PharmaNutrition 14 (2020) 100227

Contents lists available at ScienceDirect

PharmaNutrition
journal homepage: www.elsevier.com/locate/phanu

Potential mechanisms of improvement in body weight, metabolic profile,

and liver metabolism by honey in rats on a high fat diet
Atia Gohar a, *, Muhammad Shakeel b, Richard. L. Atkinson c, d, Darakhshan J. Haleem a, d, *
a
H.E.J. Research Institute of Chemistry, International Center for Chemical and Biological Sciences (ICCBS), University of Karachi, Lab 102 Animal House PCMD,
Pakistan
b
Jamil-ur-Rahman Center for Genome Research, Dr. Panjwani Center for Molecular Medicine and Drug Research, ICCBS, University of Karachi, Pakistan
c
Virginia Commonwealth University, Richmond, VA, USA
d
Dr. Panjwani Center for Molecular Medicine and Drug Research, ICCBS, University of Karachi, Pakistan

A R T I C L E I N F O A B S T R A C T

Keywords: Objective: This study aimed to evaluate some potential mechanisms of effects of natural honey on locomotor
Obesity activity, energy intake, changes in body weight, and hepatic expression of three genes of fat metabolism: fatty
High fat diet acid binding protein 1 (Fabp1), hepatic lipase (Lipc), and apolipoprotein A1 (Apoa1).
Weight gain
Methods: Male Wistar rats were fed high fat diet (HFD) (n = 18) or normal diet (ND) (n = 18) for 4 weeks, then
Fatty liver
treated daily with saline (Group1,n = 6), honey 1 g/kg (Group2,n = 6), & honey 2 g/kg (Group3,n = 6)), for
Molecular mechanism
another 4 weeks, continuing on HFD or ND. Food intake, changes in body weight and locomotor activity were
monitored weekly. Levels of circulating lipids, glucose, and liver enzymes were determined at sacrifice. The
expression of Fabp1, Lipc, and Apoa1 genes were determined through real time-qPCR.
Results: Treatment with high and low doses of honey significantly reduced body weight-gain in HFD as well as ND
treated rats compared to saline treated controls. The honey treatment lowered TAG, TC, LDL, VLDL levels
(P < 0.05), and enhanced HDL level (P < 0.05) in HFD to a greater degree than in ND treated rats. The
expression of Fabp1 was upregulated and Lipc and Apoa1 were downregulated in HFD saline treated rats
(P < 0.05) compared to ND saline treated rats. The expression of Fabp1 was significantly downregulated and that
of Lipc and Apoa1 were significantly upregulated in HFD honey treated rats (P < 0.05). Histological examination
showed improvement in cellular architecture of liver tissue in HFD honey treated rats.
Conclusion: Adverse effects of HFD on body weight-gain, serum lipids profile, serum glucose, and liver steatosis
are reversed by honey treatment in rats. Studies of honey treatment for metabolic syndrome in humans are
indicated.

1. Introduction environmental factors leading to various pathophysiological complica­

Overweight and obesity are pathological conditions of body fat in
which BMI and/or fat mass distribution is excessively enlarged [1,2]. It
is one of the common diseases of the present era, and it is complex to
identify the factors responsible for the various etiologies of obesity. The
major causes not only include greater caloric intake or lowered motor
activity, but obesity and overweight are also correlated with psycho­
logical distress and body weight dissatisfaction [3]. This is a multifac­
torial disorder involving a complex interplay of genetic as well as
tions such as dyslipidemia, hypertension, cardiovascular diseases, and
type 2 diabetes mellitus [4–6]. Economic improvement, increased
modernization, urbanization, and globalization have contributed to
increasing obesity in society in the present era [7].
Honey is a natural sweetener enriched with health beneficial nutri­
ents and being used traditionally as medicinal food since ancient times
[8]. Honey, besides the mixture of sugars with water, has highly active
components which have beneficial effects on carbohydrate metabolism
[9]. Studies have shown that honey possesses lipid lowering and weight

Abbreviations: HFD, High fat diet; ND, normal diet; TC, total cholesterol; TAG, triacylglycerol; LDL, low density lipoprotein; HDL, high density lipoprotein.
* Corresponding author at: H.E.J. Research Institute of Chemistry, International Center for Chemical and Biological Sciences (ICCBS), University of Karachi, lab 102
animal house PCMD, Pakistan.
E-mail addresses: atia_kjl13@yahoo.com (A. Gohar), shakeelbiochemist@gmail.com (M. Shakeel), adv36lab@gmail.com (Richard.L. Atkinson), djhaleem@uok.
edu.pk (D.J. Haleem).

https://doi.org/10.1016/j.phanu.2020.100227
Received 16 July 2020; Received in revised form 18 August 2020; Accepted 1 September 2020
Available online 2 October 2020
2213-4344/© 2020 Elsevier B.V. All rights reserved.
A. Gohar et al. PharmaNutrition 14 (2020) 100227

reducing abilities [10]. Honey is a healthier sweetener alternative to

mono and disaccharides from sucrose as it improves weight regulation
and obesity, prevents hypertriglyceridemia and hyperlipoproteinemia,
and reduces cardiovascular-associated diseases [11–13]. A recent study
showed honey improved elevated lipid levels and their consequences
such as hepatic steatosis in rats with obesity induced by a high fat diet
[14].
Despite these findings, the role of honey on modulating the meta­
bolic pathways controlling lipid metabolism has not been investigated.
Our study evaluates the effects of Acacia honey from a South Asian re­
gion (Pakistan) on high fat diet induced obesity in Albino Wistar rats.
This includes the investigation of body-weight gain, serum lipids levels,
liver histology, and the expression level of hepatic proteins mediating
lipid metabolism in HFD induced obese rats treated with honey
compared to control rats. This study provides insights into the molecular
mechanisms of improvement in obesity and its complications by natural
honey.

2. Materials and methods

2.1. Experimental animals

Thirty six male Wistar rats, weighing 120− 140 g, were obtained
from the animal house facility of Dr. Panjwani Center for Molecular
Medicine and Drug Research (PCMD), International Center for Chemical
and Biological Sciences (ICCBS), University of Karachi, for using in this
study. Each rat was housed individually and kept under controlled
temperature (±23 ◦ C) with a 12:12 h light/dark cycle. The rats were
housed for one week for acclimatization and had free access to normal
chow (ND) and plain drinking water. Animals were housed and handled Fig. 1. Experimental design of the study. Initially 18 rats were fed on normal
according to the strict guidelines of ‘Guide for the care and use of lab­ diet (ND), and 18 on high fat diet (HFD) for four weeks. Then each of these two
groups was further divided into 3 subgroups comprising of 6 rats each: ND with
oratory animals’, The National Academies Press, Washington DC, U.S.
saline, ND with low dose of honey (1 g/mL/kg), and ND with high dose of
A., and the Institutional Animal Ethics Committee, as described previ­
honey (2 g/mL/kg); HFD with saline, HFD with low dose of honey (1 g/mL/kg),
ously [3,15]. and HFD with high dose of honey (2 g/mL/kg) for another four weeks.

2.2. Experimental design for grouping animals and induction of obesity

After acclimatization, thirty six rats were divided into two major
groups: eighteen rats on ND, and eighteen rats on HFD for four weeks to
produce diet-induced obesity. The ND contained 5% kcal of fat, 60 %
kcal of carbohydrate, 28 % kcal of protein [16], and the HFD (Pro­
duct#D12492, Research Diet Inc., USA) contained 60 % kcal of fat, 20 %
kcal of carbohydrate, and 20 % kcal of protein.
The rats in each of the two major groups, after four weeks on ND and
HFD, were randomly divided into three groups on the basis of similar
body weights within the sets, including six rats per group. Group 1 of ND
was given saline, Groups 2 and 3 of ND were given 1 g/mL/kg, and 2 g/
mL/kg of honey orally daily. Likewise, Group 1 of HFD obese rats was
given saline, and Groups 2 and 3 were given 1 g/mL/kg and 2 g/mL/kg
of honey orally daily. For honey treatment, Acacia honey obtained from
local bee keepers, was dissolved as 1 g/mL of saline. The body weight
and food intake of each rat were measured weekly in grams until sac­
rifice after four weeks of honey/saline treatment. The caloric intake was
calculated from the quantity of food consumed by each rat, such that 1 g
of HFD provided 5.2 kcal (Research Diets Inc. diet D12492) and 1 g of
ND provided 3.9 kcal [3]. The experimental design has been summa­
rized in Fig. 1.
density lipoproteins cholesterol (HDL-C), low density lipoproteins
cholesterol (LDL-C), and very low density lipoproteins (VLDL) in the
serum were determined by calorimetric method using commercially
available kits (Spinreact, Girona, Spain). The concentrations of liver
enzymes alanine aminotransferase [20], aspartate aminotransferase,
and alkaline phosphatase (ALP) were determined by using commercial
kits (Spinreact, Girona, Spain).
2.4. Histopathological examination
The morphology of liver tissues of ND and HFD treated and untreated
animals were observed microscopically for any signs of abnormality
(steatosis, fibrosis, necrosis etc.) owing to HFD intake, and honey
treatment. For this, the liver tissue was washed in ice cold water
immediately after sacrifice, and preserved in 10 % buffered formalin
(Scharlau, Barcelona, Spain). Sections of the paraffin embedded liver
were prepared using microtome, and stained with haematoxylin and
eosin following fixation. Permanent mounts were examined by light
microscopy and the results obtained were compared with control.
2.5. Gene expression analysis of hepatic proteins

2.3. Biochemical analyses
For biochemical analyses, blood samples were collected in plain
tubes after sacrifice of the rats. The blood samples were allowed to
coagulate at room temperature followed by centrifugation at 3500 rpm
for 15 min for separation of serum. The clear supernatant was separated
and stored at − 20 ◦ C until biochemical analyses [17]. The concentra­
tions of total glucose, total cholesterol [18], triacylglycerol [19], high
For analyzing expression of hepatic genes involved in lipid meta­
bolism, total RNA was isolated from the liver tissue, as described pre­
viously [21]. Briefly, 0.1 g liver tissue was sliced and homogenized in
1 mL of Trizol reagent (Invitrogen, USA) according to the manufac­
turer’s instructions. Total RNA was precipitated using isopropanol
(Sigma-Aldrich, St. Louis, MO, US), followed by washing with 70 %
ethanol (SERVA, Heidelberg, Germany). The quantity and quality of
RNA was determined using a nanodrop instrument (Thermo Scientific,

2
A. Gohar et al.
US). The complementary DNA (cDNA) was synthesized from 1 μg of
isolated RNA with random hexamer primers using RevertAid first strand
cDNA synthesis kit (Thermo Fisher Scientific, US). The expression of
three genes i.e., fatty acid binding protein-1 (Fabp1), hepatic lipase C
(Lipc), and Apolipoprotein A-1 (Apoa1) along with a house-keeping gene
glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was determined
with real-time quantitative polymerase chain reaction (qPCR). For this,
the genes specific primers (Table 1) were used with Maxima SYBR
Green/ROX qPCR Master Mix (Thermo Scientific, US) on QuantStudio 5
system (Thermo Fisher Scientific, US), following the manufacturers
protocol. Each reaction was performed in triplicate to achieve sufficient
statistical power.
3. Statistical analysis
Values of body weight, biochemical parameters and genes expression
are expressed as means ± SD. Statistical analysis was performed using
IBM SPSS 23.0 statistical packages. The significance of differences was
evaluated by a two-way and three-way analysis of variance (ANOVA),
where applicable, followed by Tukey’s test. The statistical significance
level was chosen as P < 0.05. For comparison of gene expression, the
average Ct values were compared and the fold change was calculated
using ΔΔCt method [22].
4. Results
4.1. Effect of HFD on body weight, caloric intake, and locomotor activity
Fig. 2 shows changes in body weights, caloric intake, and locomotor
activity in rats fed with ND or HFD for four weeks, before honey treat­
ment. The data on each of these three variables was analyzed by two-
way ANOVA (repeated measures design) followed by Tukey’s test. The
body weights on day 1 of first week and last (4th) week showed sig­
nificant repeated measures (F = 6028.9, df 4,34, p < 0.01), and HFD
effect (F = 340.5, df 1,34, p < 0.01) (Fig. 2A). Interaction between
repeated measures x HFD was also significant (F = 445.7, df 1, 34,
p < 0.01). Post hoc analysis showed that body weights of ND and HFD
rats were highly comparable on week 1, but on 4th week, significantly
greater increase in body weight was observed in HFD rats.
Data on locomotor activity on week 1 and last (4th) week in a novel
environment showed significant HFD (F = 23.07, df 1,34, p < 0.01),
and repeated measures (F = 137.7, df 1,34, p < 0.01) effect (Fig. 2B).
Interaction between repeated measures x HFD (F = 15.4, df 1, 34,
p < 0.01) was also significant. The post hoc analysis showed that loco­
motor activities of ND and HFD animals were highly comparable on
week 1, but after 4 weeks on ND or HFD, a greater decrease in locomotor
activity was observed in HFD rats.
The caloric intake on week 1 and week 4 showed a non-significant
effect of HFD (F = 0.97 df 1, 34 p > 0.05) (Fig. 2C). The effect of
repeated measures (F = 0.28 df 1,34 p > 0.05) and interaction between
repeated measures x HFD (F = 0.77 df 1, 34 p > 0.05) also were not
significant. Post hoc test showed that differences in weekly caloric
intake between ND and HFD animals were similar.
4.2. Effect of honey on body weight, caloric intake and locomotor activity
Fig. 3 shows the effects of four weeks of honey treatment along with
ND/HFD on body weight, caloric intake, and locomotor activity. The
Table 1
Sequences of primers of liver genes used for qPCR.
Gene Name Forward Reverse
Fabp1 TCATCCAGAAAGGGAAGGAC CCTTGACCTTTTCCCCAGTC
Lipc CAATTTTGTGGATGCTATTC TTAAGCCATGCTCTGCAATG
Apoa1 ACAAAAACGCGAAGGAGATG TCAGGGTAGGGTGGTTCTTG
3
PharmaNutrition 14 (2020) 100227
data was analyzed by three-way ANOVA (repeated measures design) and
post hoc Tukey’s test.
There was significant effect of HFD (F = 827.6, df 1,30, p < 0.01),
repeated measures (F = 2027.1, df 1,30, p < 0.01), and honey treatment
(F = 92.1, df 2,30, p < 0.01) on body weight (Fig. 3A). Interaction be­
tween repeated measures x HFD (F = 15.5, df 1,30, p < 0.01), and HFD
x honey treatment (F = 9.3, df 2,30, p < 0.01) were significant. Inter­
action between repeated measures x honey treatment (F = 242.9, df
2,30, p < 0.01) and repeated measures x HFD x honey treatment effects
(F = 23.2, df 2,30, p < 0.01) were also significant. Tukey’s test showed
that treatment with high and low doses of honey decreased body weights
in ND as well as in HFD animals in a dose response fashion. The effect of
honey in HFD rats was greater than in ND rats.
Data on locomotor activity (Fig. 3B) showed significant effects of
HFD (F = 165.0, df 1, 30, p < 0.01), honey treatment (F = 50.5, df 2,30,
p < 0.01) and repeated measures (F = 147.6, df 1,30, p < 0.01). Inter­
action between repeated measures x HFD (F = 0.69, df 1,30, p > 0.05),
HFD x honey treatment (F = 0.7, df 2,30, p > 0.05), and repeated
measures x HFD x honey (F = 2.5, df 2,30, p > 0.05) were not signifi­
cant. Interaction between repeated measures x honey treatment
(F = 42.2, df 2,30, p < 0.01) were significant. The Tukey’s test showed
that treatment with high and low doses of honey had a significant effect
on increasing locomotor activity in HFD rats. Also, the effect of high
dose of honey was more significant than low dose.
There were non-significant effects of honey treatment (F = 0.47, df
2, 30, p > 0.05) and repeated measures (F = 0.7, df 1, 30, p > 0.05) but
the effect of HFD was significant (F = 8.72 df 1, 30 p < 0.05). Interac­
tion between weeks x HFD (F = 1.02, df 1, 30, p > 0.05), weeks x honey
(F = 0.16 df 2, 30, p > 0.05), HFD x honey (F = 0.93, df 2,30, p > 0.05),
and weeks x HFD x honey (F = 0.28, df 2,30, p > 0.05) were not
significant.
4.3. Effect of HFD, and honey on blood lipid profile
The effects of four weeks of honey treatment along with ND/HFD on
changes in serum TC, TAG, LDL-C, VLDL, Non HDL-C and HDL-C levels
in rats prior fed with ND or HFD for four weeks are presented in Fig. 4.
Data of all the variables was analyzed by two-way ANOVA, and inter­
action between the HFD and afore-mentioned lipid variables was
determined. Then Tukey’s test was applied to find the variable with
significantly changed value. The results are summarized in Fig. 4 and
Table 2.
Four weeks feeding of HFD significantly increased serum TC, TAG,
VLD-C, VLDL-C, and non-HDL-C, whereas, it significantly decreased
HDL-C in the saline group rats (Fig. 4A–F). The effect of low and high
doses of honey treatment on these variables varied in ND and HFD rats.
For TC, both low and high doses of honey decreased TC in HFD and ND
rats, yet this decrease was statistically significant in the HFD group only.
There were non-significant differences on TC in the high and low doses
of honey in both ND and HFD groups (Fig. 4A). For TAG, in the ND
group, neither low dose nor high dose of honey showed a significant
difference in TAG levels. In the HFD group, both high and low doses of
honey decreased TAG level significantly (Fig. 4B). Serum LDL-C level
was decreased non-significantly by both high and low doses of honey in
the ND rats. In the HFD group, the high dose of honey showed a sta­
tistically significant decrease in LDL-C level (Fig. 4C). The decrease in
the level of serum VLDL after high and low doses of honey was statis­
tically significant in HFD treated rats. In the ND group, neither low dose
or high dose of honey showed a significant difference in serum VLDL
levels (Fig. 4D). Likewise, the high and low doses of honey decreased
non HDL-C in HFD treated rats in a dose response fashion. In the ND
group, high and low doses of honey showed statistically non-significant
decreases in non HDL-C (Fig. 4E). For HDL-C, a statistically significant
increase in serum HDL-C level was observed in HFD treated rats after the
high dose of honey. In ND rats, no significant differences in serum HDL-C
were observed after high and low doses of honey.
A. Gohar et al. PharmaNutrition 14 (2020) 100227

Fig. 2. Effect of four weeks feeding of ND and HFD on (A) Body weight (B) Locomotor activity (C) Caloric intake in rats. Values are means ± SD. Significant dif­
ference by Tukey’s test: *p < 0.01 from respective ND treated rats; +p < 0.01 from respective week 1 rats; following two-way ANOVA.

Fig. 3. Effect of four weeks of honey treatment along with ND/HFD on (A) Body weight (B) Locomotor activity (C) Caloric intake. Values are means ± SD. Significant
difference by Tukey’s test: *p < 0.01 from respective ND treated rats; +p < 0.01 from respective saline treated rats; $p < 0.01 respective low dose honey treated rats
following three-way ANOVA. LHD = Low dose of honey, HHD = High dose of honey.

Fig. 4. Effects of four weeks of honey treatment along with ND/HFD on serum level of A) Cholesterol (B) TAG (C) LDL-C (D) VLDL (E) Non HDL-C and HDL-C in rats.
Values are means ± SD. Significant differences by Tukey’s test: **p < 0.01, *p < 0.05 from respective ND treated rats; ++p < 0.01, +p < 0.01 from respective saline
treated rats; $p < 0.01 from respective low dose of honey treated rats following two-way ANOVA. LHD = Low dose of honey, HHD = High dose of honey.

4
A. Gohar et al. PharmaNutrition 14 (2020) 100227

Table 2 4.5. Effect of HFD, and honey on blood glucose level

The effect of HFD in saline rats, and honey treatment in HFD rats. (TC = Total
cholesterol, TAG = Triacyl glycerol, LDL = Low density lipoprotein, Fig. 6 shows effects of honey treatment for four weeks along with
HDL = high density lipoprotein). ND/HFD on changes in serum glucose levels in rats previously on ND or
Variable Effect of HFD Effect of Honey HFD x honey HFD for four weeks. Serum glucose levels, analyzed by two-way
without honey Treatment along with Interaction ANOVA, showed that the effect of HFD was not significant (F = 2.27,
treatment ND/HFD
df 1, 30, p > 0.05). However, the effect of honey treatment was signif­
TC Significant Significant (F = 12.9, Non-significant icant (F = 17.6 df 2, 30, p < 0.01). The interaction between HFD x
(F = 188.1, df 1,30, df 2,30, p < 0.01) (F = 2.22, df 2,30, honey treatment was also not significant (F = 0.33, df 2, 30, p > 0.05).
p < 0.01) p > 0.05)
TAG Significant Significant (F = 47.6, Significant
Tukey’s test showed that the circulating serum glucose level was highly
(F = 76.3, df 1,30, df 2,30, p < 0.01) (F = 27.8, df 2,30, comparable in HFD and ND (saline group) rats. Both high and low doses
p < 0.01) p < 0.01) of honey showed statistically significant decreases in glucose levels in
LDL-C Significant Significant (F = 14.7, Non-significant HFD as well as in ND treated rats.
(F = 220.2, df 1,30, df 2,30, p < 0.01) (F = 1.87, df 2, 30,
p < 0.01) p > 0.05)
VLDL-C Significant Significant (F = 8.8, Significant
(F = 14.1, df 1,30, df 2,30, p < 0.01) (F = 5.17, df 2, 30, 4.6. Effect of HFD, and honey on liver Fabp1, Lipc, and Apoa1 gene
p < 0.01) and p < 0.01) expression
non- Significant Significant (F = 23.7, Significant
HDL-C (F = 443.1, df 1, 30, df 2, 30, p < 0.01) (F = 10.2, df 2, 30, The effects of HFD in saline rats and honey treatment for four weeks
p < 0.01) p < 0.01)
HDL-C Significant Significant (F = 9.02, Significant (F = 5.05
along with ND/HFD on the expression of liver Fabp1, Lipc and Apoa1
(F = 173.3, df 1, 30, df 2, 30, p < 0.01) df 2, 30, p < 0.01) genes in rats previously fed with ND or HFD for four weeks are presented
p < 0.01) in Fig. 7. The expression data of these genes was analyzed by two-way
ANOVA followed by Tukey’s test. The data on Fabp1 expression
(Fig. 7A) showed that effects of HFD (F = 311.4, df 1,30, p < 0.01),
4.4. Effect of HFD, and honey on liver function enzymes

The data on liver function enzymes ALT, ALP, and ASP were
analyzed by two-way ANOVA, with post hoc analysis performed by
Tukey’s test. The effect of HFD on serum ALT level was not significant
(F = 0.003, df 1, 30, p > 0.05) in saline rats. The effect of honey treat­
ment was significant (F = 9.2, df 2, 30, p < 0.01) in HDF animals. The
interaction between HFD x honey treatment (F = 1.19, df 2, 30,
p > 0.05) was not significant (Fig. 5A). Tukey’s test indicated that serum
ALT level was non-significantly raised in HFD rats (saline group). Both
high and low doses of honey showed decreases in serum ALT levels in
HFD as well as in ND treated rats, yet the decrease was statistically
significant in HFD group only. Likewise, the data on serum AST level
showed significant effects of HFD (F = 6.73, df 1, 30, p < 0.01), honey
treatment (F = 6.03, df 2, 30, p < 0.01) and interaction between HFD x
honey treatment (F = 9.6, df 2, 30, p < 0.01) (Fig. 5B). Tukey’s test
indicated that serum AST levels were higher in HFD (saline group). Both
high and low doses of honey decreased AST in HFD treated rats. The
decrease in AST in ND treated rats was not significant. For serum ALP
level, the data showed that effects of HFD (F = 0.97, df 1, 30, p > 0.01),
honey treatment (F = 0.74, df 2, 30, p > 0.01) and interaction between
HFD x honey treatment (F = 0.87, df 2, 30, p > 0.01) were not signifi­ Fig. 6. Effects of four weeks of honey treatment along with ND/HFD on serum
cant (Fig. 5C). glucose level in rats. Values are means ± SD. Significant differences by Tukey’s
test: +p < 0.05, ++p < 0.01 from respective saline treated rats following two-
way ANOVA. LHD = Low dose of honey, HHD = High dose of honey.

Fig. 5. Effects of four weeks of honey treatment along with ND/HFD on serum levels of A) ALT (B) AST and (C) ALP in rats. Values are means ± SD. Significant
difference by Tukey’s test: *p < 0.01 from respective ND treated rats; +p < 0.05, ++p < 0.01 from respective saline treated rats following two-way ANOVA.
LHD = Low dose of honey, HHD = High dose of honey.

5
A. Gohar et al.
Fig. 7. Effects of four week of honey treatment along with ND/HFD on hepatic expression of Fabp1 (panel A), Lipc (panel B), and Apoa1 (panel C) genes in rats.
Values are means ± SD. Significant differences by Tukey’s test: *p < 0.01 from respective ND treated rats; +p < 0.01 from respective saline treated rats; $p < 0.01
from respective low dose honey treated rats following two-way ANOVA. LHD = Low dose of honey, HHD = High dose of honey.
honey treatment (F = 30.9, df 2,30, p < 0.01), and interaction between
HFD x honey treatment (F = 66.2, df 2,30, p < 0.01) were significant.
Tukey’s test indicated that Fabp1 was upregulated in HFD rats (saline
group). In the ND group, the low dose of honey upregulated Fabp1
expression non-significantly, whereas, the high dose of honey signifi­
cantly upregulated Fabp1. In the HFD group, the treatment of high dose
of honey showed significant downregulation of Fabp1expression,
whereas, low dose did not show an effect on Fabp1 expression. The effect
of HFD (F = 60.7, df 1,30, p < 0.01) and honey treatment (F = 20.9, df
2,30, p < 0.01) on the hepatic expression of Lipc was significant. Inter­
action between HFD x honey treatment (F = 72.8, df 2,30, p < 0.01)
was also significant. Tukey’s test indicated downregulation of Lipc in
HFD rats (saline group). Both high and low doses of honey significantly
upregulated Lipc expression in HFD treated rats, in a dose response
fashion. In the ND group, both high and low doses of honey down­
regulated Lipc gene expression significantly. The changes in gene
expression of Apoa1 showed that effects of HFD (F = 9.3, df 1,30,
p < 0.01), honey treatment (F = 73.9, df 2,30, p < 0.01), and interac­
tion between HFD x honey treatment (F = 3.39, df 2,30, p < 0.05) were
significant. Tukey’s test indicated no change in Apoa1 expression in ND
and HFD rats (saline group). The high and low doses of honey signifi­
cantly upregulated Apoa1 expression in HFD as well as in ND fed rats and
a greater effect was observed with high dose than with low dose of
honey.
5. Discussion
This study was designed to assess body weight, locomotor activity,
circulating lipids level, glucose, liver enzymes, and expression profile of
lipids metabolizing genes Fabp1, Apoa1, and Lipc in liver tissue of HFD
induced obese rats treated with acacia honey. Wistar rats were used in
our study because they are prone to more rapid weight-gain (4 weeks)
upon feeding of high fat diet, and present a polygenic diet-induced
model of obesity [23]. Although, the high fat diet contained a very
high proportion of fats (60 % of calories), which is much higher than
humans routinely consume, it was used to cut-down the study duration.
Our results show that natural honey causes a decrease in body
weight-gain, decreases serum TC, TAG, LDL-C, non HDL-C, and increases
HDL-C levels in HFD induced obese rats. The down-regulated expression
of Apoa1, and Lipc genes in liver tissue in dietary obesity is upregulated
in rats after 4 weeks treatment of natural honey.
Consumption of a HFD provides greater energy because it is dense in
calories, yet it decreases energy expenditure. The greater energy intake
than energy expenditure shifts the body’s energy homeostasis to positive
energy balance and promotes adipose tissue gain, thus leading to obesity
[3,24,25]. In our study, the caloric intake by HFD groups rats was
6
PharmaNutrition 14 (2020) 100227
comparable with the caloric intake by ND groups rats at week 1 after
acclimatization until the last week of the study. The body weights of
both ND and HFD animals were comparable on day 1 of first week, but a
significant increase in body weight was observed in the HFD group in
week 4, which is consistent with other studies [3,25]. The treatment of
low dose (1 g/kg) and high dose (2 g/kg) of honey induced reduction in
weight-gain significantly in HFD rats compared with control rats. The
weight reducing effect of honey in HFD animals is in-accordance with
previous reports [10,14]. The honey induced weight controlling effect
observed in rodents in this study can also be correlated with humans, as
reported in previous randomized clinical trial [20]. Earlier, it was hy­
pothesized that consumption of honey may boost conversion of excess
calories of HFD into energy dissipation rather than storing as adiposity
in the body [10]. Here we indirectly determined energy expenditure
(EE) in experimental rats with locomotion activity in a novel environ­
ment, because the extent of locomotion corresponds to physical activity
and positively correlates with EE [26]. Our findings of a significantly
lower locomotor activity in rats on HFD compared to rats on ND before
the honey treatment suggests that this lower EE contributed to the
obesity of the HFD rats. The significantly increased locomotor activity
with honey treatment in both groups (ND and HFD) supports the hy­
pothesis that increased EE after honey treatment reduces weight-gain.
The effect of honey intervention was also assessed on HFD induced
blood lipids and glucose levels. The increase in blood TAG, TC, LDL-C,
VLDL, and glucose in rats on HFD is in-line with previous reports
[27–29]. HFD induces dyslipidemia owing to white adipose tissue’s
reduced capability of β-oxidation to cope with influx of large amount of
fatty acids [30]. The increased levels of TAG, LDL, and TC with reduced
HDL-C are important indicators of adiposity and atherogenic dyslipi­
demia [31]. In our study, modulation of blood lipids profile i.e.,
decreased TAG, TC, LDL, VLDL, non HDL-C, and glucose, while
increased HDL-C after the honey intervention are also in accordance
with previous studies [11,12,32]. The weight-gain reducing effect of
natural honey by the modulation of blood lipids along with increased EE
in HFD animals, may be due to increased mobilization of nutrients to
maintain energy homeostasis in the body. This was inferred from a
previous observation where the reduction of adiposity exhibited
enhanced oxidation of fatty acids in WAT in mice [33]. Also, honey
induces a protective effect on the pancreas by alleviating oxidative
stress, inflammation, and apoptosis markers in pancreatic islets of dia­
betic rats, and also stimulates insulin secretion and decreases blood
glucose levels [34]. The lipids lowering effect by natural honey in ro­
dents is also seen in humans. There are reports describing decreases in
total cholesterol, triglycerides, and low density lipoproteins in humans
with overweight, obesity and metabolic syndrome [20,35,36].
The biochemical indices such as liver enzymes are useful markers for
A. Gohar et al.
assessment of liver inflammation and injury [37]. The levels of tissue
enzymes’ activity can also indicate cellular impairment of tissues caused
by exogenous chemical compounds well before the structural damage
that can be detected by conventional histological examination. Our re­
sults indicated that rat liver enzymes ALT, and ALP were
non-significantly, while AST was significantly higher in HFD group,
which may be due to initial stages of hepatic steatosis due to increased
burden of lipids turn over. The increased liver enzymes ALT and AST
together with circulating lipids levels including TAG, TC, LDL, but
decreased circulating HDL are characteristics of liver steatosis [38].
Here, alleviation in hepatic enzymes activity in HFD animals after the
honey intervention indicates the liver’s metabolic adaptation towards
normal physiology of energy homeostasis which is consistent with pre­
vious findings [14].
A cascade of many proteins takes part in lipid metabolism in hepa­
tocytes to maintain energy homeostasis under basal conditions. Fatty
acid binding proteins (FABPs) play a central role as intracellular lipid
chaperones in lipid-mediated biological processes and systemic meta­
bolic homeostasis. FABPs facilitate transport of lipids to specific cellular
compartments including mitochondria or peroxisomes for oxidation.
Modification in FABP’s function through pharmacological agents can
provide cell or tissue-specific control of lipid signaling pathways, and
metabolic regulation [39,40]. Here, the expressions of hepatic Fabp1
(L-FABP) was observed to be up-regulated in rats on a HFD for eight
weeks compared with rats on ND. This observation correlates with
previous observations where ablation of L-FABP inhibited uptake of long
chain fatty acids (LCFA) and cholesterol in living cells [41,42]. The
up-regulation of Fabp1 suggests facilitating transport of more fatty acids
into hepatocytes, which consequently leads to steatosis. This observa­
tion corresponds with the previous finding that L-FABP was overex­
pressed in simple steatosis patients compared with nonsteatotic patients.
The HFD rats when treated with honey showed decreased expression by
downregulation the L-FABP gene. That honey intervention mediated
L-FABP expression is suggestive of a protective role of honey on the
liver. The role of natural honey on the expression pattern of the L-FABP
gene is a novel aspect of this study.
Hepatic lipase (Lipc) takes part in lipoproteins metabolism as a
lipolytic enzyme and catalyzes the hydrolysis of triacylglycerol and
phospholipids in chylomicron remnants, and intermediate density li­
poprotein (IDL) [43]. It also serves as a ligand which facilitates uptake of
lipoproteins by cell surface receptors and proteoglycans, thereby
directly affecting cellular lipid delivery [44]. In our study, the down­
regulated hepatic expression of Lipc in HFD rats implies diminishing
hydrolytic activity on circulating lipids and/or their delivery to target
cells resulting in elevated level of lipids in the blood. This finding cor­
relates with a recent report where HFD significantly decreased activity
of hepatic lipase in mice [45]. The increased expression of Lipc as a result
of treatment of honey in HFD animals suggests enhanced catabolism of
circulating lipids and their cellular uptake for use in downstream pro­
cesses resulting in lower TAG and LDL levels.
Apo-lipoprotein A1 (Apoa1) is the most abundant protein constituent
of HDL-C, having a negative correlation with the development of obesity
[46]. The downregulation of Apoa1 may be responsible for the decreased
level of HDL-C in dietary obesity, because, previously eight weeks
feeding of HFD significantly decreased the expression of Apoa1 mRNA in
liver tissue of Sprague-Dawley rats [47]. Here, the HFD induced
downregulation of Apoa1 correlates with the decreased level of HDL-C in
obese Wistar rats. The restoration of Apoa1 expression in liver after
honey treatment is more likely to contribute to increasing HDL-C levels
found in our HFD treated animals. The honey intervention mediated
modulation of Apoa1 expression is also a novel aspect of this study. The
modulation of liver Apoa1 expression in rodents can also be correlated
with humans as better plasma lipid profile and higher circulating levels
of metabolites associated with lower risk of atherosclerosis (asparagine,
glycine and histidine) were observed in morbidly obese patients with
increased expression of APOA1bp [48].
7
PharmaNutrition 14 (2020) 100227
The results of liver enzymes and blood lipids were confirmed by liver
histological evaluation. The microscopic examination of the liver of ND
rats presented a normal morphological appearance. The hepatic paren­
chyma appeared as homogeneous where polygonal hepatocytes anas­
tomosed with another (Supplementary Fig. 1B). Slightly damaged or
degenerated liver cells were observed in rats on HFD with saline. The
cytoplasmic vacuolization and some ballooned hepatocytes indicated an
initial degree of liver steatosis (Supplementary Fig. 1A). This fatty
infiltration could be due to increased hepatic uptake of dietary fatty
acids, as suggested by up-regulated L-FABP gene in HFD rats. The HFD
rats treated with honey displayed similar physiology as the ND control
rats. The effect of a high dose of honey on protection of liver physiology
was more prominent than a low dose of honey (Supplementary Fig. 1C &
E). These observations were in agreement with previous reports
demonstrating that daily consumption of honey induced positive effects
on liver function enzymes [49]. This modulation also gave a clue of the
protective role of natural honey to liver physiology compared to the
toxicity effects of excess dietary fats, in addition to the potential of
reducing excess weight gain and obesity. Limitations of this study
include the use of a very high fat diet (60 % of kcal as fat) to produce
rapid weight gain in the rats. This shortens the time of the experiment
but diets high in fat are reported to have effects on metabolic variables
that are independent of weight gain and obesity [50]. We report a dose
response increase in energy expenditure due to increased locomotor
activity, but we did not perform direct measures of energy expenditure
by calorimetry, so a direct effect of honey on energy expenditure cannot
be ruled out. Yoneshiro et al. demonstrated stimulation of brown fat by
bee royal jelly, but apparently there have been no direct measurements
of energy expenditure with honey treatment [51]. Finally, we did not
measure liver fat directly, but liver steatosis is well known with a high
fat diet in rats. Our findings of reduction of elevated liver enzymes and
changes in liver enzyme expression that would favor a reduction in
steatosis with honey suggest that honey may reduce liver steatosis.
6. Conclusions
The findings of our study suggest that in a dose response fashion,
natural honey increases energy expenditure and increases locomotor
activity on both a normal and a high fat diet. Weight gain is less on both
diets, but it is not clear if the entire difference in weight can be explained
by increased activity or if there is a direct effect of honey on energy
expenditure. Additional studies with direct measures of energy expen­
diture are needed in the future. Elevations of serum lipids due to a HFD
are improved by honey in a dose response fashion and serum HDL is
increased. The increases in serum ALT and AST on a high fat diet are
reduced in a dose response fashion by honey and there are changes in
liver enzyme expression that would reduce fat uptake by the liver and
thereby decrease liver steatosis on a HFD. Elevated serum glucose levels
on a HFD are also reduced. Thus, natural honey significantly improves
several major indicators of the metabolic syndrome induced by HFD in
rats. Studies in humans are needed to determine if honey is effective as a
treatment for obesity, metabolic syndrome, and fatty acid liver disease.
Funding resource
The major work of this study was carried out with faculty grant to
DJH from Dr. Panjwani Center for Molecular Medicine and Drug
Research, ICCBS, University of Karachi. Part of study was performed
with grant for project no. 2802-2019 to MS from Dr. Panjwani Center for
Molecular Medicine and Drug Research, ICCBS, University of Karachi.
The funding authority had not any role in study design, results inter­
pretation or discussion.
Authors contribution
AG designed the study, performed experimentation, carried out
A. Gohar et al.
acquisition, analysis and interpretation of data, and drafting the article.
MS involved in study design, experimentation, data acquisition, and
drafting the article. RLA involved in study design, interpretation of data,
revising the manuscript critically for important intellectual content, and
its final approval. JDH supervised this study and involved in concep­
tualization, study design, data interpretation, revising the manuscript
critically for intellectual content, and the final approval.
Declaration of Competing Interest
The authors report no declarations of interest.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.phanu.2020.100227.
References
[1] D.B. Allison, et al., Obesity as a disease: a white paper on evidence and arguments
commissioned by the Council of the Obesity Society, Obesity 16 (6) (2008)
1161–1177.
[2] G.A. Bray, Medical consequences of obesity, J. Clin. Endocrinol. Metab. 89 (6)
(2004) 2583–2589.
[3] D.J. Haleem, K. Mahmood, Brain serotonin in high-fat diet-induced weight gain,
anxiety and spatial memory in rats, Nutr. Neurosci. (2019) 1–10.
[4] I.J. Raphael, et al., Obesity and operative time in primary total joint arthroplasty,
J. Knee Surg. 26 (02) (2013) 095–100.
[5] G.C. Fuentes, et al., Prospective association of physical activity and inflammatory
biomarkers in older adults from the PREDIMED-Plus study with overweight or
obesity and metabolic syndrome, Clin. Nutr. S0261-5614 (20) (2020), p. 30037-6.
[6] R. Freire, Scientific evidence of diets for weight loss: different macronutrient
composition, intermittent fasting, and popular diets, Nutrition 69 (2020) 110549.
[7] A.B. Malafaia, et al., Obesity induction with high fat sucrose in rats, ABCD.
Arquivos Brasileiros de Cirurgia Digestiva (São Paulo) 26 (2013) 17–21.
[8] T. Eteraf-Oskouei, M. Najafi, Traditional and modern uses of natural honey in
human diseases: a review, Iran. J. Basic Med. Sci. 16 (6) (2013) 731.
[9] K. Münstedt, et al., Effects of basswood honey, honey-comparable glucose-fructose
solution, and oral glucose tolerance test solution on serum insulin, glucose, and C-
peptide concentrations in healthy subjects, J. Med. Food 11 (3) (2008) 424–428.
[10] O. Omotayo, Effect of honey on body weight, body mass index and adiposity in
high-fat diet fed Wistar rats, EC Pharmacology and Toxicology 3 (2017) 03–12.
[11] T.M. Nemoseck, et al., Honey promotes lower weight gain, adiposity, and
triglycerides than sucrose in rats, Nutr. Res. 31 (1) (2011) 55–60.
[12] N.S. Al-Waili, Natural honey lowers plasma glucose, C-reactive protein,
homocysteine, and blood lipids in healthy, diabetic, and hyperlipidemic subjects:
comparison with dextrose and sucrose, J. Med. Food 7 (1) (2004) 100–107.
[13] N. Ramli, et al., A review on the protective effects of honey against metabolic
syndrome, Nutrients 10 (8) (2018) 1009.
[14] S. Samat, et al., Four-week consumption of Malaysian honey reduces excess weight
gain and improves obesity-related parameters in high fat diet induced obese rats,
Evid. Based Complement. Altern. Med. 2017 (2017).
[15] S. Gul, et al., Inhibition of hormonal and behavioral effects of stress by tryptophan
in rats, Nutr. Neurosci. 22 (6) (2019) 409–417.
[16] M. Ricci, E. Ulman, Laboratory animal diets: a critical part of your in vivo research,
Animal Lab News 4 (6) (2005) 1–6.
[17] M.K. Tuck, et al., Standard operating procedures for serum and plasma collection:
early detection research network consensus statement standard operating
procedure integration working group, J. Proteome Res. 8 (1) (2008) 113–117.
[18] L. Kang, et al., Chronic ethanol-induced insulin resistance is associated with
macrophage infiltration into adipose tissue and altered expression of
adipocytokines, Alcohol. Clin. Exp. Res. 31 (9) (2007) 1581–1588.
[19] M.A. Mesaik, et al., Characterization of immunomodulatory activities of honey
glycoproteins and glycopeptides, J. Agric. Food Chem. 63 (1) (2014) 177–184.
[20] N. Yaghoobi, et al., Natural honey and cardiovascular risk factors; effects on blood
glucose, cholesterol, triacylglycerole, CRP, and body weight compared with
sucrose, Sci. World J. 8 (2008) 463–469.
[21] T. Salman, et al., Repeated administration of methylphenidate produces
reinforcement and downregulates 5-HT-1A receptor expression in the nucleus
accumbens, Life Sci. 218 (2019) 139–146.
[22] X. Rao, et al., An improvement of the 2ˆ(–delta delta CT) method for quantitative
real-time polymerase chain reaction data analysis, Biostat. Bioinforma. Biomath. 3
(3) (2013) 71.
PharmaNutrition 14 (2020) 100227
[23] C. Marques, et al., High-fat diet-induced obesity Rat model: a comparison between
Wistar and Sprague-Dawley Rat, Adipocyte 5 (1) (2016) 11–21.
[24] M.-S. Choi, et al., High-fat diet decreases energy expenditure and expression of
genes controlling lipid metabolism, mitochondrial function and skeletal system
development in the adipose tissue, along with increased expression of extracellular
matrix remodelling-and inflammation-related genes, Br. J. Nutr. 113 (6) (2015)
867–877.
[25] J. Mercer, Z. Archer, Diet-induced Obesity in the Sprague–Dawley Rat: Dietary
Manipulations and their Effect on Hypothalamic Neuropeptide Energy Balance
Systems, Portland Press Limited, 2005.
[26] M. Bjursell, et al., Acutely reduced locomotor activity is a major contributor to
Western diet-induced obesity in mice, Am. J. Physiol.-Endocrinol. Metab. 294 (2)
(2008) E251–E260.
[27] R.M. Hafizur, et al., A ‘Humanized’rat model of pre-diabetes by high fat diet-
feeding to weaning wistar rats, Integr Obesity Diabetes 1 (2) (2015).
[28] Y.-J. Jia, et al., Dyslipidemia in rat fed with high-fat diet is not associated with
PCSK9-LDL-receptor pathway but ageing, J. Geriatric Cardiol.: JGC 10 (4) (2013)
361.
[29] I. Karam, et al., Induce hyperlipidemia in rats using high fat diet investigating
blood lipid and histopathology, J. Hematol. Blood Disord. 4 (1) (2018) 104.
[30] C.M. Kusminski, P.E. Scherer, Mitochondrial dysfunction in white adipose tissue,
Trends Endocrinol. Metab. 23 (9) (2012) 435–443.
[31] J.-P. Després, I. Lemieux, Abdominal obesity and metabolic syndrome, Nature 444
(7121) (2006) 881.
[32] N.Z. Ramli, et al., A review on the protective effects of honey against metabolic
syndrome, Nutrients 10 (8) (2018) 1009.
[33] P. Flachs, et al., Stimulation of mitochondrial oxidative capacity in white fat
independent of UCP1: a key to lean phenotype, Biochim. et Biophys. Acta (BBA)-
Mol. Cell Biol. Lipids 1831 (5) (2013) 986–1003.
[34] M.S.A. Aziz, et al., Pancreatoprotective effects of Geniotrigona thoracica stingless
bee honey in streptozotocin-nicotinamide-induced male diabetic rats, Biomed.
Pharmacother. 89 (2017) 135–145.
[35] P. Whitfield, et al., The effect of a cinnamon-, chromium- and magnesium-
formulated honey on glycaemic control, weight loss and lipid parameters in type 2
diabetes: an open-label cross-over randomised controlled trial, Eur. J. Nutr. Food
Saf. 55 (3) (2016) 1123–1131.
[36] S. Terzo, F. Mulè, A. Amato, Honey and obesity-related dysfunctions: a summary
on health benefits, J. Nutr. Biochem. (2020) 108401.
[37] S. Gowda, et al., A review on laboratory liver function tests, Pan Afr. Med. J. 3
(2009).
[38] A. Krishnan, J. Venkataraman, Prevalence of nonalcoholic fatty liver disease and
its biochemical predictors in patients with type-2 diabetic mellitus, Exp. Clin.
Hepatol. 7 (2011).
[39] X. Chen, et al., Taurine supplementation prevents ethanol-induced decrease in
serum adiponectin and reduces hepatic steatosis in rats, Hepatology 49 (5) (2009)
1554–1562.
[40] M. Furuhashi, G.S. Hotamisligil, Fatty acid-binding proteins: role in metabolic
diseases and potential as drug targets, Nat. Rev. Drug Discov. 7 (6) (2008) 489.
[41] B.P. Atshaves, et al., Liver fatty acid-binding protein gene ablation inhibits
branched-chain fatty acid metabolism in cultured primary hepatocytes, J. Biol.
Chem. 279 (30) (2004) 30954–30965.
[42] E.P. Newberry, et al., Decreased hepatic triglyceride accumulation and altered fatty
acid uptake in mice with deletion of the liver fatty acid-binding protein gene,
J. Biol. Chem. 278 (51) (2003) 51664–51672.
[43] M.C. Cheung, et al., Lipoprotein lipase and hepatic lipase their relationship with
HDL subspecies Lp (AI) and Lp (AI, A-II), J. Lipid Res. 44 (8) (2003) 1552–1558.
[44] S. Santamarina-Fojo, et al., Hepatic lipase, lipoprotein metabolism, and
atherogenesis, Arterioscler. Thromb. Vasc. Biol. 24 (10) (2004) 1750–1754.
[45] I. Andrés-Blasco, et al., Hepatic lipase deficiency produces glucose intolerance,
inflammation and hepatic steatosis, J. Endocrinol. 227 (3) (2015) 179–191.
[46] X. Ruan, et al., Apolipoprotein A-I possesses an anti-obesity effect associated with
increase of energy expenditure and up-regulation of UCP1 in brown fat, J. Cell.
Mol. Med. 15 (4) (2011) 763–772.
[47] S.-M. Lee, et al., Onion peel extract increases hepatic low-density lipoprotein
receptor and ATP-binding cassette transporter A1 messenger RNA expressions in
Sprague-Dawley rats fed a high-fat diet, Nutr. Res. 32 (3) (2012) 210–217.
[48] J. Mayneris-Perxachs, et al., The APOA1bp-SREBF-NOTCH axis is associated with
reduced atherosclerosis risk in morbidly obese patients, Clin. Nutr. S0261-5614
(20) (2020), p. 30098-4.
[49] O. Erejuwa, et al., Effects of honey on postprandial hyperlipidemia and oxidative
stress in Wistar rats: role of HMG-CoA reductase inhibition and antioxidant effect,
Niger. J. Physiol. Sci. 33 (2) (2018) 129–138.
[50] J.R. Speakman, Use of high-fat diets to study rodent obesity as a model of human
obesity, Int. J. Obes. (Lond.) 43 (8) (2019) 1491–1492.
[51] T. Yoneshiro, et al., Royal jelly ameliorates diet-induced obesity and glucose
intolerance by promoting brown adipose tissue thermogenesis in mice, Obes. Res.
Clin. Pract. 12 (Suppl. 2) (2018) 127–137.