Food and Chemical Toxicology 57 (2013) 84–90

Contents lists available at SciVerse ScienceDirect

Food and Chemical Toxicology

journal homepage: www.elsevier.com/locate/foodchemtox

Hypocholesterolemic effect of daily fisetin supplementation in high fat

fed Sprague–Dawley rats
Min-Jeong Shin a, Yoonsu Cho a, Jiyoung Moon a, Hyun Ju Jeon b, Seung-Min Lee c, Ji Hyung Chung b,⇑
a
Department of Food and Nutrition, Korea University, Seoul 136-703, Republic of Korea
b
Cardiovascular Product Evaluation Center, Cardiovascular Research Institute, Yonsei University College of Medicine, Seoul 120-752, Republic of Korea
c
Department of Food and Nutrition, College of Human Ecology, Yonsei University, Seoul 120-749, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: We aimed to test whether fisetin could modulate cholesterol homeostasis in rats with diet-induced
Received 28 December 2012 hypercholesterolemia, and further investigated the underlying mechanisms by which fisetin exerts its
Accepted 6 March 2013 cholesterol lowering effect. Blood lipid profile, hepatic cholesterol content, as well as gene expressions
Available online 21 March 2013
in cholesterol metabolism were examined. Elevated levels of total cholesterol and LDL-cholesterol, along
with hepatic cholesterol content in a high fat group were found to be significantly reduced by fisetin. The
Keywords: high fat diet significantly decreased hepatic mRNA levels of LDLR, SREBP2, HMGCR and PCSK9 in compar-
Cholesterol
ison to the control diet, however, fisetin did not further elicit any changes in mRNA levels of the same
CYP7A1
Fisetin
genes. The high fat diet dramatically increased the transcript levels of CYP7A1, which was subsequently
HMG-CoA reductase reversed by the fisetin. In HepG2 cells, fisetin was found to increase the levels of a nuclear form of SREBP2
Hypercholesterolemia and LDLR. In conclusion, fisetin supplementation displayed hypocholesterolemic effects by modulating
the expression of genes associated with cholesterol and bile acid metabolism.
Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction predominant flavonols occurring in strawberries, its content being as

Epidemiological studies have shown that the consumption of diets
rich in fruit and vegetables is associated with lower risks of many
chronic diseases such as cardiovascular disease (CVD) and cancer, as
well as reducing the risk of stroke (O’Byrne et al., 2002; Hertog et al.,
1997; Geleijnse et al., 2002; Lee et al., 2011). It is mainly attributed
to the antioxidant capacities derived from flavonoid contents in fruits
and vegetables (Halliwell, 1994). Strawberries have been reported to
have the highest total antioxidant activity among fruits (Wang et al.,
1996), which is conferred by the wide variety of flavonoids contained
therein (Hannum, 2004). In fact, strawberry consumption either as
an individual component (Tsuda et al., 2004), or as whole strawberries
(Prior et al., 2008), has been specifically implicated in the effects on risk
factors for CVD. For example, several human studies have consistently
reported the effects of strawberry consumption on the blood lipid pro-
files (Zunino et al., 2011; Basu et al., 2009; Jenkins et al., 2008), inflam-
mation (Basu et al., 2010; Edirisinghe et al., 2011) and oxidative stress
(Basu et al., 2009; Jenkins et al., 2008). Fisetin (Fig. 1) is one of the most
Abbreviations: CYP7A1, cytochrome P450 family 7 subfamily A polypeptide 1;
FXRa, farnesoid X receptor a; HMGCR, 3-hydroxy-3-methylglutaryl-CoA reductase;
LDLR, low density lipoprotein receptor; PCSK9, proprotein convertase subtilisin/
kexin type 9; SREBP2, sterol regulatory element binding protein 2.
⇑ Corresponding author. Tel.: +82 2 2228 0332; fax: +82 2 365 1878.
E-mail address: jhchung@yonsei.ac.kr (J.H. Chung).
high as 160 lg/g (Kimira et al., 1998). Despite the abundance of fisetin
in strawberries, there is limited information on the potential metabolic
effects of fisetin. A few studies have reported that fisetin could display
hypoglycemic activities in vitro (Constantin et al., 2010) and in animals
(Prasath and Subramanian, 2011a, 2011b). However, there was found
to be no previously published data on the effects of fisetin on choles-
terol metabolism.
In the present study, we aimed to test whether fisetin could
modulate cholesterol homeostasis in rats with diet-induced hyper-
cholesterolemia, and further investigated underlying mechanism
by which fisetin exerts cholesterol lowering effect.
2. Materials and methods
2.1. Materials
Fisetin and BCA assay kit were purchased from Sigma–Aldrich (St. Louis, MO,
USA). RNA lysis buffer and RNeasy Lipid Tissue Mini Kit for RNA extraction were
purchased from Qiagen (Hilden, Germany). To perform the semi-quantitative RT-
PCR, oligo-dT and Superscript™ II reverse transcriptase were used (Invitrogen,
Carlsbad, CA). Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum
(FBS), 100,000 units/L of penicillin and 100 mg/L of streptomycin were from Gib-
co-Invitrogen (Grand Island, NY). 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltet-
razolium bromide (MTT) for cell viability assay was purchased from Amresco
(Solon, OH). For immunoblot analysis, protease inhibitor cocktail (Roche Diagnos-
tics, Mannheim, Germany), enhanced chemiluminescence kit (Young In Frontier,

0278-6915/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.fct.2013.03.010
 M.-J. Shin et al. / Food and Chemical Toxicology 57 (2013) 84–90 85

residues were dissolved in 2 mL ethanol. The concentrations of cholesterol in the

hepatic-lipid extracts were measured using the same enzymatic test kits used for
the plasma analysis.

2.4. RNA extraction from animal liver and semi-quantitative RT-PCR

Fig. 1. Chemical structure of fisetin.
Seoul, Korea) and specific antibodies such as LDLR (Cayman, Ann Arbor, MI), SREBP2
(Abcam, Cambridge, MA), HMGCR and b-actin (Santa Cruz Biotechnology, Santa
Cruz, CA) were used.
2.2. Animals and study design
The study was designed to examine the effects of fisetin supplementation on
blood lipid profiles in high fat fed rats. Five weeks old Sprague–Dawley (SD) rats
were used for an experiment of fisetin supplementation in high fat diets. After a
1 week adaptation period, the animals were randomly assigned to one of the three
experimental groups (control: C, n = 8, high fat group: HF, n = 8, and high fat group
with fisetin supplementation: HF + F, n = 8). After randomization, 6 week old rats
were grown for further 8 weeks. The control diet was based on AIN-76 rodent diet
composition (Table 1). Fisetin of the high fat diet was provided at as dose of 10 mg/
kg of body weight. Dosage of fisetin was established based on the previous studies
(Ragelle et al., 2012; Shia et al., 2009). All experimental animals were purchased
from Koatech (Pyungtek, Korea), and were grown in a pathogen-free environment
and housed in a temperature (18–24 °C) and humidity (50–60%) controlled room.
Animals were fed daily, and ad libitum for all three diets. Test diets were stored
at 4 °C. Animal body weight was measured every week. All the experimental proce-
dures applied to the animals were approved by the Committee on Animal Experi-
mentation and Ethics of Korea University.
2.3. Animal blood and liver tissue collection and measurements of biochemical
parameters
Animals were starved for 12 h prior to sacrifice. Blood samples were collected in
EDTA-containing polystyrene via the abdominal inferior vena cava. Plasma was ob-
tained by centrifugation at 3,000 rpm for 30 min at 4 °C and stored at 80 °C, after
which analysis for biochemical parameters, including blood lipid profiles, was car-
ried out. The liver was extracted from each sacrificed rat within 1 min after death,
and the weight of the liver was recorded. Extracted livers were immediately frozen
in liquid nitrogen and stored at 80 °C Plasma cholesterol, LDL cholesterol, and HDL
cholesterol were measured with the commercially available Wako test kits (Wako,
Osaka, Japan) which use enzymatic methods of determination. Hepatic lipids were
extracted using the method developed by Folch et al. (1957), and dried lipid
Liver samples (0.05 g), which were obtained from the animals were homoge-
nized in 0.4 mL of lysis buffer using a Dounce homogenizer. Total RNA from animal
liver was extracted from liver tissue using RNeasy Lipid Tissue Mini Kit according to
the manufacturer’s protocol. The cDNA was synthesized from 1 lg of RNA using oli-
go-dT and Superscript™ II reverse transcriptase. Rat primer sequences tested were
presented in Table 2. The PCR conditions for rat primers were 1 min 30 s at 97 °C,
followed by 30 cycles of 97 °C for 30 s, 54 °C for 30 s and 72 °C for 1 min. The final
extension was done at 72 °C for 15 min. The PCR conditions for human primers
were 15 min at 95 °C, followed by 26 cycles of 95 °C for 30 s, 55 °C for 30 s and
72 °C for 30 s. The final extension was performed at 72 °C for 10 min. Semi-Quanti-
tative RT-PCR and quantification of gene expression were performed by using an
StepOnePlus™ Real-Time PCR System (Applied Biosystems, Grand Island, NY). Val-
ues were expressed in arbitrary units. The mRNA levels were determined by relative
values to that of an endogenous GAPDH gene, and expressed as fold change over the
control.
2.5. Cell culture and MTT assay
Fisetin was purchased from Sigma–Aldrich (St. Louis, MO). Human hepatoma
HepG2 cells from American Type Culture Collection (ATCC, Rockville, MD) were cul-
tured in DMEM supplemented with 10% of heat inactivated FBS containing
100,000 units/L of penicillin and 100 mg/L of streptomycin Gibco-Invitrogen. The
cells were maintained in an incubator with 5% CO2 at 37 °C. A density of 1  106 -
cells was seeded in each well within 6-well culture plates. Fisetin stock solutions
were prepared in DMSO. The cells were serum-starved overnight prior to the addi-
tion of fisetin. Cell viability was determined by measuring the levels of lactate dehy-
drogenase in the incubation media, using a commercially available kit after 24 h of
treatment of MTT according to the manufacturer’s instruction.
2.6. Immunoblot analysis
To obtain total cell extracts, the human hepatoma HepG2 cells (1  106 cells)
were treated with various concentrations of fisetin, harvested, and lysed in a lysis
buffer (40 mM HEPES pH 7.5, 120 mM NaCl, 1 mM EDTA, 1% Triton X-100) contain-
ing a protease inhibitor cocktail. After resting on ice for 30 min, the homogenates
were centrifuged at 14,000 rpm for 1 h at 4 °C, and then the supernatants were col-
lected. To extract total protein from the rat livers, tissue samples of each were
homogenized at 4 °C in a lysis buffer. After resting on ice for 1 h, the tissue homog-
enates were centrifuged at 14,000 rpm for 30 min at 4 °C three times and then at
14,000 rpm for 1 h at 4 °C. The resulting supernatants (total lysates) were used
for immunoblot analysis. Protein concentrations were determined by BCA method.
Immunoblot analysis was performed using specific antibodies for LDLR, SREBP2,
HMGCR and b-actin. The bands were visualized using enhanced chemiluminescence
kit and quantified by densitometry using an AlphaviewÒ software (Alpha Innotech).

Table 1
Composition of experimental diets. Table 2
Primers used for quantitative real-time RT-PCR.
1
Ingredients Groups
Gene Primers Sequences(50 ? 30 ) Annealing
CTL (n = 8) HF (n = 8) HF + F (n = 8) description temperature (°C)
Corn starch 15 15 15 LDLR F CAGCTCTGTGTGAACCTGGA 58
Casein 20 20 20 R TTCTTCAGGTTGGGGATCAG
Sucrose 50 34 33.99 SREBP2 F AGACTTGGTCATGGGGACAG 58
Corn oil 5 3 3 R GGGGAGACATCAGAAGGACA
Mineral mix2 3.5 3.5 3.5 HMGCR F TGCTGCTTTGGCTGTATGTC 58
Vitamin mix3 1 1 1 R TGAGCGTGAACAAGAACCAG
Cellulose 5 5 5 CYP7A1 F CTGCAAGAGAGGGATGAAGG 58
DL-methionine 0.3 0.3 0.3 R ACAGGAGGGTTGTTGACCAG
Choline bitartrate 0.2 0.2 0.2 PCSK9 F CTTGTGTCTAGCCAAAGGTG 58
Lard – 17 17 R TGTAGCAAGTGCTCTCAGGT
Cholesterol – 1 1 FXRa F TATGCAGGGAGAAAACTGAA 58
BHT4 0.001 0.001 0.001 R CTG AAACCCTGGAAGTCTTT
Fisetin – – 10 mg/kg BW GAPDH F TCTGACATGCCGCCTGGAGAA 58
Total (g) 100.001 100.001 100.001 R TGGAGGCCATGTAGGCCATGA
1
CTL: control, n = 8; HF: high fat group, n = 8; HF + F; high fat group with fisetin LDLR, low density lipoprotein receptor; SREBP2, sterol regulatory element binding
supplementation, n = 8. protein 2; HMGCR, 3-hydroxy-3-methylglutaryl-CoA reductase; CYP7A1, cyto-
2
Mineral mix: AIN-76 mineral mix. chrome P450 family 7 subfamily A polypeptide 1; PCSK9, proprotein convertase
3
Vitamin mix: AIN-76 vitamin mix. subtilisin/kexin type 9; FXRa, farnesoid X receptor a; GAPDH, glyceraldehyde-3-
4
BHT: tert-Butyhydeoquinone. phosphate dehydrogenase; F, forward primer; R, reverse primer.
86 M.-J. Shin et al. / Food and Chemical Toxicology 57 (2013) 84–90

2.7. Statistical analysis
Statistical analysis was performed using the SPSS (Statistical Package for the So-
cial Science, SPSS Ins., Chicago, IL). The results were presented as means ± SE and
the differences among the experimental groups were analyzed using a student t-
test (for in vitro experiments) and one-way analysis of variance (ANOVA) with Dun-
can’s multiple range (for animal experiments) with p < 0.05 as the criterion of
significance.
3. Results
3.1. Gain in body weight, and food efficiency ratios
There were significant differences in the body weight gains of
animals fed different diets over the 8 week period (Table 3). How-
ever, fisetin supplementation did not further affect the body
weight of HF-fed rats during the experimental period. Calculated
food efficiency ratio (FER) represents weight gain efficiency based
on the amount of total food intake. FERs were significantly higher
in animals fed high fat diets, both with and without fisetin supple-
mentation (Table 3).
3.2. Blood lipid profiles and hepatic cholesterol content
Eight weeks of high fat diet resulted in abnormal blood lipid
profiles, as shown in Fig. 2. Compared to the control group, animals
on the high fat diet exhibited elevated blood levels of total choles-
terol and LDL-cholesterol, as well as reduced blood levels of HDL-
cholesterol (Fig. 2A-C). When HF group was compared with HF
with fisetin group, there were no significant differences in the ser-
um concentrations of HDL-cholesterol. However, the levels of total
cholesterol and LDL-cholesterol in those being fed a high fat diet
supplemented with fisetin were much reduced when compared
to those without the supplementation. Fisetin supplementation
of the high fat diet was found to significantly decrease hepatic cho-
lesterol (Fig. 2D). These data suggest that fisetin supplementation
can prove to be advantageous in alleviating some of the high

Table 3
Body weight gain, food intake and FER of rats fed experimental diets over 8-week period.

Groups1 CTL HF HF + F
Initial body weight(g) 189.5 ± 3.4 191.4 ± 2.7 190.6 ± 4.3
Final body weight (g) 409.2 ± 10.5a 450.9 ± 11.3b 446.1 ± 9.6b
Cumulative BW gain (g/8 weeks) 219.6 ± 8.6a 259.5 ± 9.7b 255.5 ± 9.7b
Food intake (g/day) 18.4 ± 0.5a 17.7 ± 0.5b 17.3 ± 0.8b
FER2 0.21 ± 0.03a 0.26 ± 0.03b 0.26 ± 0.02b

The values were expressed as means ± SE. Tested by ANOVA with Duncan’s multiple range test. Same lettering indicates no significant
difference between the groups (p < 0.05).
1
CTL: control, n = 8; HF: high fat group, n = 8; HF + F; high fat group with fisetin supplementation, n = 8.
2
FER: food efficiency ratio = Body weight gain for experimental period (g/day)/(Food intake for experimental period (g/day).

Fig. 2. Effects of fisetin supplementation on blood lipid profiles and reduced hepatic cholesterol content. Rats were fed either control diets, high fat diets, or high fat diets
supplemented with fisetin, for 8 weeks. The plasma total cholesterol (A), LDL-cholesterol (B), HDL-cholesterol (C), and hepatic cholesterol content (D) were analyzed. CTL, a
group on control diet; HF, a group on high fat diet, HF + F, a group on high fat diet supplemented with fisetin. The results were expressed as means ± SE of 8 animal plasma and
tissue. Tested by analysis of variance (ANOVA) with Duncan’s multiple range test. Same lettering indicates no significant difference between the groups (p < 0.05).
 M.-J. Shin et al. / Food and Chemical Toxicology 57 (2013) 84–90 87

fat-induced changes of LDL-cholesterol and total cholesterol in the the control group (Fig. 3E). The abundance of HMG-CoA reductase
blood. protein was significantly decreased in both the high fat, and fisetin
supplemented high fat groups when compared to the control group
(Fig. 3F). There was no significant difference in the LDLR and
3.3. Effects of fisetin supplementation on cholesterol metabolism in
HMGCR protein levels between high fat groups with or without
high fat fed rats and HepG2 cells
fisetin (Fig. 3E and F). These findings suggest that fisetin supple-
mentation for 8 weeks did not confer significant changes in expres-
Because fisetin supplementation was found to significantly low-
sion of LDLR, SREBP2, and HMGCR genes in rats on high fat diet.
er the circulating TC and LDL cholesterol levels in the experiment
Due to the lack of fisetin effects on high fat-induced hepatic
described above, we further investigated whether fisetin affects
gene expression in cholesterol metabolism, we attempted to inves-
the expression of genes in cholesterol metabolism of the liver of
tigate the acute effects of fisetin in HepG2 cells of the human hep-
high fat fed rats. The high fat diet was found to significantly de-
atoma cell line. Using concentrations of fisetin which had been
crease hepatic mRNA expressions of LDLR, SREBP-2, and HMGCR
shown not to affect cell viability by MTT assay (Fig. 4A), the HepG2
genes in comparison to the control diet (Fig. 3A–C). When com-
cells were examined for the expression of SREBP2, HMGCR, and
pared to the non-supplemented high fat group, fisetin supplemen-
LDLR genes (Fig. 4B). SREBP2, a major transcription factor in regu-
tation did not further elicit changes in mRNA levels of the same
lating the expression of LDLR and HMGCR genes, was examined for
genes (LDLR, SREBP2, and HMGCR). With regard to PCSK9, which
its expression and processing to a nuclear form of SREBP2, the
is known to be associated with the degradation of LDLR, both high
molecular weight of which is 55 kDa. Fisetin reduced the amount
fat diets (with and without fisetin supplementation) significantly
of full length SREBP2 (125 kDa), and increased levels of a nuclear
decreased hepatic mRNA expressions of PCSK9 in comparison to
form of SRBEP2, with a dose of 2 lM or higher (Fig. 4B). These re-
the control diet (Fig. 3D). Conversely, LDLR protein levels were sig-
sults showed that fisetin treatment increased the processed
nificantly higher in both high fat groups, when compared to that of

Fig. 3. Effect of fisetin supplementation on gene expression related to cholesterol metabolism. The mRNA abundance of hepatic LDL receptor (A), SREBP2 (B), HMGCR (C), and
PCSK9 (D) in rat fed high fat diet with 8 weeks of fisetin supplementation was analyzed by real time RT-PCR. Protein level of hepatic LDL receptor (E), and HMGCR (F) in the
liver of rat fed high fat diet with 8 weeks of fisetin supplementation was analyzed by immunoblotting. The results were expressed as means ± SD of 8 animal tissues. Tested by
analysis of variance (ANOVA) with Duncan’s multiple range test. Same lettering indicates no significant difference between the groups (p < 0.05).
88 M.-J. Shin et al. / Food and Chemical Toxicology 57 (2013) 84–90
Fig. 4. Effect of fisetin on cholesterol metabolism-associated gene expression in
HepG2 cells. (A) The MTT assay was performed using cell lysates obtained from
HepG2 cells that were treated with different concentrations of fisetin for 48 h. The
mean values of two independent experiments are shown in the graph. (B) Protein
levels of LDLR, HMGCR, SREBP2 in HepG2 cells was examined upon 48 h treatment
of various amounts of fisetin.
nuclear form of SREBP2 in a dose dependent manner, while cyto-
solic SREBP2 expressions were correspondingly decreased. No sig-
nificant changes in HMGCR protein levels were observed to have
occurred due to fisetin treatment (Fig. 4B).
3.4. Effects of fisetin supplementation on the bile acid metabolism of
high fat fed rats
To investigate the role of fisetin in bile acid metabolism we
compared the expression levels of CYP7A1 and FXRa among the
HF group, the fisetin-supplemented HF group, and the control
group. The HF diet dramatically increased the transcript levels of
CYP7A1 compared to those on the control diet (Fig. 5A). Changes
in transcript levels of CYP7A1 were reversed to the levels of the
control diet through supplementation of fisetin (Fig. 5A). In the
case of FXRa mRNA levels, fisetin slightly enhanced hepatic FXRa
gene expressions in comparison to the control and HF groups,
although it did not reach statistical significance at a 95% confidence
level (Fig. 5B).
4. Discussion
In the present study, we tested whether fisetin influences cho-
lesterol metabolism in high fat fed rats, and also investigated the
Fig. 5. Effect of fisetin supplementation on hepatic CYP7A1 and FXRa. The mRNA
abundance of hepatic CYP7A1 (A) and FXRa (B) in rat fed high fat diet with 8 weeks
of fisetin supplementation was analyzed by real time RT-PCR. The results were
expressed as means ± SD of 8 animal tissues. Tested by analysis of variance
(ANOVA) with Duncan’s multiple range test. Same lettering indicates no significant
difference between the groups (p < 0.05).
underlying mechanism by which fisetin displays hypocholestero-
lemic effects. We found that fisetin supplementation significantly
decreased total cholesterol and LDL-cholesterol in blood, as well
as hepatic TC contents in high fat fed rats.
In order to uncover the mechanism of the metabolic effect of
fisetin, we first hypothesized that fisetin acts on lipid metabolism
by affecting cellular cholesterol homeostasis, which involves the
alterations in SREBP and SRE-regulated gene expressions. SREBP2,
a key transcription factor for cholesterol metabolism, regulates
expression of LDL receptor (LDLR), HMG-CoA reductase (HMGCR),
and its own SREBP gene (Horton et al., 2002). We observed a signif-
icant decrease in SREBP2 and its target genes, including HMGCR
and LDLR in high fat-fed rats. The reduction of SREBP2 gene expres-
sion may be due to a negative feedback mechanism of SREBP2 in
response to an increase in intracellular cholesterol, which is likely
to originate from elevated blood cholesterols induced by a high fat
diet. This idea is supported by the observation of increased hepatic
cholesterol content in the high fat group when compared to that of
the to the control group. Fisetin supplementation of the high fat
diet did not elicit any change in SREBP2, HMGCR, or LDLR genes
when compared to the high fat group. Although fisetin failed to eli-
cit changes in the expressions of these genes in cholesterol metab-
olism, fisetin supplementation successfully lowered blood
cholesterol levels as well as hepatic cholesterol contents when
compared to the high fat group. Therefore, it is possible that the
cholesterol lowering effects of fisetin in a high fat diet might be
achieved without affecting high fat-induced changes in mRNA lev-
els of these genes in cholesterol metabolism.
 M.-J. Shin et al. / Food and Chemical Toxicology 57 (2013) 84–90
When the protein expression levels of HMGCR and LDLR genes
were examined, it was noticed that there was a discernable change
in the protein levels of LDLR genes. As expected from the mRNA
change shown in HMGCR, we also observed a significant reduction
of protein levels of HMGCR genes in high fat group. However, in the
case of LDLR genes, the high fat group demonstrated upregulation
of protein levels of LDLR, which is opposite to what we observed in
the mRNA levels of the same gene. The mechanism explaining this
discrepancy is still unclear, but the involvement of PCSK9 in the
regulation of LDLR protein levels has newly been proposed. PCSK9
is a serine protease mainly expressed in the liver and the intestine,
which acts by reducing the amount of LDLR in hepatocytes (Akram
et al., 2010). PCSK9 binds LDLR on the cell surface, and is subse-
quently taken up together with the LDLR, thus promoting the deg-
radation of the receptor in the lysosome (Zhang et al., 2007). It has
been shown that the ingestion of higher levels of cholesterol de-
creases the production of hepatic PCSK9 (Jeong et al., 2008), which
can lead to the up-regulation of LDLR protein levels. In our data, it
was observed that a high fat diet significantly decreased mRNA lev-
els of PCSK9 in the liver, although fisetin supplementation did not
further reduced mRNA levels of PCSK9. This may provide an expla-
nation as to why LDLR protein levels are high in high fat group,
even if there are low mRNA levels of LDLR. Since PCSK9 expression
was slightly lower in the fisetin group in comparison to the high fat
group, it could mean that fisetin was relatively inactive in down-
regulating LDLR proteins, possibly narrowing any difference in pro-
tein levels of LDLR genes between high fat group with, and without
fisetin supplementation. Other researchers have also reported sim-
ilar discrepancies between the protein levels and gene expression
of LDLR under different situations, either by hormonal regulation
or through the feeding of tailored diets (Rudling and Angelin,
1993; Persson et al., 2009). Specifically, feeding rats cholesterol
stimulates hepatic LDLR protein expression in contrast to reduc-
tions in LDLR mRNA levels by high cholesterol feeding (Persson
et al., 2009; Lee et al., 2012).
In order to further investigate whether fisetin directly influ-
ences the expression of cholesterol-related genes, including
SREBP2, HMGCR, and LDLR, we utilized hepatoma cell lines. After
48 h treatment with fisetin, we noticed that a nuclear form of
SREBP2 increases with increasing concentrations of fisetin, indicat-
ing that fisetin increased a transcriptional activity of SREBP2 via
increasing the processing of SREBP2. Fisetin of 2 lM was sufficient
to generate a nuclear form of SREBP2, and the subsequent increase
in LDLR expression. On the other hand, fisetin could directly affect
the stability of LDLR protein through down-regulation of PCSK9
expression, as suggested by in vivo findings of fisetin. Thus, fise-
tin-induced expression of LDLR protein could be both in SREBP-
dependent and -independent pathways. Our in vitro findings
clearly indicate that fisetin, which was not able to further increase
in LDLR protein levels in vivo, did increase LDLR protein levels
in vitro, and consequently lowered blood cholesterol levels.
Regardless of the similar LDLR expression levels between high
fat groups with and without fisetin supplementation, fisetin low-
ered blood cholesterol levels and hepatic cholesterol contents, as
compared to high fat group. Therefore, fisetin might efficiently re-
move cholesterol from hepatic tissue through the efficient removal
of cholesterol by promotion of the production of bile acids. Choles-
terol removal from the body is achieved by excretion of bile acid
synthesized from hepatic cholesterol, which contributes to choles-
terol homeostasis (Gilardi et al., 2007). Recent studies have shown
that bile acids not only serve as facilitators for absorption and
transport of dietary fats, but also are the signaling molecules that
activate nuclear receptors, and regulate bile acid and cholesterol
metabolism (Chiang, 2002). We used expression levels of CYP7A1
as an indirect indicator of bile acid production in the liver tissue.
CYP7A1 is the rate-limiting enzyme involved in the synthesis of
89
bile acid from cholesterol. Its expression level is repressed by FXRa
when levels of bile acids are high (Sanyal et al., 2007). Bile acids are
the endogenous ligands for FXRa, which are involved in the regu-
lation of bile acid metabolism (Makishima et al., 1999). In addition,
CYP7A1 is known to be down-regulated by SREBP, the levels of
which increase when intracellular cholesterol levels are low (Ponu-
goti et al., 2007). Based on these facts, the elevated protein levels of
CYP7A1 in high fat fed rats could be due to high intracellular cho-
lesterol contents, and thereby be activated by the reduced levels of
inhibitory SREBP2 as indicated by a reduced mRNA levels of
SREBP2. In contrast, down-regulation of CYP7A1 by fisetin might
indicate that fisetin initiated the generation of bile acids to a great-
er extent from HF diet. Bile acids are the most potent physiological
inhibitors of CYP7A1 (Gilardi et al., 2007), and they inhibit CYP7A1
transcription and reduce CYP7A1 mRNA stability (Chiang, 2009).
Increased production of bile acids as a result of fisetin supplemen-
tation could effectively force intracellular cholesterol out of the
hepatocytes, which is evident from the observation of low hepatic
cholesterol contents in the fisetin supplemented group. Our results
showed that fisetin slightly enhanced FXRa gene expression, indi-
cating that increased FXRa expression might further result in
down-regulation of CYP7A1 transcription. Taken together, fisetin-
driven reductions in hepatic cholesterol content can lower circulat-
ing LDL-cholesterol, and might participate in the prevention or
amelioration of atherosclerosis and cardiovascular disease. The
modulations of gene expression involved in cholesterol and bile
acid metabolism can explain this mechanism of the hypocholeste-
rolemic effect of fisetin. It may involve the regulation of SREBP in
the induction of SRE-regulated genes, and enhanced bile acid syn-
thesis and hepatic cholesterol elimination, of which the net effect
is to decrease circulating LDL-cholesterol levels.
In conclusion, daily fisetin supplementation in high fat fed rats
exhibited hypocholesterolemic effects, providing the novel infor-
mation that fisetin exerts preventative effect against cardiovascu-
lar risk. In addition, the results raise the possibility that fisetin
may be used as a single supplement, or in combination with other
therapeutic agents, in the prevention and/or treatment of
hypercholesterolemia.
Conflict of Interest
The authors declare that there are no conflicts of interest.
Acknowledgments
This research was supported by Basic Science Research Program
through the National research Foundation of Korea (NRF) funded
by the Ministry of Education, Science and Technology (2012-
0002119).
References
Akram, O.N., Bernier, A., Petrides, F., Wong, G., Lambert, G., 2010. Beyond LDL
cholesterol, a new role for PCSK9. Arterioscler. Thromb. Vasc. Biol. 30, 1279–
1281.
Basu, A., Wilkinson, M., Penugonda, K., Simmons, B., Betts, N.M., Lyons, T.J., 2009.
Freezedried strawberry powder improves lipid profile and lipid peroxidation in
women with metabolic syndrome: baseline and post intervention effects. Nutr.
J. 8, 43–49.
Basu, A., Fu, D.X., Wilkinson, M., Simmons, B., Wu, M., Betts, N.M., Du, M., Lyons, T.J.,
2010. Strawberries decrease atherosclerotic markers in subjects with metabolic
syndrome. Nutr. Res. 30, 462–469.
Chiang, J.Y., 2002. Bile acid regulation of gene expression: roles of nuclear hormone
receptors. Endocr. Rev. 23, 443–463.
Chiang, J.Y., 2009. Bile acids: regulation of synthesis. J. Lipid Res. 50, 1955–1966.
Constantin, R.P., Constantin, J., Pagadigorria, C.L., Ishii-Iwamoto, E.L., Bracht, A., Ono
Mde, K., Yamamoto, N.S., 2010. The actions of fisetin on glucose metabolism in
the rat liver. Cell Biochem. Funct. 28, 149–158.
Edirisinghe, I., Banaszewski, K., Cappozzo, J., Sandhya, K., Ellis, C.L., Tadapaneni, R.,
Kappagoda, C.T., Burton-Freeman, B.M., 2011. Strawberry anthocyanin and its
90 M.-J. Shin et al. / Food and Chemical Toxicology 57 (2013) 84–90
association with postprandial inflammation and insulin. Br. J. Nutr. 106, 913–
922.
Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A simple method for the isolation and
purification of total lipides from animal tissues. J. Biol. Chem. 226, 497–509.
Geleijnse, J.M., Launer, L.J., Van der Kuip, D.A., Hofman, A., Witteman, J.C., 2002.
Inverse association of tea and flavonoid intakes with incident myocardial
infarction: the Rotterdam Study. Am. J. Clin. Nutr. 75, 880–886.
Gilardi, F., Mitro, N., Godio, C., Scotti, E., Caruso, D., Crestani, M., De Fabiani, E., 2007.
The pharmacological exploitation of cholesterol 7alpha-hydroxylase, the key
enzyme in bile acid synthesis: from binding resins to chromatin remodelling to
reduce plasma cholesterol. Pharmacol. Ther. 116, 449–472.
Halliwell, B., 1994. Free radicals, antioxidants, and human disease: curiosity, cause,
or consequences? Lancet 344, 721–724.
Hannum, S.M., 2004. Potential impact of strawberries on human health: a review of
the science. Crit. Rev. Food Sci. Nutr. 44, 1–17.
Hertog, M.G., Feskens, E.J., Kromhout, D., 1997. Antioxidant flavonols and coronary
heart disease risk. Lancet 349, 699.
Horton, J.D., Goldstein, J.L., Brown, M.S., 2002. SREBPs: activators of the complete
program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109,
1125–1131.
Jenkins, D.J., Nguyen, T.H., Kendall, C.W., Faulkner, D.A., Bashyam, B., Kim, I.J.,
Ireland, C., Patel, D., Vidgen, E., Josse, A.R., Sesso, H.D., Burton-Freeman, B., Josse,
R.G., Leiter, L.A., Singer, W., 2008. The effect of strawberries in a cholesterol-
lowering dietary portfolio. Metabolism 57, 1636–1644.
Jeong, H.J., Lee, H.S., Kim, K.S., Kim, Y.K., Yoon, D., Park, S.W., 2008. Sterol-dependent
regulation of proprotein convertase subtilisin/kexin type 9 expression by sterol
regulatory element-binding protein-2. J. Lipid. Res. 49, 399–499.
Kimira, M., Arai, Y., Shimoi, K., Watanabe, S., 1998. Japanese Intake of flavonoids and
isoflavonoids from foods. J. Epidemiol. 8, 168–175.
Lee, K.H., Park, E., Lee, H.J., Kim, M.O., Cha, Y.J., Kim, J.M., Lee, H., Shin, M.J., 2011.
Effects of daily quercetin-rich supplementation on cardiometabolic risks in
male smokers. Nutr. Res. Prac. 5, 28–33.
Lee, S.M., Moon, J., Do, H.J., Chung, J.H., Lee, K.H., Cha, Y.J., Shin, M.J., 2012. Onion
peel extract increases hepatic LDL receptor and ABC transporter A1 mRNA
expressions in high fat fed SD rats. Nutr. Res. 32, 210–217.
Makishima, M., Okamoto, A.Y., Repa, J.J., Tu, H., 1999. Identification of a nuclear
receptor for bile acids. Science 284, 1362–1365.
O’Byrne, D.J., Devaraj, S., Grundy, S.M., Jialal, I., 2002. Comparison of the antioxidant
effects of concord grape juice flavonoids alpha-tocopherol on markers of
oxidative stress in healthy adults. Am. J. Clin. Nutr. 76, 1367–1374.
Persson, L., Galman, C., Angelin, B., Rudling, M., 2009. Importance of proprotein
convertase subtilisin/kexin type 9 in the hormonal and dietary regulation of rat
liver low-density lipoprotein receptors. Endocrinology. 150, 1140–1146.
Ponugoti, B., Fang, S., Kemper, J.K., 2007. Functional interaction of hepatic nuclear
factor-4 and peroxisome proliferator-activated receptor-gamma coactivator
1alpha in CYP7A1 regulation is inhibited by a key lipogenic activator, sterol
regulatory element-binding protein-1c. Mol. Endocrinol. 21, 2698–2712.
Prasath, G.S., Subramanian, S.P., 2011a. Fisetin, a bioflavonoid ameliorates
hyperglycemia in STZ induced experimental diabetes in rats. Int. J. Pharm. Sci.
Rev. Res. 6, 68–74.
Prasath, G.S., Subramanian, S.P., 2011b. Modulatory effects of fisetin, a bioflavonoid,
on hyperglycemia by attenuating the key enzymes of carbohydrate metabolism
in hepatic and renal tissues in streptozotocin-induced diabetic rats. Eur. J.
Pharmacol. 668, 492–496.
Prior, R.L., Wu, X., Gu, L., Hager, T.J., Hager, A., Howard, L.R., 2008. Whole berries
versus berry anthocyanins: interactions with dietary fat levels in the C57BL/6J
mouse model of obesity. J. Agric. Food Chem. 56, 647–653.
Ragelle, H., Crauste-Manciet, S., Seguin, J., Brossard, D., Scherman, D., Arnaud, P.,
Chabot, G.G., 2012. Nanoemulsion formulation of fisetin improves
bioavailability and antitumour activity in mice. Int. J. Pharm. 427, 452–459.
Rudling, M., Angelin, B., 1993. Stimulation of rat hepatic low density lipoprotein
receptors by glucagon. Evidence of a novel regulatory mechanism in vivo. J. Clin.
Invest. 91, 2796–2805.
Sanyal, S., Båvner, A., Haroniti, A., Nilsson, L.M., Lundåsen, T., Rehnmark, S., Witt,
M.R., Einarsson, C., Talianidis, I., Gustafsson, J.A., Treuter, E., 2007. Involvement
of corepressor complex subunit GPS2 in transcriptional pathways governing
human bile acid biosynthesis. Proc. Natl. Acad. Sci. USA 104, 15665–15670.
Shia, C.S., Tsai, S.Y., Kuo, S.C., Hou, Y.C., Chao, P.D., 2009. Metabolism and
pharmacokinetics of 3,3’,4’,7-tetrahydroxyflavone (fisetin), 5-hydroxyflavone,
and 7-hydroxyflavone and antihemolysis effects of fisetin and its serum
metabolites. J. Agric. Food. Chem. 57, 83–89.
Tsuda, T., Ueno, Y., Aoki, H., Koda, T., Horio, F., Takahashi, N., Kawada, T., Osawa, T.,
2004. Anthocyanin enhances adipocytokine secretion and adipocyte-specific
gene expression in isolated rat adipocytes. Biochem. Biophys. Res. Commun.
316, 149–157.
Wang, H., Cao, G., Prior, R.L., 1996. Total antioxidant capacity of fruits. J. Agric. Food
Chem. 44, 701–705.
Zhang, D.W., Lagace, T.A., Garuti, R., Zhao, Z., McDonald, M., Horton, J.D., Cohen, J.C.,
Hobbs, H.H., 2007. Binding of proprotein convertase subtilisin/kexin type 9 to
epidermal growth factor-like repeat A of low density lipoprotein receptor
decreases receptor recycling and increases degradation. J. Biol. Chem. 2007
(282), 18602–18612.
Zunino, S.J., Parelman, M.A., Freytag, T.L., Stephensen, C.B., Kelley, D.S., Mackey, B.E.,
Woodhouse, L.R., Bonnel, E.L., 2011. Effects of dietary strawberry powder on
blood lipids and inflammatory markers in obese human subjects. Br. J. Nutr. 9,
1–10.