, Canada).The capillary
method for RI assays (Tomczak et al. 2003) was employed,
except that capillaries were snap frozen in an ethanol/dry ice
bath. Samples were scored after 16–20 h incubation at -3 °C.
End point of RI activity was defined as the lowest protein
concentration (mg mL-1) at which ice crystal size remained
unchanged. For apoplastic extracts, end point of RI activity
was expressed as the equivalent wet weight of starting plant
material per volume of extract. For proteinase K treatment,
total leaf extracts from cold-acclimated D. antarctica plants
at 1 mg mL-1 were incubated at 56 °C for 1 h with freshly
dissolved proteinase K (Sigma) at a final concentration of
4 mg mL-1, either active or inactivated at 95 °C for 10 min.
Assays were replicated at least three times, and images from
representative assays are shown. Digital images were cap-
tured with a Leica DFC 300 F camera mounted on an MZFL
III stereoscopic zoom microscope using FireCam software
(Leica, Heerbrugg, Switzerland).
Molecular cloning and DNA sequence analysis
cDNA libraries were prepared, and clones were identified
by Expressed Sequence Tag (EST) sequencing (Sawbridge
338 U. P. John et al.
et al. 2003). 3′- and 5′-Rapid amplification of cDNA ends
(RACE) was used to uncover further gene sequences.
cDNA was synthesized from leaf RNA and RACE per-
formed with the BD SMART RACE cDNA Amplification
Kit (BD Biosciences, Palo Alto, CA, USA), according to
the manufacturer’s instructions, with the primers DaIRIP2
and DaIRIP7: 5′ TATGGCTCCCAGGTACGGTATTA
TGG and 5′ ATGGCAAAATGCTGGCTGCTGCAGC;
DaIRIP3: 5′ ATGGCGCCGAAATGCTGGCTGCTA;
and DaIRIP5: 5′ AGTGTTGTGGTTCCCGGTTACGG
CA and 5′ ATGGCGAAATGCTTGTTGCTGCTGCT.
cDNAs spanning the entire Open Reading Frame (ORF)
were amplified using the primers DaIRIP2: 5′ ATGGC
AAAATGCTGGCTGC and 5′ GATGGAAACAATCCA
CTAAAG; and DaIRIP5 and DaIRIP6: 5′ ATGGCGA
AATGCTTGTTGCT and 5′ TTAACCTCCCGTCACG
ACT. Genomic sequences were isolated using Genom-
eWalker (BD Biosciences), and the nested gene specific
primers DaIRIP3: 5′ GACATCGCGATTGGTCCCACC
AAGTG and 5′ GCATCCTGCACGGACATATCATTA;
DaIRIP4: 5′ GTTACATAAGACGATTGGCCCCACCA
AG and 5′ CAATCCACTCACTGATCATTAACCACC;
DaIRIP7: 5′ GCTGAGTTTGTGTATACATATATAGCA
TACCACACCTG and 5′ AATGCTGGCTGCTGCTGC
TCTTCTCGGTGC; and LpIRIP1: 5′ GATGCTATATCC
ACGAAGTTACAT and 5′ ATTGGCCCCACCAAGT
GA. PCR products were purified using QIAquick gel
extraction kit (Qiagen) and molecularly cloned into
pGEM-T Easy (Promega, Madison, WI, USA). Templates
for sequencing of individual plasmid-borne cDNA and
genomic clones were purified using a QIAprep spin mini-
prep kit (Qiagen), and sequencing reactions were primed
with modified SMART: 5′ AAGCAGTGGTAACAACG-
CAGAGTGGG, M13F or M13R primers.
Sequence files were used as queries for Basic Local
Alignment Search Tool X (BLASTX) and Basic Local
Alignment Search Tool N (BLASTN) (Altschul et al. 1997)
searches of the Swiss-Prot and GenBank Main databases.
IRIP-related sequences were identified by Translation
Basic Local Alignment Search Tool N (TBLASTN)
searches of the National Center for Biotechnology Infor-
mation (NCBI) database of GenBank + European Mole-
cular Biology Laboratory (EMBL) + DNA Data Bank
of Japan (DDBJ) sequences from EST divisions, and
assembled (from accession numbers) to derive representa-
tive IRIP homologs, LmIRIP from Italian ryegrass (Lolium
multiflorum) (AU250873, AU251218), TaIRIP from wheat
(Triticum aestivum) (BE490254, BJ224369, BE490074,
BF474043, CK197682, BI479842, BF200590, BQ166227)
and HvIRIP from barley (Hordeum vulgare) (CA002308,
CB882630, CA018380, CA018335, BJ454063, CA003891,
CA003578, BM376553, BJ461598, BG416480, BU988802,
BJ461841, BJ454308, CA000759, CA016565, CA016493,
AJ461161). Sequence assembly was performed using
Sequencher v.4.1.4 (Gene Codes, Ann Arbor, MI, USA).
Signal sequences were predicted by analysis with SignalP
(http://www.cbs.dtu.dk/services/SignalP/) (Bendtsen et al.
2004) and subcellular localization with TMHMM (http://
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
www.cbs.dtu.dk/services/TMHMM/) (Sonnhammer, von
Heijne & Krogh 1998) and PSORT (http://psort.nibb.ac.jp)
(Nakai & Horton 1999).
Multiple sequence alignment was performed using
CLUSTAL X v.1.81, with different gap opening (15.0) and
gap extension (0.3) values, followed by manual editing, and
a phylogenetic tree constructed using distance method
and PAUP v.4.0.b2a (Sinauer Associates, Sunderland, MA,
USA) with the putative D. antarctica orthologue of Histone
3.2 (DaH3.2) (R.M. Polotnianka, unpublished results) as
out-group. Robustness of branches was estimated using
100 bootstrapped replicates with neighbour-joining
Unweighted Pair Group Method with Arithmetic mean
(UPMGA) search option. Plant leucine-rich repeat (LRR)
protein sequences (and accession numbers) are PvPGIP2,
PGIP2 of Phaseolus vulgaris (P58822); DcLRR-AFP,
LRR-containing AFP from D. carota (AF055480); AtRLK
receptor-like kinase (RLK) from Arabidopsis thaliana
(AB007644); DcPSKR, phytosulphokine receptor (PSKR)
from D. carota (AB060167); OsLRR-RLK, LRR-RLK
from Oryza sativa (AY730046); SbRLK, RLK from
Sorghum bicolor (AF466199); CaLRR-P, LLR-protein
from chickpea (Cicer arietinum) (AJ609275); HvPRK, puta-
tive receptor kinase from H. vulgare (AY268139);TaLRR-P,
LRR-P from T. aestivum (AY736123); ZmRLK/MARK,
RLK/Maize Atypical Receptor Kinase from Zea mays
(AY188755).
Structural modelling
Homology modelling was performed using Macromodel
v.8.6 molecular modelling software (Schrödinger, Portland,
OR, USA), and the prime homology modelling module
using the crystal structure of P. vulgaris polygalacturonase-
inhibiting protein (PGIP) (Di Matteo et al. 2003) (pdb
entry: 1OGQ), and the structure (Kuiper, Davies & Walker
2001) (pdb entry: 1I3B) and Fourier transform infrared
spectroscopy data (Pudney et al. 2003) for L. perenne IRIP.
The model was geometrically optimized with distance con-
straints holding optimal hydrogen bond distances between
b-sheet regions for 10 000 iterations using an OPLS2001
force field and Generalized Born (GB) solvation, followed
by an additional 5000 iterations minimization without con-
straints. Images were generated using the Swiss-PdbViewer
(Guex & Peitsch 1997) and Pov-Ray v.3.5 (http://www.
povray.org).
Southern and northern analysis
Southern and northern hybridizations were performed
and washed under high stringency conditions [0.1 ¥ saline-
sodium citrate (SSC) buffer, 65 °C] (Sambrook, Fritsch &
Maniatis 1989). Hybridization patterns were visualized and
quantified with background subtraction using a Typhoon
8600 Variable Mode Imager and associated software
(Amersham Biosciences, Amersham, UK).
© 2009 Department of Primary Industries
 IRIPs and cryotolerance in Antarctic hair grass D. antarctica 339
RT-PCR analysis
First-strand cDNA was synthesized from 1 mg double
DNase-treated total RNA using SuperScript III Reverse
Transcriptase and oligo dT(12–18) (Invitrogen, Carlsbad, CA,
USA). Amplifications were performed on cDNA using
DyNAzyme DNA Polymerase (FinnZyme, Espoo, Finland),
at 94 °C for 5 min and 30–40 cycles of 94 °C for 1 min,
55–61 °C for 1 min and 72 °C for 30 s. Putative D. antarctica
and L. perenne orthologues of Histone 3.2 (Da and LpH3.2)
(R.M. Polotnianka, unpublished results) and actin-2 from
A. thaliana (At3g18780) (AtAct2) were employed as con-
stitutively expressed controls. The primer pairs used were,
for DaH3.2: 5′ AGAGCACGGAGCTGCTCAT and 5′
AACCGCAGGTCGGTCTTGA; DaIRIP1: 5′ GGAGTG
ACAATATCATAACC and 5′ GTCATTCCCGGATACT
TTG; DaIRIP3: 5′ GGAGTGATAATACCATAACC and
5′ ATTATTGTCGTGCCCGGTT; DaIRIP4: 5′ GAGCTG
GAGGAGCTCATC and 5′ AGACACAGTGTTGTGA
CAC; LpH3.2: 5′ TTCGTGAGATCCGCAAGTACC and
5′ CTCTCACCACGGATCCTCCT; LpIRIP1: 5′ CATCAT
AAAGTATCTGGAGGC and 5′ TTAACCTCCTGTCAC
GACTTTG; and AtAct2: 5′ CTTCTTCCGCTCTTTCTT
TCCAAG and 5′ GAGCTTCTCCTTGATGTCTCTTAC.
The products of cDNA synthesis reactions without reverse
transcriptase were included as controls, and reactions were
replicated three times.
Generation and analysis of
transgenic Arabidopsis
The ORFs of DaIRIP4 and LpIRIP1 were PCR adapted
using the primers 5′ GGGGACAAGTTTGTACAAAA
AAGCAGGCTGCAGGCGTAACACAGCTTGAGTCC
ATGGCGAA and 5′ GGGGACCACTTTGTACAAGA
AAGCTGGGTCTGCAGAAGCTTCGATTCAATCCA
CTCACTGATCATTAAC; and 5′ GGGGACAAGTTTG
TACAAAAAAGCAGGCTGCAGAAAATCTTACATA
GCTGAACCAATGGAG and 5′ GGGGACCACTTTGT
ACAAGAAAGCTGGGTCTGCAGAAGCTTGGAAA
CAATTCTCTATAGATTGTTAACC, respectively, and
cloned in the Gateway enabled pPZP221 (Hajdukiewicz,
Svab & Maliga 1994), under the control of the 2x35S
promoter. Vectors were transformed into Agrobacterium
tumefaciens Agl-1 by electroporation, and A. thaliana Col-0
transformed as described (Ye et al. 1999) with selection by
75 mg L-1 gentamicin and 50 mg L-1 timetin. The leaves of
gentamicin-resistant T2 plants from lines segregating 3:1 for
resistance were analysed by RT-PCR and RI assay.
Expression and purification of
recombinant protein
The sequence encoding the N-terminally 6xHis-tagged
DaIRIP4 LRR and IRIP domains was PCR adapted with
the primers 5′ CGCGTCGGATCCATGTTGCTCCCCA
GGCGCGGCCTC and 5′ ACTCACAAGCTTAACCTCC
TGTCACGACTTTGT using Platinum Pfx (Invitrogen),
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
molecularly cloned into BamHI and HindIII restricted
pQE-30, transformed into Escherichia coli M15 [pREP4]
and expressed as described (Qiagen). The 6xHis-tagged
product of the thioredoxin 1 gene of H. vulgare (courtesy of
J. Juttner, University of Adelaide, Australia) was included
as a control. 6xHis-tagged protein was purified using BD
Talon (BD Biosciences), and elution buffer was replaced
by extraction buffer using a Nanosep 10K device (Pall Life
Sciences, East Hills, NY, USA). Purified protein was resolved
by SDS–PAGE and visualized with Coomassie staining.
Accession numbers
Sequence data from this article can be found in the
EMBL/GenBank data libraries under accession numbers
DaIRIP1 (FJ663038); DaIRIP2 (FJ663039); DaIRIP3
(FJ663040); DaIRIP4 (FJ663041); DaIRIP5 (FJ663042);
DaIRIP6 (FJ663043); DaIRIP7 (FJ663044); and LpIRIP1
(FJ663045).
RESULTS
RI activity in D. antarctica and L. perenne is
induced by cold acclimation, mediated by
protein and present in the apoplasm
Ice RI assays reveal that D. antarctica exhibits cold
acclimation-induced RI activity, that interferes with the
migration of ice boundaries that normally thermodynami-
cally favour the creation of large ice crystals at the expense
of smaller ones (Knight et al. 1984). Extracts of leaf fluids
from plants grown at 5 °C for 2 weeks manifest RI activity,
unaffected by incubation at 95 °C for 5 min, at concentra-
tions of protein down to 15.6 mg mL-1 (Fig. 1a & Table 1).
By contrast, extracts from plants grown at 22 °C containing
1000 mg mL-1 of protein possess no RI activity. Similarly, in
roots of D. antarctica, RI activity is undetectable in extracts
from non-acclimated plants at 800 mg mL-1 of protein but
present in extracts in response to cold acclimation
(Table 1).
In L. perenne, a grass that inhabits more temperate
regions, RI activity is below the threshold of detection in
concentrated extracts of leaves and roots from non-
acclimated plants but is induced, at more modest levels
compared with D. antarctica, following cold acclimation
(Table 1).
The sensitivity of leaf extracts of cold-acclimated D. ant-
arctica to the action of the non-specific endolytic protease
proteinase K provides evidence that RI activity is proteina-
ceous in origin. Compared with untreated samples, extracts
incubated at 56 °C for 1 h in the presence or absence of
heat-inactivated proteinase K retain significant RI activity,
but incubation with active proteinase K ablates activity
(Fig. 1b).
To determine whether RI activity was present in the
extracellular spaces of D. antarctica and L. perenne, RI
assays were conducted on apoplastic extracts of leaves.
While undiluted apoplastic fluids from plants of both
340 U. P. John et al.

(a)
22 °C 5 °C
Untreated 95 °C, 5 min Untreated 95 °C, 5 min

E B 1 2 3 E B 1 2 3 1 2 3 4 5 6 7 1 2 3 4 5 6 7

(b) Figure 1. Recrystallization inhibition (RI) assays

4 °C, 1 h 56 °C, 1 h on cellular extracts from leaves of Deschampsia
Pro K: – – Heat inactiv. Active antarctica. (a) From non-acclimated (grown at
22 °C) and cold-acclimated (5 °C) plants. Upper
panel: initial ice crystal structure following snap
E + 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 freezing. Lower panel: after 16 h incubation at
-3 °C. Extracts were either untreated or incubated
at 95 °C for 5 min. Capillary E, extraction buffer;
B, 1000 mg mL-1 bovine serum albumin; 1–7, 1000,
250, 62.5, 15.6, 3.91, 0.977 and 0.244 mg mL-1,
respectively, of leaf soluble protein. (b) Response to
proteinase K treatment. Capillaries as above except
‘+’: positive control. Extracts incubated for 1 h on
ice, or at 56 °C in absence (-) or presence of
heat-inactivated (heat inactiv.) or active
proteinase K.

species (at 6550 and 6590 mg mL-1 wet weight of leaf mate- a significantly lesser extent in L. perenne. Moreover, RI
rial per volume of extract) grown at 22 °C possess none, RI activity in D. antarctica is conferred by the action of pro-
activity is detectable down to 155.9 ⫾ 176.8 mg mL-1 (n = 3) teins, and a substantial proportion of this activity is local-
and 3830 ⫾ 1915 mg mL-1 (n = 3) in cold-acclimated plants, ized to the apoplasm.
respectively. These corresponded in one instance to protein
concentrations in the apoplastic fluids of 0.31 and IRIP homologs from D. antarctica are predicted
14 mg mL-1, respectively, to be secreted proteins with two repeat
Therefore, the activity to inhibit the consolidation of ice
motif domains
crystals by recrystallization is induced in response to cold
acclimation in both leaves and roots of D. antarctica, and to Full-length clones of putative homologs of the incomplete
IRIP coding sequence from L. perenne (Sidebottom et al.
2000), DaIRIP1, 2, 5 and 6 (cDNA) and DaIRIP3, 4 and 7
Table 1. Recrystallization inhibition (RI) activitya in leaves and (genomic clones) were obtained from D. antarctica. A
roots of non-acclimated (grown at 22 °C) and cold-acclimated genomic clone encoding the putative IRIP paralogous
(5 °C) Deschampsia antarctica and Lolium perenne sequence, LpIRIP1 was also obtained from L. perenne. The
predicted IRIP homologs in D. antarctica and L. perenne
Leaves Roots
are proteins of molecular weight (MW) 21 881–29 161 Da,
22 °C 5 °C 22 °C 5 °C isoelectric points in the range of 8.75–10.2 and rich in
glycine, asparagine, leucine, valine and serine residues.
D. antarctica ND b
46.9 ⫾ 27.0 ND b
133.3 ⫾ 57.7
In addition, many IRIP-related sequences have been
L. perenne NDb 125.0 ⫾ 108.3 NDb 266.7 ⫾ 115.5
identified in EST collections from other species of the
a
Expressed as the lowest concentration of total protein extract
Poaceae (grass family) subfamily Pooideae, and have been
(mg mL-1) at which activity retained (n = 3). assembled to derive consensus amino acid sequences of
b
No activity detectable at 1000 and 800 mg mL-1 for leaves and representative forms. The intramolecular repeat structures
roots, respectively. of the longest IRIP homolog, HvIRIP from barley (H.
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
 IRIPs and cryotolerance in Antarctic hair grass D. antarctica 341

(a) Figure 2. Structural and phylogenetic analysis of ice

recrystallization inhibition proteins (IRIPs). (a) Intramolecular
repeat structure of IRIP of Hordeum vulgare (HvIRIP).
Arrowhead: predicted signal peptide cleavage site. Four cysteine
residues conserved in leucine-rich repeat (LRR) proteins and
predicted to form two disulphide bridges in bold, connected by
lines to show the predicted disulphide bridges. Highly conserved
10 amino acid motif including three of these cysteine residues are
underlined. Consensus sequences for plant LRRs (Kobe &
Kajava 2001) and IRIP repeat in bold with identical residues
shaded. (b) Intramolecular repeat structure of DaIRIP3.
(c) Schematic of domain organization in IRIP homologs and
phytosulphokine receptor from Oryza sativa (OsPSKR). TaIRIP
from wheat (Triticum aestivum). Boxes labelled SP, signal
peptide; 2 ¥ S-S, domain predicted to form two disulphide
bridges; with numbers, LRRs; Is., island domain; unlabelled, IRIP
repeats; TM, transmembrane domain. (d) Phenogram of IRIP
(b) homologs and selected plant LRR proteins. Bootstrap values (%)
at nodes.

14th IRIP repeat, but has an additional degenerate repeat

immediately proximal to the usual start position of the IRIP
domain (Fig. 2c & Supporting Information Fig. S1).
The region proximal to the IRIP domain has affinities to
proteins with LRR motifs. LRRs in IRIPs range in number
from 9 (Fig. 2c & Supporting Information Fig. S1) to as few
as 1 in D. antarctica forms (Supporting Information Fig. S1),
(c)
and for DaIRIP3 to only 17 of the usual complement of
24–25 residues (Fig. 2b). Sequence similarity searches indi-
cate that IRIPs are most closely related to a putative rice (O.
sativa) orthologue of a phytohormone receptor, the PSKR
(NP_911036).Regions of significant sequence similarity with
PvPGIP2 PSKR extend in a discontinuous fashion through the first 17
(d) DcLRR-AFP
AtRLK LRRs and approximately 22 residues into a 36 amino acid
DcPSKR residue ‘island’ domain (Li & Chory 1997), where similarity
OsLRR-RLK
ceases with the advent of the IRIP domain (Fig. 2c & Sup-
DaIRIP4
TaIRIP porting Information Fig. S1). With reference to the organi-
DaIRIP1 zation of LRRs in the O. sativa PSKR orthologue, IRIPs lack
DaIRIP3
HvIRIP between 8 and 16 of the first 17 LRRs (Fig. 2c).
LpIRIP2 Phylogenetic analysis of the sequences of representative
LmIRIP IRIP homologs outside of the IRIP domain, together with
LpIRIP1
OsPSKR representative LRR-containing proteins reveal that IRIPs
SbRLK fall into a robust and distinct clade, with PSKR from O.
CaLRR-P sativa comprising the immediate sister group (Fig. 2d). IRIP
HvPRK
TaLRR-P homologs from L. perenne and Italian ryegrass (L. multiflo-
ZmRLK/MARK rum) form a sub-clade separate from the IRIPs of D. ant-
DaH3.2 arctica and the Triticeae. The IRIP-PSKR super-clade is
distinct from other LRR-RLKs of both monocotyledonous
and dicotyledonous origin, including a LRR-containing
vulgare), and the shortest, DaIRIP3 (Fig. 2a,b), and the AFP from D. carota (Worrall et al. 1998; Meyer, Keil &
domain organization of putative IRIP homologs from selec- Naldrett 1999) (Fig. 2d).
tive representative Pooideae species (Fig. 2c) are shown. In Immediately proximal to the LRRs in the predicted
all predicted IRIP homologs (Fig. 2), the c. 120 residues at IRIPs is a highly conserved 10 amino acid residue motif
the C-terminus consist of c. 16 tandem repeats of a degener- (CCXWEGVXCD) containing three invariant cysteine
ate 7–8 amino acid residue motif (here designated the ‘IRIP residues (Fig. 2a,b & Supporting Information Fig. S1). An
repeat’). The consensus sequence for the IRIP repeat is additional invariant cysteine residue occurs a further 31–32
SNNTVVSG, with the glycine residue being most conserved residues towards the N-terminus (Fig. 2a,b & Supporting
(91.9% identity) across all types. Relative to IRIP forms in Information Fig. S1). Cysteine residues are located at the
other species, LpIRIP1 from L. perenne appears to lack the corresponding four positions in the majority of LRR-RLKs
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
342 U. P. John et al.

(U.P. John, unpublished results), and have been shown to (a) N-terminal
LRR
form two conformationally critical disulphide bridges in domain
the structural determination of the LRR-RLK PGIP ortho- IRIP domain
logue of kidney bean (P. vulgaris) (Di Matteo et al. 2003). It
N
is surmised, based on their conservation in all IRIP forms,
that the orthologous residues also participate in structurally C
important disulphide bonds.
At the N-terminus of all IRIP homologs is a 20 or 21
amino acid residue region predicted to function as a signal
peptide (Fig. 2c), with a cleavage site between conserved Disulphide bonds
alanine and either threonine or valine residues (Fig. 2a,b &
Supporting Information Fig. S1). Consistent with this, the Ice
4.5 Å
mature versions of all full-length IRIP forms are predicted
to be extracellularly localized. Consequently, it is likely that (b) LRR IRIP domain
IRIPs are apoplastic proteins.
N-terminal
domain
C

IRIPs are predicted to adopt conformations

N
with two lattice-matched ice-binding surfaces
Three-dimensional structures of the predicted mature Ice
forms of DaIRIP3 and LpIRIP1 were constructed by 4.5 Å
Disulphide bonds
knowledge-based comparative homology modelling
(Fig. 3). The structural model of DaIRIP3 has three main
(c)
regions: the double disulphide-bonded N-terminal domain, N
one abbreviated LRR loop and the IRIP domain (Fig. 3a).
LpIRIP1 is similar to the DaIRIP3 in overall structure
except for its three LRRs and an additional predicted dis-
ulphide bond (Fig. 3a). Side ‘A’ Side ‘B’
The extended b-roll structure of the IRIP domain is pre- T105 T107 V113 S115
dicted to form two surfaces complementary to the prism V120 S122 V128 S130
4.5 Å
face of ice, on alternate sides of the domain. Adjacent par- I135 S137 V143 T145
allel b-loops are spaced approximately 4.5 Å apart T150 T152 V157 S159
(Fig. 3a,b), while threonine and other solvent-accessible I164 T166 A171 T173
residues are arrayed in two ranks on the b-strand faces, N178 S180 T185 S187
spaced two residues, or approximately 7.4 Å apart (Fig. 3c). T192 S194 T199 S201
This almost exactly matches the prism ice surface that has V206 S208 V213 T215
repeating structures 4.5 Å parallel to the a-axis and 7.35 Å C
7.5 Å
parallel to the c-axis of ice. The putative ice-binding sur-
faces are stabilized by valine residues that allow tight Figure 3. Ribbon backbone diagrams of structural models of
regular hydrophobic packing of the central core of the ice recrystallization inhibition proteins (IRIPs). (a) DaIRIP3
b-roll region, and by asparagine residues that participate in aligned along the prism face of ice (parallel to the a-axis)
hydrogen bonds between adjacent b-strands. The highly showing b-strands (yellow), a-helices (red) and disulphide bonds.
conserved glycine residues in the IRIP repeat are structur- (b) LpIRIP1 aligned along the prism face of ice. (c) DaIRIP3
orientated to view one of two putative ice-binding surfaces.
ally important, as they form the turns between the upper
Predicted ice-binding amino acid residues at positions two
and lower b-strand faces of the ice-binding b-roll. residues apart on visible ice-binding surface (side ‘A’), and
Although the conformation of the three LRRs of the obverse surface (side ‘B’), are shown. LRR, leucine-rich repeat.
LpIRIPa model recapitulates the right-handed b-roll of the
IRIP repeat, they do not engender a flat b-sheet roll as does
the incomplete LRR in DaIRIP3 (Fig. 3b). On one side of
The genome of D. antarctica harbours a family
the b-roll, adjacent parallel b-loops are spaced approxi-
of IRIP-related sequences
mately 4.5 Å apart, but on the other, adjacently a-helical
strands cannot pack as closely (Fig. 3b). Therefore, with Consistent with the multiple IRIP gene variants isolated
each iteration of the LRR, the b-roll structure becomes from them, the genomes of D. antarctica and L. perenne
increasingly displaced, forming a curved b-sheet region. As appear to harbour multiple IRIP-related sequences. Up to
a consequence, relative to DaIRIP3, the predicted LpIRIPa six hybridizing bands are detected by probing of a Southern
structure with three LRRs appears to display a suboptimal blot of D. antarctica genomic DNA with DaIRIP4 (Fig. 4a).
surface lattice match to the ice prism face (Fig. 3b). The occurrence of as few as two or three hybridizing
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
 IRIPs and cryotolerance in Antarctic hair grass D. antarctica 343

(a) (b) (c) (d)

1 2 3 4 5 6 1 2 3 1 2 3
12.0 kb
12.0 kb
7.0
7.0
5.0 5.0
4.0 4.0
3.0 Figure 4. Southern analysis with ice
3.0
2.0 recrystallization inhibition protein (IRIP) gene
1.65 probes. Lanes 1, undigested; 2, SphI; 3, KpnI; 4,
2.0 HindIII; 5, BamHI; 6, AatII. (a,b) Deschampsia
1.65 1.0 antarctica probed with DaIRIP4. (c) Multiply
heterozygous Lolium perenne probed with
LpIRIP1. (d) Doubled haploid L. perenne probed
1.0 with LpIRIP1.

bands (Fig. 4a, lanes 3 and 5) is evidence that IRIP- Heterologously expressed DaIRIP is sufficient
related sequences may be physically linked on genomic to reconstitute the RI activity present in
fragments totalling to 20 kb. Additional Southern analysis cold-acclimated leaves
of D. antarctica employing restriction endonucleases
without predicted recognition sites in any of the known To demonstrate that the RI activity was directly attribut-
DaIRIP sequences detected up to 15 hybridizing bands able to IRIPs, their coding sequences were engineered for
(Fig. 4b). expression in two heterologous systems. Extracts from the
At least four LpIRIP1 sequence-related restriction leaves of independent transgenic A. thaliana lines constitu-
fragments are detected in a sample genome from a tively expressing full-length DaIRIP4 (Fig. 6a) or LpIRIP1
heterogeneous breeding population of L. perenne (Fig. 4c). were assayed for RI activity. Three independent lines
The genomic DNA from a doubled haploid plant, however, transgenic for DaIRIP4 exhibited activity down to a
exhibits only one strongly hybridizing band, with a back-
ground of less intense bands (Fig. 4d). (a) (c)
Leaf Root Leaf Root
22 5 22 5 °C 22 5 22 5 °C
DaIRIP transcript levels are greatly elevated in 1.1 kb 1.2 kb
response to cold acclimation
The modulation of steady-state levels of IRIP gene tran-
scripts in response to temperature in D. antarctica and L. rRNA
perenne was investigated. Northern analysis on roots and
leaves of D. antarctica plants grown at 22 °C, and 5 °C
hybridized with a DaIRIP4 probe detects 40- to 50-fold
elevated levels of transcript in leaves in response to cold (b) (d)
22 °C 5 °C 22 °C 5 °C
acclimation (Fig. 5a). Similarly, RT-PCR analysis shows
L R L R L R L R
DaIRIP4 and DaIRIP3 mRNA is specific to cold-
DaIRIP1 LpIRIP1
acclimated leaves, while DaIRIP1 specific transcripts are
detectable in both leaves and roots of cold-acclimated DaIRIP3 LpH3.2
plants (Fig. 5b). DaIRIP4
By contrast, LpIRIP1 transcript levels in L. perenne are DaH3.2
below the threshold level of detection in northern analysis
of leaves grown at 5 or 22 °C, but are elevated approxi- Figure 5. Analysis of ice recrystallization inhibition protein
mately fourfold in the roots of cold-acclimated plants (IRIP) transcript levels in response to temperature. (a) Northern
relative to those grown at 22 °C (Fig. 5c). RT-PCR analysis analysis of Deschampsia antarctica leaves and roots grown at 22
detects low levels of LpIRIP1 transcript in roots of plants and 5 °C probed with DaIRIP4. Ribosomal RNAs (rRNA)
functioned as loading controls. (b) RT-PCR of D. antarctica
grown at 22 °C, and a modest elevation of levels upon
leaves (L) and roots (R) for DaIRIP1, DaIRIP3, DaIRIP4 and
transfer to 5 °C (Fig. 5d). Thus, steady-state levels of IRIP DaH3.2 as constitutively expressed control. (c) Northern analysis
transcripts are greatly enhanced in leaves of D. antarctica in of Lolium perenne probed with LpIRIP1. (d) RT-PCR of L.
response to cold acclimation but only moderately so in the perenne for LpIRIP1 and LpH3.2 as constitutively expressed
roots of L. perenne. control.
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
344 U. P. John et al.

(a) (b) #1725 #1738 #1743

E + wt 1 2 3 4 1 2 3 4 1 2 3 4

wt #1725 #1738 #1743

DaIRIP4

AtAct2

(c) (d) HvT1 DaIRIP4 22 °C leaf +

- HvT1 DaIRIP4

DaIRIP4 HvT1
E + 1 2 3 4 5 6 7 8

30.5

22.2

12.9

6.4

Figure 6. Heterologously expressed DaIRIP4 confers recrystallization inhibition (RI) activity. (a,b) Three independent Arabidopsis
thaliana lines transgenic for 35S:DaIRIP4. (a) RT-PCR of leaves for DaIRIP4 and AtAct2. wt, Col-0. (b) RI assay on cellular extracts
from leaves. Capillary E, extraction buffer; ‘+’, positive control; wt, Col-0 at 400 mg mL-1 leaf soluble protein; 1–4, transgenic lines at 400,
100, 25 and 6.25 mg mL-1. (c,d) N-terminally 6xHis-tagged DaIRIP4 expressed in Escherichia coli. (c) Coomassie-stained sodium dodecyl
sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) of purified HvT1 and DaIRIP4. (d) RI assay on ‘add-backs’ of purified protein
to cellular extracts from leaves of non-acclimated Deschampsia antarctica. Capillaries as above except 1: 2.5 mg mL-1 purified HvT1, 2–3:
purified DaIRIP4 at 2.5 and 1.25 mg mL-1, 4–8: non-acclimated (22 °C) extract at 250 mg mL-1 leaf soluble protein with addition of
extraction buffer, 2.5 mg mL-1 final concentration purified HvT1 or 2.5, 1.25 and 0.625 mg mL-1 DaIRIP4.

concentration of 100 mg mL-1 of protein, while no activity DISCUSSION

was detectable in non-transgenic plants at a concentration
A gene family encoding IRIPs has been identified and char-
of 400 mg mL-1 (Fig. 6b). By comparison, analogous lines
acterized, the expression of which can account for D. antarc-
transgenic for constitutive LpIRIP1 expression manifested
tica’s cold-induced RI activity, and thus contribute to its
no detectable RI activity (Supporting Information Fig. S2).
tolerance of freezing. D. antarctica has protein-based activity
Thus, expression of the monocot-derived protein DaIRIP4
induced by cold acclimation, and present in the apoplasm,
in the dicot plant A. thaliana engenders a novel phenotype,
to inhibit ice recrystallization, thereby minimizing the
RI activity.
lytic consequences of uncontrolled ice crystal growth. This
A 6xHis-tagged version of DaIRIP4, expressed in E.
capacity is correlated with the expression of IRIP genes and
coli and purified by Co-affinity chromatography (Fig. 6c),
the primary structure, conformation, predicted localization
conferred RI activity at a concentration of 2.5 mg mL-1 of
and, most significantly, the activity of their products.
purified protein (Fig. 6d, lane 2). Furthermore, when ‘added
back’ to extracts from the leaves of non-acclimated plants
at 250 mg mL-1 of soluble protein, purified DaIRIP4 D. antarctica has protein-mediated,
reconstitutes RI activity at final concentrations down to
apoplastically localized activity to inhibit
1.25 mg mL-1, or 0.5% of total protein (Fig. 6d, lane 7), reca-
recrystallization of ice
pitulating the activity observed in plants that have been
cold acclimated by exposure to 5 °C for 2 weeks. This Consistent with its tolerance of freezing, soluble homoge-
threshold of RI activity is lower than that observed for nates of D. antarctica exhibit potent cold acclimation-
DaIRIP4 in isolation (Fig. 6d, lane 2), suggesting that IRIPs induced, heat-resistant ice crystallization inhibition activity.
function more efficiently in the context of endogenous In leaves grown in temperate conditions, RI activity is
cellular components. Therefore, the activity of DaIRIP4 absent in extracts containing 1 mg mL-1 of protein, but
is sufficient to account for RI activity in leaf extracts of present in cold-acclimated plants at 64-fold less levels of
cold-acclimated D. antarctica. protein. Furthermore, this activity is obliterated by the
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
 IRIPs and cryotolerance in Antarctic hair grass D. antarctica 345
action of protease, and a significant proportion resides in
apoplastic fluids, the first and usually only part of the plant
in which ice crystals form. By contrast, in the temperate
grass, L. perenne RI activity manifests at more modest
levels. Comparable results were found in D. antarctica using
a sucrose sandwich assay for RI activity (Doucet et al.
2000). RI activity was exhibited down to 50 mg mL-1 of
protein in crude homogenates of aerial parts grown in a
diurnal range of 2–8 °C, virtually identical to that for plants
grown at 5 °C in this study. However, in contrast to the
findings presented here, this RI activity was heat labile and
only partially sensitive to protease. Using an entirely dif-
ferent type of assay, ice crystal shaping activity has been
detected in apoplastic extracts from D. antarctica (Bravo &
Griffith 2005). The activity reported is proteinaceous but,
unlike the findings presented here, is sensitive to boiling
and present in non-acclimated plants. It remains, however,
unclear what the mechanistic relationship is between ice
crystal-shaping activity and ice recrystallization activity.
IRIP genes encode proteins with two potential
ice-binding domains
We have isolated and characterized full-length IRIP genes
from both D. antarctica and L. perenne. The form reported
previously from L. perenne (Sidebottom et al. 2000), isolated
as a protein associated with RI activity, lacked an N-terminal
methionine and was comprised solely of 16 IRIP repeats.The
IRIP forms reported here, unlike other known AFPs, include
two potential ice-binding domains: the IRIP and LRR
domains. Ten LRRs are also the predominant feature of an
unrelated ice recrystallization inhibiting AFP from D. carota
(Worrall et al. 1998; Meyer et al. 1999).
Although the LRR domain has the potential to function
in ice binding, in the various IRIP forms described here,
there is a wide range of variation in its relative contribution
to the overall primary structure. Thus, while IRIPs invari-
ably contain 16 IRIP repeats, LRRs are present from as
many as nine iterations in the H. vulgare form HvIRIP to
less than one in the D. antarctica form, DaIRIP3, where the
residues with similarity to the LRR consensus number only
17 of the usual complement of 24 or 25 residues (Fig. 2b,c).
Despite the apparent plasticity in the number of LRRs,
and even their dispensability, other features commonly
found in LRR proteins, including the region predicted to
participate in two disulphide bridges, and the probable
signal sequence are invariant in IRIPs, suggesting that they
are essential for structure/function and/or localization.
What is the evolutionary origin of IRIP genes?
Like all plant (and animal) AFPs characterized to date
(Logsdon & Doolittle 1997), IRIPs appear to have arisen
relatively recently in evolutionary terms, through co-option
of existing protein structures. Outside the IRIP domain
itself, IRIPs are structurally related to LRR-RLKs, having
the greatest affinity with putative monocot orthologues of
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
PSKR, a receptor for the hormone phytosulphokine. PSKR
first isolated and characterized in D. carota consists of an
extracellular domain containing 21 LRRs, a single-pass
transmembrane domain (Fig. 2c), and a cytoplasmic serine–
threonine kinase domain (Matsubayashi et al. 2002). Like
the IRIPs, the majority of known plant AFPs are derived
from secreted proteins, many being homologs of
pathogenesis-related proteins (Griffith & Yaish 2004), and
one, the AFP from D. carota (Worrall et al. 1998; Meyer
et al. 1999) also being related to LRR-RLKs.
Although they exhibit plasticity in their number and
arrangement (Fig. 2c), all LRRs in extant IRIPs have high
levels of identity and conservation with LRRs in PSKR
(Fig. 2c & Supporting Information Fig. S1), with no evi-
dence for the addition of any other sequences, LRR or
otherwise. Therefore, consistent with the principle of
maximum parsimony, it is most likely that the evolution
of IRIPs has resulted from the progressive loss of LRRs,
rather than their acquisition or rearrangement. A possible
evolutionary scenario is that a PSKR-related protein was
co-opted as an AFP, either because of intrinsic structural
complementarity to ice crystals, and/or as a vector to target
the ‘hitch-hiking’ IRIP domain to the cellular compartment
where RI activity is critical, the apoplast. The origin of
the sequence encoding the IRIP repeat, however, remains
obscure, as it exhibits no sequence similarity to any
reported nucleotide or derived amino acid sequence.
Genes encoding IRIP homologs appear to be monophyl-
etic in origin and confined to the Pooideae. We are not yet
aware of any species of the Pooideae without IRIP-related
sequences. In addition to the D. antarctica, L. perenne, L.
multiflorum, H. vulgare and T. aestivum sequences reported
here, sequence similarity searches of the NCBI EST data-
base have also revealed IRIP-related sequences in Leymus
chinensis, Puccinellia tenuiflora, winter rye (S. cereale), tall
fescue (Festuca arundinacae) and diploid, and tetraploid
forms of wheat (Triticum monococcum and Triticum turgi-
dum), frequently associated with cDNA libraries derived
from cold-stressed or vernalized material. We have also
identified in in-house EST data putatively orthologous
sequences in colonial bent grass (Agrostis capillaris). Fur-
thermore, sequence similarity searches of the draft genome
of the model temperate grass Brachypodium distachyon
(http://blast.brachybase.org/) identify eight IRIP homolo-
gous sequences, one apparently incomplete, clustered in two
distinct genomic regions of 21 and 29 kb. Incongruously,
IRIP homologous sequences are also present in EST
resources of the yellow fever mosquito (Aedes aegypti),
possibly the result of contamination. By contrast, no
sequences related to the IRIP domain have been found in
sequence similarity searches of any dicots, including A.
thaliana, nor in sequences from the warm season grasses O.
sativa, maize (Zea mays) or S. bicolor. Furthermore, the IRIP
clade (Fig. 2d) is distinct and well supported, consistent with
the notion that IRIPs arose once early in the evolutionary
history of the Pooideae and have subsequently diverged in
both copy number and structure. On this basis, IRIP genes
are predicted to have arisen sometime after the divergence
346 U. P. John et al.
of the Pooideae and Panicoideae subfamilies 60 mya, but
before that of the Triticodae and Poodae super-tribes 35 mya
(Huang et al. 2002).
Structural modelling predicts that the IRIP
repeat has greater affinity for ice than the LRR
We have used knowledge-based protein modelling to devise
a theoretical 3-D structure for full-length IRIPs. A trun-
cated version of LpIRIP modelled previously (Kuiper et al.
2001) did not include the LRR domain, nor the twin disul-
phide bond-forming N-terminal domain. The structural
model demonstrates that both the IRIP and LRR domains
can contribute to a common, structurally complementary
ice-binding domain.
The predominant ice-binding region is predicted to be
the IRIP domain, which presents two ice-binding faces, on
either side of the b-roll domain. However, the putative ice-
binding surfaces are not as regular as the stereotypical
threonine-X-threonine motifs in b-roll configurations
observed in two unrelated insect AFPs with high TH activ-
ity (Graether et al. 2000; Liou et al. 2000). The D. antarctica
and L. perenne IRIPs exhibit only 30–40% threonine at the
analogous positions. This may be because of the differences
in the primary function of the proteins. Insect AFPs must
provide appreciable TH activity, as most insects are not
freezing tolerant. The regularity of the threonine residues
on the presenting ice-binding surfaces has been implicated
in their high TH activity, TH activity having been shown to
rapidly decrease with increasing mutational substitution of
residues in the ice-binding surface (Marshall et al. 2002). By
contrast, as D. antarctica is freezing tolerant, the primary
purpose of AFPs in this organism would be to provide RI
activity, to avoid the plasmolytic consequences of continued
ice crystal growth in an already frozen tissue.
In fact, IRIPs may have evolved to have low TH activity,
as high activity may prove detrimental during the inevitable
seasonal freezing of these plants. If a plant was to deploy an
IRIP with a relatively high TH activity, the apoplastic fluid
of the plant would remain liquid until the temperature
dropped below the lower end of the TH gap. Freezing would
then occur much more rapidly than if initiated close to the
freezing equilibrium point, and would do so with the spicu-
lar dendritic growth observed with other AFPs (Davies &
Sykes 1997), potentially doing much mechanical damage to
cells.
The LRR domains of IRIPs are also predicted to contrib-
ute to ice-binding surfaces but not with the inherent struc-
tural complementary to the prism face of ice of the IRIP
domain. While solved crystal structures of LRRs in proteins
form parallel b-sheets on one side of a b-roll, the obverse
side is made up of adjacently packed a-helical strands (Di
Matteo et al. 2003). As the a-helical regions cannot pack
as closely as the b-sheet regions, the b-roll structure will
become progressively curved, proportional to the numbers
of LRRs. Thus, extended curved b-sheet surfaces of LRR
regions, as in LpIRIP1 (Fig. 3b), do not present an optimal
surface lattice match to ice. This consequence appears to
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
have been minimized in DaIRIP3, with an abbreviated
LRR, predicted to recapitulate and extend the flat ice-
binding surface conferred by the IRIP repeats (Fig. 3a).
IRIPs confer RI activity
In order to attribute the RI activity observed in accli-
mated D. antarctica to the activity of IRIPs, we have
unequivocally demonstrated RI activity conferred by het-
erologously expressed DaIRIP. Both when expressed in
the dicotyledonous plant A. thaliana and by the addition
of purified protein to extracts from non-acclimated D. ant-
arctica plants, DaIRIP4 is sufficient to functionally account
for cold acclimation-induced RI activity in D. antarctica. A
heterologously expressed putative IRIP homolog from T.
aestivum has also been shown to inhibit ice crystal growth
(Tremblay et al. 2005).
A molecular mechanism for freezing tolerance
in D. antarctica
Deschampsia antarctica is believed to have colonized
Antarctica around 5000 ya (Smith 1984), when glaciers
retreated from the Antarctic Peninsula following the end of
the last ice age. Recent expansion of populations of D.
antarctica has been linked to climate change (Smith 1994).
In addition to overcoming the geographical impediments to
colonizing the Antarctic continent, D. antarctica must have
been predisposed to contend with such an extreme environ-
ment. We propose that well-developed IRIP-mediated RI
activity, in combination with other cryotolerance mecha-
nisms, may have facilitated the establishment and propaga-
tion of D. antarctica in Antarctica. We believe the findings
reported here illustrate the utility of functional genomic
studies beyond model and crop species, particularly in the
flora of extreme environments, and identify a potential
resource for conferring freezing tolerance in sensitive
plants.
ACKNOWLEDGMENTS
We thank Jessica White and Suzanne Lelean for propaga-
tion and collection of plant material, Jutta Nagel for tech-
nical assistance,Tim Sawbridge for advice on bioinformatics
and Michael Emmerling for assistance with figure prepara-
tion. This work was supported by the Australian Research
Council, the Grains Research and Development Corpora-
tion, the Victorian Department of Innovation, Industry and
Regional Development and the Victorian Department of
Primary Industries.
REFERENCES
Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z.,
Miller W. & Lipman D.J. (1997) Gapped BLAST and PSI-
BLAST: a new generation of protein database search programs.
Nucleic Acids Research 25, 3389–3402.
Anchordoguy T.J., Rudolph A.S., Carpenter J.F. & Crowe J.H.
© 2009 Department of Primary Industries
 IRIPs and cryotolerance in Antarctic hair grass D. antarctica 347
(1987) Modes of interaction of cryoprotectants with membrane
phospholipids during freezing. Cryobiology 24, 324–331.
Antikainen M. & Griffith M. (1997) Antifreeze protein accumula-
tion in freezing tolerant cereals. Physiologia Plantarum 99, 423–
432.
Bendtsen J.D., Nielsen H., von Heijne G. & Brunak S. (2004)
Improved prediction of signal peptides: SignalP 3.0. Journal of
Molecular Biology 340, 783–795.
Bravo L.A. & Griffith M. (2005) Characterization of antifreeze
activity in Antarctic plants. Journal of Experimental Botany 56,
1189–1196.
Bravo L.A., Ulloa N., Zuniga G.E., Casanova A., Corcuera L.J. &
Alberdi M. (2001) Cold resistance in Antarctic angiosperms.
Physiologia Plantarum 111, 55–65.
Davies P.L. & Sykes B.D. (1997) Antifreeze proteins. Current
Opinion in Structural Biology 7, 828–834.
Day T.A., Ruhland C.T., Grobe C.W. & Xiong F. (1999) Growth
and reproduction of Antarctic vascular plants in response to
warming and UV radiation reductions in the field. Oecologia
119, 24–35.
Di Matteo A., Federici L., Mattei B., Salvi G., Johnson K.A., Savino
C., De Lorenzo G., Tsernoglou D. & Cervone F. (2003) The
crystal structure of polygalacturonase-inhibiting protein (PGIP),
a leucine-rich repeat protein involved in plant defense. Proceed-
ings of the National Academy of Sciences of the United States of
America 100, 10124–10128.
Doucet C.J., Byass L., Elias L., Worrall D., Smallwood M. & Bowles
D.J. (2000) Distribution and characterization of recrystallization
inhibitor activity in plant and lichen species from the UK and
maritime Antarctic. Cryobiology 40, 218–227.
Graether S.P., Kuiper M.J., Gagne S.M., Walker V.K., Jia Z., Sykes
B.D. & Davies P.L. (2000) Beta-helix structure and ice-binding
properties of a hyperactive antifreeze protein from an insect.
Nature 406, 325–328.
Griffith M. & Yaish M.W. (2004) Antifreeze proteins in overwin-
tering plants: a tale of two activities. Trends in Plant Science 9,
399–405.
Guex N. & Peitsch M.C. (1997) SWISS-MODEL and the Swiss-
PdbViewer: an environment for comparative protein modeling.
Electrophoresis 18, 2714–2723.
Hajdukiewicz P., Svab Z. & Maliga P. (1994) The small, versatile
pPZP family of Agrobacterium binary vectors for plant transfor-
mation. Plant Molecular Biology 25, 989–994.
Hon W.C., Griffith M., Chong P. & Yang D. (1994) Extraction and
isolation of antifreeze proteins from winter rye (Secale cereale
L.) leaves. Plant Physiology 104, 971–980.
Huang S., Sirikhachornkit A., Faris J.D., Su X., Gill B.S., Haselkorn
R. & Gornicki P. (2002) Phylogenetic analysis of the acetyl-CoA
carboxylase and 3-phosphoglycerate kinase loci in wheat and
other grasses. Plant Molecular Biology 48, 805–820.
Knight C.A., DeVries A.L. & Oolman L.D. (1984) Fish antifreeze
protein and the freezing and recrystallization of ice. Nature 308,
295–296.
Kobe B. & Kajava A.V. (2001) The leucine-rich repeat as a protein
recognition motif. Current Opinion in Structural Biology 11,
725–732.
Kuiper M.J., Davies P.L. & Walker V.K. (2001) A theoretical model
of a plant antifreeze protein from Lolium perenne. Biophysical
Journal 81, 3560–3565.
Li J. & Chory J. (1997) A putative leucine-rich repeat receptor
kinase involved in brassinosteroid signal transduction. Cell 90,
929–938.
Lin C., Guo W.W., Everson E. & Thomashow M.F. (1990) Cold
acclimation in Arabidopsis and wheat: a response associated
with expression of related genes encoding ‘boiling-stable’
polypeptides. Plant Physiology 94, 1078–1083.
© 2009 Department of Primary Industries
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
Liou Y.C., Tocilj A., Davies P.L. & Jia Z. (2000) Mimicry of ice
structure by surface hydroxyls and water of a beta-helix anti-
freeze protein. Nature 406, 322–324.
Logsdon J.M. Jr & Doolittle W.F. (1997) Origin of antifreeze
protein genes: a cool tale in molecular evolution. Proceedings of
the National Academy of Sciences of the United States of America
94, 3485–3487.
McCown B.H., McLeester R.C., Beck G.E. & Hall T.C. (1969)
Environment-induced changes in peroxidase zymograms in the
stems of deciduous and evergreen plants. Cryobiology 5, 410–
412.
Marshall C.B., Daley M.E., Graham L.A., Sykes B.D. & Davies P.L.
(2002) Identification of the ice-binding face of antifreeze protein
from Tenebrio molitor. FEBS Letters 529, 261–267.
Matsubayashi Y., Ogawa M., Morita A. & Sakagami Y. (2002) An
LRR receptor kinase involved in perception of a peptide plant
hormone, phytosulfokine. Science 296, 1470–1472.
Meyer K., Keil M. & Naldrett M.J. (1999) A leucine-rich repeat
protein of carrot that exhibits antifreeze activity. FEBS Letters
447, 171–178.
Montiel P., Smith A. & Keiller D. (1999) Photosynthetic responses
of selected Antarctic plants to solar radiation in the southern
maritime Antarctic. Polar Research 18, 229–235.
Nakai K. & Horton P. (1999) PSORT: a program for detecting
sorting signals in proteins and predicting their subcellular local-
ization. Trends in Biochemical Sciences 24, 34–36.
Pudney P.D., Buckley S.L., Sidebottom C.M., Twigg S.N., Sevilla
M.P., Holt C.B., Roper D., Telford J.H., McArthur A.J. & Lillford
P.J. (2003) The physico-chemical characterization of a boiling
stable antifreeze protein from a perennial grass (Lolium
perenne). Archives of Biochemistry and Biophysics 410, 238–245.
Raymond J.A. & DeVries A.L. (1977) Adsorption inhibition as a
mechanism of freezing resistance in polar fishes. Proceedings of
the National Academy of Sciences of the United States of America
74, 2589–2593.
Sambrook J., Fritsch E.F. & Maniatis T. (1989) Molecular Cloning:
A Laboratory Manual, 2nd edn. Laboratory Press, Cold Spring
Harbor, NY, USA.
Sawbridge T., Ong E.-K., Binnion C., et al. (2003) Generation and
analysis of expressed sequence tags in white clover (Trifolium
repens L.). Plant Science 165, 1077–1087.
Sidebottom C., Buckley S., Pudney P., et al. (2000) Heat-stable anti-
freeze protein from grass. Nature 406, 256.
Smith R.I.L. (1984) Terrestrial plant biology of the sub-Antarctic
and Antarctic. In Antarctic Ecology (ed. R.M. Laws), pp. 61–162.
Academic Press, London, UK.
Smith R.I.L. (1994) Vascular plants as bioindicators of regional
warming in Antarctica. Oecologia 99, 322–328.
Smith R.I.L. & Poncet S. (1987) Deschampsia antarctica and Colo-
banthus quitensis in the Terra Firma Islands. Bulletin – British
Antarctic Survey 74, 31–35.
Sonnhammer E.L., von Heijne G. & Krogh A. (1998) A hidden
Markov model for predicting transmembrane helices in protein
sequences. Proceedings of the 6th International Conference on
Intelligent Systems for Molecular Biology 6, 175–182.
Thomashow M.F. (1999) PLANT COLD ACCLIMATION: freez-
ing tolerance genes and regulatory mechanisms. Annual Review
of Plant Physiology and Plant Molecular Biology 50, 571–599.
Tomczak M.M., Marshall C.B., Gilbert J.A. & Davies P.L. (2003) A
facile method for determining ice recrystallization inhibition by
antifreeze proteins. Biochemical Biophysical Research Commu-
nications 311, 1041–1046.
Tremblay K., Ouellet F., Fournier J., Danyluk J. & Sarhan F. (2005)
Molecular characterization and origin of novel bipartite cold-
regulated ice recrystallisation inhibition proteins from cereals.
Plant & Cell Physiology 46, 884–891.
348 U. P. John et al.
Uemura M., Joseph R.A. & Steponkus P.L. (1995) Cold acclima-
tion of Arabidopsis thaliana (effect on plasma membrane lipid
composition and freeze-induced lesions). Plant Physiology 109,
15–30.
Urrutia M.E., Duman J.G. & Knight C.A. (1992) Plant thermal
hysteresis proteins. Biochimica et Biophysica Acta 1121, 199–
206.
Worrall D., Elias L., Ashford D., Smallwood M., Sidebottom C.,
Lillford P., Telford J., Holt C. & Bowles D. (1998) A carrot
leucine-rich-repeat protein that inhibits ice recrystallization.
Science 282, 115–117.
Ye G.N., Stone D., Pang S.Z., Creely W., Gonzalez K. & Hinchee M.
(1999) Arabidopsis ovule is the target for Agrobacterium in
planta vacuum infiltration transformation. The Plant Journal 19,
249–257.
Received 16 May 2008; received in revised form 21 November 2008;
accepted for publication 23 November 2008
SUPPORTING INFORMATION
Additional Supporting Information may be found in the
online version of this article:
Figure S1. Sequence alignment of ice recrystallization
inhibition protein (IRIP) homologs and phytosulphokine
Journal compilation © 2009 Blackwell Publishing Ltd, Plant, Cell and Environment, 32, 336–348
receptor from Oryza sativa (OsPSKR). LpIRIP, truncated
sequence from L. perenne (AJ277399). HvIRIP, derived
from the assembly of Hordeum vulgare sequences in the
NCBI database of GenBank + EMBL + DDBJ sequences
from EST divisions (see Materials and Methods). OsPSKR,
a putative phytosulphokine receptor (PSKR) orthologue
from Oryza sativa (NP911036). Identical residues are high-
lighted in black.
Figure S2. Ice recrystallization inhibition protein of Lolium
perenne (LpIRIP1) expressed in Arabidopsis thaliana does
not confer recrystallization inhibition (RI) activity. Assays
were performed on three independent lines transgenic for
35S:LpIRIP1 and results from one representative line are
shown. (a) RT-PCR of leaves for LpIRIP1 and AtAct2. wt,
Col-0. (b) RI assay on cellular extracts from leaves. Capil-
lary E, extraction buffer; ‘+’, positive control; wt, Col-0 at
400 mg mL-1 leaf soluble protein; 1–4, transgenic line at 400,
100, 25 and 6.25 mg mL-1.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials
supplied by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
© 2009 Department of Primary Industries