FACULTAD DE MEDICINA

DEPARTAMENTO DE BIOQUÍMICA

DOCTORADO EN BIOCIENCIAS MOLECULARES

EXPLORING THE ROLE OF NUCLEOLAR

STRESS IN AGEING AND
NEURODEGENERATION

DOCTORAL THESIS

OLEKSANDRA SIROZH
MADRID, 2022
 UNIVERSIDAD AUTÓNOMA DE MADRID

FACULTAD DE MEDICINA

DEPARTAMENTO DE BIOQUÍMICA

EXPLORING THE ROLE OF NUCLEOLAR

STRESS IN AGEING AND
NEURODEGENERATION

OLEKSANDRA SIROZH

BSc, BIOTECHNOLOGY

MSc, BIOMOLECULES AND CELLULAR DYNAMICS

The work presented in this Doctoral Thesis has been carried out at the Genomic Instability Group in the Spanish
National Cancer Research Centre (CNIO, Madrid), under the direction and supervision of Dr. Óscar Fernández-
Capetillo Ruiz.

Madrid, 2022

1
March 17 th 2022

To whom it might concern:

Dr. Óscar Fernández-Capetillo Ruiz, head of the Genomic Instability Group at the Spanish National Cancer
Research Centre (CNIO) and Professor of Cancer Therapy at the Department of Medical Biochemistry and
Biophysics (Karolinska Institutet), certifies that the Doctoral Thesis entitled: “Overcoming multi-drug resistance
in FBXW7-deficient tumours”, developed by Laura Sánchez Burgos, BSc, MSc, meets all the requirements to
obtain the PhD (Doctor of Philosophy) degree in Molecular Biology and that it will be defended at the Universidad
Autónoma de Madrid with the aforementioned objective. This Thesis has been carried out under my direction
and I authorise its presentation to the Tribunal

Dr. Óscar Fernández-Capetillo Ruiz

PhD Thesis Director

Deputy Director
Genomic Instability Group
Spanish National Cancer Research Centre (CNIO)
C/Melchor Fernández Almagro, 3
28029 Madrid
Spain

Professor of Cancer Therapy

Department of Medical Biochemistry and Biophysics
Karolinska Institutet
Solnavägen, 1
17177 Stockholm
Sweden

2
 "The Answer to the Great Question..."
"Yes..!"
"Of Life, the Universe and Everything..." said Deep Thought.
"Yes...!"
"Is..." said Deep Thought, and paused.
"Yes...!"
"Is..."
"Yes...!!!...?"
"Forty-two," said Deep Thought, with infinite majesty and calm.

[…]

“I think the problem, to be quite honest with you,

is that you’ve never actually known what the question is.”

Douglas Adams, “The Hitchhiker’s Guide to the Galaxy”

3
INDEX

ABSTRACT ............................................................................................................................................................. 9
RESUMEN............................................................................................................................................................. 11
ABBREVIATIONS .................................................................................................................................................. 13

INTRODUCTION ................................................................................................................................................... 17
1. AMYOTROPHIC LATERAL SCLEROSIS ............................................................................................................. 18
1.1 GENETICS OF ALS ...................................................................................................................................... 18
1.1.1 The genetic landscape in ALS.............................................................................................................. 18
1.1.2 Discovery of ALS-causing mutations ................................................................................................... 19
1.2 ALS DISEASE MECHANISMS ...................................................................................................................... 20
1.2.1 Disease cascade of ALS ...................................................................................................................... 20
1.2.2 RBP mislocalisation and defective RNA metabolism .......................................................................... 21
1.2.3 Perturbed proteostasis ........................................................................................................................ 21
1.2.4 Aberrant nucleocytoplasmic transport ................................................................................................ 22
1.2.5 Axonal transport defects ..................................................................................................................... 22
1.2.6 Oxidative stress and mitochondrial dysfunction ................................................................................. 22
1.2.7 Impairment of the DNA damage response .......................................................................................... 23
1.2.8 Excitotoxicity........................................................................................................................................ 23
1.2.9 Prion-like propagation .......................................................................................................................... 23
1.2.10 Neuroinflammation and accessory cell involvement ......................................................................... 23
1.3 C9ORF72 MUTATION IN ALS...................................................................................................................... 23
1.3.1 Three hypotheses for cell death .......................................................................................................... 23
1.3.2 DPRs in ALS patients ........................................................................................................................... 24
1.4 MECHANISMS OF CELL DEATH BY ARGININE-RICH PEPTIDES IN ALS .................................................... 25
1.4.1 Defects in ribosome biogenesis and translation ................................................................................. 25
1.4.2 Perturbation of membrane-less organelles. ........................................................................................ 25
1.4.3 RNA processing, splicing and modification defects ............................................................................ 26
1.4.4 Nucleocytoplasmic transport disruption ............................................................................................. 26
1.4.5 Cytoskeletal defects ............................................................................................................................ 27
1.4.6 Chromatin dysfunction ........................................................................................................................ 27
1.5 ARGININE-RICH PEPTIDES OUTSIDE ALS .................................................................................................. 27
1.5.1 Cell penetrating peptides ..................................................................................................................... 27
1.5.2 RGG/RG motifs .................................................................................................................................... 28
2. THE NUCLEOLUS ............................................................................................................................................. 28
2.1 RIBOSOME BIOGENESIS ............................................................................................................................. 29
2.2 NUCLEOLAR STRUCTURE .......................................................................................................................... 30
2.2.1 The tripartide model............................................................................................................................. 30

4
 2.2.2 Liquid-liquid phase separation in nucleolar structure .......................................................................... 30
2.2.3 The nucleolus in steady-state flux ........................................................................................................... 31
2.3 NUCLEOLAR STRESS.................................................................................................................................. 31
2.3.1 The nucleolus under stress.................................................................................................................. 31
2.3.2 The morphology of nucleolar stress .................................................................................................... 32
3. THE NUCLEOLUS, TRANSLATION & C9-ALS/FTD ............................................................................................ 33
3.1 NUCLEOLAR STRUCTURE AND DPRs......................................................................................................... 33
3.2 RIBOSOME BIOGENESIS AND DPRs ........................................................................................................... 33
3.3 PROTEIN SYNTHESIS AND DPRs ............................................................................................................... 33
3.4 NUCLEOLAR LLPS AND DPRs .................................................................................................................... 34
4. THE NUCLEOLUS & AGEING ............................................................................................................................ 34
5.1 THE rDNA LOCUS ....................................................................................................................................... 34
5.2 NUCLEOLAR ACTIVITY ............................................................................................................................... 34
5.3 TRANSLATION ............................................................................................................................................ 35
5.4 NUCLEOLAR REGULATION & SIGNALLING ................................................................................................ 36
5.4.1 mTOR ................................................................................................................................................... 36
5.4.2 MYC ..................................................................................................................................................... 37
5.5 NUCLEOLAR STRESS.................................................................................................................................. 38

OBJECTIVES ........................................................................................................................................................ 39

MATERIALS AND METHODS ................................................................................................................................ 41

CELL BIOLOGY ..................................................................................................................................................... 42
1.1 CELL CULTURE ........................................................................................................................................... 42
1.2 TOOL CELL LINE GENERATION .................................................................................................................. 42
1.3 MOTOR NEURON DIFFERENTIATION ......................................................................................................... 42
1.4 TREATMENTS............................................................................................................................................. 43
1.5 siRNA TRANSFECTION ............................................................................................................................... 43
1.6 CELL VIABILITY .......................................................................................................................................... 43
1.7 CLONOGENIC ASSAYS ............................................................................................................................... 44
1.8 IMMUNOFLUORESCENCE AND HIGH THROUGHPUT MICROSCOPY......................................................... 44
1.9 PEPTIDE LABELLING .................................................................................................................................. 46
1.10 IN SITU HYBRIDIZATION .......................................................................................................................... 46
1.11 CRISPR/CAS9 EFFICIENCY....................................................................................................................... 46
1.12 VIRAL INFECTION ..................................................................................................................................... 46
1.13 HALO PULSE-CHASE ................................................................................................................................ 46
MOLECULAR BIOLOGY......................................................................................................................................... 46
2.1 WESTERN BLOT ......................................................................................................................................... 46
2.2 IMMUNOPRECIPITATION ........................................................................................................................... 47

5
 2.3 CHROMATIN FRACTIONATION .................................................................................................................. 47
2.4 ISOLATION OF RNA-BINDING PROTEINS ................................................................................................... 47
2.5 POLYSOME ANALYSES .............................................................................................................................. 47
2.6 MASS SPECTROMETRY ............................................................................................................................. 47
2.7 SUCROSE GRADIENT MASS SPECTROMETRY ........................................................................................... 48
2.8 IN VITRO RIBOSOME ASSEMBLY................................................................................................................ 48
2.9 ELECTRON MICROSCOPY .......................................................................................................................... 48
2.10 IN VITRO TRANSLATION .......................................................................................................................... 48
2.11 RNA EXTRACTION FROM TISSUE AND RNASEQ ..................................................................................... 49
2.12 qRT-PCR ................................................................................................................................................... 49
2.13 RNA DEGRADATION ASSAY ..................................................................................................................... 49
2.14 REVERSE TRANSCRIPTION ...................................................................................................................... 49
2.15 SPLICING .................................................................................................................................................. 49
2.16 EMSA ........................................................................................................................................................ 49
2.17 dNTP BINDING ......................................................................................................................................... 50
2.18 PHOSPHATASE ASSAY ............................................................................................................................ 50
MOUSE BIOLOGY ................................................................................................................................................. 50
3.1 GENERATION OF MOUSE LINES................................................................................................................. 50
3.2 GENOTYPING ............................................................................................................................................. 50
3.3 TREATMENTS............................................................................................................................................. 50
3.4 IMAGING ..................................................................................................................................................... 51
3.5 IMMUNOHISTOCHEMISTRY AND IN VIVO IMMUNOFLUORESCENCE ....................................................... 51
BIOINFORMATICS AND DATA ANALYSIS ............................................................................................................ 51
4.1 PROTEOMICS ANALYSIS ............................................................................................................................ 51
4.2 RNASEQ ANALYSIS .................................................................................................................................... 51
4.3 CMAP.......................................................................................................................................................... 52
4.4 DRUG SET ENRICHMENT ANALYSIS (DSEA) ............................................................................................. 52
4.5 NEUROLINCS RNASEQ ANALYSIS.............................................................................................................. 52
4.6 DATA AVAILABILITY ................................................................................................................................... 52

RESULTS .............................................................................................................................................................. 53
ELUCIDATION OF THE MECHANISM OF CELL DEATH BY ARGININE-RICH POLY(PR) PEPTIDES....................... 54
1.1 The effect of (PR)20 peptides on ribosomes ........................................................................................ 54
1.2 DPRs inhibit RNA and DNA-based reactions ....................................................................................... 56
1.3 Protamine recapitulates the effects of ALS-associated arginine-rich peptides ......................................... 61
1.4 Exposure to arginine-rich (PR)20 peptides and protamine leads to a generalised displacement of proteins
from mRNA and chromatin .............................................................................................................................. 63
1.5 Competitive binding with non-coding oligonucleotides, or with heparin, rescues the toxicity of arginine-rich
peptides ............................................................................................................................................................ 65
1.6 Expression of (PR)97 causes nucleolar stress and accumulation of free ribosomal proteins .................... 68

6
STRATEGIES TO OVERCOME POLY(PR) PEPTIDE TOXICITY .............................................................................. 70
2.1 NSC34 cells resistant to (PR) 20 peptides show downregulated translation and ribosome biogenesis ...... 70
2.2 mTOR inhibition protects against poly(PR) toxicity .................................................................................... 72
2.1 MYC down-regulation protects against poly(PR) toxicity .................................................................... 75
TESTING THE EFFECT OF POLY(PR) PEPTIDES IN VIVO ..................................................................................... 76
3.1 An in vivo model of poly(PR) toxicity shows a lethal premature ageing phenotype ................................... 77
3.2 Poly(PR)-expressing animals have up-regulated mTOR and MYC hallmarks ............................................. 79
3.3 C9-ALS patients have up-regulated mTOR and MYC hallmarks ................................................................. 80
3.4 Poly(PR) inducible mice have increased ribosomal protein levels, activated mTOR, and nucleolar stress 82
3.5 Inhibition of mTOR rescues viability in poly(PR) expressing mice ............................................................. 84

DISCUSSION......................................................................................................................................................... 87
INSIGHTS INTO THE MECHANISM OF CELL DEATH BY ARGININE-RICH PEPTIDES .......................................... 88
1.1 ARGININE-RICH PEPTIDES PROMISCUOUSLY BIND TO NUCLEIC ACIDS .................................................. 88
1.2 ARGININE-RICH PEPTIDES IN PHASE SEPARATION OF MEMBRANE-LESS ORGANELLES ....................... 89
1.3 ARGININE-RICH PEPTIDES AND RNA-BINDING PROTEIN AGGREGATION ................................................ 90
1.4 ARGININE-RICH PEPTIDES AND CHROMATIN ........................................................................................... 90
1.5 ARGININE-RICH PEPTIDES CAN BIND NUCLEOTIDES ............................................................................... 90
1.6 NUCLEOLAR STRESS AS A DRIVER OF CELL DEATH BY ARGININE-RICH PEPTIDES ................................ 91
1.6.1 Nucleolar stress or nucleolus under stress?........................................................................................ 91
1.6.2 Nucleolar stress as stoichiometric imbalance .................................................................................... 92
STRATEGIES TO OVERCOME POLY(PR) TOXICITY.............................................................................................. 94
2.1 REPRESSION OF NUCLEOLAR ACTIVITY TO OVERCOME NUCLEOLAR STRESS ....................................... 94
2.1.1 Activation of ribosome biogenesis in response to poly(PR) peptides ................................................. 94
2.1.2 Inhibition of mTOR to rescue poly(PR) toxicity .................................................................................... 95
2.1.3 Inhibition of MYC to rescue poly(PR) toxicity ...................................................................................... 96
2.1.4 Spontaneous resistance for therapeutic target discovery ................................................................... 96
2.2 POLYANIONS TO OVERCOME POLY(PR) TOXICITY ................................................................................... 97
THE NUCLEOLUS IN AGEING AND NEURODEGENERATION ................................................................................ 97
3.1 NUCLEOLAR ACTIVITY IN PROGERIA & AGEING........................................................................................ 97
3.2 PROTEOSTATIC COLLAPSE THEORY OF AGEING...................................................................................... 98
3.3 CONTRIBUTION OF POLY(PR) PEPTIDES TO AGEING ............................................................................. 100
3.3.1 Proteostasis imbalance ..................................................................................................................... 100
3.3.2 Poor protein quality............................................................................................................................ 100
3.3.3 Oxidative stress ................................................................................................................................. 100
3.3.4 Chaperone saturation ........................................................................................................................ 101
3.3.5 Stem cell depletion ............................................................................................................................ 101
3.4 REINTERPRETATION OF ALS THROUGH AGEING THEORY ..................................................................... 101
3.4.1 Why do RNA binding proteins cause ALS?......................................................................................... 101

7
 3.4.2 Why does RNA binding protein aggregation occur?........................................................................... 102
3.4.3 What is the role of molecular chaperones? ....................................................................................... 103
3.4.4 What is the contribution of protein degradation? .............................................................................. 103
3.4.5 What is the role of oxidative stress? .................................................................................................. 103
THE ROLE OF ARGININE-RICH PEPTIDES IN ALS PATHOGENESIS ................................................................... 104
4.1 ARGININE-RICH DIPEPTIDE REPEATS AT THE SOURCE OF THE DISEASE CASCADE ............................. 104
4.2 POST-MORTEM CONTROVERSY: ARE ARGININE-RICH PEPTIDES RELEVANT? ...................................... 105
4.3 ANTI-AGEING THERAPIES AS A TREATMENT FOR ALS .......................................................................... 105

CONCLUSIONS ................................................................................................................................................... 108

ANNEXES ........................................................................................................................................................... 111

ANNEX 1 ......................................................................................................................................................... 114
ANNEX 2 ......................................................................................................................................................... 114
ANNEX 3 ......................................................................................................................................................... 116
ANNEX 4 ......................................................................................................................................................... 124
ANNEX 5 ......................................................................................................................................................... 127
ANNEX 6 ......................................................................................................................................................... 128
ANNEX 7 ......................................................................................................................................................... 129
ANNEX 8 ......................................................................................................................................................... 130
ANNEX 9 ......................................................................................................................................................... 130

REFERENCES ..................................................................................................................................................... 134

8
ABSTRACT

9
Amyotrophic lateral sclerosis (ALS) is a deadly neurodegenerative disease with no cure, characterised by the
progressive death of spinal motor neurons and subsequent paralysis. A hexanucleotide repeat expansion (HRE)
in an intronic region of C9ORF72 is the most common known cause of familial ALS in European populations. By
an unconventional form of ATG-independent translation, HRE RNA gives rise to a series of dipeptide repeats
(DPRs) out of which two, poly(PR) and poly(GR), are toxic. These arginine-rich peptides were shown to
accumulate at nucleoli, repress ribosome biogenesis, and drive multiple disturbances in almost all aspects of
RNA and nucleolar metabolism. However, the precise mechanism of their toxicity, and whether it could be
chemically or genetically alleviated remained unknown.

During the first part of this thesis we focused on resolving the mechanism to explain the pleiotropic pathological
effects driven by arginine-rich DPRs. Our work revealed that this is due to a generalised DPR coating of DNA and
RNA, which leads to protein displacement from nucleic acids, and thus to widespread inhibition of all reactions
using nucleic acid substrates. As such, we propose that cell death is the result of inhibition of multiple processes,
the most prominent of which being ribosome biogenesis and translation, as well as the collective displacement
of RNA-binding proteins (RBPs) and ribosomal proteins (r-proteins) from RNA.

Next, and to evaluate the effects of arginine-rich DPRs in vivo, we developed a novel mouse model that enables
tissue-wide inducible expression of ninety-seven copies of PR. Systemic expression of the peptide led to a lethal
premature ageing phenotype within 3 months. Molecular and cellular biology analyses revealed that this
progeroid phenotype was associated to an accumulation of nucleolar stress and free r-proteins, suggesting that
the pathology is reminiscent to a class of diseases known as ribosomopathies. Supporting this view, DPR toxicity
in vitro is ameliorated by the mTOR inhibitor rapamycin, or by downregulation of MYC, both of which are known
to reduce overall translation and to extend lifespan in mammals. Importantly, and similarly to what has been
seen in ribosomopathies, rapamycin extends the survival of (PR) 97 mice.

Altogether, our work has revealed the mechanism of toxicity driven by arginine-rich DPRs, provided a new mouse
model which can be used as a preclinical tool for research in the field, revealed that the pathology driven by
poly(PR) DPRs is reminiscent of ribosomopathies, and identified some initial therapies that can reduce the
severity of these diseases.

10
RESUMEN

11
La esclerosis lateral amiotrófica (ELA) es una enfermedad neurodegenerativa letal sin cura, caracterizada por la
muerte progresiva de las motoneuronas de la médula espinal, y la subsecuente parálisis. La causa más común
de ELA familiar en poblaciones europeas es una expansión de repeticiones de hexanucleótidos (ERH) en el
primer intrón del gen C9ORF72. El ARN de las ERH genera una serie de productos peptídicos compuestos por
repeticiones de polidipéptidos (RPD), mediante traducción independiente de ATG, de los cuales dos, poli(PR) y
poli(GR), son tóxicos. Se ha demostrado que estos péptidos se acumulan en nucleolos, reprimen la biogénesis
ribosomal, y promueven múltiples perturbaciones en casi todos los aspectos del metabolismo de ARN y del
nucleolo. Sin embargo, el mecanismo concreto de su toxicidad se desconocía, así como la posibilidad de
mitigarla química o genéticamente.

La primera parte de esta tesis se enfoca en resolver el mecanismo, y explicar la pleiotropía de los efectos
patológicos de los RDPs ricos en argininas. Nuestro trabajo ha descubierto que la muerte celular se debe a un
recubrimiento generalizado de ADN y ARN, que provoca el desplazamiento de proteínas de unión de los ácidos
nucleicos y, por lo tanto, una inhibición de todas las reacciones basadas en sustratos ácidos nucleicos.
Proponemos que la muerte celular se produce por la inhibición de múltiples procesos, entre los cuales los más
prominentes son la biogénesis ribosomal y la traducción, además del desplazamiento del conjunto de las
proteínas de unión a ARN, y las proteínas ribosomales (proteínas-r) del ARN.

A continuación, para evaluar los efectos de los RPDs in vivo, desarrollamos un modelo ratón que permite la
expresión inducible en todos los tejidos de noventa y siete copias de PR. La expresión sistémica del péptido
provocó un fenotipo letal de envejecimiento prematuro en tan solo tres meses. El análisis a nivel molecular y
celular desveló que este fenotipo progeróide se asocia con la acumulación de estrés nucleolar y proteínas-r
libres, sugiriendo que la ELA de C9ORF72 tiene rasgos reminiscentes de un grupo de patologías llamadas
ribosomopatías. De acuerdo con esta hipótesis, la toxicidad de RPDs in vitro se alivia con rapamicina, un inhibidor
de mTOR, o bajando los niveles de MYC, ambos siendo intervenciones conocidas para bajar traducción global y
extender la esperanza de vida en mamíferos. Consistentemente, con lo que se ha visto anteriormente en
ribosomopatías, la rapamicina extiende la supervivencia de los ratones (PR) 97.

En resumen, nuestro trabajo ha permitido demostrar el mecanismo de toxicidad de los RPDs ricos en arginina,
desarrollar un nuevo modelo ratón con potencial como una herramienta valiosa de investigación preclínica,
revelar que la patología provocada por los RPDs poli(PR) presenta paralelismos con las ribosomopatías, e
identificar vías terapéuticas que pueden reducir la severidad de estas enfermedades.

12
ABBREVIATIONS

13
 eukaryotic translation initiation
4E-BP1 dsDNA double strand DNA
factor 4E-binding protein 1

ActD Actinomycin D DSEA Drug Set Enrichment Analysis

acquired immune deficiency

AIDS DTT dithiothreitol
syndrome

ALS amyotrophic lateral sclerosis EB embryo bodies

ATP adenosyl triphosphase EdU 5-ethynyl-2-deoxyuridine

enhanced green fluorescent

BAC bacterial artificial chromosome EGFP
protein
brain-derived neurotrophic eukaryotic translation initiation
BDNF eIF4E
factor factor 4E

BOP1 block of proliferation 1 EM electron microscopy

BSA bovine serum albumin EMSA electrophoretic mobility assay

C9ORF72 amyotrophic lateral

C9-ALS ER endoplasmic reticulum
sclerosis
chromosome 9 open reading
C9ORF72 EU 5-ethynyl uridine
frame 72
familial amyotrophic lateral
CB Cajal body fALS
sclerosis

cDNA copy DNA FBL fibrillarin

Cmap Connectivity Map FBS foetal bovine serum

CNV copy number variant FC fibrillar centre

CPP cell-penetrating peptide FDR falase discovery rate

clustered regularly interspaced

CRISPR FTD frontotemporal dementia
short palindromic repeats

CS Cockayne syndrome FUS fused in sarcoma

DFC dense fibrillar component GA glycine-alanine

DKC1 dyskerin GC granular centre

glial cell-derived neurotrophic

DNA deoxynucleic acid GDNF
factor

dNTD deoxynucleotide GP glycine-proline

dox doxycycline GR glycine-arginine

DPR dipeptide repeat GSEA Gene Set Enrichment Analysis

14
 higher-energy collisional AIDS-associated
HCD NeuroAIDS
dissociation neurodegeneration

HDAC histone deacetylase NOP56 nucleolar protein 56

Hutchinson-Gilford progeria
HGPS NOR nucleolar organiser regions
syndrome

HIV human immunodeficiency virus NPM1 nucleophosmin

HMG high mobility group OPP O-propargyl-puromycin

hexanucleotide repeat
HRE PA proline-alanine
expansion

HTM high throughput microscopy PBS phosphate buffer saline

IDR intrinsically disordered regions PC perinucleolar chromatin

iPSC induced pluripotent stem cell PCR polymerase chain reaction

ISR integrated stress response PFA paraformaldehyde

KD knock down PR proline-arginine

KI knock-in qRT-PCR quantitative real time PCR

RAN repeat-associated ATG-

KO knock-out
translation independent translation

LIF leukaemia inhibitory factor RBP RNA-binding protein

LLPS liquid-liquid phase separation rDNA ribosomal DNA

MEFs mouse embryonic fibroblasts RNA ribonucleic acid

mESCs mouse embryonic stem cells RNA Pol RNA polymerase

MLO membrane-less organelle RNAi RNA interference

MN motor neuron RNP ribonucleoparticle

mRNA messenger RNA ROS reactive oxygen species

MS mass spectrometry RPL 60S ribosomal protein

mechanistic target of
mTOR r-protein ribosomal protein
rapamycin

NCL nucleolin RPS 40S ribosomal protein

ribosome-associated protein
ncRNA non-coding RNA RQC
quality control

15
R-rich arginine-rich SOD1 superoxide dismutase-1

RRL rabbit reticulocyte lysate ssDNA single strand DNA

rRNA ribosomal RNA ssRNA single strand RNA

S6K RPS6 kinase TARDBP TAR DNA-binding protein 43

sporadic amyotrophic lateral

sALS tRNA transfer RNA
sclerosis

SBP streptavidin binding protein UBF1 upstream binding factor 1

SG stress granule UPS ubiquitin-proteasome system

siRNA silencing RNA UV Ultraviolet

Wiedemann-Rautenstrauch
snoRNA small nucleolar RNA WRS
syndrome

SNP single nucleotide polymorphism

16
INTRODUCTION

17
Over the last century, life expectancy has doubled in some parts of the globe; United Nations estimated a global average of 72.6
years, in 2019. As humanity lives longer, age-related diseases will become an increasing public health burden, and research is
desperately needed to offset the effects of an ageing population. A prominent group of diseases that disproportionately impact
the elderly are neurodegenerative disorders, of which amyotrophic lateral sclerosis (ALS) is an important member. ALS is a lethal
adult-onset neurodegenerative disorder with no cure. Recently, a mutation in the human C9ORF72 gene was identified as the most
common known cause of familial ALS.

In this work, we found that toxic arginine-rich (R-rich) peptides associated with C9ORF72-associated ALS (C9-ALS) kill cells
through unspecific nucleic acid binding, which generates an array of cellular disruptions, including nucleolar stress. We also
generated a mouse model expressing ALS-associated toxic peptides, which presented a lethal premature ageing phenotype.
Surprisingly, rapamycin, a renowned anti-ageing drug, could extend the lifespan of these animals. We have unexpectedly linked
ageing mechanisms with nucleolar stress, and ALS; accordingly, this introduction will discuss all three, in order to provide the
frame of reference through which to interpret this thesis.

1. AMYOTROPHIC LATERAL SCLEROSIS

ALS is a devastating neurodegenerative motor neuron disorder, which invariably results in lethality. It affects approximately 2-3 in
100,000 people in Europe, at a median age of 65 (Logroscino et al., 2010). Characterised by lower and upper motor neuron death,
ALS initially presents with muscle weakness and spasticity, which aggressively progresses to almost complete muscle atrophy,
and terminal respiratory muscle denervation 2-4 years after onset (Chiò et al., 2009). Approximately half of the patients suffer
from cognitive alterations, up to 13% presenting with co-morbid frontotemporal dementia (FTD) (Elamin et al., 2013; Phukan et
al., 2012). FTD is caused by frontotemporal lobar degeneration, leading to a variety of cognitive and behavioural deficits, and
indeed, can present as an independent disorder.

Despite decades of intense activity in the field, the mechanism of motor neuron death remains unknown, and there is no cure.
Only two medications are approved for the treatment of ALS, Riluzole and Edavarone, both of which bestow only moderate
improvements (Petrov et al., 2017; Sawada, 2017).

One of the reasons for slow progress is that ALS presents a complex heterogeneous genetic landscape, with multiple variants in
over 50 disease-associated genes, spread over several biological processes. Approximately 10% of ALS cases arise in individuals
with at least one affected family member. These cases are known as “familial ALS” (fALS), as opposed to “sporadic ALS” (sALS),
which occurs in patients with no prior family history (Al-Chalabi et al., 2016). A very small portion of sALS cases are postulated
to be caused by environmental factors, such as exposure to the neurotoxin β-methylamino-L-alanine (Bradley et al., 2013), but
the vast majority is thought to be genetic in origin (Figure 1).

1.1 GENETICS OF ALS

1.1.1 The genetic landscape in ALS

Much of our current understanding of the genetics of ALS originates from the analysis of the pedigrees of fALS cases. As such,
only 48% of fALS, and 5% of sALS cases, can be accounted for by a known pathogenic variant, most of these occurring in just a
handful of genes: superoxide dismutase-1 (SOD1), TAR DNA-binding protein 43 (TARDBP), fused in sarcoma (FUS), and
chromosome 9 open reading frame 72 (C9ORF72) (Zou et al., 2017). Although many other ALS-associated genes have been
catalogued, they are rare, and over 90% of cases remain unexplained. In total, there are approximately 50 known disease-causing
genes, which readily segregate into several affected processes: RNA metabolism, autophagy, cytoskeletal dynamics, and oxidative
stress. The currently known ALS-causing genes are summarised in Table 1, and out of these, the most common ones are described
in Table 2.

Table 1. Disease causing and modifying mutations, grouped according to relevant disease processes in ALS (Summarised from (Mejzini
et al., 2019)). The most commonly mutated genes are shown in bold, and are further described in Table 2. *DPR products caused by the
HRE mutation in C9ORF72, as opposed to the C9ORF72 gene product.

18
 INTRODUCTION
Process Mutated genes

TARDBP, FUS, C9ORF72 DPRs*, ANG, SETX, MATR3, ATXN2, TAF15, EWSR1, hnRNPA1,
RNA metabolism
hnRNPA2B1, ELP3, TIA1

Autophagy, endosomal trafficking, and

C9ORF72, ALS2, VAPB, CHMP2B, FIG4, UBQLN2, SQSTM1, SIGMAR1, OPTN, VCP, TBK1
ubiquitin-proteasome system

Cytoskeletal and axonal dynamics DCTN1, PFN1, SPG11, TUBA4A, NEFH, PRPH, NEK1, KIF5A

Oxidative stress & mitochondria SOD1, CHCHD10, C19ORF12

Others ERBB4, SS18L1, PNPLA6, PON1-3, DAO, CHRNA3, CHRNA4, CHRNB4, ALS3, DNAJC7

Unknown ALS7, ALS-FTD

Figure 1. Frequency of ALS-associated mutations in European and Asian populations. Data from (Zou et al., 2017).

1.1.2 Discovery of ALS-causing mutations

The first ALS-causing mutations were identified in SOD1, in 1993 (Rosen et al., 1993). SOD1 can be found in the cytosol and
mitochondria, where its activity neutralises reactive oxygen species (ROS) generated during mitochondrial respiration (McCord
and Fridovich, 1969). SOD1 mutations generate a range of issues in ALS, including excitotoxicity, oxidative stress, endoplasmic
reticulum (ER) stress, mitochondrial dysfunction, and misfolded protein aggregates (Hayashi et al., 2016). For many years,
oxidative stress was the focus of SOD1-ALS research. Vast efforts went into counteracting it, and culminated in the marketing of
a second approved treatment of ALS, the antioxidant Edaravone, two decades later (Abe et al., 2014; Takei et al., 2017).

However, antioxidants gave lacklustre results in clinical trials, which is why the field welcomed the arrival of a new therap eutic
target: RNA-binding proteins (RBPs). The field shifted focus when causative mutations were discovered in in TARDBP (TDP-43), in
2008 (Gitcho et al., 2008; Kabashi et al., 2008; Sreedharan et al., 2008; van Deerlin et al., 2008; Yokoseki et al., 2008) , and
in FUS (Kwiatkowski et al., 2009; Vance et al., 2009), in 2009. TDP-43 and FUS are nuclear RBPs, with a variety of functions in
RNA metabolism (Mejzini et al., 2019). In ALS, TDP-43 tends to mislocalise to the cytosol, and form ubiquitinated cytosolic
aggregates (Arai et al., 2006; Neumann et al., 2006) . This proteinopathy occurs in 97% of patients, regardless of the mutation,
and is a clinically recognised pathological hallmark of the disease (Hardiman et al., 2017). FUS also tends to form insoluble
aggregates, however, they generally only occur in patients harbouring mutations in FUS (Mejzini et al., 2019). These two genes
marked a change in paradigm, bringing RNA dysfunction to the centre of ALS pathophysiology. In the decade that followed,
scientists unearthed a growing number of ALS-associated RBPs, including hnRNPA1, hnRNPA2B1 (Kim et al., 2013), MATR3
19
(Johnson et al., 2014), and proteins from the FET family, TAF15 and EWSR1 (Neumann et al., 2011), of which FUS is also a
member.

Although these findings represented a breakthrough, they still only accounted for a small number of patients. Finally, in 2011, the
most common cause of ALS and FTD in patients of European and North American descent was isolated, a copy number variant
(CNV) in the C9ORF72 gene. Two groups discovered a hexanucleotide repeat expansion (HRE) inside the first intron of C9ORF72,
in C9ORF72 ALS/FTD (C9-ALS/FTD) patients. While healthy individuals have 11 or fewer copies of the “GGGGCC” hexanucleotide,
mutation carriers present a variable number of copies, ranging from 30 to 1000s (DeJesus-Hernandez et al., 2011; Renton et
al., 2011). How a mutation inside a non-coding region could cause motor neuron death posed an interesting problem, and
C9ORF72 became the subject of a decade of intense activity.

Table 2. Most common disease-causing mutations in ALS, according to date of discovery. Incidence rates from (Zou et al.,
2017); variants from (Yamashita and Ando, 2015) for SOD1, and (Lattante et al., 2013) for TARDBP and FUS. Single nucleotide
polymorphisms (SNPs); copy number variant (CNV)

Gene Protein Functions Pathogenesis Variants Incidence References

SOD1 aggregates,
excitotoxicity, oxidative 15-30%
Superoxide
Cytosolic stress, ER stress, >185 fALS (Rosen et al.,
SOD1 dismutase
antioxidant mitochondrial SNPs 1993)
[Cu-Zn]
dysfunction, possible <2% sALS
gain of function toxicity

(Gitcho et al.,
Nuclear depletion,
RNA splicing, 2008; Kabashi
cytosolic aggregates, 1.5-4.2%
stability and et al., 2008;
TAR DNA- RNA metabolism fALS
transport. Sreedharan et
TARDBP binding alterations, LLPS > 48 SNPs
Regulation of al., 2008; van
protein 43 dynamics perturbation, 0.2-0.8%
ncRNA Deerlin et al.,
possible gain of function sALS
biogenesis 2008; Yokoseki
toxicity
et al., 2008)

Nuclear depletion,
2.8-6.4%
cytosolic aggregates,
Transcription, fALS
RNA metabolism > 50 (Kwiatkowski et
Fused in RNA splicing, and
FUS alterations, LLPS SNPs, al., 2009; Vance
sarcoma transport. DNA 0.3-0.9%
dynamics perturbation, indels et al., 2009)
repair
possible gain of function sALS
toxicity

2.3-33.7%
fALS
Guanine DPR-mediated
(DeJesus-
nucleotide perturbation of RNA
Autophagy and 0.3-5.1% Hernandez et
exchange metabolism and GGGGCC
C9ORF72 endosomal sALS al., 2011;
C9orf72, dynamics, RNA toxicity, CNV
trafficking Renton et al.,
C9ORF72 down-
25% fFTD 2011)
DPRs regulation
5% sFTD

1.2 ALS DISEASE MECHANISMS

1.2.1 Disease cascade of ALS

Despite genetic insights afforded by the discovery of causing mutations, the molecular mechanism of the disease is not well
understood. The current view of ALS pathogenesis is that the characteristic cellular perturbations occur in a cascade, early events
provoking the later and eventually cell death. Disease onset likely originates from a combination and accumulation of deleterious
events, as opposed to a single cause. It is likely that ageing plays a role in triggering disease onset. Furthermore, the influence of
environmental factors is not clear, although a number of loose correlations with pre-morbid lifestyle factors, such as physical
20
 INTRODUCTION
activity and smoking, have been reported, and may have a place in the pathogenesis (Filippini et al., 2020; Westeneng et al.,
2021).

Although there is consensus about the characteristic cellular alterations, the order of pathological incidents is still in dispute.
Table 3 summarises the disease processes that occur in ALS, organised according to a proposed order of early, mid- and late
disease events; these groups are conjectural and open to reinterpretation. Each of the pathological mechanisms is expanded on
in the following section, and summarised in Figure 2.

Table 3. Pathophysiological processes associated to ALS, and proposed order of pathological cascade.

Order Pathological mechanism

Early events Defective RNA metabolism & RBP mislocalisation

Perturbed proteostasis

Aberrant nucleocytoplasmic transport

Middle events Axonal transport defects

Oxidative stress

DNA repair impairment

Excitotoxicity

Late events Prion-like propagation

Neuroinflammation and accessory cell involvement.

1.2.2 RBP mislocalisation and defective RNA metabolism

RNA metabolism deterioration as a key driver of ALS was proposed when the first mutations in RBPs were discovered, and
crystallised when RNA processing defects were also found in C9-ALS/FTD patients, suggesting a universal step in pathogenesis.
Indeed, alterations in mRNA expression and splicing, rRNA processing, ncRNA transcription, and mRNA transport have all been
documented in association with the principal ALS-driving mutations (Arnold et al., 2013; Chen-Plotkin et al., 2010; Haeusler et
al., 2014; Ratti and Buratti, 2016; Walsh et al., 2015). Consistently, RBPs are frequently mislocalised to the cytosol or
sequestered in insoluble aggregates, which ablates their ordinary activity, and explains the RNA processing defects. Indeed, both
phenomena are two sides of the same coin. Cytosolic mislocalisation of RBPs provokes the formation of stress granules (SGs).
SGs are transitory RNA-rich organelles, which assemble when a cell is exposed to a stressor, and disassemble when the stress is
resolved. However, in the case of ALS, unresolved SGs are thought to be the precursors of the characteristic TDP -43 aggregates
(Parker et al., 2012; Vanderweyde et al., 2013; Winton et al., 2008) .

1.2.3 Perturbed proteostasis

The tendency to accumulate ubiquitinated and p62-possitive aggregates, in almost all cases of ALS, suggests an underlying
protein clearance problem. Ubiquitin marks substrates for the ubiquitin-proteasome system (UPS), while p62 is an adaptor for
autophagy. Autophagy and the UPS are processes through which the cell degrades damaged proteins, and rare mutations in both
can cause ALS (Majcher et al., 2015; Nassif et al., 2017; Ying and Yue, 2016) . Defects in these processes have also been seen
in SOD1-ALS, where components of the UPS system are down-regulated (Urushitani et al., 2002). In C9-ALS/FTD,
haploinsufficiency of C9ORF72, causes defects in autophagy, and exacerbates other deleterious phenotypes (Shi et al., 2018).
Indeed, both SOD1 and TDP-43 are autophagosome substrates, and their tendency to aggregate may in part be due to collapse of
autophagy.

21
1.2.4 Aberrant nucleocytoplasmic transport

The common nuclear depletion of RBPs, such as TDP-43 and FUS, in ALS gives a possible role for nucleocytoplasmic transport in
pathogenesis. Furthermore, C9ORF72 mutations have been associated with problems in this process, as will be discussed below.

1.2.5 Axonal transport defects

Identification of ALS-driving mutations in DCTN, PFN1, and TUBA4A, sparked interest in how cytoskeletal and transport dynamics
might contribute to neuron death (Puls et al., 2003; Smith et al., 2014; Wu et al., 2012) . Motor neurons are highly polarised
cells, and require an extensive active transport system to supply the axons with ca rgos such as proteins, mRNA, organelles, and
transport vesicles. Post-mortem patient tissue suggests that there is a breakdown in transport processes, and an abnormal
accumulations of neurofilaments, as well as cargos like lysosomes, vesicles and mitochondria have been observed (Corbo and
Hays, 1992; Hirano et al., 1984; Rouleau et al., 1996; Sasaki and Iwata, 1996). There is also evidence of Golgi fragmentation,
indicating the breakdown of vesicle trafficking (Fujita and Okamoto, 2005; Gonatas et al., 1992; Mourelatos et al., 1994). In
fact, several disease-causing mutations in the vesicle transport system have also been reported, including OPTN, VAPB, CHMP2B,
and UNC13A (Chadi et al., 2017; Cox et al., 2010; Sundaramoorthy et al., 2015; Urwin et al., 2010; Vidal-Taboada et al.,
2015). All of these transport defects effectively leave the synapse stranded, and cut off from the nucleus, which may explain why
axon retraction occurs before cell death. In this view, axonopathy reflects the cell’s inability to support the axonal projection.

Figure 2. Summary of pathogenic mechanisms involved in ALS. ALS presents with a series of characteristic cellular disruptions, including
perturbed RNA metabolism, dysfunctional proteostasis, problems in nucleocytoplasmic transport, and cytoskeletal axonal transport,
mitochondrial dysfunction and oxidative stress, DNA damage, and excitotoxicity. Involvement of accessory cells, such as glia and
astrocytes is also a hallamark of ALS. Finally, prion-like spreading of misfolded proteins between neurons has also been observed in
several models.

1.2.6 Oxidative stress and mitochondrial dysfunction

Oxidative stress refers to the accumulation of ROS, which can damage long-lived macromolecules of the cell such as DNA, proteins
and lipids. ALS patients present evidence of oxidative damage in spinal cord sections (Shibata et al., 2001). ROS are an ordinary
22
 INTRODUCTION
by-product of mitochondrial respiration, but can be exacerbated by mitochondrial defects, which have also been reported in SOD1-
ALS patients and mice (Magrané et al., 2014; vande Velde et al., 2011) . In the first decade of ALS research, particularly in work
with SOD1, oxidative stress was postulated to be the primary driver of neurodegeneration. This hypothesis is now under debate.
While some studies maintain that oxidative stress can cause RNA metabolism aberrations, and therefore the rest of the cascade,
others argue that it occurs downstream of RNA dysfunction (Mejzini et al., 2019). Its overall contribution in ALS remains to be
resolved.

1.2.7 Impairment of the DNA damage response

A number of ALS-associated proteins, including TDP-43, FUS, TAF15, SETX, and EWS, participate in DNA damage repair (Hill et
al., 2016; Mejzini et al., 2019), and failure in this process may contribute to motor neuron death. Likewise, several reports
associate defects in DNA damage signalling and repair with C9ORF72 mutations (Andrade et al., 2020; Farg et al., 2017; Lopez-
Gonzalez et al., 2016; Nihei et al., 2020; Walker et al., 2017). Although the DNA damage response may be dysfunctional in
motor neurons, the question of how much effect this can have on terminally differentiated, non-dividing cells remains open.

1.2.8 Excitotoxicity

Glutamate is a neurotransmitter, which participates in synaptic signal transmission. If glutamate levels in the synaptic cleft are
elevated, either through incomplete of clearance, or through aggravated release, neuronal glutamate receptors are over-stimulated,
leading to cellular damage. Excitotoxicity has long been regarded as an important cause of motor neuron death although this
notion is now challenged by the poor effect of excitotoxicity therapeutic targeting (Mejzini et al., 2019). Riluzole is believed to
repress glutamate toxicity, however, its effects are mild, and no other drug from this class has been successful in clinical trials
(Chiò et al., 2020). This suggests that glutamate toxicity maybe only one of multiple apoptotic drivers, and singular targeting
insufficient to reverse cell death.

1.2.9 Prion-like propagation

ALS onset is focal, but as the disease advances, motor neuron death spreads through the spine, progressing to anatomically
neighbouring regions. This spreading has been proposed to occur through prion-like self-propagation of misfolded proteins. SOD1,
TDP-43, FUS, and C9ORF72-associated peptides have all been shown to have prion-like spreading properties in vitro, and SOD1 in
vivo, although further work is necessary to determine the relevance of these processes in patients, and how they may occur in
different types of ALS (Ayers and Cashman, 2018).

1.2.10 Neuroinflammation and accessory cell involvement

Neuroinflammation is common in imaging studies of ALS patients (Corcia et al., 2012; Turner et al., 2004) . Astrocytes and
microglia are activated, and secrete pro-inflammatory cytokines, which drives inflammation and the recruitment of T lymphocytes
(Komine and Yamanaka, 2015). Microglia are responsible for the detection of damage in the brain, and may generate pro-
inflammatory signals in response to initial motor neuron death, which places inflammation in the final stages of pathogenesis,
once motor neurons begin to die. Microglial cytokines, in turn, activate astrocytes, which is also potentially neurotoxic (Liddelow
et al., 2017). Oligodendrocytes constitute the myelin sheath of motor neurons, and several studies corroborate their degeneration
in ALS, which may also contribute to the final atrophy (Kang et al., 2013; Philips et al., 2013). Overall, growing evidence indicates
that cell types that are not directly affected are important in propagation and exacerbation of ALS pathogenesis.

1.3 C9ORF72 MUTATION IN ALS

1.3.1 Three hypotheses for cell death

In the years following the initial discovery of C9ORF72, three competing hypotheses arose to explain motor neuron death
associated to this mutation (Figure 3).

1) Haploinsufficiency. C9ORF72 participates in autophagy and vesicle trafficking, both of which are affected in ALS. As carriers of
the HRE mutation had lower expression of C9ORF72, researchers postulated that partial loss of autophagy was responsible for
neuron death (Belzil et al., 2013; Fratta et al., 2012; Gijselinck et al., 2012; van Blitterswijk et al., 2015; Waite et al., 2014) .
While invertebrate models gave promising results, C9orf72 knock-out (KO) mice failed to develop neurodegeneration, showing
that the ablation of C9ORF72 is insufficient to cause ALS in mammals (Burberry et al., 2016; Koppers et al., 2015; O’Rourke et

23
al., 2016). Current lines of evidence indicate that the loss of C9ORF72 may exacerbate other deleterious events in disease
progression (Shi et al., 2018; Zhu et al., 2020).

2) RNA toxicity. HRE GGGGCC repeats give rise to both sense and antisense repetitive transcripts, which are detectable in RNA
foci in C9-ALS/FTD post-mortem tissue (DeJesus-Hernandez et al., 2011). G-rich transcripts are prone to secondary structures,
such as G-quadruplexes, or hairpins (Fratta et al., 2012), and avidly bind and sequester RBPs in other neurological disorders, like
myotonic dystrophy (Cooper et al., 2009). A parallel mechanism seemed likely for C9-ALS/FTD. Indeed, several studies claimed
RNA-mediated toxicity, and showed that RNA foci co-localised with various RBPs (Freibaum et al., 2015; Xu et al., 2013).
Nonetheless, a third theory appeared when several groups found that HRE transcripts could give rise to protein products.

3) Peptide toxicity. HRE RNA can be translated in all six reading frames through an unconventional form of repeat-associated ATG-
independent translation, giving rise to five dipeptide repeat (DPR) products: poly glycine-alanine (poly(GA)), poly glycine-proline
(poly(GP)), poly proline-alanine (poly(PA), poly glycine-arginine (poly(GR)), and poly proline-arginine (poly(PR)) (Ash et al., 2013;
Gendron et al., 2013; Mori et al., 2013b, 2013a; Zu et al., 2013) . Of the five, poly(GR) and poly(PR) proved to be potently
neurotoxic in both in vivo and in vitro models, leading researchers to propose these species to be responsible for motor neuron
death in ALS (Kanekura et al., 2016; Kwon et al., 2014; Mizielinska et al., 2014; Tao et al., 2015; Wen et al., 2014; Yamakawa
et al., 2015).

Figure 3. The hexanucleotide repeat expansion in C9ORF72 has been proposed to kill cells by three different mechanisms. 1) The expanded
region leads to lower expression of C9ORF72, and toxicity is derived from deficiency of the gene product. 2) The repetitive GGGCCC
RNA can for secondary structures, which sequester RBPs. 3) The repetitive HRE RNA undergoes RAN translation, which generates a
series of toxic peptide products, one from each reading frame.

While C9ORF72 haploinsufficiency proved to be incapable of driving disease, debate continued over the gain of function toxicity
mechanisms, as the presence of HRE RNA gives rise to the RAN DPR products. An elegant experiment by Mizielinska and
colleagues tipped the scale towards DPR toxicity (Mizielinska et al., 2014). The team generated a set of repeat constructs with
stop codons intercalated in each reading frame; while these transcripts could form secondary RNA structures, such as G -
quadruplexes, and accumulate in RNA foci, they did not yield DPRs. Drosophila harbouring original C9-ALS/FTD repeats produced
DPRs and showed neurodegeneration, but the stop-codon intercalated transcripts did not (Mizielinska et al., 2014). In a later
study, it was confirmed that although the stop codon RNAs could sequester RBPs, they could not cause neurodegeneration
(Moens et al., 2018).

1.3.2 DPRs in ALS patients

Despite the encouraging in vivo and in vitro results, analysis of post-mortem C9-ALS/FTD patient tissue was incongruous
(Balendra and Isaacs, 2018). The distribution of DPR inclusions did not correlate well with disease-relevant anatomy; they are
24
 INTRODUCTION
common in all brain regions, including those that remain intact, but relatively infrequent in the spinal cord of C9-ALS patients (Ash
et al., 2013; Davidson et al., 2016, 2014; Mann et al., 2013; Schludi et al., 2015) . Furthermore, DPR anatomical localisation
in FTD was the same as in ALS, despite atrophy occurring in different areas of the nervous system (Davidson et al., 2014;
Mackenzie et al., 2013, 2015). Finally, TDP-43 proteinopathy and DPRs infrequently coincided in the same neurons (Gendron
et al., 2015; Gomez-Deza et al., 2015; Mann et al., 2013; Mori et al., 2013b) .

Some data, however, does support DPR participation. One group found that if neurons are stratified according to DPR, TDP-43
aggregation correlates with poly(GR) peptides, but not others (Saberi et al., 2018), while another reported that poly(GR)-positive
neurons coincided with areas of neurodegeneration (Sakae et al., 2018).

An important caveat to these data is that post-mortem studies do not necessarily represent the early disease-driving cascades,
but rather, the final lethal outcome, and DPRs may yet prove to be relevant up-stream of TDP-43 proteinopathy. Several works in
vitro and in vivo indicate that this may be the case (Cook et al., 2020; Mori et al., 2016; Yamakawa et al., 2015; Zhang et al.,
2015).

1.4 MECHANISMS OF CELL DEATH BY ARGININE-RICH PEPTIDES IN ALS

The downstream mechanisms by which R-rich DPRs provoke motor neuron death is unknown, although an incomplete picture is
beginning to emerge. DPRs, specifically poly(PR) and poly(GR), provoke a myriad of cellular disruptions, listed below and
summarised in Figure 4.

1.4.1 Defects in ribosome biogenesis and translation

R-rich DPRs have a prominent nucleolar localisation. Consistently, over a range of models, poly(PR) and poly(GR) cause rRNA
processing defects, and nucleolar dysfunction, while the other DPRs do not (Boeynaems et al., 2017; Kwon et al., 2014; Lee et
al., 2016; Mizielinska et al., 2014; Tao et al., 2015; Wen et al., 2014; White et al., 2019) . There are also multiple reports of
translation inhibition (Kanekura et al., 2016; Lee et al., 2016; Moens et al., 2018; Rossi et al., 2015; Vanneste et al., 2019;
Y.-J. Zhang et al., 2018).

Protein synthesis can be downregulated through several routes. Defects in ribosome biogenesis leads to lower
production of ribosomes, and lower protein synthesis. Translation can also be inhibited through direct mechanical
defects, as suggested by Kanekura and colleagues; if poly(PR) peptides can limit mRNA accessibility through direct
binding (Kanekura et al., 2016). Finally, the formation of stress granules can potently repress translation (Boeynaems
et al., 2017; Chew et al., 2019; Lee et al., 2016; Y.-J. Zhang et al., 2018). All three mechanisms are likely to be operative
in DPR toxicity.

Nucleolar and protein synthesis perturbation are believed to be a key process in R-rich DPR pathogenesis, will be further
discussed in section 3.

1.4.2 Perturbation of membrane-less organelles.

Membrane-less organelles (MLOs), such as the nucleolus, SGs) nuclear speckles and Cajal bodies (CBs), are subcellular
compartments, which are not delimited by a lipid membrane (Boeynaems et al., 2018). These structures consist of a discrete
liquid phase, immiscible with the surrounding solution, like oil droplets on water, driven by liquid-liquid phase separation (LLPS).
LLPS is a physical process by which two separate liquid phases are “demixed” from a single homogeneous solution (Boeynaems
et al., 2018; Lafontaine et al., 2021). There is a growing number of reports of poly(PR) and poly(GR) interference with the
functions and dynamics of various MLOs, as well as the LLPS processes that promote their assembly.

SGs are cytoplasmic condensates of RNA and RBPs, which are formed in protective response to different infarctions; they
sequester mRNAs and halt non-essential protein synthesis until the cell has resolved the source of stress (Li et al., 2013).
Although all five the DPRs can provoke SG formation (Boeynaems et al., 2017; Lee et al., 2016; Tao et al., 2015; Wen et al.,
2014; K. Zhang et al., 2018), only those that contain arginine co-localise with them, and lead to a decreased SG protein mobility
(Boeynaems et al., 2017; Chew et al., 2019; Lee et al., 2016; Y.-J. Zhang et al., 2018). Of note, other MLOs, such as nucleoli,
nuclear speckles, and CJs, also present defective dynamics when exposed to DPRs (Lee et al., 2016; Lin et al., 2016).

25
Protein mobility is a read-out of organelle dynamics; decreased mobility is interpreted as a transition of the liquid towards a gel,
or even a solid-like state. Such aberrant state transitions in SGs are hypothesised to mediate protein aggregate formation in ALS
(Portz et al., 2021). This idea is upheld by other disease-causing mutations. Many of the mutations in ALS-associated RBPs, such
as TDP-43, FUS, TIA1, Ataxin 2, and hnRNPs, occur in the domains necessary for LLPS and impair their phase partitioning (Tang
et al., 2020).

Figure 4. Summary of cellular disruptions caused by arginine-rich peptides in ALS.

1.4.3 RNA processing, splicing and modification defects

Perturbations in rRNA processing is one of the most commonly-reported effects of poly(PR) and poly(GR) (Kwon et al., 2014;
Lee et al., 2016; Suzuki et al., 2018; Tao et al., 2015; White et al., 2019) . Besides RNA cleavage defects, an impairment of
adenosine to inosine conversion in RNA was reported in patient-derived motor neurons, as well as mice expressing a 149-copy
HRE construct (Moore et al., 2019). Likewise, several studies indicate that R-rich peptides can also generate spicing defects,
some of which have been specifically documented in ALS (Cooper-Knock et al., 2015; Kwon et al., 2014; Yin et al., 2017) .

1.4.4 Nucleocytoplasmic transport disruption

As previously discussed, the frequent cytosolic mislocalisation of nucleolar proteins, as well as the formation of aggregates
containing numerous nucleocytoplasmic transport factors in C9-ALS/FTD patients and mice (Chew et al., 2019; Zhang et al.,
2015, 2019, 2016), makes nucleocytoplasmic transport an interesting target.

Indeed, R-rich DPRs can cause problems in this process, but there is no consensus on the mechanism. Shi and colleagues
described direct physical blockage of the nuclear pore by poly(PR) peptides (Shi et al., 2017), while others propose that transport
is disrupted through improper regulation (Zhang et al., 2015). A contrasting study suggested that neither poly(GR) nor poly(PR)
can directly repress transport, but rather this is a secondary effect of cellular stress (Vanneste et al., 2019). A possible
conciliation was provided by a recent study, which showed that while DPRs inhibited importin-mediated transport, passive nuclear
influx of small cargos was unaffected (Hayes et al., 2020).

Nuclear importins and exportins, as well as components of the nuclear pore, have also been identified as modifiers of poly(PR)
and poly(GR) toxicity in CRISPR screens in yeast and human cells (Chai and Gitler, 2018; Jovičić et al., 2015; Kramer et al.,
2018), and in an RNAi screen in G4 C2-repeat expressing Drosophila (Freibaum et al., 2015). In fact, direct interaction with several
importins was later confirmed (Hayes et al., 2020; Hutten et al., 2020).

Although nuclear export and import are important in their own right, they might also augment other phenotypes. Nuclear import
may control the amount of DPR that can enter the nucleus and damage the nucleoli, while export the amount of mRNA that reaches
the cytosol for translation.
26
 INTRODUCTION
1.4.5 Cytoskeletal defects

Components of the cytoskeleton can interact with R-rich peptides. Lin and colleagues reported that poly(PR) could be found in
puncta on intermediate filaments (Lin et al., 2016), while two reports of deteriorated microtubule transport appeared recently
(Abo-Rady et al., 2020; Fumagalli et al., 2021). A handful of rare mutations in cytoskeletal proteins can cause ALS (Table 2),
and these affirmations pose a compelling link of C9ORF72 with another piece of the pathology.

1.4.6 Chromatin dysfunction

According to several studies, DNA damage and repair may be involved in C9-ALS/FTD. Evidence of DNA damage has been seen,
both in experimental models and in patient tissue. Several authors propose that the mutation can directly induce DNA damage,
either through HRE RNA (Walker et al., 2017), or poly(PR) and poly(GR) expression (Farg et al., 2017; Lopez-Gonzalez et al.,
2016). DNA damage response through ATM signalling is also compromised, meaning that repair may not be efficient in C9-
ALS/FTD patients (Nihei et al., 2020; Walker et al., 2017). Indeed, a later study found that DPRs impair multiple pathways of
DNA repair (Andrade et al., 2020).

R-rich DPRs have also been connected with heterochromatin deregulation. Surprisingly, the authors diverged from the widely-
reported nucleolar localisation of poly(PR) peptides, but rather found them bound to heterochromatin, which caused epigenetic
and structural abnormalities (Zhang et al., 2019).

Poly(GR) and poly(PR) cause a wide array of cellular defects, however, a unifying mechanism has not been identified. One possible
explanation is that R-rich ALS-associated peptides interact with many proteins containing a common element. Several lines of
evidence suggest that these peptides preferentially interact with low complexity domains in phase-separating proteins (Lee et al.,
2016; Radwan et al., 2020), which gives a possible explanation for the widespread MLO disturbance. However, given the
prominent presence of RNA in the vast majority of the affected processes described above, the importance of RNA in establishing
LLPS (Boeynaems et al., 2018), and the high reported affinity of poly(PR) and poly(GR) for RNA (Suzuki et al., 2018; White et
al., 2019), another possibility emerges. The positively-charged R-rich DPRs may bind RNA, and indeed, DNA, by electrostatic
interactions, and disrupt any cellular processes with nucleic acid intermediates, accounting for such widespread effects caused
by a single species.

1.5 ARGININE-RICH PEPTIDES OUTSIDE ALS

ALS-associated poly(PR) and poly(GR) peptides are not unique in biology, several other protein species characterised by high
arginine content appear in diverse fields. R-rich tracts are positively charged under physiological conditions, as it is one of the
three basic amino acids. These positively-charged tracts can form electrostatic interactions with negatively charged species, such
as phosphor groups, nucleic acids, and acidic amino acids, defining many of the properties seen in R-rich peptides.

1.5.1 Cell penetrating peptides

R-rich peptides are intensively studied in the context of pharmacological delivery, by virtue of their unique cell penetrating
properties.

In 1988, two independent laboratories discovered that the human immunodeficiency virus (HIV-1) trans-activator protein, TAT,
could freely enter cells in vitro, and directly localise in the nucleus to activate viral gene expression (Frankel and Pabo, 1988;
Green and Loewenstein, 1988). This translocation activity was isolated to a sequence of 12 amino acids (GRKKRRQRRRPQ),
and Tat became the first cell-penetrating peptide (CPP) (Park et al., 2002). Fusion of the Tat sequence with a protein of interest
promotes internalisation, while Tat complexes with nucleic acids can transfect cells (Fawell et al., 1994; Yi et al., 2012). In the
decades that followed, multiple R-rich CPPs have been developed for efficient delivery of different cargos, such as nucleic acids,
proteins, nanoparticles, or drugs (reviewed in (Borrelli et al., 2018; Copolovici et al., 2014) ).

CPPs have an important drawback: cytotoxicity. As the epidemic of acquired immune deficiency syndrome (AIDS) evolved in the
80s and 90s, numerous reports emerged connecting AIDS-associated neurodegeneration (NeuroAIDS) with the TAT protein (King
et al., 2006). In fact, TAT, and a number of R-rich CPPs are cytotoxic in vitro (Bonavia et al., 2001; Haughey et al., 2001; Jones
et al., 2005). Protamine is widely used in the clinic as a neutralising agent of the The mammalian ribosome is the single most
important molecular machine of the cell, responsible for the synthesis of all others, and, indeed, itself. The mature 80S ribosome
is composed of two subunits. The 40S is the small subunit, which contains the 18S rRNA, bound to 33 ribosomal proteins (r-

27
proteins) (termed RPSs), while the large 60S subunit is made up of the 28S, 5.8S, and 5S rRNAs, assembled around 47 r-proteins
(RPLs) (Anger et al., 2013; Ben-Shem et al., 2010).

anticoagulant, heparin; however, it is associated with severe secondary effects (Sokolowska et al., 2016).

Protamines are short basic proteins, found across all of the animal kingdom, and have also been used as CPPs (Balhorn, 2007;
He et al., 2014). Protamines are expressed in the final stages of spermatogenesis, and are responsible for the high degree
compaction and inaccessibility of chromatin in the spermatid head (Kierszenbaum and Tres, 1975). Protamine is approximately
50% arginine, which is determinant in its high affinity for DNA; logically, DNA binding may be a common property of all R-rich
peptides (Brewer et al., 2003).

Interestingly, poly(PR) and poly(GR) share several properties with CPPs: they readily enter cells, are cytotoxic, and can bind RNA.

1.5.2 RGG/RG motifs

R-rich domains also occur within eukaryotic proteins, and feature prominently in RBPs. Many nucleolar phase separating proteins
harbour domains rich in arginine, called RGG/RG motifs. These positively-charged tracts often occur in low complexity domains.

Interestingly, RGG/RG motifs are multifunctional. They can bind nucleic acids, such as RNA, but also can form protein-protein
interactions with negatively-charged regions (Mitrea et al., 2018, 2016; Scott et al., 2010; Thandapani et al., 2013). Of note,
these electrostatic interactions are believed to be crucial in RPBs undergoing LLPS, particularly in nucleolar structure, as will be
discussed below. Importantly, the RGG motif is a common nucleolar localisation sequence, and appears in many nucleolar proteins
(Doron‐Mandel et al., 2021; Shubina et al., 2020; Thandapani et al., 2013).

In fact, R-rich peptides can also undergo LLPS without the rest of the protein, “RRASLRRASL” peptides could readily bind RNA, and
form coacervate droplets (Aumiller and Keating, 2016). This behaviour was dependent on the net positive charge, as
phosphorylation of the serine residues ablated LLPS.

This overview of the properties of different R-rich peptides is important, because poly(PR) and poly(GR) share many of their
features. They readily cross cell membranes, localise at the nucleoli, bind nucleic acids, interfere with LLPS, and kill cells. Indeed,
arginine is determinant to the behaviour of this group of peptides. Deciphering the mechanism of toxicity of ALS-associated DPRs
may give us important insights to other R-rich protein species, but also, the physiological activity of R-rich proteins provide us with
significant predictive tools with respect to the activity of poly(GR) and poly(PR).

Arginine-containing DPRs are now established as a likely driver of C9-ALS/FTD pathogenesis; and a growing body of evidence
indicates that poly(PR) and poly(GR) toxicity is exerted by interference with RNA-related processes, by diverse mechanisms. In
this thesis, we propose that R-rich peptides, due to their basic nature, have affinity for negatively-charged nucleic acids, and by
promiscuously binding to RNA and DNA species, cause impairment in multiple cellular processes, promoting cell death. This
universal mechanism can explain how a single chemical species can produce such disparate cellular events.

2. THE NUCLEOLUS

Nucleoli were first observed by light microscopy over 200 years ago, by Fontana, Valentin, and Wagner (Pederson, 1998). They
are well-delimited nuclear structures, with a roughly spherical shape, and house one of the most complex cellular processes:
ribosome biogenesis. The transcription of ribosomal RNA (rRNA), splicing, modification, and sequential assembly involves several
hundred trans-acting factors, as well as small nucleolar RNAs (snoRNAs) (Sharma and Lafontaine, 2015), all of which are
organised and coordinated within the nucleoli. This level of organisation is all the more striking in the absence of lipid bi layer
compartmentalisation, as nucleoli are MLOs, defined by a highly dynamic, open, and fluid structure.

Although initially described only as a ribosome assembly factory, this limited characterisation has since been expanded to
acknowledge the role of the nucleolus in processes as central as cellular division, growth, and stress response. In reflection of
these findings, nucleolar morphology undergoes modification in various pathologies, including cancer, neurodegeneration, and
ageing, making this organelle an emerging therapeutic target (Buchwalter and Hetzer, 2017a; Stamatopoulou et al., 2018;
Tiku et al., 2017; Zink et al., 2004).

28
 INTRODUCTION
2.1 RIBOSOME BIOGENESIS

The synthesis of ribosomes is one of the most intricate eukaryotic processes (Figure 5), requiring the coordination of all three
RNA polymerases, approximately 200 trans-acting assembly factors, and over 80 small nucleolar RNAs (snoRNAs) (Baßler and
Hurt, 2019). Synthesis begins with rRNA transcription, in the nucleolus. A single polycistronic 45S pre-rRNA transcript is
synthesised by RNA polymerase I (RNA Pol I). The 45S transcript is subjected to exo- and endonuclease cleavages, as well as over
one hundred individual covalent modifications, such as methylations or pseudouridilations (Henras et al., 2015; Natchiar et al.,
2017). R-proteins are integrated in parallel to the RNA processing steps, facilitating the correct folding of the rRNA.

The 5S rRNA is transcribed by RNA polymerase III (RNA Pol III) (Weinmann and Roeder, 1974), in the nucleoplasm, and binds with
uL18 (formerly RPL5) and uL5 (RPL11), to form the 5S ribonucleoparticle (5S RNP), which also incorporated into the pre-60S
subunit at this point. The accumulation of unbound 5S RNPs is an important point of ribosome quality control (Donati et al., 2013;
Horn and Vousden, 2008; Sloan et al., 2013a) . Assembly and processing yields the finished 18S, 5.8S, 28S, and 5S rRNAs,
incorporated into pre-40S and pre-60S ribosomal units; these are expelled from the nucleoli and transported to the cytosol, where
they undergo the final maturation steps.

Figure 5. Summary of ribosome biogenesis. The rRNA is transcribed as a single polycistronic 45S transcript, by RNA Pol I, which then
undergoes a series of processing steps, including digestion, modification and folding. Processing requires the participation of over 80
snoRNAs, and over 200 nucleolar factors, as well as r-proteins. Finally, the 5S rRNA is transcribed by RNA Pol III, and is incorporated
into the 60S subunit during ribosome assembly.

The ribosome biogenesis is resource-intensive, demanding up to 80% of a dividing cell’s energy expenditure, and accounting for
over 60% of total transcriptional activity (Steffen and Dillin, 2016; Warner, 1999). As such, tight control mechanisms evolved to
couple ribosome biogenesis to the proliferation programme, among which regulation by mechanistic target of rapamycin (mTOR)
and MYC are the most prominent, and will be discussed in a later section.

29
2.2 NUCLEOLAR STRUCTURE

2.2.1 The tripartide model

The nucleolus is organised according to a tripartide model (Figure 6), in which each of the three phases is immersed in the
consecutive layer, like Russian nesting dolls (Boisvert et al., 2007; Lafontaine et al., 2021) . The fibrillar centre (FC) is the
innermost phase; it contains RNA polymerase I (RNA Pol I), and rRNA transcription occurs on its boundary with the following
compartment, the dense fibrillar component (DFC). The DFC is characterised by the presence of the nucleolar protein fibrillarin
(FBL), and is the site of pre-rRNA processing, chemical modifications, and folding. The first ribosomal proteins are also
incorporated here (Thomson et al., 2013). The granular centre (GC) is the outermost layer, enriched nucleophosmin (NMP1), and
is constricted by a ring of dense perinucleolar chromatin (PC). Ribosomal protein incorporation continues in the GC, the maturing
pre-ribosomal particles moving towards the nucleolar periphery as they approach completion (Riback et al., 2020).

Several dozen FC-DFC modules are immersed in each GC, the number being dependent on cell type, and each of these is nucleated
around two or three transcriptionally active ribosomal DNAs (rDNAs) (Lafontaine, 2019; Yao et al., 2019) . The rDNA loci are
distributed between the acrocentric chromosomes (13, 14, 15, 21 and 22 in humans), giving a total of 10 nucleolar organiser
regions (NOR) in human diploid cells, or 12 in mice (Boisvert et al., 2007). Typically, only a subset of the NORs is active at any
one time; for example, only 6 out of 10 are active in HeLa cells (Roussel et al., 1996).

Figure 6. The tripartide model of nucleolar structure. The nucleolus is organised in three functionally, and materially distinct layers. The
FC is the innermost phase; it contains RNA Pol I, and rRNA transcription occurs on its boundary with the following compartment, the
DFC. The DFC is the site of pre-rRNA processing, chemical modifications, and folding. The GC is the outermost layer, and is constricted
by a ring of dense perinucleolar chromatin. Ribosomal protein incorporation occurs in the DFC and GC. (Immunofluorescence adapted
from (Lafontaine et al., 2021))

2.2.2 Liquid-liquid phase separation in nucleolar structure

Despite this highly organised architecture, nucleoli retain liquid-like properties. They are able to split and coalesce (Brangwynne
et al., 2011), like oil drops on the surface of water, as well as showing open exchange dynamics with the nucleoplasm,
characteristic of liquid-phase behaviour (Lafontaine et al., 2021). LLPS is a physical process in which an initially homogeneous
liquid, reaching sufficient concentration of one of the constituents, separates into two distinct phases. In biomolecular sys tems,
this process is responsible for the formation of membrane-less organelles, such as stress granules, Cajal Bodies, and nucleoli,
and is driven by the nature and concentration of the constituents. Indeed, the ability to “demix”, and form a discrete phase is a
crucial property of key nucleolar proteins, including FBL and NPM1 (Lafontaine et al., 2021).

Fibrillarin is able to phase separate on its own, once it reaches a saturation concentration, however, this concentration is lower in
the presence of RNA, making the interaction of FBL with rRNA decisive in the phase s eparation of the DFC (Berry et al., 2015).
Indeed, protein-RNA interactions are prominent in the formation of other phase-separated compartments, where RNA acts as a
scaffold for RBPs and promotes phase partitioning (Boeynaems et al., 2018; Grese et al., 2021; Molliex et al., 2015; Schwartz
et al., 2013). A growing body of evidence indicates that the tripartide organisation is a multiphase biomolecular condensate,
formed by LLPS, in which each of the three layers acts as a liquid immiscible with the next (Feric et al., 2016).

Many phase-separating proteins, and in particular, the nucleolar proteome, contain intrinsically disordered regions (IDRs) which
are characterised by a high degree of structural disorder. Cytosolic proteins in humans on average have approximately 14%
structural disorder, 12% in mice, while the nucleolar proteome presents 20% and 22%, respectively (Stenström et al., 2020). IDRs
30
 INTRODUCTION
within nucleolar proteins present tracts of electrostatically charged amino acids; basic glycine-arginine-rich GAR-domains
(containing RGG motifs) in fibrillarin, GAR1, nucleolin, and many ribosomal proteins (Ben-Shem et al., 2010; Girard et al., 1992;
Scott et al., 2010), or acidic domains, rich in glutamine and asparagine, such as in nucleophosmin (Mitrea et al., 2018, 2016).
R-rich tracts are particularly prominent in the nucleolar proteome, as they also have the additional role of nucleolar-localisation
sequences (Scott et al., 2010). The establishment of weak electrostatic interactions between these tracts is believed to be the
driver of the nucleation events necessary for phase separation. Such is the case in the partitioning of nucleophosmin. The acidic
tracts in its IDR form interactions with R-rich proteins, such as the GC component SURF6, or ribosomal proteins (RPL23a), allowing
them to demix, and establish a discrete liquid phase (Mitrea et al., 2018, 2016).

2.2.3 The nucleolus in steady-state flux

Fluid dynamics are vital to nucleolar function, because nucleoli don’t exist as closed stable systems, but rather as a consta nt state
of flux (Lafontaine et al., 2021). Perhaps the closest analogy is that of stellar structure; the perimeter of stars, in part, is
maintained by a constant outward flux of energy and matter from the reaction core. Likewise, nucleoli are sustained by the
constant flux of synthesis and assembly of pre-ribosomal particles.

The nucleolar phases are formed in concert with each processing step, the heterotypic interactions between rRNA and the
associated proteins drive phase condensation (Riback et al., 2020; Yao et al., 2019). An illustrative example of this dependence
is treatment with Actinomycin D, which inhibits rRNA translation at low doses, without affecting the consecutive processing
(Geuskens and Bernhard, 1966; Lazdins et al., 1997) . When nascent rRNA is unavailable to incorporate into the DFC, FBL
segregates to form “nucleolar caps”, indicating the destabilisation of the DFC phase, while the GC slowly dissolves, nucleophosmin
relocalising to the nucleoplasm (Hernandez-Verdun et al., 2010; Riback et al., 2020) .

The flow of ribosomal assembly, therefore, needs open, rapid dynamics, provided by the liquid state, while the structure itself is
formed around these reactions. As each is implicit to the other, any perturbations that interfere with the liquid phase have severe
consequences on ribosome biogenesis, and vice versa.

2.3 NUCLEOLAR STRESS

2.3.1 The nucleolus under stress

The advent of proteomic technologies allowed massive interrogation of nucleoli, and revealed that out of the 4500 identified
nucleolar proteins only 30% are actually involved directly in ribosome biogenesis. This left a wide variety of previously unexplored
nucleolar functions, amongst which stress response has a principal role (Ahmad et al., 2009).

Direct perturbation of the nucleoli, either by genetic depletion of nucleolar factors and ribosomal proteins, or by chemical inhibition
of the different stages of ribosome biogenesis, leads to important aberrations in nucleolar structure and function (Lafontaine et
al., 2021). Morphological aberrations are also a feature of various types of cell stresses, including starvation, ultraviolet irradiation,
heat shock, viral infection, hypoxia, oxidative, osmotic stress (Colombo et al., 2002; Kim et al., 2011; Kurki et al., 2004;
Matthews, 2001; Mayer and Grummt, 2005; Yang et al., 2016; Yogev et al., 2008) , as well as treatment by cytotoxic agents
(Chan et al., 1999, 1987; David-Pfeuty, 1999; Desnoyers et al., 1996; Perlaky et al., 1997; Thielmann et al., 1999; Valdez
et al., 1998).

The concept of “nucleolar stress” was developed based on these observations. Nucleolar stress, also called “ribosomal str ess”,
or “ribotoxic stress”, is a lax term, generally used to refer to stressor-induced alterations in nucleolar morphology and function,
accompanied with detrimental effects on growth, and with no formal distinction as to whether nucleolar alteration is the primary
cause of stress, or a secondary response to stress (Yang et al., 2018). Given the tight coupling of ribosome biogenesis to the
cell growth programme, it is perhaps unsurprising that the nucleolus is highly responsive to numerous types of stressors; therefore,
to avoid ambiguity, in this work, the term “nucleolar stress” excludes this class of general effects, and refers specifically to the
direct perturbation of the nucleolus.

Intriguingly, the nucleolus reacts with highly specific morphological aberrations to different disruptions in ribosome biogenesis.
The ablation of RNAPol I activity, whether by inhibitors, such as Actinomycin D (ActD) or BMH-21, or by depletion of nucleolar
transcription factors, such as TIF1A, leads to nucleolar segregation, as described above (Lafontaine et al., 2021; Yuan et al.,
2005). However, a perturbation of ribosome assembly, by depletion of r-proteins, uL18 (RPL5) and uL5 (RPL11), causes a highly
disrupted “nucleolar necklace” phenotype, while knock-down of different nucleolar factors, or treatment with a range of
chemotherapeutic agents present other compromised but specific structures (Burger et al., 2010; Nicolas et al., 2016;
Stamatopoulou et al., 2018).

31
Another common hallmark of nucleolar stress is the redistribution of nucleolar components to the nucleoplasm or the cytosol.
The presence of unbound r-proteins, specifically uL18 (RPL5), uL5 (RPL11), uS3 (RPS3), eS7 (RPS7), and uS12 (RPS23), in the
cytosol is a prime example, and is especially associated with ribosomopathies (Bhat et al., 2004; Bursać et al., 2012; Chen et
al., 2007; Dai et al., 2004; Lohrum et al., 2003; Yadavilli et al., 2009; Zhu et al., 2009). NPM1 has also been described to
relocalise to the nucleoplasm under a wide range of conditions, such as serum starvation, viral infection, hypoxia, and UV
irradiation (Chan et al., 1985; Kurki et al., 2004; Yang et al., 2016) , as well as treatment with a wide range of inhibitors, including
ActD, DNA topoisomerase II inhibitors (doxorubicin and daunomycin 8), a PIK3 inhibitor (toyocamycin), and a JAK/STAT3 inhibitor
(cucurbitacin B) (Chan et al., 1987; Chan and Chan, 1999; Duangmano et al., 2012; Finch et al., 1997; Yung et al., 1985).
Other nucleolar proteins, namely nucleolin and PICT1, are also known to translocate to the nucl eoplasm under nucleolar stress
(Avitabile et al., 2011; Lee et al., 2012). According to the classical model, the accumulation of these proteins stabilise p53,
which brings about cell cycle arrest and apoptosis, however, p53-null cells are equally susceptible to nucleolar stress, and
mechanisms independent of p53 signalling have since been described (Dai et al., 2007; Fumagalli et al., 2012; Pestov et al.,
2001; Rubbi and Milner, 2003; Russo et al., 2013; Yuan et al., 2005) .

2.3.2 The morphology of nucleolar stress

Figure 7. The morphology of nucleolar stress. Nucleolar stress is characterised by different kinds of structural perturbations, such as
enlarged nucleoli, nucleolar caps, or “beaded necklace” structures. Other markers of nucleolar stress include nucleocytoplasmic release
of NPM1, or accumulation of r-proteins. (Immunofluorescence adapted from (Lafontaine et al., 2021))
In the view of the nucleolus as a liquid condensate, relocalisation of nucleolar proteins can be interpreted as a destabilisation of
the liquid phases by stoichiometric imbalance (Lafontaine et al., 2021). As the quantity of pre-rRNA is altered, either through
compromised production, or through accumulation of unprocessed intermediates, the relative requirement for nucleolar proteins
also changes. NPM1 translocation has long been regarded as a gold standard indicator of nucleolar stress (Yang et al., 2018),
but in this light, it may be a manifestation of the shutting-down of nucleolar activity (Riback et al., 2020). The accumulation of
free r-proteins may reflect the inability to produce sufficient pre-rRNA to incorporate them; indeed, many ribosomopathies are
caused by a relative imbalance of one of the r-proteins (Aspesi and Ellis, 2019; Kampen et al., 2020; Mills and Green, 2017).

Finally, if viewed as a liquid phase condensate, nucleolar stress can also manifest itself from alterations in liquid-phase dynamics.
A recent study has demonstrated that gelation of the nucleolus, through optogenetic aggregation of NPM1, leads to rRNA
processing defects (Zhu et al., 2019).

The nucleolus is a highly structured organelle, maintaining the thousands of factors necessary for ribosome biogenesis
concentrated and organised. Its structure is intimately linked to function, and any perturbations in one, have repercussions on the
other.

32
 INTRODUCTION

3. THE NUCLEOLUS, TRANSLATION & C9-ALS/FTD

Through the discovery of mutations in TARDBP and other RBPs, their involvement in the pathology of ALS became clear, and the
field shifted focus away from oxidative stress and towards RNA metabolism. As such, characterisation of the link between
nucleolar alterations and C9-ALS rapidly followed the discovery of the HRE-derived DPR products.

3.1 NUCLEOLAR STRUCTURE AND DPRs

During the initial description of the effects of each of the DPRs, different groups coincided on the nucleolar localisation of poly(PR)
and poly(GR), as well as their particular toxicity (Kwon et al., 2014; Mizielinska et al., 2014; Tao et al., 2015; Wen et al., 2014).
R-rich DPRs proved to cause nucleolar swelling, and perturbed morphology in several in vitro models (Haeusler et al., 2014; Tao
et al., 2015; Wen et al., 2014), and the same alterations have since been seen in animal models. Increased nucleolar area is an
indicator of nucleolar stress, as are the morphological aberrations. Poly(GR) expression increased nucleolar volume 18-fold in
Drosophila brains (Mizielinska et al., 2017), while mice expressing a human bacterial artificial chromosome (BAC) with an HRE
of 800 copies also showed larger nucleoli compared to controls (O’Rourke et al., 2015). In addition, several studies coincide on
mislocalisation of the nucleolar proteins NPM1 and NCL, another classical sign of nucleolar stress (Haeusler et al., 2014;
O’Rourke et al., 2015; Tao et al., 2015; Wen et al., 2014) .

While the data in vitro and in animal models points clearly towards nucleolar dysfunction, patient in vivo evidence is less clear.
Nucleolar localisation of R-rich poly(PR) and poly(GR) is not common in patient post-mortem tissues (Schludi et al., 2015).
However, despite the infrequency of DPR inclusions, a general tendency towards smaller nucleoli has been reported both in frontal
cortex and spinal cord neurons of C9-ALS/FTD patients, indicating generalised nucleolar alterations, even in the absence of
pathological markers (Aladesuyi Arogundade et al., 2021; Mizielinska et al., 2017). Compellingly, one of the studies found that
if only cells harbouring poly(GR) inclusions or HRE RNA foci are considered, enlarged nucleoli become evident (Mizielinska et al.,
2017). Heausler and team also saw a variety of nucleolar pathologies, including increased nucleolar volume, as well as NPM1
and NCL redistribution, in B-lymphocytes and induced pluripotent stem cell (iPSC)-derived motor neurons extracted from C9-ALS
patients (Haeusler et al., 2014).

A possible conciliatory explanation for these data is that enlarged nucleolar pathology is an early event in ALS pathogenesis, and
may not always be detectable in post-mortem tissue. Interestingly nucleolar aberrations need not be accompanied by TDP-43
mislocalisation, as DPR accumulation precedes TDP-43 pathology (Aladesuyi Arogundade et al., 2021; Baborie et al., 2015;
Gami et al., 2015; Herrmann and Parlato, 2018). In fact, DPRs have been found in spinal fluid of pre-symptomatic HRE carriers
(Lehmer et al., 2017). Although postulated to be a specific issue associated to C9-ALS, sporadic ALS cases have also shown
shrunken nucleoli, hinting at a universalising mechanism (Aladesuyi Arogundade et al., 2021).

3.2 RIBOSOME BIOGENESIS AND DPRs

In agreement with nucleolar stress, exposure to poly(PR) and poly(GR) peptides leads to functional defects in ribosome
biogenesis. Several groups have reported decreased levels of mature rRNA, accumulation of pre-rRNA processing intermediates,
or both (Kwon et al., 2014; Lee et al., 2016; Suzuki et al., 2018; Tao et al., 2015; White et al., 2019) . Consistently, 45S rRNA
processing defects have also been confirmed in patient-derived cells (Haeusler et al., 2014). Proteomic approaches to identify
poly(PR) and poly(GR) interactors have revealed an enrichment of nucleolar and RNA-binding proteins, supporting a prominent
nucleolar role (Lee et al., 2016; Suzuki et al., 2018; Tao et al., 2015) . Interestingly, Suzuki and team report that the interaction
with a set of RNA helicases is RNA-dependent, and is ablated in the presence of RNase A (Suzuki et al., 2018). Indeed, many
such interactions may yet be uncovered, given the ability of poly(PR) to bind rRNA (Suzuki et al., 2018; White et al., 2019) .

3.3 PROTEIN SYNTHESIS AND DPRs

Finally, nucleolar defects are mirrored in a related deficiency, decreased translation, although whether the effect is direct , or
through inhibition of ribosome biogenesis, is yet unknown (Hartmann et al., 2018; Kanekura et al., 2016; Lee et al., 2016;
Rossi et al., 2015; Vanneste et al., 2019; Y.-J. Zhang et al., 2018). Errors in ribosome biogenesis decrease the number of
functional ribosomes, therefore translation inhibition is to be expected, however, it may also be repressed directly.

Kanekura and colleagues suggested that translation inhibition was direct, as poly(PR) peptides form insoluble
complexes with mRNA, inhibiting the access of ribosomes and translation initiation factors (Kanekura et al., 2016).

33
Several reports also coincide on poly(GR) and poly(PR) interaction with ribosomal proteins, although whether they are
in ribosomes, of in the free fraction is unknown (Hartmann et al., 2018; Kanekura et al., 2016; Lee et al., 2016; Lopez-
Gonzalez et al., 2016; Y.-J. Zhang et al., 2018). Direct mechanisms of translation inhibition likely contribute to the
repression of protein synthesis, in concert with nucleolar atrophy.

3.4 NUCLEOLAR LLPS AND DPRs

Besides functional and structural nucleolar defects, R-rich DPRs also can perturb the material properties of nucleoli, interfering
with their liquid dynamics (Frottin et al., 2019; Lee et al., 2016) . In fact, dynamic properties of many MLOs, including stress
granules, nuclear pores, nuclear speckles, RNA transport granules, and Cajal bodies, are slowed by exposure to poly(PR) or
poly(GR) (Boeynaems et al., 2017; Haeusler et al., 2014; Lee et al., 2016; Shi et al., 2017; K. Zhang et al., 2018; Y.-J. Zhang
et al., 2018).

One of the current theories is that DPRs can infiltrate the nucleoli, and compete for the interactions that form the condensate,
leading to the acquisition of a hardened material state (Frottin et al., 2019; Lee et al., 2016; White et al., 2019) . In line with this
theory, White and team demonstrated that poly(PR) peptides, through rRNA binding, interfere in the LLPS of NPM1 and rRNA, and
displace NPM1 from the nucleolus (White et al., 2019). Indeed, by virtue of their positive charge, poly(PR) peptides can undergo
coacervation with a number of polyanions, besides RNA, and may interact with other cellular components (Boeynaems et al.,
2019). Given the importance of electrostatic interactions, particularly with RNA, in the establishment of nucleoli, LLPS alterations
may contribute to DPR-mediated nucleolar stress.

4. THE NUCLEOLUS & AGEING

Ageing is a physiological organism-wide decline in homeostasis and function, eventually leading to death. Although once believed
to be the result of arbitrary wearing down of an organism’s components, we now know that it is a regulat ed process subject to
environmental input, and controlled by various genes and signalling routes. Ageing is accompanied by a number of consolidated
and interconnected molecular hallmarks, including genomic instability, epigenetic modifications, loss of p roteostasis, telomere
attrition, mitochondrial dysfunction, and deregulated nutrient sensing (López-Otín et al., 2013). Recent literature is bringing light
to nucleoli in the context of lifespan regulation, making nucleolar dysregulation an emerging hallmark of ageing (recently
reviewed in Tiku and Antebi, 2018).

As the organism ages, the ageing nucleolus accumulates a series of modifications at every level of structure and function, from
epigenetic and genomic modifications of the rDNA locus, down to its material properties. Strikingly, these modifications follow a
pattern. In broad terms, decreased nucleolar function correlates with extended lifespan, while modifications that activate th e
nucleolus shorten it. In the context of ageing, the modifiers of nucleolar activity are numerous and varied, however, they all
converge at this simple correlation. Age-related nucleolar modifications are summarised below.

5.1 THE rDNA LOCUS

Due its repetitive nature, and high transcriptional activity the rDNA is an inherently unstable genomic region, subject to age-related
copy-number variations (Kasselimi et al., 2022). Likewise, recent studies indicate that the rDNA loci accumulate repressive CpG
hypermethylation in rodents, humans and yeast (D’Aquila et al., 2017; Holland et al., 2016; Mansisidor et al., 2018; Salim et
al., 2017; Wang and Lemos, 2019). Both of these processes are strictly correlated with chronological age, in fact, the correlation
between CpG methylation and age in mice is so high that methylation status has age-predictive power (Wang and Lemos, 2019).

CpG methylation represses ribosome biogenesis, and fits into the line of nucleolar repression as an adaptive mechanism in ageing.
Indeed, a recent comparison between human foetuses and aged individuals showed a significant decrease in the number of active
NORs per cell with increased age, indicating a general repressive pattern (Lezhava et al., 2020).

5.2 NUCLEOLAR ACTIVITY

Nucleolar activity was unexpectedly linked with longevity in two recent studies (Buchwalter and Hetzer, 2017a; Tiku et al.,
2017). The first showed that a selection of long-lived animal models, including C. elegans, Drosophila, mice, and humans
undergoing dietary restriction, had smaller nucleoli than the controls (Tiku et al., 2017). On the flip side of the coin, fibroblasts
34
 INTRODUCTION
from patients with Hutchinson-Gilford progeria syndrome (HGPS), showed enlarged nucleoli, the size of adolescent HGPS donor’s
fibroblasts nucleoli being comparable to those of aged healthy donors (Buchwalter and Hetzer, 2017a). Nucleolar size is a
direct read-out of ribosome biogenesis, so these studies give a direct link between longevity and repression of nucleolar activity.

This pattern was again seen in a recent study in which RNA Pol I inhibition decreased nucleolar area and increased lifespan i n
flies, and it has been known since the 70s that senescent cells present a single expanded nucleolus (Bemiller and Lee, 1978;
Martínez Corrales et al., 2020). Indeed, over the last decade a plethora of studies have shown that repression of nucleolar
factors, including RNA Pol III, FBL, NSUN5, Mnt, NOG1, and the snoRNA Jouvence, decreases nucleolar size, and increases lifespan
in a variety of animal models (Demontis et al., 2014; Filer et al., 2017; Heissenberger et al., 2019; Kim et al., 2014;
Schosserer et al., 2015; Soulé et al., 2020; Tiku et al., 2017) . Consistently, there is also ample evidence of the association of
ageing with activation of nucleolar factors. Oocytes recovered from reproductively aged mice presented a single large nucleolus,
increased FBL and ribosomal levels (Duncan et al., 2017). Higher FBL, NCL, and nucleolar area were also found upon NOL12
downregulation, an rRNA processing factor that was downregulated in fibroblasts recovered from octogenarian donors compared
to young donors (Pinho et al., 2019).

Although the pattern associating nucleolar repression with extended lifespan is evident, several studies follow a conflicting line,
showing an age-related drop in ribosome biogenesis, both at the level of ribosomal proteins and rRNA (D’Aquila et al., 2017;
Jung et al., 2015). Conciliation of these observations may lie in a proposed compensatory mechanism favouring longevity (Jung
et al., 2015; Tiku et al., 2017).

Figure 8. Repression of nucleolar activity is associated with longevity. Organisms with extended lifespans, such as those undergoing
calorie restriction, have small nucleoli, which correspond to lower ribosome biogenesis and translation. Progeric cells present the
opposite: large nucleoli and increase translation.

5.3 TRANSLATION

Ribosome biogenesis and translation are directly coupled processes, and as such, the link between longevity and inhibition of
translation is well documented across various organisms. Downregulation of protein synthesis through depletion of ribosomal
proteins and translation initiation factors, or overexpression of a translational inhibitor, has anti-ageing effects in yeast, worms
and flies (Curran and Ruvkun, 2007; Hansen et al., 2007; Pan et al., 2007; Rogers et al., 2011; Steffen et al., 2008;
Syntichaki et al., 2007; Tohyama et al., 2008; Zid et al., 2009) . Consistently, long-lived nematodes have significantly lower
levels of ribosomal proteins, and reduced protein metabolism (Lan et al., 2019; Stout et al., 2013). Direct disruption aside, many
anti-ageing interventions, such as inhibition of mTOR signalling, insulin/IGF signalling, or dietary restriction, are up-stream
regulators of translation, and converge at protein synthesis repression, and, indeed, ribosome biogenesis.

Several theories have been proposed to explain how protein synthesis influences ageing. The first proposes that lifespan extension
is achieved by increasing the efficiency of the use of the cell’s resources, diverting them from non-essential processes that favour
young cells, but become detrimental in aged cells by competing for machinery and energy (Bjedov and Rallis, 2020; Gems and
Partridge, 2013; Steffen and Dillin, 2016) . The second theory revolves around a set of stress-response transcripts that are
activated when global protein synthesis is inhibited, resulting in the remodelling the proteome to favour stress resistance (Rogers
et al., 2011; Zid et al., 2009). A final line of evidence proposes that inhibition of translation improves accuracy and has an overall
35
favourable effect on the cell’s proteostasis (Martinez-Miguel et al., 2021; Suhm et al., 2018; von der Haar et al., 2017; Xie et
al., 2019).

5.4 NUCLEOLAR REGULATION & SIGNALLING

5.4.1 mTOR

Mechanistic target of rapamycin (mTOR) is the central rheostat of metabolism, and coordinates the cell’s synthetic activity to the
integrated input of growth signalling, nutrient availability, energetic status, and stress. Under favourable conditions, mTOR is
active, and pushes the cell towards anabolism and growth by activating biosynthetic routes. Activity of this pathway can be
attenuated pharmacologically using small chemical inhibitors such as rapamycin, the namesake of mTOR, or physiologically,
through dietary restriction (Liu and Sabatini, 2020). Inhibition of mTOR signalling, whether genetic or pharmacological, extends
lifespan in a plethora of organisms, including yeast, flies, worms and mice (Bjedov et al., 2010; Harrison et al., 2009; Jia et al.,
2004; Kaeberlein et al., 2005; Kapahi et al., 2004; Powers et al., 2006; Vellai et al., 2003; Wu et al., 2013) . Likewise, dietary
restriction, which is believed to act through the mTOR pathway, also promotes longevity (Hansen et al., 2007; Kaeberlein et al.,
2005; Kapahi et al., 2004).

Figure 9. mTOR coordinates the cell’s synthetic activity to the integrated input of growth signalling, nutrient availability, and energetic status.
Under favourable conditions, mTOR is active, and activates anabolic processes like ribosome biogenesis and translation. 4E-BP1 and
S6K1 are the principal effectors of mTOR in regulation of translation. Activity of this pathway can be attenuated pharmacologically using
small chemical inhibitors such as rapamycin.
As the most costly process, both in energy and resources, protein synthesis is one of the key points of control by mTOR, both at
the level of translation and ribosome biosynthesis (Buttgereit and Brand, 1995; Liu and Sabatini, 2020) . The key effectors of
mTOR are eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) and p70 S6 kinase 1 (S6K1).

4E-BP1 is a translational repressor, which is maintained phosphorylated and inert by active mTOR signalling. This leaves
eukaryotic translation initiation factor 4E (eIF4E) free to join the cap-binding complex, and initiate translation (Liu and Sabatini,
2020). Ablation of eIF4E reduced protein synthesis and extended lifespan in C. elegans (Syntichaki et al., 2007). Likewise, 4E-
BP is necessary to extend lifespan by calorie restriction in flies (Zid et al., 2009).

S6K1, on the other hand, is an activator of protein synthesis; it is phosphorylated by mTOR, and in turn phosphorylates ribos omal
protein 6 (eS6, previously RPS6). Importantly, yeast, worms, flies, and mice, harbouring a deletion of S6K1 live longer than the
controls (Selman et al., 2009). S6 phosphorylation appears to preferentially promote ribosome biogenesis over translation, as
translation was unaffected in mice harbouring a phospho-dead version of S6 (Chauvin et al., 2014; Ruvinsky et al., 2005) .

36
 INTRODUCTION
However, the S6K branch exerts direct control on ribosome biogenesis, through up-regulation of RNA Pol I and RNA Pol III
transcription factors, UBF1, TIF-1A, and MAF1 (Hannan et al., 2003; Mayer et al., 2004; Michels et al., 2010; Shor et al., 2010) .
In fact, over 75% of ribosome biogenesis factors are downregulated in S6K1/2-deficient mice, without a corresponding fall in
translation (Chauvin et al., 2014).

Inhibition of either translation or ribosome biogenesis independently of mTOR extends lifespan across a number of organisms,
suggesting that inhibition of mTOR regulates lifespan through both processes, although whether one is dominant over the other
remains an open question. It is evident how inhibition of ribosome biosynthesis can result in an inhibition of translation; however,
given that a large portion of translational machinery is dedicated to the synthesis of new ribosomal proteins, the opposite, although
less intuitive, is also true. Additionally, both processes are co-regulated by mTOR at several levels, and the independent genetic
inhibition of either one of the two extends lifespan. Given this extent of both functional and regulatory connectivity, it is difficult to
determine which of the two, or both, levels of the feedback loop are responsible for the effect on longevity. Which came first, the
chicken or the egg? Ribosome biosynthesis or translation?

Several lines of evidence can support the link of mTOR to the nucleolus in lifespan regulation. The most basic of these is th at
inhibition of mTOR decreases nucleolar size in several organisms, underscoring its role in rRNA synthesis (Neumüller et al., 2013;
Sheaffer et al., 2008; Tiku et al., 2017). S6K1 deletion in worms and mice extends lifespan (Hansen et al., 2007; Selman et
al., 2009), but is not associated with a global decrease in translation (Mieulet et al., 2007; Pende et al., 2004). Likewise,
rapamycin treatment inhibits the S6K1 branch more than the 4E-BP1 branch, and only has a small effect on global translation (Liu
and Sabatini, 2020).

5.4.2 MYC

MYC is one of the few transcription factors that can regulate all three RNA polymerases, and therefore can drive the entire
ribosome biogenesis programme (van Riggelen et al., 2010). MYC not only regulates the expression of RNAPol I and RNAPol III
subunits, and cofactors, but also directly binds to rDNA and 5S-rRNA locus regulatory regions, directly regulating their output
(Arabi et al., 2005; Gomez-Roman et al., 2003; Grandori et al., 2005; Poortinga et al., 2011, 2004; Shiue et al., 2009; Steiger
et al., 2008). MYC knock-down or deletion results in lower levels of rRNA across a range of models, including Drosophila larvae,
mice, and human or rat fibroblasts (Grewal et al., 2005; Hofmann et al., 2015; Johnston et al., 1999; Mateyak et al., 1997).

Figure 10. MYC is a central regulator of ribosome biogenesis. MYC can activate all three RNA Pols. MYC directly binds to rDNA and 5S-
rRNA locus regulatory regions, directly regulating the output of 45S and 5S rRNAs. MYC also regulates the expression of prote ins which
participate in ribosome assembly, including ribosomal proteins, FBL, NPM1, NCL, UBF, and snoRNAs. Finally, MYC directly participates
in translational regulation by control of expression of initiation factors, and tRNAs.

Finally, MYC also regulates the expression of a large number of RNAPol-II-transcribed proteins, which participate in ribosome
assembly, including ribosomal proteins, FBL, NPM1, NCL, UBF, nucleolar protein 56 (NOP56), dyskerin (DKC1), block of
proliferation 1 (BOP1), and snoRNAs (Boon et al., 2001; Coller et al., 2000; Herter et al., 2015; Kim et al., 2000; Romano et
37
al., 2017; Schlosser et al., 2003; Watson et al., 2002) . In fact, posterior studies, using -omic approaches, confirmed that the
core MYC expression signature in mammals is characterised by nucleolar and RNA processing factors, while proteomic analysis
of interactors confirmed that MYC also directly associates with a large number of nucleolar proteins (Ji et al., 2011; Kalkat et
al., 2018).

The overall ability to activate ribosome biogenesis and protein synthesis has been observed across several in vivo models (Iritani
and Eisenman, 1999; Johnston et al., 1999; Kim et al., 2000; Schuhmacher et al., 2001) , and makes MYC a potent
oncoprotein (Campbell and White, 2014). The role of MYC in ageing, however, is less well described. Intriguingly, Myc haploid
mice had longer lifespans. Importantly, these mice also showed downregulation of both IGF1 and mTOR pathways, and decreased
rRNA levels and protein synthesis (Hofmann et al., 2015). Likewise, downregulation of the Myc activator, Mtbp, led to a 20%
increase in lifespan, and a similar phenotype to Myc haploinsufficiency (Grieb et al., 2016).

5.5 NUCLEOLAR STRESS

The most direct link between nucleolar stress and longevity is through p53, as p53 activation is the best-characterised mechanistic
output of nucleolar stress. Several mouse models with hyperactive, or deregulated p53 present premature aging, although none
of these models focussed on the nucleolus (Armata et al., 2007; Liu et al., 2010; Maier et al., 2004; Tyner et al., 2002).
However, the association is explicitly documented in several recent studies (Báez-Becerra et al., 2020; Zhang et al., 2020). In
one study, nucleolar stress was induced in smooth muscle tissue of mice by the conditional deletion of TIF-1A, and led to p53
activation, senescence and vascular degeneration (Zhang et al., 2020).

Wiedemann-Rautenstrauch syndrome (WRS) is a neonatal progeria, caused by mutations in a subunit of RNAPol III, POLR3A (Jay
et al., 2016; Paolacci et al., 2018). Recently, a group described disrupted nucleolar morphology, decreased expression of rRNA,
p53 activation, and senescence in fibroblasts derived from WRS patients (Báez-Becerra et al., 2020). Compellingly, mutations in
POLR3A are also associated with adolescent-onset spastic ataxia, connecting the progeric phenotype with neurodegeneration
(Minnerop et al., 2017).

Likewise, p53 has appeared in association with other longevity-associated factors. MYC overexpression has been shown to induce
nucleolar stress and stabilise p53; a compelling finding to contrast with the long-lived Myc heterozygous mice (Hofmann et al.,
2015; Morcelle et al., 2019a). Fibroblasts from aged donors present nucleolar stress and reduced levels of NOL12, consistently,
NOL12 repression activates nucleolar stress and p53 in vitro (Pinho et al., 2019).

As nucleolar stress can manifest in a p53-independent manner, other associations of nucleolar stress and ageing is a reasonable
possibility. One such manifestation is the age-associated hardening of the nucleolus observed in old C. elegans, which was
reflected in decreased dynamics of FBL (Feric et al., 2016). As the field of nucleolar stress is further fleshed out, especially the
p53-independent branches, further links to ageing may be uncovered.

ALS is a devastating neurodegenerative disease, with a complex pathogenic landscape. The mutation in C9ORF72 generates a
series of toxic R-rich DPR products, which are believed to be the key drivers of C9-ALS/FTD. In this Doctoral Thesis, we have
provided a unifying molecular mechanism to explain the many cellular perturbations caused by R-rich peptides, summarised in
section 1.4. We proposed that by virtue of their positive charge, poly(PR) and poly(GR) peptides can bind to nucleic acids,
interfering with any cellular process involving these intermediates. Among the resulting cellular disturbances, some of the most
prominent are problems in translation and ribosome biogenesis.

In an attempt to develop a strategy to overcome poly(PR) toxicity we isolated a cell line which became resistant to them by
spontaneous mechanisms. We found that this line had lower nucleolar activity and translation. Targeting these processes with
either mTOR inhibition or c-MYC down-regulation protected against poly(PR) toxicity. Finally, we developed mouse model
expressing poly(PR) peptides in all tissues. The animals developed an unexpected premature ageing phenotype, associated with
nucleolar stress, and hyperactivation of mTOR and MYC. Reducing nucleolar activity through mTOR inhibition extended lifespan
in these animals. Surprisingly, RNAseq data from differentiated motor neurons derived from C9-ALS patients showed that both of
these routes are also hyperactivated, suggesting that therapies targeting the nucleolus may be beneficial in C9-ALS/FTD.

38
 OBJECTIVES

OBJECTIVES

39
1. To uncover the mechanisms of toxicity of arginine-rich, ALS-associated, poly(PR) peptides.

2. To discover cellular resistance pathways to poly(PR) toxicity, and develop potential therapies.

3. To develop a mouse model of poly(PR) toxicity, and test the interventions identified in the previous objective.

40
MATERIALS AND METHODS

41
 1.

CELL BIOLOGY

1.1 CELL CULTURE

All cells were cultivated at 37ºC, in a humidified air atmosphere with 5% CO 2, unless otherwise specified.

U2OS, BHK-21, HeLa-SBP, HeLa-RPS9SBP, NSC34, inducible U2OS-TRex(PR)97 and NSC34 TRex (PR)97, cells were cultivated in
standard high glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% foetal bovine serum (FBS), 2 mM L-
glutamine and 1% penicillin/streptomycin, using tetracycline-free FBS (PAN biotech, P30-3602) in the case of inducible cells.
Mouse embryonic fibroblasts (MEFs) were cultivated in DMEM supplemented with 15% FBS, and under hypoxic conditions (5%
CO2, and 5% O2). Mouse embryonic stem cells (mES) and the previously described mouse ES Cas9 cells (Ruiz et al., 2016) were grown
on gelatin in DMEM supplemented with 15% knockout serum replacement (Invitrogen), leukaemia inhibitory factor (LIF) (1000
U/mL), 0.1 mM nonessential amino acids, 1% glutamax and 55 mM β-mercaptoethanol. All cell lines are regularly tested for
mycoplasma contamination.

U2OS, BHK-21, R1 mES, and NSC34 cells were acquired from ATCC as well as the parental HeLa from which stable transfectants
were made. U2OS-TRex cells were a kind gift from Steve Jackson. Immortalised MEFTp53-/- and MEFTp53-/-Tsc2-/- cells were a kind gift
from Alejo Efeyan. HCT116-RPL29 HALO cells were a kind gift from Jeffrey Harper.

1.2 TOOL CELL LINE GENERATION

Stable transfectants were generated using pINTO-C-(PR)97-HF in U2OS-TRex and NSC34-TRex lines. The (PR)97 construct was
assembled through consecutive rounds of annealed oligonucleotide insertions. The codons corresponding to proline and arginine
were selected to avoid the formation of GC-rich repetitive sequences, thus avoiding the possibility of RNA-based toxicity. Briefly,
two annealed and phosphorylated (T4 PNK, M0201S, New England Biolabs) oligonucleotides, corresponding to 30 copies of PR
were ligated into the EcoRI and BamHI sites through compatible sticky ends in the pINTO-C-HF vector, forming a novel SacII site
at the intersection (EcoRI, R0101S; BamHI, R0136S; T4 DNA ligase, M0202; all from New England BioLabs). The resulting vector
with 30 copies was digested with SacII (R0157S, New England BioLabs), and a third annealed and phosphorylated oligonucleotide,
containing 15 more copies of PR with compatible sticky ends was ligated, destroying the SacII site at one end, and recovering it
at the other. Through consecutive rounds of digestions with SacII and insertions of the (PR) 15 fragment the construct was built up
to 97 copies of PR.

MEFs were generated from mouse embryos extracted at day 14 post-coitum. Under sterile conditions, the hepatic tissue was
discarded, and a tissue sample set aside for genotyping. The rest of the tissue was mechanically disgregated using a sterile blade,
and then digested with pre-warmed trypsin 0.25% EDTA (Gibco), after which it was subjected to further mechanical disgregation
using a pipette. The resultant cell suspension was plated in DMEM 15% FBS, and allowed to reach confluence.

Spontaneously resistant NSC34R clones were generated from wild-type NSC34 cells. 4,000 cells per well of a 6 well plate and the
next day the cells were treated with 5 μM (PR) 20 for 10 days, changing medium supplemented with fresh (PR) 20 every 2 days. A
few remaining (PR)20 resistant cells were trypsinised and dispensed as single cells in 96 well plates by FACSAria TM III (BD
Biosciences). The cells were subsequently exposed to 10 µM (PR)20 for 2 – 3 weeks, with the medium changed each week.
Eventually, colonies in some plates appeared.

1.3 MOTOR NEURON DIFFERENTIATION

For NSC34 differentiation, cells were seeded onto plates containing DMEM supplemented with 10% FBS, 2 mM L-glutamine and
1% penicillin/streptomycin. On the next day, the media was exchanged to Neurobasal medium (Thermo Fisher scientific,
2121103049) containing a B-27 supplement (Thermo Fisher scientific, 17504044) for 48 h.

For the differentiation of spinal motor neurons from mESCs, we used the previously described protocol (Wichterle et al., 2002).
Briefly, embryo bodies (EBs) were generated by culturing mESCs in suspension in non-adherent plates under constant shaking
over 2 days. Differentiation was promoted by exposing EBs to the smoothened agonist SAG (500 nM, Peprotech, 9128694) and
retinoic acid (100 nM, Sigma, R2625-100MG) for 5 days, at the end of which they were dissociated and plated in 96- well plates at

42
 MATERIALS AND METHODS
200,000 cells/cm2. The plates were previously coated with poly-L-ornithine (Sigma-Merck, A-004-C), followed by laminin (Sigma,
L2020-1MG). Motor neuron (MN) cultures were maintained in medium supplemented with GDNF and BDNF (10 ng/mL, Peprotech,
450-02, 450-10).

1.4 TREATMENTS

(PR)20, (GR)20, (PK)20 and (GA)20 dipeptide repeats with a C-terminal HA epitope tag were synthesized at Genscript. Fluorophore-
labelled oligonucleotides were synthesized by Sigma, with the following sequences: Cy3-5´-DNA (CCACTGCACCGCTGCTAGG);
Cy5-5´- DNA (CCTAGCAGCGGTTGCAGTGG); Cy3-5´-RNA (CCACUGCACCGCUGCUAGG) and Cy5-RNA
(CCUAGCAGCGGUUGCAGUGG).

The references of the remaining compounds used in cell treatments are summarised in Table 4.

Table 4. Compounds and peptides, and their references, used for treatments in vitro.

Compound Reference

(GA)20 Genscript N/A

(GR)20 Genscript N/A

(PK)20 Genscript N/A

(PR)20 Genscript N/A

Actinomycin D Sigma A9415

AZ20 GVK-BIO CNO-03R-15

BSA New England Biolabs B900S

Camptothesin Sigma C9911

Cisplatin Sigma P4394

CX-5461 Selleckchem S2648

Doxycycline Sigma D9891

Heparin Sigma H3393

Protamine Sigma P4005

Rapamycin Alpha Aesar J62473

Torin-1 Selleckchem S2827

1.5 siRNA TRANSFECTION

Exponentially growing U2OS and U2OS (PR)97, or NSC34 (PR)97 cells were transfected in suspension with 50 nM or 10 nM, respectively,
of control siRNAs, or siRNAs targeting human C-MYC or mouse C-Myc, respectively (Horizon Discovery biosciences, ON-
TARGETplus siRNAs), using Lipofectamine RNAiMAX (Thermo Fisher Scientific), according to the manufacturer’s protocol. The
cells are seeded 24 h post-transfection, at 5,000 or 10,000 per well, respectively, in µCLEAR bottom 96-well tissue culture plates
(Grenier Bio-One), and treated 24 h later.

1.6 CELL VIABILITY

For the anion rescue experiments in motor neurons, 4,000 NSC34 cells, or 60,000 MNs, were seeded per well in a 96-well tissue
culture plate and treated with the indicated concentrations of (PR) 20 alone or together with 4 µM of 19 or 38 nt-long Cy5- RNA or
Cy5-DNA oligonucleotides, or the indicated concentration of heparin. 36 hours after the treatment, cell viability was measured

43
using a luminescent system (CellTiter-Glo, Promega), according to the manufacturer’s protocol. Viability is plotted as percentages
compared to untreated controls.

For the inducible U2OS(PR)97 cells, viability was quantified by high throughput microscopy (HTM). 5,000 cells were seeded, and
treated with 1 µL/ mL doxycycline (dox), alone or with other treatments. After the indicated time, the c ells were fixed with 4%
paraformaldehyde (PFA in PBS, and stained with DAPI. Images were automatically acquired from each well using an Opera High -
Content Screening System (Perkin Elmer). A 10x magnification lens was used and images were taken at non-saturating conditions.
Images were segmented using DAPI signals to count the number of cells.

For the inducible NSC34(PR)97 cells, viability was quantified by manual counting of alive cells. 100,000 cells were seeded on gelatin
pre-treated 12-well plates, and on the following day treated with 1 µg/mL doxycycline with 50 nM rapamycin, or 50 nM torin-1. 72
hours later the cells were trypsinised, and counted, using trypan blue to identify the dead cells.

To test resistance to different drugs of NSC34 WT cells and NSC34R (blue), 10,000 cells were seeded, and treated with the non-
nucleolar-stress-inducing compounds (AZ20 (ATRi), 20 µM, cisplatin, 25 µM, and camptothesin (CPT), 8 µM), and nucleolar-stress-
inducing compounds ((PR) 20, 20 µM, ActD 5 nM, and CX, 10 nM) on the following day. In the case of the mTOR inhibitor
experiments, NSC34WT were pre-treated with 50 nM rapamycin, or 50 nM torin1. In the case of MYC knock-down (KD), 5000 cells
were seeded 24 h post-transfection, and treated 24 h later. Viability was quantified 24 hours after treatment using a luminescent
system (CellTiter-Glo, Promega).

In the experiments using MEFs, 2000 cells were seeded, and treated with doxycycline, with or without rapamycin (1 nM), on the
following day. Viability was quantified 48 hours after treatment using a luminescent system (CellTiter-Glo, Promega).

1.7 CLONOGENIC ASSAYS

For the anion rescue experiments, 2,000 U2OS cells were seeded in 6-well tissue culture plates in culture medium. The following
day, cells were incubated with 10 µM (PR) 20 alone or in combination with 2 µM of 19 (CCACTGCACCGCTGCTAGG) or 38
(CCACTGCACCGCTGCTAGGATCGCCTGAAATCGTTGGC) nucleotide-length ssDNA molecules. After 2 days, the medium was
changed and cells were then grown for 8 additional days in untreated medium.

U2OS (PR)97 cells were simultaneously treated with 30 nM rapamycin or 3 nM torin-1, with doxycycline, for 48 h, and then allowed to
grow for 10 days before fixing. At the end of the experiments, cells were fixed and stained with 0.4% methylene blue in metha nol
for 30 min.

1.8 IMMUNOFLUORESCENCE AND HIGH THROUGHPUT MICROSCOPY

For immunofluorescence, cells were fixed with 4% PFA prepared in PHEM buffer (60 mM Pipes, 25 mM Hepes, 10 mM EGTA, 2
mM MgCl2 pH 6.9) containing 0.2% of Triton X-100, and permeabilised with 0.5% Triton X-100 after fixation. For HTM, cells were
grown on µCLEAR bottom 96-well plates (Greiner Bio-One) and immunofluorescence of γH2AX (Millipore; #05-636) was performed
using standard procedures. Analysis of DNA replication by EdU, transcription by EU and translation by OPP or HPG incorporation
were done using Click-It kits (Invitrogen) following the manufacturer’s instructions. In all cases, images were automatically
acquired from each well using an Opera High-Content Screening System (Perkin Elmer). A 20x or 40x magnification lens was used
and images were taken at non-saturating conditions. Images were segmented using DAPI signals to generate masks matching
cell nuclei, from which the mean signals for the rest of the stainings were calculated. The references to all primary and sec ondary
antibodies can be found in Table 5.

Table 5. Antibodies used in this thesis, their references, use and dilutions

Host
Antibody Reference Use Dilution
species

Primary antibodies

ACTIN Sigma A5441 Mouse WB 1:500

C-MYC Santa Cruz CS-40 Mouse WB (h) 1:250

C-MYC Abcam ab32072 Rabbit WB (m) 1:500

44
 MATERIALS AND METHODS
COILIN Kind gift from Angus Lamond Rabbit IF 1:100

FBL Cell Signalling 2639 Rabbit IF, ivIF 1:250, 1:100

1:1000,
HA-tag Roche 11867423001 Rat IF, ivIF
1:500

HA-tag Cell Signalling 2367 Mouse IHC 1:500

PR Kind gift from Giovanna Roncador Rat ivIF 1:100

RPS2 Santa Cruz sc-130399 Mouse WB 1:500

RPS6 Cell Signalling 2217 Rabbit WB, IHC 1:500

p-RPS6 (Ser240/244) Cell Signalling 2215 Rabbit WB, IHC 1:500

S6K Cell Signalling 2708 Rabbit WB 1:500

p-S6K (Thr389) Cell Signalling 9234 Rabbit WB 1:500

SMN Santa Cruz sc-32313 Mouse IF 1:100

TUBULIN Sigma T9026 Mouse WB 1:5000

TUBB3 Biolegend 801202 Mouse IF 1:2000

UBF Santa Cruz sc-13125 Mouse IF 1:500

Secondary Antibodies

Anti-Mouse IgG-488 Invitrogen A11001 Goat IF 1:500

Anti-Mouse IgG-550 Bethyl A90-516D3 Goat IF 1:500

Anti-Mouse IgG-647 Invitrogen A21463 Chicken IF 1:500

Anti-Rabbit IgG-488 Invitrogen A21441 Chicken IF, ivIF 1:500

Anti-Rabbit IgG-550 Bethyl A120-201D3 Goat IF 1:500

Anti-Rabbit IgG-647 Invitrogen A21443 Chicken IF 1:500

Anti-Rat IgG-488 Invitrogen A21470 Chicken IF 1:500

Anti-Rat IgG-594 Invitrogen A21471 Chicken IF, ivIF 1:500

Anti-Rat IgG-647 Bethyl A110-105D5 Goat IF 1:500

Anti-Mouse Licor 680 Invitrogen A21057 Goat WB 1:2000

Anti-Mouse Licor 800 Li-Cor 925-32210 Goat WB 1:5000

Anti-Rabbit Licor 680 Invitrogen A21076 Goat WB 1:2000

Anti-Rabbit Licor 800 Li-Cor 926-32211 Goat WB 1:5000

IF: Immunofluorescence; ivIF: In vivo immunofluorescence; IHC: Immunohistochemistry; WB: Western blot; (m): mouse; (h):
human

45
1.9 PEPTIDE LABELLING

The Cy®3 Mono 5-pack kit (Sigma) was used for the labelling of protamine. Briefly, 0.150 mM salmon protamine was incubated
with 0.850 mM of Cy3 NHS Ester in 20 mM Hepes and 150 mM NaCl buffer overnight at 4°C, followed by the addition of 1 M Tris
23 pH7.5 in order to quench the reaction. Cy3-protamine was purified using 3K Amicon Ultra 0.5 mL centrifugal filters (Sigma).

1.10 IN SITU HYBRIDIZATION

In situ hybridization was carried out as previously described (Palanca et al., 2014). Briefly, U2OS cells were fixed with 4% PFA
prepared in PHEM buffer. An oligo dT(50)-mer, 5′-end labelled with biotin (MWG-Biotech, Germany) was used as a probe for in situ
hybridization to poly(A) RNA. After hybridization, cells were washed and the hybridization signal was detected with FITC-avidin for
30 min. All samples were mounted with the ProLong anti-fading medium (Invitrogen).

1.11 CRISPR/CAS9 EFFICIENCY

The previously described ESCas9 mESC line (Ruiz et al., 2016) which carries a Doxycycline-inducible Cas9 was co-infected with
lentiviral vectors expressing EGFP (pLVTHM, Addgene, 12247) and an EGFP-targeting sgRNA cloned in the pKLVU6gRNA-
PGKpuro2ABFP backbone (Addgene, 50946). Two independent clones with stable exp ression of all components were seeded on
gelatin. After six hours, doxycycline (1 µg/mL) and/or (PR) 20 (10 µM) were added to the medium. 72 hours later, cells were
recovered and the percentage of GFP-positive cells was quantified by flow cytometry using the FlowJo software (BD).

1.12 VIRAL INFECTION

BHK-21 cells were infected with Sindbis virus (Alphavirus, ssRNA genome with positive polarity) at a MOI of 20 viral PFU/cell in
the absence or presence of (PR) 20. Cells were collected 4 hours after infection and total RNA was purified using RNeasy Mini Kit
(Quiagen). Virus-specific primers (F:GGTACTGGAGACGGATATCGC and 28 R:CGATCAAGTCGAGTAGTGGTTG) were used to
detect viral RNA by qRT-PCR, which were normalized against cellular GAPDH.

1.13 HALO PULSE-CHASE

Halo pulse-chase experiments to label pre-existing RPL29 and newly synthesised RPL29 were carried out as previously described
(An et al., 2020). Briefly, HCT116-RPL29 HALO cells were seeded in 96-well plates, and on the following day treated with TMR-Halo
ligand (Promega, G8251) for 1 hour. After three washed of 10 minutes with DMEM media, the cells were treated with media
containing R110 Halo ligand (Promega, G3221), with or without (PR)20 and rapamycin, for 16 hours. The cells were then fixed with
4% PFA, and analysied by HTM.

2.

MOLECULAR BIOLOGY

2.1 WESTERN BLOT

Cell pellets were recovered, and washed with cold PBS, before lysis at 4ºC, on a shaker, using Urea buffer ( 50 mM Tris, pH 7.5, 8
M urea, and 1% CHAPS). To obtain mouse tissue protein extracts, a sample of the tissue was homogenised using zirconium beads
in RIPA buffer (50 mM Tris, pH 8.0, 0.2% nonidet-P40 , 200 mM NaCl, 50 µM glicerolphosphate, and 1% tween-20) with protease
and phosphatase inhibitors. The protein fraction was isolated by centrifugation at 13.2 rpm, for 15 minutes, and quantified using
the Bio-Rad Protein Assay (Bio-Rad). Approximately 20 µg of sample was mixed with NuPAGE LDS (LifeTechnologies) and 10 mM

46
 MATERIALS AND METHODS
dithiothreitol (DTT) (Sigma), and incubated at 70ºC for 10 minutes. The extracts were resolved in precast 4-20% gradient
polyacrylamide gels (Invitrogen), and transferred using standard methods. After blocking, the membrane was incubated overnigh t
at 4ºC with the primary antibody, and 1 h at room temperature with the seconda ry. A complete list of all antibodies used can be
found in Table 5. Fluorophore-conjugated secondary antibodies were used for detection, using the Li-Cor LCx system.

2.2 IMMUNOPRECIPITATION

10x106 Hela-SBP and Hela-RPS9SBP cells were lysed in cold RNA-IP lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1 mM MgCl 2,
2 % NP-40, 10% glycerol and freshly added Complete protease inhibitors) and incubated with 30 µL of Strep-Tactin beads (IBA) for
1 h at 4°C with constant shaking. The beads were washed 6 times in NET2 buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.5% Triton
X-100).

2.3 CHROMATIN FRACTIONATION

After treatment with (PR) 20 or protamine, cells were washed twice with ice-cold phosphate-buffered saline (PBS), resuspended in
180 µL of ice-cold hypotonic lysis buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA containing protease and phosphatase
inhibitors), and incubated on ice for 10 min, followed by addition of 20 µL of Nonidet P-40. After 3 min at room temperature, cells
were vortexed and the cytosolic fraction was obtained by centrifugation for 5 min at 2,500g. The nuclear pellet was resuspended
in high-salt-concentration extraction buffer (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA containing protease and phosphatase
inhibitors) and incubated with shaking at 4°C for 1 h. To obtain the chromatin fraction, the pellet was then extracted in 50 mM Tris,
pH 7.5, 8 M urea, and 1% CHAPS.

2.4 ISOLATION OF RNA-BINDING PROTEINS

The systems-wide purification of RBPs was developed as performed reported (Castello et al., 2013). Briefly, 5x150 cm2 dishes of
60 % confluent U2OS cells were treated for 4 hours with 20 µM of (PR) 20 or protamine. RBPs and polyadenylated RNAs were
crosslinked by irradiating the cells with 0.15 J/cm2 (~1 min) at 254 nm UV, and non-irradiated cells were used as a control. Cells
were lysed and proteins covalently bound to mRNA were captured with oligo(dT) magnetic beads. After stringent washes, the
mRNA interactome was determined by quantitative mass spectrometry (MS).

2.5 POLYSOME ANALYSES

HeLa-RPS9SBP cells were treated with either water as control or 10 μM (PR) 20 during 16 hours. U2OS(PR)97 cells were treated with
doxycycline for 2 days.

Ribosomes were stalled by addition of 100 µg/mL cycloheximide (CHX) for 5 min, and cells were lysed in polysome lysis buffer
(15 mM Tris-HCl pH 7.4, 15 mM MgCl2, 300 mM NaCl, 1% Triton-X-100, 0.1% β-mercaptoethanol, 200 U/mL RNAsin (Promega), 1
complete Mini Protease Inhibitor Tablet (Roche) per 10 mL). Nuclei were removed by centrifugation (9300×G, 4°C, 10 min) and the
cytoplasmic lysate was loaded onto a sucrose density gradient (17.5–50% in 15 mM Tris-HCl pH 7.4, 15 mM MgCl2, 300 mM NaCl
and, for fractionation from BMDM, 200 U/mL Recombinant RNAsin Ribonuclease Inhibitor, Promega). After ultracentrifugation
(2.5 h, 35,000 rpm at 4°C in a SW60Ti rotor), gradients were eluted with a Teledyne Isco Foxy Jr. system into 16 fractions of similar
volume.

All the fractions were analysed for the polysome studies in the HeLa-RPS9SBP, however, in the case of U2OS (PR)97 the first,
ribosome-free, fractions, were compared with polysomes.

2.6 MASS SPECTROMETRY

IP samples were eluted in urea, FASP-digested with Lys-C/trypsin and analyzed by LCMS/ MS. Label-free quantification was
performed using MaxQuant. Chromatin and whole cell extract samples were trypsin-digested using S-traps, isobaric-labelled with
iTRAQ 8-plex (chromatin) or TMT 11-plex (whole cell) reagents and pre-fractionated with RPHPLC at high pH. Fractions were then
analysed by LC-MS/MS and raw data was processed with MaxQuant.

For RNA-bound proteomics, proteins were digested by means of standard FASP protocol. Briefly, proteins were reduced (15 mM
TCEP, 30 min, RT), alkylated (50 mM CAA, 20 min in the dark, RT) and sequentially digested with Lys-C (Wako) (o/n at RT) and
trypsin (Promega) (6 h at 37 °C). Resulting peptides were desalted using Sep-Pak C18 cartridges (Waters). LC-MS/MS was done
by coupling an UltiMate 3000 HPLC system to a Q Exactive Plus mass spectrometer (Thermo Fisher Scientific). Peptides were
47
loaded into a trap column Acclaim™ PepMap™ 100 C18 LC Columns 5 µm, 20 mm length) for 3 min at a flow rate of 10 µL/min in
0.1% FA. Then peptides were transferred to an analytical column (PepMap RSLC C18 2 μm, 75 µm x 50 cm) and separated using
a 89 min effective curved gradient (buffer A: 0.1% FA; buffer B: 100% ACN, 0.1% FA) at a flow rate of 250 nL/min from 2% to 42.5%
of buffer B. The mass spectrometer was operated in a data-dependent mode, with an automatic switch between MS (350-1400
m/z) and MS/MS scans using a top 15 method (intensity threshold signal ≥ 3.8e4, z ≥2). An active exclusion of 26.3 s was used.
Peptides were isolated using a 2 Th window and fragmented using higher-energy collisional dissociation (HCD) with a normalized
collision energy of 27.

2.7 SUCROSE GRADIENT MASS SPECTROMETRY

For ribosome-free fraction proteomics, samples from the sucrose gradient fractions were solubilized in 2% SDS, 100 mM TEAB
pH 7.55. Proteins were reduced and alkylated (15 mM TCEP, 25 mM CAA) 1h at 45 °C in the dark. Then, samples were digested
following the solid-phase-enhanced sample-preparation (SP3) protocol (Hughes et al., 2019). Briefly, ethanol was added to the
samples to a final concentration of 70% and proteins were incubated for 15 minutes with SP3 beads at a bead/protein ratio of
10:1 (wt/wt). Beads were rinsed using 80% EtOH and proteins were digested with 100 µ L of trypsin in 50 mM TEAB pH 7.55
(Promega, protein:enzyme ratio 1:50, 16 h at 37 °C). Resulting peptides were desalted using C18 stage-tips.

LC-MS/MS was done by coupling an UltiMate 3000 RSLCnano LC system to a Q Exactive HF mass spectrometer (Thermo Fisher
Scientific). Peptides were loaded into a trap column (Acclaim™ PepMap™ 100 C18 LC Columns 5 µm, 20 mm length) for 3 min, at
a flow rate of 10 µL/min in 0.1% FA. Then, peptides were transferred to an EASY-Spray PepMap RSLC C18 column (Thermo Fisher
Scientific) (2 µm, 75 µm x 50 cm) operated at 45 °C and separated using a 60 min effective gradient (buffer A: 0.1% FA; buffer B:
100% ACN, 0.1% FA) at a flow rate of 250 nL/min. The gradient used was, from 2% to 6% of buffer B in 2 min, from 6% to 33% B in
58 minutes, from 33% to 45% in 2 minutes, plus 10 additional minutes at 98% B. Peptides were sprayed at 1.5 kV into the mass
spectrometer via the EASY-Spray source and the capillary temperature was set to 300 °C.

The mass spectrometer was operated in a data-dependent mode, with an automatic switch between MS and MS/MS scans using
a top 15 method. (Intensity threshold ≥ 6.7E4, dynamic exclusion of 25 s and excluding charges +1 and > +6). MS spectra were
acquired from 350 to 1400 m/z with a resolution of 60,000 FWHM (200 m/z). Ion peptides were isolated using a 2.0 Th window
and fragmented using higher-energy collisional dissociation (HCD) with a normalised collision energy of 27. MS/MS spectra
resolution was set to 15,000 (200 m/z). The ion target values were 3e6 for MS (maximum IT of 25 ms) and 1E5 for MS/MS
(maximum IT of 15 ms).

2.8 IN VITRO RIBOSOME ASSEMBLY

Ribosomal subunits were purified from BHK21 cells using previously described procedures (Pisarev et al., 2007). Briefly, the
ribosomal fraction (P100) was treated with 1 mM puromycin for 15 min on ice and then for 15 min at 37ºC. The suspension was
adjusted to 0.5 M KCl and loaded onto 10 to 30% sucrose density gradients, which were centrifuged at 22,000 rpm for 16 h at 4 ºC
in a SW40 rotor. The peaks corresponding to 40S and 60S subunits were identified by optical density at 260 nm. Finally, fractions
were concentrated using YM-100 centricons. 1 pmol of 40S and 60S were incubated in assembly buffer (25 mM of Tris-HCl pH
7.5, 100 mM KCl, 5 mM MgCl2 and 3mM of DTT) for 45 minutes at 30 ºC. To control for non-assembly, the concentration of MgCl2
in the buffer was reduced to 1 mM.

2.9 ELECTRON MICROSCOPY

For negative staining 3 µL of purified 40S+60S ribosome fractions or alternatively 3 µL of 40S+60S ribosome fractions in the
presence of (PR)20 (1:10 molar ratio) were deposited onto freshly glow-discharged carbon-coated 400 mesh copper electron
microscopy (EM) grids (Electron Microscopy Sciences) and retained on the grid for 1 min. Afterwards, grids were washed with
three distinct 50 µL drops of MilliQ water. The excess of water was removed with filter paper and the grids were placed on the top
of three different 40 µL drops of 2% uranyl acetate and stained on the last drop for 1 min. The grids were then gently stripped for
4 s and air dried. Finally, grids were visualised on a Tecnai 12 transmission electron microscope (Thermo Fisher Scientific I nc.)
with a lanthanum hexaboride cathode operated at 120 keV. Images were recorded at 61320 nominal magnification on a 4kx4k
TemCam-F416 CMOS camera (TVIPS).

2.10 IN VITRO TRANSLATION

In vitro translation was performed in nuclease-treated rabbit reticulocyte lysates (RRL) (Promega, L4960) using a luciferase
mRNAs in the presence of the indicated concentrations of (PR) 20. Reactions were incubated for 60 min at 30ºC and a 5 µL aliquot
was used to measure luciferase activity in 100 µL of reaction buffer (15 mM K 2HPO4, 15 mM MgSO4, 4 mM EGTA pH 8, 4 mM DTT,
2 mM ATP and 0.1 mM luciferin) in a Berthold Luminometer. For radioactive measurements, in vitro translation was performed in

48
 MATERIALS AND METHODS
nuclease-treated RRL (Promega) using 150 ng of luciferase mRNA in the presence of 15 μCi of [35S]-Met for 60 min at 30°C.
Samples were denatured in sample buffer and analysed by SDS-PAGE and autoradiography.

2.11 RNA EXTRACTION FROM TISSUE AND RNASEQ

Total RNA was extracted from liver tissue using TRIzol reagent (Invitrogen), according to the manufacturer’s protocols. A portion
of the RNA was purified a second time with the RNA Clean & Concentrator-5 kit (Zymo Research), according to manufacturer’s
instructions, and submitted to standard quality controls. The sequencing library was constructed with the QuantSeq 3' mRNA-Seq
Library Prep Kit (Lexogen), and approximately 10 million reads were obtained by Illumina sequencing.

2.12 qRT-PCR

RNA was extracted from mESCs or NSC34 cells using the Absolutely RNA Microprep kit (Agilent). cDNA generated from mESC
was pre-incubated on ice for 5 min with increasing concentrations of (PR) 20. Out of this mixture, 50 ng of cDNA per reaction was
used. The real-time PCR reaction was carried out using the 2X SYBR Select Master Mix (Life Technologies). Each value was
normalised against that of the untreated reaction of the corresponding gene.

NSC34 rRNA levels were measured by real-time quantitative PCR after reverse transcription of RNA, using the SuperScript III
Platinum SYBR Green One-Step qRT-PCR Kit with ROX (Invitrogen), and 3 ng of total RNA. Each value was normalised against that
of Eif1 of the corresponding line.

The sequences of the primers used are as follows: Gapdh F TTCACCACCATGGAGAAGGC, Gapdh R CCCTTTTGGCTCCACCCT, 45S
F GGCTGGGGTTGGAAAGTTTC, 45S R CAAGGGCATTCTGAGCATCC, 18S F CTGGATACCGCAGCTAGGAA, 18S R
GAATTTCACCTCTAGCGGCG, 5.8S F GTCGATGAAGAACGCAGCTA, 5.8S R AACCGACGCTCAGACAGG, 28S F
CGGCGGGAGTAACTATGACT, 28S R GCTGTGGTTTCGCTGGATAG, Eif1 F TGGTACTGTAATTGAGCATCCAG, Eif1 R
CCTTAGCCAGCCCAATCTCT. All reactions were carried out in MicroAmp© Optical 384-Well plates (Applied Biosystems) in the
QuantStudio™ 6 Flex Real-Time PCR System (Thermo Fisher) using standard protocols.

2.13 RNA DEGRADATION ASSAY

1 μg of RNA was pre-incubated with 4.5 μg of (PR) 20 or water for 10 min at room temperature, and subsequently treated with
serially diluted RNase A (Qiagen) at 37°C for 15 min, at the end of which the reaction was halted by RNasin ribonuclaease inhibitor
(Promega) and 1% SDS. The resulting mixture was column purified using the RNA Clean & Concentrator-5 kit (Zymo Research),
according to manufacturer’s instructions. The recovered RNA was analyzed by agarose gel electrophoresis, and quantified by
image analysis (ImageJ, NIH, USA).

2.14 REVERSE TRANSCRIPTION

500 ng of RNA isolated from mESC was pre-incubated on ice for 5 minutes with increasing concentrations of (PR) 20. The mixture
was then used as template for cDNA synthesis using the SuperScript III First Strand Synthesis System (ThermoFisher Scientific )
according to manufacturer’s instructions. The reaction mixture was subsequently treated with RNase A (15 min at 37°C),
solubilized with SDS 1%, and finally purified using PCR cleanup columns (Qiagen). The yield of cDNA was visualized by agarose
gel electrophoresis, and quantified by fluorometry using the Qubit kit (ThermoFisher Scientific), according to manufacturer’s
instructions.

2.15 SPLICING

U2OS cells were plated at a density of 2.4 × 104 cells/mL on 6-well plates and treated on the following day with either 20 μM of
(PR)20 or 30 μM protamine. RT-PCR was performed as described above using previously described primers to det ect alternative
splicing events at GADD45A and NACA mRNAs (Kwon et al., 2014).

2.16 EMSA

To analyse the binding of (PR) 20 or protamine to ssDNA and ssRNA, 0.2 μM of Cy3- RNA (CCACUGCACCGCUGCUAGG) or Cy3-
DNA (CCACTGCACCGCTGCTAGG) oligonucleotides were incubated with increasing amounts of (PR) 20 for 10 min at room
temperature. To evaluate the binding of (PR) 20 or protamine to dsDNA and dsRNA, Cy3-RNA and Cy3-DNA oligonucleotides were
annealed with the complementary RNA (CCUAGCAGCGGUUGCAGUGG) or DNA (CCTAGCAGCGGTTGCAGTGG) molecule prior to
incubation with (PR)20. Reactions were supplemented with 4 µL of 6x loading buffer (30% glycerol, bromphenol blue, xylene cyanol)
and were resolved by polyacrylamide gel electrophoresis in 4-12% TBE Gels (Invitrogen) in 1% TBE buffer at 100 V for 45 min at
4°C. The gels were scanned and Cy3 intensity was measured using Typhoon Trio (GE Health Care). Band quantification was
performed using ImageJ (Schneider et al., 2012) and data fitting was performed using Graphpad Prism 7.
49
2.17 dNTP BINDING

The binding of peptides to dNTPs was done by measuring absorbance of peptide-dNTP solutions at 600 nm using NanoDrop 2000
(Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions.

2.18 PHOSPHATASE ASSAY

Briefly, RPE cells were lysate with RIPA (150 mM NaCl, 25 mM Tris-HCl, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1 % SDS
and protease inhibitors) and 100 mg of protein was used for each condition. PP2A Immunoprecipitation Phosphatase Assay kit
was used for determining phosphatase activity following manufactured instructions. The dephosphorylation of a KRpTIRR peptide
activity was measured by absorbance of Malachite green.

3.

MOUSE BIOLOGY

3.1 GENERATION OF MOUSE LINES

The inducible (PR)97 mouse lines were generated by the previously-described KH2 system (Beard et al., 2006), mediated by site-
specific recombination, targeted to the Col1A1 locus. The (PR)97-HA-FLAG cassette was extracted from pINTO-C-(PR)97-HF by PCR
amplification, and cloned into the flp-in pBS31, using the EcoRI and MluI sites. The circular pBS31-(PR)97-HF plasmid was co-
electroporated into KH2 mESCs (hybrid B6.129 background), which harbour the rtTA transactivator in the widely expressed Rosa26
locus, along with a vector expressing the FLPe recombinase. After selection in hygromicin 200 µg/mL, single mES clones were
isolated, and functionally tested with doxycycline treatment in vitro. A clone showing high and homogeneous induction levels of
(PR)97 was selected, microinjected into E2.5 C57BL/6_TyrC morulae, and transferred to CD1 foster females, giving rise to chimaeric
animals. A male with a high degree of chimaerism was selected, and backcrossed with C57BL/6 females to test for germ line
transmission. The resulting inducible mice in this study are in a mixed C57BL6.129 background.

3.2 GENOTYPING

DNA was extracted from ear tissue samples using isopropanol precipitation, following standard protocols, and used in PCRs to
determine the genotypes of the mice. The primer sequences are as follows (5’-3’): Rosa26F (AAAGTCGCTCTGAGTTGTTAT);
Rosa26R-WT (GGAGCGGGAGAAATGGATATG); Rosa26R-KI (GCGAAGAGTTTGTCCTCAACC); Col1A1F
R-WT R-KI
(CCCTCCATGTGTGACCAAGG); Col1A1 (GCACAGCATTGCGGACATGC); Col1A1 (GCAGAAGCGCGGCCGTCTGG). The
Rosa26 locus yields a wild-type band of 500bp, while the knock-in allele 300 bp, while the Col1A1 wild-type allele gives a band of
331 bp, and the knock-in of 551 bp.

3.3 TREATMENTS

In the initial characterisation, mice were treated, starting at 5 weeks, with oral doxycycline (PanReac), 2 mg/mL, in 5% sucr ose
(Sigma), to make the solution palatable. Teklad Global 18% Protein Rodent Diet chow diet (2018S, Ha rlan Laboratories) was freely
available.

Encapsulated rapamycin was administered in the diet. Rapamycin encapsulated in eudragit, or empty eudragit microcapsules
(Rapamycin holdings), were mixed with a standard 5LG6 ModLabDiet (TestDiet) at 425 ppm, and irradiated, to make the rapamycin
diet, and the control diet. Standard chow was switched to rapamycin, or control diet, at 9 -10 weeks of age, and the mice were
allowed to adapt for another week before beginning the doxycycline treatment, in which sucrose was replaced by 0.4% saccharin
(Sigma), to reduce free sugar intake. The treatments were postponed until this age to allow for weight-loss caused by the
rapamycin diet. Sucrose was eliminated to prevent rapamycin-induced diabetes.

Health status of mice was monitored daily, and weight every 1-2 weeks. Mice were maintained at the CNIO animal facility under
standard housing conditions with free access to chow diet and water, following the guidelines of the Federation of European
Laboratory Animal Science Association. All mouse work was performed in accordance to the Guidelines for Humane Endpoints

50
 MATERIALS AND METHODS
for Animals Used in Biomedical Research and under the supervision of the Ethics Committee for Animal Research of the “Institu to
de Salud Carlos III”.

3.4 IMAGING

For microCT scans mice were anaesthetised with a continuous flow of 1% to 3% sevoflurane/oxygen mixture (2 L/min), and the
whole body was able to be imaged at one time using the eXplore Vista micro-CT scanner (GE Healthcare, London, Canada). The
isotropic resolution of this instrument is 45 µm. The micro-CT image acquisition consisted of 400 projections collected in one full
rotation of the gantry in approximately 10 min. The X-ray tube settings were 80 kV and 450 µA. The angles were measured using
the software 3D slicer. The kyphosis angle was determined between the C1-T3-T9 vertebrae in each animal.

3.5 IMMUNOHISTOCHEMISTRY AND IN VIVO IMMUNOFLUORESCENCE

Tissues were fixed in formalin, and embedded in paraffin for subsequent processing. Sections of 2.5 µm were treated with citrate
for antigen retrieval, and processed for immunohistochemistry with hematoxylin and eosin staining, or HA-tag antibodies,
following standard protocols. Images were captured with a Leica DM2000 LED optical microscope, using a 20x lens.

Immunofluorescence on tissue sections was carried out as previously described (Zaqout et al., 2020). Briefly, after antigen
retrieval, the sections are rinsed, and permeabilised with 0.25% Triton X100 and 0.2% gelatine in PBS, after which they are blocked
in 5% BSA in permeabilisation buffer. They are incubated with the primary antibodies overnight, at 4ºC, and secondary for 1 h at
room temperature. A complete list of all antibodies used can be found in Table 5. Finally, after rinsing, the sections are incubated
in 10 mM CuSO4 /50 mM NH4Cl solution, dried, and mounted with Fluoromount-G (SouthernBiotech) mounting media. Images were
captured with a Leica SP5 WLL confocal microscope. A 40x magnification lens was used and images were taken at non-saturating
conditions. Images were segmented using DAPI and 488-FBL staining signals to generate masks matching cell nuclei, and nucleoli,
respectively, to obtain the nucleolar area.

4.

BIOINFORMATICS AND DATA ANALYSIS

4.1 PROTEOMICS ANALYSIS

Raw data files were processed with MaxQuant (v 1.6.0.43) using the standard settings against a human protein database
(UniProtKB/Swiss-Prot, 20,373 sequences). Carbamidomethylation of cysteines was set as a fixed modification whereas
oxidation of methionines and protein N-term acetylation were set as variable modifications. Minimal peptide length was set to 7
amino acids and a maximum of two tryptic missed-cleavages were allowed. Results were filtered at 0.01 FDR (peptide and protein
level).

Afterwards, the “proteinGroups.txt” file was loaded in Prostar (Wieczorek et al., 2017) using the intensity values for further
statistical analysis. Briefly, proteins with less than two valid values in at least one experimental condition were filtered out. Missing
values were imputed using the algorithms SLSA (Bø et al., 2004) for partially observed values and DetQuantile for values missing
on an entire condition. Differential analysis was done using the empirical Bayes statistics Limma. Proteins with a p.value < 0.05
and a log2 ratio >1 or <-1 were defined as regulated. The FDR was estimated to be below 7.43% by Benjamini-Hochberg.

For RNA-bound proteomics, protein interaction networks arising from proteomic experiments were analysed with STRING
(Szklarczyk et al., 2015).

4.2 RNASEQ ANALYSIS

Differential expression analysis was performed using Bluebee® (Lexogen). Functional analysis was done by Gene Set Enrichment
Analysis (GSEA) of the expression data, according to the publishers’ instructions (Subramanian et al., 2005).

51
4.3 CMAP

The CMap Query clue.io tool (https://clue.io/) (Subramanian et al., 2017) was used to extract perturbagens (compounds, over-
expression, knock-out or knock-down of genes) with signatures similar to spontaneously resistant NSC34 R cells. For this, 50-100
genes upregulated in the proteomics profile were used as an input for the Query CMap tool, employing Gene expression (L1000),
Touchstone and individual query as query parameters. Similarity scores were downloaded and results were sorted based on their
scores and the type of perturbagen.

4.4 DRUG SET ENRICHMENT ANALYSIS (DSEA)

DSEA was carried out, as previously described (Sanchez-Burgos et al., 2022; Sinha et al., 2020). Briefly, the GSEA method
implemented in the R package fgsea (Korotkevich et al., 2019) was adapted to enable enrichment analyses of "drug classes"
based on their mechanism of action. The CMap compound similarity scores were ranked, and the GSEA method was applied to
the ranked list with drug sets for DSEA analysis. The drug classes were based on the mechanism of action, which was available
in the annotation data included in CMap analysis in the “description” field. For the computational analysis, R version 3.6.3 w as
used, and a sample of the code used for a similar analysis can be obtained from https://github.com/Genomic-Instability-Lab/An-
in-silicoanalysis-of-drugs-potentially-modulating-the-cytokine-storm-triggered-by-SARS-CoV-2-inf.

4.5 NEUROLINCS RNASEQ ANALYSIS

Expression data from motor neurons, differentiated from induced pluripotent stem cells of ALS patients and unaffected subjects,
was obtained from the NeuroLINCS data repository (Leslie Thompson: diMN (Exp 3) - ALS and Control (unaffected) diMN cell lines
differentiated from iPS cell lines using a short and direct differentiation protocol - RNA-seq, 2017, LINCS (dataset),
http://identifiers.org/lincs.data/LDS-1499, ; retrieved: 21/07/2021). Differential expression analysis between unaffected subjects
and sporadic ALS cases, or unaffected subjects and C9ORF72-ALS cases, was carried out using the limma-voom tool (Law et al.,
2014), available on the Galaxy platform (https://usegalaxy.org/). The P-value of enrichment of the mTORC1 signalling, MYC
signalling 1 and 2 hallmarks, as well as the ribosomal proteins was obtained by a hypergeometric test.

4.6 DATA AVAILABILITY

Mass spectrometry proteomics data from results, sections 1.1 and 1.4 have been deposited to the ProteomeXchange Consortium
via the PRIDE (Perez-Riverol et al., 2019) partner repository with the dataset identifier PXD010555 (Username:
reviewer92012@ebi.ac.uk; Password: ZnXyUNzE) and PXD014085 (Username: reviewer29822@ebi.ac.uk; Password: UAy57afS).

The mass spectrometry and RNAseq data from the rest of the work can be found at (https://fundacioncnio-
my.sharepoint.com/:f:/g/personal/osirozh_cnio_es/EnDUaqAJeb9Lq2Bb--1o0dABeYe7i02GFsl8QOL99D275g?e=X3XEbs).

52
RESULTS

53
 1.

ELUCIDATION OF THE MECHANISM OF CELL DEATH BY ARGININE-RICH POLY(PR) PEPTIDES

A large body of literature describes interference in translation by poly(PR) and poly(GR) peptides, although there is no consensus
on a mechanism; some studies argue that it is through binding to RNA, others through r-proteins, and others through stress-
induced repression. We decided to approach the problem by testing the effect of poly(PR) peptides on ribosomes through a
proteomic approach.

1.1 The effect of (PR)20 peptides on ribosomes

Figure 11. Poly(PR) peptides displace the large ribosomal subunit from the ribosome. A) Diagram representing the experimental set-up.
B) Protein levels of RPL factors in ribosomes purified from Hela RPS9SBP cells exposed to 10 µM of (PR) 20 for 16 h, as identified by
LC-MS/MS. C) Protein levels of RPL factors in ribosomes purified from Hela RPS9SBP cells exposed to 10 µM of (PR) 20 for 16 h, as
identified by LC-MS/MS. D) Protein levels of RPL factors in the input extracts used input extracts used for ribosome purification from
Hela RPS9SBP cells exposed to 10 µM of (PR) 20 for 16 h, as identified by LC- MS/MS. E) Protein levels of RPL factors in the input
extracts used for ribosome purification from Hela RPS9SBP cells exposed to 10 µM of (PR) 20 for 16 h, as identified by LC- MS/MS.

In order to examine the direct effects of synthetic (PR) 20 peptides on the ribosome, we used HeLa cells stably expressing a
streptavidin binding protein (SBP)-tagged RPS9 to isolate ribosomes and their interactomes from (PR) 20-treated cells, and
untreated cells, by immunoprecipitation (Figure 11A, Annex Table 1).

The proteomic profile revealed a loss of ribosomal proteins belonging to the 60S subunit (RPL), while the levels of 40S ribosomal
proteins (RPS) were evenly distributed (Figure 11B-C). The loss of RPLs was not due to a decrease in total levels of ribosomal

54
 RESULTS

proteins, which conserved similar levels under both conditions (Figure 11D-E). The consistent loss of RPL interaction suggests
that (PR)20 peptides impair the binding of the 60S subunit to the 40S during the assembly of 80S ribosomes on mRNA in translation.

The distribution of ribosomal subunits between translating polysomes and free subunits can be studied by polysome profiling.
Consistently, the (PR)20-treated profile revealed the presence of halfmers on ribosome-bound mRNAs, supporting the impairment
of 60S binding (Figure 12A). The failure to bind to the 40S subunit maybe caused by direct structural alterations, therefore we
examined ribosome assembly in the presence of (PR) 20 peptides by electron microscopy (Figure 12B-C). MgCl2 stimulated free
assembly of 80S ribosomes in the absence of mRNA, both in the presence, and absence of (PR) 20, indicating that the half-mers
did not originate due to changes in ribosomal subunit structure.

Figure 12. Poly(PR) peptides promote the formation of half-mers on polysome-associated mRNA, but do not affect the free assembly of
ribosomes in solution. A) Representative polysome profiles obtained from HeLa cells untreated or treated with 10 µM of (PR) 20 for 16 h.
The presence of half-mers is indicated (arrows). B) Electron microscopy images from purified 40S and 60S ribosomal complexes (1
pmol each) assembled in vitro in the presence of MgCl2, and in the presence or absence of 5 pmol of (PR) 20. Assembled 80S particles
are indicated (red arrows). Scale bar (white) represents 10 nm. C) Quantification of 80S particles identified in (B) (n = 1,000) in non-
assembly (1 mM MgCl2) or assembly (5 mM MgCl2) conditions.

Translation is a tightly regulated process, leading us to consider a cell-free system to study translation from a strictly mechanical
approach. As expected, in view of previous findings (Kanekura et al., 2016), in vitro translation in rabbit reticulocyte lysates
confirmed a dose-dependent decrease of luciferase activity, and yield, consistent with mechanical inhibition of translation by
(PR)20 peptides (Figure 13A-B).

Figure 13. Poly(PR) peptides inhibit cell-free translation in vitro, depending on the length of the mRNA. A) In vitro translation of 100 ng of
luciferase mRNA (quantified by Relative Luciferase Units [RLU]) in the presence of increasing doses of (PR) 20. B) In vitro translation of
100 ng of luciferase mRNA in the presence or absence of 0.5 µM (PR) 20. Translation products were labelled with [35S]-Met/Cys and
analysed by SDS–PAGE and autoradiography. C) In vitro translation of 100 ng of luciferase mRNA with different 50 UTR lengths in the
presence (orange columns) or absence (grey column) of 0.5 µM (PR) 20 (n = 3). Data represent mean values ± SD (*P < 0.05; t-test). D)
In vitro translation of 100 ng of luciferase mRNA in the presence or absence of 0.5 µM (PR) 20. In the right two columns, the mRNA was
extracted from a translation reaction done in the presence of the DPR, and subsequently used in a new translation reaction performed
in the absence of (PR)20 (n = 3). Data represent mean values ± SD.

55
Taken together, the loss of the 60S subunit, seen both in the proteomic profile, and in the presence of half -mers on actively
translating mRNAs, could be attributed to inaccessibility of mRNA to the large subunit during translation. It is known that ALS-
associated arginine-rich DPRs bind to, and tend aggregate with, RNA (Boeynaems et al., 2017; Kanekura et al., 2016; White et
al., 2019). We postulated that the high arginine content, and therefore positive charge, of DPRs would give it a high affinity for
negatively-charged RNA, and in fact, this is true for other arginine-rich peptides (Tan and Frankel, 1995). If the peptide binds to
mRNA at the site of translation initiation, it would become inaccessible to the incoming 60S ribosomal subunit. Likewise, if the
40S subunit has to scan a longer 5’ UTR before reaching the AUG, it is more likely to encounter bound peptides, and stall, th an in
shorter 5’ UTRs, and translation rate would be inversely correlated with 5’ UTR length. In line with this model, a 656 bp 5’ UTR
proved to be more susceptible to (PR) 20-mediated translation inhibition than an 84 bp 5’ UTR (Figure 13C). Importantly, (PR) 20
peptides do not irreversibly modify the mRNA, as mRNA recovered from rabbit reticulocyte reactions in the presence of (PR) 20, can
be efficiently translated after purification (Figure 13D).

This set of experiments demonstrates that translation inhibition is a result of the union (PR)20 to mRNA, which impairs ribosome
binding, and assembly of the active 80S unit.

1.2 DPRs inhibit RNA and DNA-based reactions

Besides translation, ALS-associated arginine-rich DPRs have been shown to affect a number of processes involving RNA, including
splicing, rRNA biosynthesis, and mRNA export (Kwon et al., 2014; Rossi et al., 2015; Yin et al., 2017) . According to our model,
translation inhibition by (PR) 20 peptides arises from the high-affinity binding of peptides to mRNA, preventing the efficient binding
and assembly of ribosomes. If inhibition arises from DPR affinity for negatively-charged nucleic acids, we hypothesised that (PR) 20
peptides would similarly inhibit all reactions with RNA substrates.

Figure 14. Poly(PR) peptides inhibit RNA-based reactions in vitro. A-B) Reverse transcription of RNA (500 ng) with oligo dT in the presence
of increasing doses of (PR)20 (A), and representative image of an agarose gel electrophoresis of resultant cDNA (B). Data in represent
the fluorometric quantification of the resultant cDNA (n = 3), mean values ± SD. C-D) Percentage of RNA (1 µg) remaining after a 150
digestion with increasing doses of RNase A in the presence or absence of (PR) 20 (5 µM; n = 3) (C), and representative image of an
agarose gel electrophoresis of remaining RNA (D). Data represent mean values ± SEM.

To test our model in vitro, we carried out in vitro reverse transcription and RNase A degradation reactions. Consistently, (PR) 20
peptides inhibit reverse transcription in a dose-dependent manner, giving rise to a lower yield of cDNA at higher concentrations of
peptide (Figure 14A-B). Similarly, (PR)20 peptides protected RNA from RNase A degradation (Figure 14C-D).

Interestingly, these effects were restricted only to the arginine containing peptides of those associated to ALS. (GR) 20 peptides
inhibited both reverse transcription (Figure 15C), and RNase A digestion (Figure 15F), while (GA)20 peptides did not (Figure 15B,
15E). The presence of an unrelated protein, such as BSA, actually activated both reactions, possibly through the effects of
molecular crowding (Figure 15A, 15D).

56
 RESULTS

Figure 15. Effects of BSA, (GA)20 and (GR)20 peptides on in vitro RNA-based reactions. A-C) Reverse transcription of RNA (500 ng) with
oligo-dT in the presence of increasing doses of BSA (A), (GA) 20 (B) or (GR)20 (C). Data represent the fluorometric quantification of the
resultant cDNA (n=3). D-F) Percentage of RNA (1 μg) remaining after a 15 minute digestion with increasing doses of RNase A in the
presence or absence of BSA (D), (GA) 20 (E), or (GR)20 (F) (5 μM) (n=3). Data information: *P < 0.05; **P < 0.01; t-test.

57
 Figure 16. Poly(PR) peptides inhibit RNA-based reactions in cells. A) High-throughput microscopy (HTM)-mediated analysis of 5-ethynyl-
uridine (EU) levels per nucleus found in U2OS cells exposed to 10 µM (PR) 20 for 16 h. EU was added 30 minutes prior to fixation (n =
3). Black lines indicate mean values. B) High-throughput microscopy (HTM)-mediated analysis of polyA+ mRNA levels per nucleus
found in U2OS cells exposed to 10 µM (PR) 20 for 16 h. Boxes define upper and lower quartiles and whiskers mark the highest and
lowest observations. C) Effect of (PR)20 (10 µM, 16 h) in the number of Cajal Bodies (CB) identified by immunofluorescence with anti-
COILIN and anti-SMN antibodies (n = 3). Data represent mean values ± SD. Data information: **P < 0.01; ***P < 0.001; ****P < 0.0001;
t-test. Representative images from these analyses (C–E) are provided in each case. Scale bar (white) indicates 2–5 µm.

Similar effects were also consistently observed in cellular RNA reactions. In agreement with previous studies (Kwon et al., 2014),
total levels of RNA synthesis, as determined by EU incorporation, were decreased in (PR) 20-treated U2OS cells (Figure 16A).
Likewise, despite the decreased transcription levels, polyA-positive mRNA accumulated in the nuclei (Figure 16B), indicating
deficient mRNA export, as previously described (Rossi et al., 2015).

Cajal Bodies are membrane-less nuclear organelles in which various RNA processing and metabolic processes occur, including
snRNA modifications, histone mRNA assembly, or telomeric RNA processing (Nizami et al., 2010). We quantified the number of
Cajal bodies (CBs) with HTM-mediated quantification of COILIN- or SMN-positive spots per nucleus, both of which are components
of CBs. Both stainings revealed that (PR) 20-treated cells have fewer CBs, and therefore lower levels of the aforementioned RNA
processes (Figure 16C).

Figure 17. Poly(PR) peptides inhibit viral replication in cells. A) Diagram of experimental set-up. B) Accumulation of Sindibis virus (SV)
genomic RNA in BHK-21 cells in the absence or presence of increasing doses of (PR) 20. The amount of viral and cellular RNA was
quantified from total RNA isolated 4 h after infection by quantitative real-time PCR (qRT–PCR) with specific primers (n = 3). Data
represent mean values ± SEM.

Of note, not only endogenous cellular processes are affected by DPRs, but also exogenous reactions which require RNA, such as
parasitic viral infection. Baby Hamster Kidney cells (BHK-21) were infected with the Sindibis virus, both in the presence and
absence of (PR)20 peptides, and the yield of viral RNA was quantified by qRT-PCR (Figure 17A). The Sindibis virus replicates its
single-stranded RNA (ssRNA) genome through a double-stranded RNA (dsRNA) intermediate by cytosolic transcription. As
predicted, viral replication is also inhibited in BHK-21 cells by (PR)20 peptides (Figure 17B).

The dsRNA intermediate in the replication cycle of the Sindibis virus would suggest that (PR) 20 peptides bind RNA independently
of strand parity. In fact, as arginine-rich peptides were first studied as primitive transfection reagents, they are known to bind to
DNA, as well as RNA (DeRouchey et al., 2013; Mascotti and Lohman, 1997; Tan and Frankel, 1995). To characterise the affinity of
(PR)20 peptides to different nucleic acids, electrophoretic mobility assays (EMSAs) were carried out, revealing avid binding to both
single-stranded and double-stranded RNA and DNA (Figure 18A). Indeed, (PR)20 peptides bind to, and precipitate with,
deoxynucleotides (dNTPs), independently of the base (Figure 18B-C). The lack of base preference in dNTP affinity supports the
view that the interaction is electrostatic, rather than sequence-specific.

58
 RESULTS

Figure 18. Poly(PR) peptides have a high affinity for nucleic acids. A) Quantification of EMSA assays evaluating the binding of (PR) 20 to
19 nt-long ssDNA, ssRNA, dsDNA and dsRNA molecules. Each probe (0.2 µM) was incubated with increasing concentrations of (PR) 20
for 100 . Curve-fitting was performed using non-linear regression with the Hill equation. B-C) Turbidity of solutions containing (PR) 20
mixed with the different dNTPs measured by optical density at 600 nm (OD 600) (B) (n = 3). Data represent mean values ± SEM. A
representative image of these assays is provided in (C).

Based on these findings, we tested whether arginine-rich DPRs also inhibited DNA-based reactions, as well as RNA. As predicted,
a qRT-PCR reaction done on the same cDNA substrate was inhibited by (PR) 20 peptides in a dose-dependent manner (Figure 19A-
C).

Like before, neither (GA)20, nor BSA had any effect on the PCR, while (GR) 20 peptides were inhibitory (Figure 20A-C). Importantly,
(PR)20 peptides had no effect on the phosphatase assay, which has no nucleic acid intermediates, indicating that the peptides
don’t directly interfere with enzyme activity (Figure 20D). This result is in line with the previously described in vitro mRNA-free 80S
ribosome assembly experiment (Figure 12B-C), supporting the key role of nucleic acids in inhibition, rather than of the proteins
themselves.

Figure 19. Poly(PR) peptides inhibit DNA-based reactions in vitro. A-C) Percentage of Gapdh or 5.8 rRNA levels quantified by qPCR in
reactions containing increasing doses of (PR) 20 (n = 3). Data represent mean values ± SEM. A representative image of the 5.8S rRNA
amplicon, visualised by agarose gel electrophoresis. (**P < 0.01; ***P < 0.001; t-test.)

59
 Figure 20. Effects of BSA, (GA)20 and (GR)20 peptides on in vitro DNA-based reactions in vitro. A-C) Percentage of 5.8 rRNA levels quantified
by qPCR in reactions containing increasing doses of BSA, (GA) 20 or (GR)20 (n=3). D) PP2A in vitro phosphatase assay performed in the
presence or absence of (PR)20 or Okadaic acid (a phosphatase inhibitor). PP2A activity is measured through the liberation of phosphates
from a KRpTIRR peptide. Data information: ***P < 0.001; t-test.

Like cell processes involving RNA, those involving DNA were also inhibited by the presence of (PR) 20. The rate of DNA synthesis,
as determined by HTM-mediated quantification of incorporated EdU, was lower in cells exposed to (PR) 20, at a non-lethal dose and
time point (Figure 21A). To evaluate double-strand break repair, treated and untreated U2OS cells were exposed to ionising
radiation, and the levels of phosphorylated histone H2AX (γH2AX) were quantified by HTM (Figure 21B). Similar levels of γH2AX
were detected 30 minutes post-irradiation, indicating equally proficient recognition of the double-strand breaks, however, 10 hours
after irradiation (PR)20-treated cells harboured significantly higher levels of γH2AX, indicating impaired DNA repair. Gene editing
by CRISPR requires proficient DNA repair, and unsurprisingly, the efficiency of CRISPR/Cas9 deletion of an EGFP gene, targeted
with a specific sgRNA, was impaired by (PR) 20 (Figure 21C). As the efficiency of gene deletion depends on the loading of the
sgRNA onto Cas9, recognition of genomic DNA by the specific RNA sequence bound by the Cas9, as well as posterior DNA repair,
the loss of efficiency is likely to be multifactorial.

60
 RESULTS

Figure 21. Poly(PR) peptides inhibit DNA-based reactions in vitro. A) HTM-mediated analysis of 5-ethynyl-deoxyuridine (EdU) levels per
nucleus found in U2OS cells exposed to 10 µM (PR) 20 for 4 h. EdU was added 30 minutes prior to fixation. Representative images from
these analyses are provided (right). Black lines indicate mean values. Scale bar (white) indicates 5 µm. B) HTM-mediated analysis of
γH2AX levels per nucleus in U2OS cells exposed to 3 Gy of IR in the presence or absence of 10 µM (PR)20 , and allowed to recover for
the indicated times. Note the accumulation of cells with persistent DNA damage (γH2AX) 10 h after IR in the presence of the DPR.
Representative images from these analyses are provided (right). Black lines indicate mean values. Scale bar (white) indicates 5 µm. C)
Efficiency of CRISPR-mediated gene deletion quantified in mouse embryonic stem cells stably expressing EGFP, a doxycycline-inducible
Cas9 and an EGFP targeting sgRNA. The percentage of EGFP-positive cells was quantified by flow cytometry 72 h after inducing Cas9
expression with doxycycline in the presence or absence of 10 µM (PR) 20 (n = 3). Data represent mean values ± SEM. Data information:
**P < 0.01; ****P < 0.0001; t-test.

Taken together, these experiments show that arginine-rich (PR)20 peptides avidly bind both RNA and DNA, and generally inhibit
processes in which nucleic acids participate as intermediates.

1.3 Protamine recapitulates the effects of ALS-associated arginine-rich peptides

As the biochemical and cellular effects of (PR) 20 and (GR)20 appear to be arginine-dependent, we hypothesised that other arginine-
rich peptides may have the same properties. To test this, we analysed the effects of protamine, a short mammalian protein wit h
a 48% arginine content. Protamine participates in the compaction of DNA during spermatogenesis (Balhorn, 2007), however, it
has also been studied in the context of transfection technologies, and is known to bind DNA, enter cells and induce toxicity
(Scheicher et al., 2015; Sokolowska et al., 2016) , like (PR)20 peptides.

In vitro assays confirmed a marked similarity between the properties of protamine and (PR) 20 or (GR)20. EMSA analysis showed
that protamine binds ssDNA, and revealed that protamine also binds ssRNA with a similar affinity (Figure 22A). In vitro, protamine
inhibited both PCR and RNase A digestion reactions (Figure 22B-C), reflecting that the ability to bind both DNA and RNA has
repercussions on both DNA and RNA-based reactions.

In cells, protamine continued to phenocopy (PR) 20 peptides. The cellular localisation of ALS-associated arginine-rich peptides is
known to be nucleolar (Kwon et al., 2014). It was particularly striking to find that fluorophore-marked protamine peptides co-
localised with the nucleolar marker UBF1 in U2OS cells (Figure 22D).

61
 Figure 22. Protamine inhibits reactions using nucleic acid templates. A) Quantification of EMSA assays evaluating the binding of
protamine to 19 nt-long ssDNA and ssRNA molecules. Each probe (0.2 µM) was incubated with increasing concentrations of (PR) 20 for
100 . Curve fitting was performed using non-linear regression with the Hill equation. B) Percentage of GAPDH levels quantified by qPCR
in reactions containing increasing doses of protamine (n = 3). Data represent mean values ± SEM. C) Percentage of RNA (1 µg)
remaining after a 150 digestion with increasing doses of RNase A in the presence or absence of protamine (5 µM). Data derive from
one representative experiment that was repeated twice. D) Immunofluorescence of Cy3-labelled salmon protamine (red) and the
nucleolar factor UBF1 (green) in U2OS cells treated with 30 µM Cy3-protamine for 4 h. Scale bar (white) indicates 2.5 µm. E-F) HTM-
mediated quantification of the EU levels per nucleus (E) and O-propargyl-puromycin (OPP) levels per cell (F) in U2OS cells exposed to
30 µM protamine for 16 (E) or 24 (F) h. EU and OPP were added 30 minutes prior to fixation. Black lines indicate mean values (****P <
0.0001; t-test). G) RT–PCR of NACA and GADD45A mRNAs in U2OS cells treated with protamine (30 µM) or (PR)20 (20 µM) using primers
in non-consecutive exons to monitor alternative splicing events. A scheme of the primers used is provided on the right side of the panel.
H) RT–PCR of GADD45A mRNAs in U2OS cells treated with HA-tagged (PR)20, (GR)20, (PK)20 and (GA)20 peptides (20 µM) using the
pipeline defined in (G).

As predicted by the cell-free experiments, protamine also impaired DNA- and RNA-based reactions in cells, as revealed by HTM-
mediated quantification of transcription and translation levels in protamine-treated cells (Figure 22E-F). Abnormal splicing in
several genes, including NACA and GADD45A, has been observed in cells treated with synthetic (PR)20 peptides in previous studies
(Kwon et al., 2014). The same splicing defects were triggered by protamine treatment both in NACA and GADD45A transcripts
(Figure 22G). Importantly, splicing alterations were not caused by (GA) 20 treatment, nor by the positively charged lysine-rich (PK)20
peptides (Figure 22H), supporting the claim that these effects are specifically caused by arginine-rich peptides.

62
 RESULTS

1.4 Exposure to arginine-rich (PR)20 peptides and protamine leads to a generalised displacement of proteins from mRNA and

chromatin

During spermatogenesis the genome undergoes a histone-to-protamine transition during which protamine induces coiling and
condensation of DNA, rendering it up to six-fold more compact and, importantly, enzymatically inaccessible). Indeed, protamine
is known to coat DNA, establishing electrostatic interactions between the basic arginine residues and phosphodiest er groups of
the deoxyribose spine (Balhorn, 2007). Given the biochemical and cellular similarities in the responses caused by protamine and
ALS-associated (PR)20 or (GR)20 peptides, we hypothesised that (PR) 20 peptides may also coat chromatin, displace DNA-binding
factors and make it inaccessible.

Figure 23. Arginine-rich peptides trigger a widespread displacement of proteins from chromatin and mRNA. A) Distribution of the
chromatin-bound levels of all proteins identified by proteomics in U2OS cells treated with protamine (30 µM) or (PR) 20 (20 µM) for
90 min . Numbers indicate the Pearson’s correlation coefficient (R) and the P-value, which was obtained by a t-test to evaluate the
Pearson correlation between both samples. B) Venn diagram illustrating the overlap among the proteins that show reduced levels
on chromatin upon treatment of U2OS cells with protamine (30 µM) or (PR) 20 (20 µM) for 90 min. The P-value was obtained by a
hypergeometric test. C) Distribution of the levels of all proteins identified after isolation of the RNA-bound proteome in U2OS cells
treated with protamine (30 µM) or (PR) 20 (20 µM) for 180 min. RNA-binding proteins (RBPs) were identified as those significantly
enriched after the isolation of mRNA-binding factors. Note that treatment with either peptide leads to a selective reduction in the
levels of RBPs bound to mRNA that is not observed for the rest of the factors (Not RBPs) (n = 2). P values were calculated with two-
sided two-sample t-tests assuming equal variances. Centre lines indicate median values; box limits indicate the 25 th and 75th
percentiles; whiskers extend 1.5 times the interquantile range from the 25 th and 75th percentiles and outliers are represented by
dots. D) Venn diagram illustrating the overlap among the proteins that show reduced levels on mRNA upon treatment of U2OS cells
with protamine (30 µM) or (PR) 20 (20 µM) for 90 min. The P-value was obtained by a hypergeometric test

In accord with this model, proteomic analysis of the chromatin-bound fraction from U2OS cells treated either with (PR) 20, or
protamine, revealed a high correlation between the changes caused by each treatment, and a significant overlap in the identity of
displaced factors (Figure 23A-B). Notably, the among the top proteins displaced by (PR) 20, we could identify linker histone H1
variants and High Mobility Group (HMG) proteins (Annex Table 2), both of which are physiologically replaced by protamine during
spermatogenesis.

63
Given that both protamine and (PR) 20 bind to RNA, as well as DNA, we next evaluated whether the protein displacement seen on
chromatin could be a phenomenon extendable to nucleic acids in general, evaluating the mRNA-bound proteins through a
proteomic approach. The RNA-binding proteins (RBPs) bound to mRNA were isolated by oligo-dT immunoprecipitation (Castello
et al., 2013), in protamine- and (PR)20-treated U2OS cells. As before, there was a generalised eviction of RBPs from RNA upon
both treatments (Figure 23C), and again, there was a significant overlap in the displaced factors between both conditions (Figure
23D). Remarkably, among the top displaced proteins for (PR) 20 we could identify TDP-43, and FUS, both of which are intimately
implicated in ALS pathogenesis (Annex Table 3).

These data show that arginine-rich peptides evict DNA- and RNA- binding factors from chromatin and mRNA, respectively, in a
generalised manner. The fact that (PR) 20 peptides are capable of displacing prominent proteins in ALS pathology makes a
compelling case for the contribution of this process towards the mislocalisation of TDP-43 seen in ALS-patients’ motor neurons.

64
 RESULTS

Figure 24. Non-coding oligonucleotides rescue the effects of arginine-rich peptides. A) In vitro translation of a luciferase mRNA with or
without of 0.5 µM (PR)20 and in the presence of increasing amounts of a 646 bp non-coding RNA (n = 3). Data represent mean values
± SEM. B) HTM-mediated quantification of OPP levels per cell (PR) 20 (10 µM, 16 h) alone or together with a 38 bp ssDNA oligonucleotide
at the indicated doses. Black lines indicate mean values. C) Percentage of viable cells as evaluated with a CellTiter-Glo luminescent
assay in U2OS cells treated with increasing doses of (PR)20 alone or together with 2 µM of ssDNA oligonucleotides (19 or 38 bp; n =
3). Data represent mean values ± SEM. D) Immunofluorescence of HA-(PR)20 (green) and the nucleolar factor UBF1 (red) in U2OS cells
treated with 7.5 µM HA-(PR)20 alone or together with 2 µM of a 19 bp ssDNA oligonucleotide for 8 h. E) HTM-mediated quantification
of the nucleolar levels of an HA-(PR)20 peptide in U2OS cells treated with 7.5 µM HA- (PR)20 alone or together with 2 µM of 19 or 38 bp
ssDNA oligonucleotides for 8 h. F) Immunofluorescence of HA-((PR)20 (green) and Cy5 (red) in U2OS cells treated with 7.5 µM HA-
(PR)20 alone or together with 4 µM of Cy5-labeled 19 bp ssDNA or ssRNA oligonucleotides for 8 h. G) HTM-mediated quantification of
the nuclear levels of Cy5-labeled ssDNA or ssRNA 19 bp oligonucleotides in U2OS cells treated with 7.5 µM HA-(PR)20 alone or together
with 4 µM of the oligonucleotides for 8 h. Black lines indicate mean values.

1.5 Competitive binding with non-coding oligonucleotides, or with heparin, rescues the toxicity of arginine-rich peptides

So far, our data support a model of arginine-rich peptide toxicity in which (PR) 20 peptides, or protamine, avidly bind to RNA and
DNA, forcing the displacement of functional factors, and preventing their partici pation in ordinary reactions. In this model,
sequestration of peptides would promote recovery of nucleic-acid reactions, which led us to hypothesise that non-coding
oligonucleotides could compete with cellular RNA and DNA, and decrease the active concentration of (PR)20 peptides.

To this effect, in vitro translation in rabbit reticulocyte lysates was recovered in a dose-dependent manner when (PR) 20 peptides
are pre-incubated with a 646-nt, non-coding RNA (Figure 24A). Likewise, cellular translation in U2OS cells, as determined by OPP
levels, was also restored by the addition of ssDNA oligonucleotides (Figure 24B), which was accompanied by a complete rescue
in viability, in the case of 38 bp-long oligonucleotides (Figure 24C). Importantly, the rescue was not due to a mislocalisation of
(PR)20, as the peptides still co-localised with the nucleolar marker UBF1, and were present at similar levels with 19 bp and 38 bp,
as without oligonucleotides (Figure 24D-E). In fact, not only could the peptides localise at the nucleolus, but they also allowed the
entry and nucleolar accumulation of ssDNA, and, to a lesser extent, ssRNA, behaving as transfection reagents (Figure 24F-G).

65
 Figure 25. Cell entry, toxicity and transfection capacities of arginine-rich peptides. A-B) Immunofluorescence using anti-HA antibody
(green) in U2OS cells treated with 7.5 µM of the different peptides for 4 hours. Scale bar (white), 2.5 µm. (B) HTM -mediated
quantification of the nuclear levels of HA-tagged peptides from the experiment defined in. C) Clonogenic survival assay of U2OS cells
exposed to 7.5 μM of the indicated peptides. D-E) HTM-mediated quantification of the nuclear levels of C y5-labeled ssDNA (D) or
ssRNA (E) oligonucleotides in U2OS cells treated with 7.5 µM of the indicated peptides alone or together with 2 µM of the
oligonucleotides for 8 h.

Interestingly, the nucleolar localisation of basic peptides correlates with toxicity. As previously described (Kwon et al., 2014),
both (PR)20 and (GR)20, but not (GA)20, accumulated at nucleoli (Figure 25A-B), and both arginine-rich peptides were toxic in U2OS
cells (Figure 25C). (PK)20 proved to be capable of entering the cell, and showed a nucleoplasmic localisation, however, was not
toxic. These effects were also mirrored in the capacity of each peptide to bring Cy5-labelled ssDNA or ssRNA into the nucleus,
which accumulated in the nuclei when co-treated with both (PR)20, and (GR)20, but not (GA)20, nor (PK)20 (Figure 25D-E). These data
suggest that the affinity of arginine-rich peptides for nucleic acids is superior to that of lysine, and that this exceptional ability to
bind to RNA and DNA is key to the cellular effects of arginine-rich peptides, including toxicity, localisation, and transfection. Indeed,
the transfection properties of arginine-rich peptides have been heavily researched for decades (Emi et al., 1997; Schwarze et
al., 1999), since the discovery that arginine-rich histone fractions and protamine were able to bring nucleic acids into cells (SMULL
and LUDWIG, 1962).

Besides its role as a primitive transfection reagent, purified protamine is used in the clinic as an antidote against the anticoagulant,
heparin (Sokolowska et al., 2016). Heparin is a linear glycosaminoglycan polymer, harbouring up to four negatively-charged
sulphate or carboxyl groups per monomer unit, paralleling nucleic acids both in linear structure, and high negative charge density.
As protamine is capable of binding heparin, we tested whether heparin could neutralise the negative effects of protamine, or,
indeed (PR)20. In fact, heparin rescued toxicity of protamine, (PR) 20, and (GR)20, in U2OS cells (Figure 26A), and while it did not
modify the nucleolar localisation, heparin did slightly decrease nuclear (PR) 20 levels, although not enough to justify the rescue
seen in toxicity (Figure 26B-C).

Figure 26. Heparin rescues the effects of arginine-rich peptides. A) Clonogenic survival assay of U2OS cells exposed to 7.5 μM with the
indicated peptides or protamine alone or together with 2 μM of a 38 bp ssDNA oligonucleotide or 0.5 μM heparin. B-C)
Immunofluorescence of HA-(PR)20 (green) and the nucleolar factor UBF1 (red) in U2OS cells treated with 7.5 μM HA-(PR)20 alone or
together with heparin (0.5 μM) (B), and HTM mediated quantification of the nucleolar levels of HA-(PR)20 peptide (C). Data information:
Scale bar (white) in (B), (E) and (G) indicates 2.5 µm. *P < 0.1; ***P < 0.001; t-test.

66
 RESULTS

Figure 27. Non-coding oligonucleotides and heparin rescue the effects of arginine-rich peptides in motor neurons. A-B) Viability of mouse
motor neurons differentiated from mESC (mMN) (A) and differentiated NSC34 cells (NSC34 DIFF) (B) exposed to 2.5 μM, and 5 μM, of
different peptides for 24 h and 48 h, respectively, quantified using the CellTiter-Glo luminescence assay. C) Immunofluorescence of
the neuronal marker TUBB3 (red) in mouse motor neurons differentiated from mESC (mMN) or from NSC34 cells (NSC34DIFF)
exposed to 2.5 μM, and 5 μM, respectively, (PR) 20 for 24 and 48 h, respectively, with or without 2 μM of a non-coding 38 bp
oligonucleotide. Nuclei were stained with DAPI (blue). Scale bar (white),10 μm. Note that besides its impact on overall survival, the
presence of the oligonucleotide also had a marked effect in rescuing neurite lengths that had been shortened by the peptide. D-E) Cell
viability quantified CellTiter-Glo luminescence assays mMN (D) and NSC34DIFF (E) treated as in (C) (n = 3). Data represent mean values
± SEM. F) Immunofluorescence of the neuronal marker TUBB3 (red) in mouse motor neurons differentiated from mESC (mMN) or
from NSC34 cells (NSC34 DIFF) exposed to 2.5 μM (PR)20, and 5 μM, respectively, for 24 and 48 h, respectively, with or without heparin
(0.5 μM). Nuclei were stained with DAPI (blue). Scale bar (white), 10 μm. G-H) Cell viability quantified CellTiter-Glo luminescence assays
mMN (G) and NSC34DIFF (H) treated as in (F) (n = 3). Data represent mean values ± SEM. Data information: **P < 0.01; ***P < 0.001.

One of the features of C9ORF72 ALS, is that expression of the C9ORF72 gene, and therefore of the arginine-rich DPRs, is confined
to motor neurons (Suzuki et al., 2013). Our nucleic-acid-binding model ought to be cell-type independent, and therefore applicable
to motor neurons. Consistently, peptide toxicity followed the same pattern in motor neurons differentiated from mESCs and
differentiated NSC34 cells (Figure 27A-B); arginine-rich (PR)20 and protamine decreased viability, while (GA) 20 and (PK)20 had no
67
effect. Treatment of either cell type with (PR) 20 led to neurite retraction, consistently with one of the early clinical features of ALS,
while both ssDNA oligonucleotides and heparin were able to rescue both viability and neurite length (Figure 27C-H).

Collectively, this block of experiments supports our model of cell death based on RNA and DNA coating by arginine-rich peptides,
showing that introducing competitive anionic binders decreases toxicity. Both ssDNA and ssRNA oligonucleotides, and heparin,
were able to revert toxicity is several cell types. Importantly, all peptides behaved in the same manner in motor neurons as in U2OS
cells, supporting that this mechanism could be applicable to C9-ALS/FTD pathogenesis.

1.6 Expression of (PR)97 causes nucleolar stress and accumulation of free ribosomal proteins

Figure 28. Expression of (PR)97 recapitulates the effects of (PR)20. A) Summary diagram of the T-Rex inducible expression system. The
T Rex transactivator binds the TetO operator when exposed to doxycycline, and induces the expression of (PR) 97. B) Viability by HTM-
mediated quantification of nuclei, stained by DAPI, after 24, 48, and 72 hours of treatment with doxycycline. C) Representative
immunofluorescence image of (PR) 97-HA induction at 48h. D-E) HTM-mediated analysis of O-propargyl-puromycin (OPP) (F), and 5-
ethynyl-uridine (EU) (G) levels per nucleus after 48h of doxycycline treatment. OPP and EU were added 30 minutes prior to fixation (n
= 3). Black lines indicate mean values. Data information: ****P < 0.0001; t-test. Scale bar represents 10 µm.

ALS patients accumulate DPRs in motor neurons, and nervous tissue from endogenous expression, while synthetic arginine-rich
peptides enter the cells through unknown mechanisms, introducing a non-physiological and unknown variable into the model.
These limitations mean that while synthetic peptides are a useful tool for in vitro studies, they are not well suited for in vivo work.
In order to develop a more physiological model of PR toxicity, we generated an inducible Tet-ON model of (PR)97-HA-Flag
expression in U2OS cells, using the doxycycline-responsive transactivator T Rex (Figure 28A). Repetitive, GC-rich RNA is known to
sequester RNA-binding factors, and cause toxicity independently of its protein products (Cooper et al., 2009), therefore, in order
to avoid the possible contribution of repetitive mRNA towards toxicity, the (PR)97 cassette was engineered using all the available
codons for proline and arginine, avoiding repetition, or accumulation of GC-rich sequences.

The resulting inducible U2OS (PR)97 cell line recapitulated the major features of treatment with synthetic peptides, including toxicity,
nucleolar localisation, and inhibition of both translation and transcription (Figure 28B-E).

Perturbations in rRNA biogenesis and nucleolar problems have been previously associated with arginine-rich DPRs (Haeusler et
al., 2014; Tao et al., 2015; Wen et al., 2014) . Consistently, U2OS (PR)97 cells expressing (PR)97 showed an increased nucleolar
area, which is indicative of nucleolar stress (Figure 29A-B). In fact, while untreated U2OS (PR)97 cells showed a dose-dependent loss
in viability upon treatment with the RNA Pol I inhibitor CX-5461, or with the rDNA intercalating agent ActD, dox-treated cells,
expressing (PR)97, showed no additive toxicity with either nucleolar stress-inducing agent (Figure 29C-D). This suggests that cells
expressing (PR)97 die by the same route, but due to alterations further downstream, rendering them insensible to bottlenecks at
68
 RESULTS

the level of rRNA transcription. Given the arginine-rich peptides’ ability of displacing RBPs from RNA (Figure 23), it is likely that PR
peptides impede every step of rRNA processing.

Figure 29. Nucleolar stress in U2OSPR97 cells. A-B) Representative immunofluorescence of the nucleolar factor FBL (green) (A), and
HTM-mediated quantification of nucleolar area, as quantified by FBL staining (B). Black lines indicate mean values. C-D) Viability by
HTM-mediated quantification of nuclei, stained by DAPI, after 48 hours’ treatment with the nucleolar stress inducers actinomycin D
(A), or CX (B), with (green), or without (grey), doxycycline. E) Intensity and fold-change of all proteins identified by proteomic comparison
of U2OS(PR)97 after 48 hours’ treatment with doxycycline, and untreated cells. Ribosomal proteins are marked with orange (RPs from
the 40S subunit) and blue (RPs from the 60S subunit). Data information: ****P < 0.0001; t-test

Nucleolar stress is often accompanied by the cytosolic mislocalisation of nucleolar proteins, such as nucleophosmin (Yang et
al., 2018). Indeed, the presence of cytosolic unbound ribosomal proteins is indicative of nucleolar stress, and is pathological in
ribosomopathies (Recasens-Alvarez et al., 2021). Based on the observation of fibrillarin in cytosolic granules in cells expressing
(PR)97 (Figure 29A), we decided to look for the presence free ribosomal proteins in the cytosol. The ribosome-free fraction of
induced U2OS (PR)97 cells, recovered from sucrose gradient polysome fractionation, revealed a marked increase of ribosomal
proteins in doxycycline-treated cells (Figure 29E). This is particularly significant, given that the majority of the proteome was down-
regulated, as can be expected in cells with severe translation inhibition (Figure 28D). Cells expressing (PR) 97, therefore, show a
functional parallelism with nucleolar stress-driven pathologies.

In this block of experiments, we have provided a unifying mechanism the divergent phenotypes observed in C9-ALS/FTD. We
showed that arginine-rich poly(PR) and poly(GR) peptides bind avidly to nucleic acids, disrupting the whole range of cellular
processes which involve DNA or RNA, including, but not limited to, translation, transcription, mRNA export, DNA replication, and
repair. Indeed, the model is consistent with previously described perturbations in DNA and RNA processes, such as in ribosome
biosynthesis, mRNA export and transport, and translation. The high affinity of arginine-rich peptides for RNA allows them to
displace RBPs, inhibiting ribosome biogenesis if the RNA in question is rRNA. The maturation of rRNA is one of the most
complicated nucleic acid processes, making it particularly susceptible to sequential layers of inhibition by poly(PR) protein
displacement. This generates pronounced and lethal nucleolar stress.

69
 2.

STRATEGIES TO OVERCOME POLY(PR) PEPTIDE TOXICITY

Several groups have identified various modifiers of poly PR toxicity through CRIPSR screening approaches, although, none have
yet yielded a useful treatment. We also tried several CRISPR libraries with limited success, which led us to develop an alternative
approach, based on spontaneous resistance mechanisms in cultured cell lines.

2.1 NSC34 cells resistant to (PR) 20 peptides show downregulated translation and ribosome biogenesis

Cells lines cultured in vitro, and subjected to a selective pressure, can develop resistances, through either intrinsic mechanisms,
or spontaneous mutations. Indeed, tool cell lines derived from tumours, su ch as HeLa, or U2OS, are not genetically uniform, but
rather present a heterogeneous population of cells with different spontaneous mutations (Liu et al., 2019). We decided to take
advantage of this genetic heterogeneity to isolate cells that, through spontaneous mechanisms, become resistant to poly(PR)
peptides (Figure 30A). Wild type motor neuron precursor NSC34 cells were subjected to a low concentration of (PR) 20 peptides
over 14 days, giving rise to two biologically independent clones with pronounced resistance to (PR)20 (NSC34R1 and NSC34R2)
(Figure 30B).

Figure 30. Generation of NSC34R clones spontaneously resistant to poly(PR) peptides. A) Diagram experimental set-up for the generation
of spontaneously resistant NSC34 R cells. B) Normalised viability, as evaluated with a CellTiter-Glo luminescent assay, of wild-type NSC-
34 cells (black), and two spontaneously resistant clones (NSC34R1 (blue) and NSC34R2 (green)), treated with increasing doses of (PR) 20
peptide over 24 hours.

Remarkably, proteomic analysis revealed that all the processes relating to ribosome biogenesis and protein translation were
repressed in NSC34R cells (Figure 31A-B; Annex Figure 4). In fact, total ribosome protein content, as well as the precursor 45S, and
the processed 18S, 5.8S, and 28S rRNAs were decreased in the resistant clones (Figure 31C-D). That a mechanism of resistance
for a treatment that is known to inhibit translation should be by down-regulating translation seems contradictory, however,
functional assays confirmed that, indeed, NSC34R cells present lower levels of translation and transcription (Figure 31E-F).

70
 RESULTS

Figure 31. NSC34R cells have lower levels of translation and nucleolar activity. A-B) GSEA enrichment plots for the gene onthology
biological process classes corresponding to ribosome biogenesis (C), and translation initiation (D). Both gene classes are depleted in
the spontaneously resistant clones, and show a negative enrichment score. C) Volcano plot of all proteins identified by proteomic
comparison of NSC34WT cells with NSC34R1. Ribosomal proteins are marked with orange (RPs from the 40S subunit) and blue (RPs
from the 60S subunit). D) Fold-change of rRNA precursor transcript (45S), and processed rRNA (18S, 5.8S, and 28S) levels in wild-type
NSC34WT cells (grey) and spontaneously resistant NSC34R (blue), quantified by qPCR, and normalised against Eif1. E-F) HTM-mediated
quantification of the HPG levels per nucleus (E) and EU levels per cell (F) in wild-type NSC34WT cells and spontaneously resistant
NSC34R. EU and HPG were added 30 minutes prior to fixation. Black lines indicate mean values. Data information: * P < 0.05;
****P < 0.0001; t-test.

Nucleolar activity correlates with nucleolar size, and unsurprisingly, NSC34R cells had smaller nucleoli than the wild-type parent
line (Figure 32A-B). The contrast between NSC34R cells, which have small nucleoli and down-regulated RPs, and poly(PR) peptide
treatment, which increased nucleolar area and led to the accumulation of unbound RPs (Figure 29) led us to question whether the
adaptations of NSC34R cells protected only from nucleolar stress caused by (PR) 20, or from nucleolar stress in general. To test
this, we treated wild-type NSC34WT cells, and NSC34R cells with a series of cytotoxins with different mechanisms of action (Figure
32C). The ATR inhibitor, AZ20, cisplatin, or camptothesin were equally toxic to both NSC34 WT and NSC34R cells, however, besides
(PR)20, NSC34R cells also proved to be resistant to the DNA polymerase I inhibitor CX-5461, and the rDNA intercalating agent
actinomycin D, both of which induce nucleolar stress. These data indicate that the adaptations of NSC34 R cells are generally
protective against nucleolar stress, but not other kinds of stress.

71
 Figure 32. NSC34R are protected from nucleolar stress. A-B) Immunofluorescence of FBL (green) in wild-type NSC34 (top panels) and
NSC34R (bottom panels) (A), and HTM-mediated quantification of nucleolar area (B). Black lines indicate mean values. C) Normalised
viability, as evaluated with a CellTiter-Glo luminescent assay, of NSC34WT cells (grey) and NSC34 R (blue), treated with non-nucleolar-
stress-inducing compounds (AZ20 (ATRi), 20 µM, cisplatin, 25 µM, and camptothesin (CPT), 8 µM), and nucleolar-stress-inducing
compounds ((PR)20, 20 µM, actinomycin D (ActD), 5 nM, and CX-5461 (CX), 10 nM), over 24h. Data information: n. s. P > 0.05; * P < 0.05;
** P < 0.01; *** P < 0.005; t-test. Scale bar represents 10 µm.

2.2 mTOR inhibition protects against poly(PR) toxicity

The Connectivity Map (CMap), at the Broad Institute, is an ambitious project, which aims to create a collection of changes in gene
expression, or “signatures”, caused by different chemical or genetic treatments (Subramanian et al., 2017). The dataset contains
over 1.3 million signatures, generated from treatments with over 25,000 perturbagens, including compounds, loss-of-function by
shRNA silencing or CRISPR, and gain-of-function by cDNA over-expression. The dataset is freely available (https://clue.io/cmap)
and can be queried against an external expression profile, giving a score of similarity (connectivity score), between the catalogue
of perturbagens and the query signature.

In order to translate our observations from the spontaneously resistant NSC34 R cells into a useful treatment, we compared the
proteomic expression profile against the CMap signature catalogue. The connectivity scores to the CMap chemical signatures
were then subjected to a drug set enrichment analysis (DSEA). DSEA is an adaptation of the gene set enrichment analysis (GSEA)
algorithm, which calculates the enrichment of drug classes instead of genes, therefore allowing us to detect over-representation
of compounds which share a common mechanism of action (Sanchez-Burgos et al., 2022; Sinha et al., 2020) (Annex Figure
5).

Both NSC34R clones’ profiles proved to have four drug classes in common: mTOR inhibitors (mTORi), PI3K inhibitors (PI3Ki), T -
type calcium channel blockers, and HDAC inhibitors (Figure 33A-B; Annex Figure 5). This indicates that the signatures of NSC34R
cells are highly similar to a majority of the members of each drug class. In the case of mTOR inhibitors, 14 of the 15 compou nds
showed a high connectivity score with either one, or both, of the NSC34 R clones (Figure 33C).

72
 RESULTS

Figure 33. NSC34R cells have inhibited mTOR signalling; mTOR inhibition can rescue poly(PR) toxicity. A-B) Drug set enrichment analysis
(DSEA) enrichment plots for top enriched drug classes in NSC34R1 and NSC34R2 corresponding to mTOR inhibitors (A), and PI3K
inhibitors (B). DSEA was carried out on the connectivity scores between the top up-regulated proteins of NSC34R1 and NSC34 R2, and
the compound gene-expression signatures deposited in the CMap perturbagen signature data set. C) Connectivity scores (CS) of mTOR
inhibitor compound set in NSC34R1 and NSC34R2. The CS is represented by the colour gradient, and the value indicated in each cell. D)
Western blot evaluating the levels of mTOR signalling in wild-type NSC34 WT cells, and spontaneously resistant NSC34R1 and NSC34R2.
Total and phosphorylated levels of S6K1 and RPS6 are shown, along with a loading control. E) Normalised viability, as evaluated with
a CellTiter-Glo luminescent assay, of two lines of p53-null MEFs, wild-type for Tsc2 (MEFsTp53-/- Tsc2 +/+) and homozygous-null (MEFsTp53-
/- Tsc2-/- ), treated with increasing doses of (PR)
20 peptide over 24 hours (n=2). F) Average normalised viability, as evaluated with manual
counting of live cells, of two independent inducible NSC-34(PR)97 cell lines, with and without doxycycline, treated with rapamycin (50 nM)
and torin-1 (50 nM) over 48 hours. Representative immunofluorescence image of (PR) 97-HA induction at 48h. Scale bar represents 10
µm. G) Clonogenic survival assay of inducible U2OS(PR)97 cells, exposed to doxycycline and mTOR inhibitors. U2OS(PR)97 cells were
simultaneously treated with 30 nM rapamycin or 3 nM torin-1, with doxycycline, for 48h, and then allowed to grow for 10 days before
fixing. Representative immunofluorescence image of (PR)97-HA induction at 48h. Data information: **P < 0.01; t-test. Scale bar
represents 10 µm.

The identification of HDAC inhibitors among the repeated hits was significant, because HDACs are an emerging target in ALS.
Inhibition of HDAC6 has been recently proposed for the treatment of TDP43-ALS (Fazal et al., 2021), and FUS-ALS (Stoklund
Dittlau et al., 2021; Tejido et al., 2021); HDAC1 for TDP43-ALS (Sanna et al., 2020); general HDAC inhibition for FUS-ALS
(Arenas et al., 2020), or even SOD1-ALS (Schiaffino et al., 2018).

The coincidence of both mTORi and PI3Ki classes was particularly striking, as PI3K is an upstream activator of mTOR. In fact,
inhibitors of two other upstream activators of the same route were over-represented: AKT inhibitors in NSC34R1, and IGF1 inhibitors
in NSC34R2 (Annex Figure 5, Annex Figure 6).

73
 Figure 34. Inhibition of mTOR protects against nucleolar stress. A-B) Immunofluorescence of the nucleolar factor FBL (green) in wild-type
NSC34 treated with 50nM rapamycin (A), and HTM-mediated quantification of nucleolar area (B). Black lines indicate mean values. C-D)
Normalised viability, as evaluated with a CellTiter-Glo luminescent assay, of untreated NSC34WT cells (grey) pre-treated with rapamycin
(C, blue), or torin-1 (D, green), and treated with non-nucleolar-stress-inducing compounds (AZ20 (ATRi), 20 µM, cisplatin, 25 µM, and
camptothesin (CPT), 8 µM), and nucleolar-stress-inducing compounds ((PR)20, 20 µM, Actinomycin D (ActD), 5 nM, and CX, 10 nM), over
24h. E-G) Levels of newly synthesised (E) and previously synthesised RPL29 protein (F) and in RPL29-Halo HCT113 after 16h treatment
with (PR)20 (10 µM), with and without rapamycin (50 nM), and representative immunofluorescence (G). New RPL29 is green, and
previously synthesised RPL29 is red. Data information: n. s. P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.005; ****P < 0.0001; t-test). Scale
bar represents 10 µm (A), 20 µm (G).

The mTOR signalling pathway is one of the key activators of translation and ribosome biogenesis (Liu and Sabatini, 2020), therefore
mTOR repression, as indicated by the CMap data, is in agreement with the low nucleolar activity observed in the proteomic profile
(Figure 32), and could be key to the resistant phenotype of the NSC34R cells. Indeed, both NSC34R1 and NSC34R2 had inhibited this
route, as indicated by low levels of phosphorylated S6K, and RPS6 (Figure 33D). Consistently, Tsc2-/- MEFs, which have
constitutively elevated levels of mTOR activity (Inoki et al., 2002), proved to be more sensitive to (PR) 20 than the wild-type Tsc2+/+
line (Figure 33E). Finally, exposure of inducible (PR) 97-expressing NSC34PR(97) or U2OSPR(97) to the mTOR inhibitors rapamycin
(sirolimus), or torin-1, moderately rescued viability (Figure 33F-G).

Treatment with rapamycin shrinks nucleoli, and has been described to protect against cell death by ActD (Goudarzi et al., 2014),
which led us to test whether the nucleolar stress-resistance of the NSC34R could be phenocopied by mTOR inhibition. Like NSC34 R,
we could confirm that rapamycin-treated cells had smaller nucleoli (Figure 34A-B). Treatment with rapamycin or torin-1 led to a
small rescue in toxicity of ActD, CX-5461, and (PR)20, although statistical significance was not reached in the case of (PR) 20 rescue

74
 RESULTS

by rapamycin (Figure 34C-D). While mTOR inhibition confers some protection against nucleolar stress, it is not equivalent to that
seen in the NSC34R clones, suggesting that additional adaptive mechanisms are at work.

Finally, to test the effects of rapamycin on pre-existing and nascent r-protein levels, we used an HCT116 cell line with endogenous
Halo-tagged RPL29 (HCT116-RPL29Halo) to carry out pulse-chase experiments (An et al., 2020). In agreement with our proteomic
data, treatment with (PR)20 peptides increased the levels of newly-synthesised RPL29, and interestingly, rapamycin returned them
to baseline levels (Figure 34E). In contrast, pre-existing levels of RPL29 were higher in (PR) 20-treated cells, and were not rescued
by rapamycin treatment, indicating repression of protein degradation pathways(Figure 34F). These data suggest that in poly(PR)-
treated cells rapamycin modulates r-protein levels through control of nucleolar activity rather than degradation.

Through the analysis of spontaneously resistant NSC34 R cells, we derived mTOR inhibitors, such as rapamycin, as a candidate
treatment against poly(PR) toxicity. Additionally, this block of experiments serves as a proof of concept for the application of this
approach for the discovery of novel mechanisms of resistance.

2.1 MYC down-regulation protects against poly(PR) toxicity

Analysis of similarity to CMap chemical perturbagens unearthed mTOR inhibition as a protective treatment against poly(PR)
toxicity, however it led to only a moderate rescue, and failed to reconstitute the full phenotype of NSC34R in the context of nucleolar
stress, which reflects that the resistance phenotype is probably the result of multiple adaptations. We returned to the CMap data,
focussing on the genetic perturbagens, in order to unearth further resistance mechanisms.

Figure 35. NSC34R cells have signatures compatible with down-regulation of MYC or RAS. A-B) Connectivity scores were calculated
between the top up-regulated proteins of NSC34R1, and the genetic perturbagen gene-expression signatures deposited in the
Connectivity Map signature data set. Connectivity correlation profiles for MYC (A) and RAS (B) perturbagens are represented with their
FDR. Loss of function events are represented by blue and purple points, by shRNA and CRISPR, respectively. Gain of function events,
by overexpression are represented by pink points. The NSC34R signature positively correlates with loss of function events of both MYC
and the RAS, and negatively correlates with gain of function events of both.

The CMap genetic perturbagens have an added element of complexity, as opposing signatures loss-of-function and gain-of-
function processes are catalogued for the same gene. Loss-of-function perturbagens can be either by knock-down by shRNA, or
knock-out by CRISPR, while gain-of-function can be obtained by cDNA overexpression. These contrasting signatures can both be
used in the analysis of a query profile. When compared to the NSC34 R1 profile, one of the most significantly opposing signatures
is “over-expression of MYC”. Analysis of the distribution of each of the perturbations of MYC, in each CMap cell line, reveals a
clear pattern. NSC34R1 cells are similar to loss-of-function of MYC, and dissimilar to MYC over-expression (Figure 35A).
Interestingly, perturbations of the RAS gene family (H-, K-, and N-RAS; here collapsed as a single entity), follow the same pattern
(Figure 35B).
75
Both RAS and MYC are essential regulators of ribosome biogenesis; in fact, MYC is an effector of the RAS/ERK route in Drosophila
and mammals (Kerkhoff et al., 1998; Piazzi et al., 2019; Sriskanthadevan-Pirahas et al., 2018). Several promising
pharmacological approaches to target MYC are available, including the recently published family of MYC-inhibitors, as well as the
dominant-negative peptide OmoMYC (Han et al., 2019; Soucek et al., 2008; Whitfield and Soucek, 2021), while, to date RAS is
considered undruggable. Genetic targeting of MYC is also simpler, as it is a single gene, whereas there are three RAS homologues,
and in fact, stabilised antisense oligonucleotide-targeting of MYC has recently been described in the context of oncology (Gill et
al., 2021). The availability of these interventions favour MYC as a possible target in the treatment of ALS.

Figure 36 MYC down-regulation rescues cell death by poly(PR) peptides. A) MYC levels 96 hours after transfection with siRNAs, either
control siCTRL, or siMYC. B) Viability by HTM-mediated quantification of nuclei, stained by DAPI, in U2OS(PR)97 after 48 hours of
treatment with doxycycline, with (green) and without rapamycin (blue). Cells were transfected with siRNAs, either scrambled, or siMYC,
48 h prior to treatment. C) HTM-mediated quantification of nucleolar area, by immunofluorescence of FBL in U2OS (PR)97 after 48 hours
of treatment with doxycycline (blue), or untreated (grey). Cells were transfected with siRNAs, either scrambled, or siMYC, 48 h prior to
treatment. Black lines indicate mean values. D) Normalised viability, as evaluated with a CellTiter-Glo luminescent assay, of U2OS WT
transfected with scrambled siRNAs (grey), or siMYC (blue), and treated with non-nucleolar-stress-inducing compounds (AZ20 (ATRi),
10 µM, cisplatin, 50 µM, and camptothesin (CPT), 8 µM), and nucleolar-stress-inducing compounds ((PR)20, 10 µM, Actinomycin D
(ActD), 5 nM, and CX, 10 nM), over 24h. Data information: n. s. P > 0.05; * P < 0.05; ** P < 0.01; *** P < 0.005; ****P < 0.0001; t-test.

Down-regulation of MYC, using anti-MYC siRNAs, improved viability in doxycycline-treated U2OS(PR)97 cells (Figure 36A-B). Of note,
MYC knock-down was more efficient than treatment with rapamycin, and the two were not additive, indicating that the rescue
maybe through the same mechanism. Like cells treated with rapamycin, U2OS (PR)97 cells with silenced MYC had smaller nucleoli,
both under basal conditions, and upon (PR) 97 induction (Figure 36C). Likewise, MYC silencing protected cells against (PR) 20, and
ActD, however, surprisingly sensitised them to CX-5461 (Figure 36D). This divergence in response to CX-5461 argues against
coincidence of pathway with mTOR inhibitors. Despite the non-general response to nucleolar stress, MYC modulation is another
viable strategy to ameliorate poly(PR) toxicity.

3.

TESTING THE EFFECT OF POLY(PR) PEPTIDES IN VIVO

In this section, we set out to develop an in vivo mouse model in which to test poly(PR) toxicity, and the strategies identified in the
previous section. When we began this project, several mouse strains had been developed to model C9-ALS in vivo (Jiang et al.,
2016; Liu et al., 2016), the most promising of which only showed a phenotype in a fraction of the females at the end of 2 years,
and even that was later refuted (Mordes et al., 2020; Nguyen et al., 2020) . The lack of a fast model in which to test potential
therapies greatly hinders drug development in the field, although a better model has since been produced (Hao et al., 2019).

We set out to develop a rapid and robust model of poly(PR) toxicity in which to screen potential therapies. This line is meant for
fast preliminary testing, before moving onto more physiological, but much slower models.
76
 RESULTS

3.1 An in vivo model of poly(PR) toxicity shows a lethal premature ageing phenotype

To generate a doxycycline-inducible, Tet-ON model of poly(PR) DPR toxicity, we used the previously described KH2 system (Beard
et al., 2006). The codon-optimised (PR)97-HA-Flag construct was knocked-in to the Col1a1 locus, under the control of a TetO
operator, in KH2 mESCs harbouring the rtTA transactivator in the widely expressed Rosa26 locus (Figure 37A-B). This two-tier
level of control gives a particularly tight system, minimising the problem of leakiness, characteristic of these systems.

Figure 37 MEFs derived from inducible PRKI/KI mice present nucleolar stress and death upon peptide induction. A) Diagram representing
the inducible double knock-in Col1a1(PR)97 Rosa26 rtTA system. B) Agarose electrophoresis gel of PCR genotyping amplicons for the
littermate non-inducible Col1a1(PR)97/(PR)97 Rosa26+/+ MEF cell lines (PR+/+), and inducible Col1a1(PR)97/(PR)97 Rosa26 rtTA/+ MEF cell lines
(PRKI/KI). C) Immunofluorescence of (PR)97–HA (red) and the nucleolar factor FBL (green) (A), in inducible PR KI/KI MEFs after a 48h
treatment with doxycycline. D-E) HTM-mediated quantification of HA intensity (D), and nucleolar area (E), by HA and FBL staining,
respectively, per nucleus after a 48h treatment with doxycycline. Each point corresponds to the mean value from a biologicall y
independent littermate MEF line and black lines indicate mean values of the three lines. Untreated controls are represented in grey, while
non-inducible PR+/+ MEFs +dox in green, and inducible PRKI/KI MEFs +dox in blue. F) HTM-mediated quantification of HPG levels per
nucleus in three non-inducible PR+/+ MEF lines, and three inducible littermate PRKI/KI MEF lines, treated with doxycycline for 48h. Each
point corresponds to the mean value from a biologically independent littermate MEF line. Untreated controls are represented in grey,
while non-inducible PR+/+ MEFs +dox in green, and inducible PRKI/KI MEFs +dox in blue. HPG was added 1 hour prior to fixation. Black
lines indicate mean values G) Average normalised viability, as evaluated with a CellTiter-Glo luminescent assay, of three non-inducible
PR+/+ MEF lines, and three PRIND+ MEF lines, treated with doxycycline for 48h, and a representative image of an inducible line. Untreated
controls are represented in grey, while non-inducible PR+/+ MEFs +dox in green, and inducible PRKI/KI MEFs +dox in blue. Data information:
n. s. P > 0.05; *P < 0.05; ** P < 0.01; **** P < 0.001; paired t-test). Scale bar represents 10 µm.

MEFs extracted from these animals showed a robust, although heterogeneous, induction of (PR) 97 in Col1a1 (PR)97/(PR)97/Rosa26 rtTA/+
MEF lines (hereafter called PRKI/KI) treated with doxycycline, while no signal was detected in non-inducible
Col1a1(PR)97/(PR)97/Rosa26+/+ MEF lines (hereafter called PR+/+), or in PRKI/KI cells not treated with doxycycline (Figure 37C-D). As in
the U2OS (PR)97 cells (Figure 28), (PR)97 induction in MEFs was accompanied by expansion of nucleolar area (Figure 27E), and
77
inhibition of protein synthesis (Figure 37F), as quantified by HTM. Predictably, induction of (PR)97 leads to a loss of viability in
PRKI/KI MEFs (Figure 37G). Poly(PR) induction in MEFs derived from inducible animals recapitulate the major properties of
U2OS (PR)97 cells, including translation inhibition, nucleolar stress, and toxicity. The in vivo phenotype, therefore, is directly linked to
the cellular characterisation so far.

78
 RESULTS

Figure 38. PRKI/KI mice expressing (PR)97 present a lethal premature ageing phenotype. A) HA immunohistochemistry in sections of
intestine, pancreas, and liver in a non-inducible mouse (PR+/+), and an inducible littermate (PRKI/KI), after 3 weeks’ treatment with
doxycycline. Black arrows indicate examples of nucleolar localisation in pancreas sections. B) Immunofluorescence in of (PR)97–HA-
FLAG (red) in sections of intestine in a representative non-inducible PR+/+ mouse, and an inducible PRKI/KI littermate, after 3 weeks’
treatment with doxycycline. C) Kaplan-Meyer representation of the lifespan of non-inducible (PR+/+; n = 8), heterozygous inducible (PRKI/+,
n = 9), and homozygous inducible (PRKI/KI, n = 5) mice, after starting doxycycline treatment at 5 weeks. (**** P < 0.001; Mantel-Cox test).
D) Representative lateral and dorsal images of non-inducible PR+/+ and inducible PRKI/+ littermates after 20 weeks’ treatment with
doxycycline. Black arrow indicates kyphosis, and while dotted white lines delimit areas of grey fur in the PR KI/KI mouse. E) Representative
weights of non-inducible (PR+/+) and inducible (PRKI/KI) littermates before, after 1 weeks’, and after 4 weeks’ treatment with doxycycline.
(0 and 1 weeks: nPR+/+ = 12, nPR KI/KI = 15; 4 weeks: nPR+/+ = 10, nPR KI/KI = 10) (n. s. P > 0.05; ****P < 0.0001; t-test). F) Kyphotic angle
between C1-T3-T9 vertebrae in the spines of non-inducible PR+/+ and inducible PRKI/KI littermates after 12 weeks’ treatment with
doxycycline. G) Representative image of a cataract in an inducible PR KI/KI mouse after 20 weeks’ treatment with doxycycline. White
between C1-T3-T9
arrow indicates thevertebrae
cataract. in
H)the spines of and
Hematoxylin non-inducible PR+/+from
eosin staining and the
inducible
femoral
KI/KI littermates after 12 weeks’ treatment
PRhead of representative non-inducible PR+/+ with
and
KI/KI mouse after 20 weeks’ treatment with doxycycline. White
doxycycline. G)
KI/+ Representative image of a cataract in an inducible PR
inducible PR littermates after 20 weeks’ treatment with doxycycline to illustrate the accumulation of fat in the bone marrow. Scale
arrow indicates500
bar represents theµM.
cataract. H) Hematoxylin
I) Hematoxylin and
and eosin eosin of
staining staining from the femoral
skin cross-sections, and head of representative
quantification non-inducible
of skin thickness, PR+/+ and
in non-inducible
KI/+ littermates after
inducible
+/+ PR KI/+ 20 weeks’ treatment with doxycycline to illustrate the accumulation of fat in the bone
PR (n = 7) and inducible PR (n = 6) littermates after 20 weeks’ treatment with doxycycline to illustrate the decrease in skin thickness.marrow. Scale
bar represents 500 µM.
Scale bar represents 100 µM.I) Hematoxylin and eosin staining of skin cross-sections, and quantification of skin thickness, in non-inducible
PR+/+ (n = 7) and inducible PRKI/+ (n = 6) littermates after 20 weeks’ treatment with doxycycline to illustrate the decrease in skin thickness.
Scale bar represents 100 µM.

When given oral doxycycline, the animals showed induction in most tissues, with the notable exception of nervous tissue (Figu re
38A, Annex Figure 7). In the original description of the KH2 system, the same exception is observed, and accrued to the inability
of doxycycline to cross the blood-brain barrier (Beard et al., 2006). We believe that this explanation is unlikely, as doxycycline is
routinely used in the clinic to treat cerebral infections (Cunha, 2000; Wormser and Halperin, 2008), and many other doxycycline-
inducible models with expression in the brain have been described, such as the CamK2 tTA model (Mayford et al., 1996). Indeed,
our efforts to induce expression with doxycycline treatment in vitro, in differentiated PRKI/KI motor neurons, or in ex vivo brain slices
have both been unsuccessful (data not shown). We believe that this may be an intrinsic limitation from endogenous expression
levels of Rosa26 and Col1a1 expression in nervous tissue, rather than permeability of the blood-brain barrier to doxycycline.

Immunohistochemical staining against the HA tag of the construct showed variable levels of expression, and homogeneity,
depending on the tissue (Figure 38A, Annex Figure 7). The subcellular localisation revealed by immunohistochemistry varied from
nucleolar, such as in the pancreas, to nuclear, nucleolar, and cytosolic, under saturating conditions, such as in the int estine. Using
a second, anti-PR antibody, nucleolar localisation, was confirmed by immunofluorescence in intestine tissue sections (Figure 38B).
Poly(PR) peptides behave similarly in vivo, as in vitro, although tissues in vivo appear to tolerate higher accumulation of DPRs, as
inferred by the diffuse cytosolic staining in the intestine slices (Figure 38B).

Treatment with doxycycline, and therefore (PR) 97 induction, proved to be lethal, and dependent on gene dosage; PR KI/KI animals
had a median survival of 10 weeks, while PRKI/+ of 18 (Figure 38C). Astonishingly, mice expressing poly(PR) peptides developed
what appeared to be a progeric phenotype, characterised by weight loss, patches of grey fur, kyphosis, and dark discolouration on
the visible skin of the tail (Figure 38D-F). In fact, approximately 30% of inducible PRKI/KI animals developed cataracts in either one,
or both, eyes, which was not seen in any PR+/+ animals (Figure 38G). Histopathologic analysis yielded further signs of ageing, such
as the replacement of bone marrow with adipose tissue in the head of the femur (Figure 38H), or decreased skin thickness (Figure
38I).

3.2 Poly(PR)-expressing animals have up-regulated mTOR and MYC hallmarks

In order to further characterise the ageing phenotype, we decided to analyse the expression profiles of livers in PR KI/+, and PR+/+
mice. GSEA revealed four general groups of up-regulated hallmarks: metabolic processes, stress-response, and inflammation
(Figure 39, Annex Table 8). The up-regulation of inflammation and stress-response are consistent with a premature ageing
phenotype, and in fact, many of the hallmarks from these groups coincide with those that appear in the GSEA from physiologica lly
aged mouse livers (Annex Table 8) (White et al., 2015). Another transcriptional change, which was indicative of ageing, was the
extensive remodelling of the expression of the cytochrome P450 family. The expression profile of this large group of proteins is
known to change with development and aging in rodents (Hart et al., 2009; Xu et al., 2019), and its consistent variation supports
that there are differences in biological age between doxycycline-treated PRKI/+, and PR+/+ littermates.

After eliminating the hallmarks associated with physiological ageing, those left b ehind are most likely direct consequences of
poly(PR) expression, and are therefore probable drivers of the phenotype. It was particularly striking to find the hallmarks for MYC
79
targets and mTOR signalling among the enriched processes, as both are involved in lifespan regulation, and, specifically in the
light of our previous data, showing that the down-regulation of either can rescue poly(PR)-toxicity in vitro (Figure 34, 36). Inhibition
of mTOR is one of the best-described life-span extending interventions in mammals (Liu and Sabatini, 2020); likewise, Myc
heterozygous animals also live longer (Hofmann et al., 2015). In addition, both MYC and mTOR are metabolic activators and can
be responsible for the other up-regulated hallmarks, such as oxidative phosphorylation and glycolysis.

Figure 39. PRKI/+ mice have up-regulated metabolic signatures. Plot of false discovery rate (FDR) against normalised
enrichment score (NES) of hallmarks enriched in PRKI/+ male mice, compared to PR+/+ mice (n=2 in each group), after 17
weeks of dox treatment, as calculated by GSEA analysis. The area of the bubble is proportional to the number of genes in
each group. Only metabolism-related hallmarks are represented, and split into those directly involved in ribosome
biogenesis and translation regulation (purple), and those that are not (red).

3.3 C9-ALS patients have up-regulated mTOR and MYC hallmarks

Although the robust ageing phenotype of PRKI/+ animals is not directly relevant to ALS, the expression signature may be, as we
have previously shown that poly(PR) peptide toxicity can be rescued with mTOR inhibitors independently of cell type, both in
human osteosarcoma U2OS cells, and mouse motor neuron NSC34 cells. We therefore searched for evidence of MYC or mTOR
activation in C9ORF72-ALS patients.

NeuroLINCS is a data repository for neurological diseases (http://neurolincs.org/). In the latest release, RNAseq expression
profiles from motor neurons, obtained by differentiation of iPSCs derived from ALS patients and healthy controls became available
(Leslie Thompson: diMN (Exp 3) - ALS and Control (unaffected) diMN cell lines differentiated from iPS cell lines using a
short and direct differentiation protocol - RNA-seq, 2017, LINCS (collection), http://identifiers.org/lincs.data/LDG-1393).
We obtained differential expression analysis comparing C9-ALS patients, or sporadic ALS patients, with healthy controls.

The hallmark corresponding to “mTORC1 signalling” had no significant enrichment in sporadic ALS, however, the signature was
significantly up-regulated in C9-ALS patients (Figure 40A-B). MYC targets are defined by two hallmarks, “MYC targets (1)” being a
larger gene set, derived from 404 founder gene sets, while “MYC targets (2)” is a streamlined version, defined only by 6 core gene
sets (Liberzon et al., 2015). Like the mTORC1 hallmark, both MYC target signatures, showed equal distribution, and no activation
in sporadic ALS, while both were highly up-regulated in C9-ALS (Figure 40C-D).
80
 RESULTS

Nucleolar stress has been associated with C9-ALS, and both mTOR and MYC are key regulators of nucleolar metabolism. Given
the prominent role of ribosomal proteins both in poly(PR)-mediated nucleolar stress (Figure 29), and resistance mechanisms
(Figure 31), we hypothesised that ribosomal proteins might also feature in C9-ALS. In line with activation of these two routes, both
40S, and 60S ribosomal proteins were up-regulated in C9-ALS, but not in sporadic cases (Figure 40E-F).

81
 Figure 40. C9ORF72 ALS patients present activated mTORC1 signalling, and up-regulated ribosomal proteins. A-F) Volcano plot of RNA-
seq data from differentiated motor neurons, derived from healthy controls (n=4), and patients of sporadic ALS (A, C, E) (n=8), and
C9ORF72 ALS (B, D, F) (n=8), made available on the LINCS data repository. The grey points indicate gene expression distribution in all
cases, while the coloured points correspond to genes defined as the “mTORC1 signalling” hallmark (A-B; green), “MYC targets 1” and
“MYC targets 2” hallmarks (C-D; blue and green, respectively), and ribosomal proteins (E-F; blue and orange, respectively). Each volcano
plot is accompanied by a bar chart summarising the gross distribution of each gene set in the corresponding expression profile analysis.
The P-value was obtained by a hypergeometric test.

This block of experiments shows that expression signatures of tissues in the inducible poly(PR) mice share hallmarks specifically
with differentiated motor neurons from C9-ALS patients, but not cases of sporadic ALS. This draws a direct link between ageing
mechanisms and neurodegeneration in ALS, implying that the two processes have common drivers.

3.4 Poly(PR) inducible mice have increased ribosomal protein levels, activated mTOR, and nucleolar stress

Consistent with the up-regulation of MYC and mTORC1 signalling hallmarks, and like in C9-ALS derived motor neurons, we also
found a robust up-regulation of ribosomal protein mRNAs in poly(PR)-expressing mice (Figure 41A), which was confirmed at the
level of protein expression in liver tissue (Figure 41B). Likewise, pRPS6 levels were elevated in PRKI/+ mice, indicating mTOR
activation (Figure 41B-C). Hyperactive mTOR signalling has been shown to exhaust stem cell pools in tissues, halting self-renewal
(Chen et al., 2009; Yilmaz et al., 2012), while both chemical and genetic inhibition of mTOR has been widely described to extend
lifespan, making mTOR activation a feasible driver of ageing in this model. Furthermore, this hyperactivation could be
compensatory for the ribosomal biogenesis impairments caused by poly(PR) peptides, and could also explain why mTOR inhibition
rescues poly(PR) peptide toxicity in vitro, bringing together the phenotype in vivo with the toxicity in vitro.

82
 RESULTS

Figure 41. PRKI/KI mice expressing (PR)97 present nucleolar stress and mTOR activation. A) Normalised read counts of all detected
ribosomal protein mRNAs, quantified by RNA-seq in total RNA of livers of non-inducible (grey, PR+/+) and inducible (blue, PRKI/+) male
littermates after 17 weeks’ treatment with doxycycline. B) Western blot evaluating the levels of mTOR signalling, by pRPS6, and of
ribosomal proteins RPS6 and RPS2 in liver total protein extracts of non-inducible PR+/+ and inducible PRKI/+ female littermates after
20 weeks’ treatment with doxycycline. C) RPS6 and pRPS6 immunohistochemistry in sections of liver in a non-inducible mouse (PR+/+),
and an inducible littermate (PRKI/KI), after 3 weeks’ treatment with doxycycline. D-E) Co-immunofluorescence of (PR)97–HA (red),
indicated by HA staining, and the nucleolar factor FBL (green), in sections of intestine (D), and liver (E) in a representative non-inducible
PR+/+ mouse, and an inducible PRKI/KI littermate, after 3 weeks’ treatment with doxycycline. Accompanying quantification of nucleolar
FBL+ area in each tissue. White dotted lines delimit the position of the nuclei in the red and green channels; white arrows indicate
nucleolar ring structures indicative of nucleolar stress. Data information: No P value indicated P > 0.05; * P < 0.05; ** P < 0.01; ***
P < 0.005; ****P < 0.0001; t-test. Scale bar indicates 10 µm.

Premature ageing has previously been connected to nucleolar alterations; fibroblasts extracted from patients with Hutchinson -
Gilford progeria showed expanded nucleoli (Buchwalter and Hetzer, 2017b), just like PRKI/KI MEFs, while small nucleoli correlated
with longevity in worms, mice and humans (Tiku et al., 2017). PRKI/KI mice had expanded nucleoli in both intestinal and hepatic
tissue (Figure 41D-E); in fact, the nucleolar marker, fibrillarin, formed ring structures in liver sections. Nucleolar rings, or
“necklaces”, are one of the most characteristic morphological alterations associated with nucleolar stress (Yang et al., 2018).
Interestingly, the levels of nucleolar stress in liver appear to be much higher than in intestine, as reflected by both the area, and
the presence of nucleolar rings, perhaps explaining why the intestine appears to tolerate much higher expression of (PR) 97.

83
3.5 Inhibition of mTOR rescues viability in poly(PR) expressing mice

Taking together the hyperactivation of mTOR in vivo, coinciding with a progeroid phenotype, and the rescue of poly(PR) toxicity
with mTOR inhibition in vitro, all support the use of mTOR inhibitors, such as rapamycin, for the rescue of PR KI/KI survival.

Preliminary tests in PRKI/KI MEFs recapitulate the rescue seen in U2OS (PR)97 and NSC34(PR)97 cells, both in viability and nucleolar
area and morphology (Figure 42A-B, Figure 42D). Importantly, the levels of (PR) 97-HA expression were equivalent in rapamycin-
treated and –untreated cells, eliminating the possibility of lower expression accounting for the rescue (Figure 42C). In addition,
both rapamycin and torin-1 rescued viability in differentiated dNSC34(PR)97 cells (Figure 42E). In fact, rapamycin treatment
prevented the retraction of neurites in dNSC34 (PR)97 (Figure 42F-G), which is an early sign of ALS, making a promising case towards
the transferability of mTOR inhibitors as a C9-ALS/FTD treatment.

To test the efficacy of rapamycin in vivo, 8-10 week-old inducible PRKI/KI and non-inducible PR+/+ mice were used (Figure 43A).
Rapamycin treatment began later than in the pilot test to give the animals opportunity to gain weight, as rapamycin is known to
cause weight-loss. Doxycycline treatment began a week after switching the animals to rapamycin diet. Surprisingly, mTOR
inhibition had a more potent effect in vivo than in vitro, and extended median survival of PRKI/KI animals by 60% (109 days over
183) (Figure 43B). It should be noted that the basal survival of the PR KI/KI animals in these experiments was significantly longer
than in the primary characterisation (Figure 38C), and may be due to the different composition of the rapamycin diet, later start of
treatment with doxycycline, replacement of sucrose for saccharin in the oral doxycycline, or other unknown causes. A second
observation of note is that although mTOR inhibition through rapamycin was successful, calorie restriction was not (data not
shown).

84
 RESULTS

Figure 42. Rapamycin rescues viability and nucleolar stress in PRKI/KI MEFs, and in differentiated NSC34(PR)97 cells. A-C)
Immunofluorescence of (PR)97–HA (red) and the nucleolar factor FBL (green) (A), in a representative a inducible PR IND+ MEF line, after
a 48h treatment with doxycycline, with and without 1 nM rapamycin. HTM-mediated quantification of HA intensity (C), and nucleolar
area (B), by HA and FBL staining, respectively. Each point corresponds to the mean value from a biologically i ndependent littermate
MEF line and black lines indicate mean values of the three lines. Doxycycline-untreated controls are represented in grey, while treated
cells in blue. (n. s. P > 0.05; * P < 0.05; paired t-test). D) Average normalised viability, as evaluated with a CellTiter-Glo luminescent
assay, of three biologically independent littermate inducible MEF lines, treated with doxycycline for 48h, with (green) and without (grey)
rapamycin 1 nM. (**** P < 0.001; t-test). E) Average normalised viability, as evaluated with manual counting of live cells, of two
independent inducible differentiated dNSC34(PR)97 cell lines, with and without doxycycline, treated with rapamycin (50 nM) and torin-1
(50 nM) over 48 hours. (*P < 0.05; t-test) F-G) Immunofluorescence of the neuronal marker TUBB3 (red) differentiated NSC-34(PR)97
cells treated with doxycycline for 48 hours, with or without 50 nM rapamycin. Nuclei were stained with DAPI (blue). Scale bar (white),
10 μm. Note that besides its impact on overall survival, mTOR inhibition by rapamycin also had a marked effect in rescuing neurite
lengths that had been shortened by the peptide, as quantified in (G). Scale bar represents 100 µm (****P < 0.001; t-test)

85
 Figure 43. Rapamycin rescues viability in PRKI/KI mice expressing (PR)97 . A) Diagram showing the experimental treatment regime of
animals with rapamycin and doxycycline. B) Kaplan-Meyer representation of the lifespan of non-inducible PR+/+ (n = 13), and inducible
PRKI/KI (n = 13) littermates, after starting rapamycin treatment at 9 weeks, and doxycycline treatment at 10 weeks of age. Rapamycin
extends median lifespan by 60% in inducible mice. (** P < 0.01; Mantel-Cox test).

We have shown that rapamycin treatment can rescue both in vitro poly(PR) toxicity, and improve survival of (PR) 97-expressing
mice. This is particularly striking in light of the anti-ageing properties of mTOR inhibition in contrast to the premature ageing
phenotype of PRKI/KI animals. Taking into account mTORC1 activation seen in the mRNA expression data from C9-ALS/FTD derived
motor-neurons (Figure 40B), and the rescue of dNSC34 (PR)97 motor neuron death (Figure 42E-G), here we show that mTOR
inhibition, using small molecule inhibitors such as rapamycin, is a promising target in the treatment of C9-ALS/FTD.

86
 RESULTS

DISCUSSION

87
 1.

INSIGHTS INTO THE MECHANISM OF CELL DEATH BY ARGININE-RICH PEPTIDES

It is tempting to postulate that, in analogy to cancer, ALS is a multigenic disease, driven by multiple “hits” in
several disease-relevant mechanisms. The difficulty in identifying the genetic cause of vast majority of cases
would support this view. Given the plethora of defects associated to the pathology, it seems unlikely that a single
mutation can cause so many different types of damage.

In this thesis, we provide a unifying mechanism for the toxicity of R-rich peptides, which can explain most of the
associated cellular defects. Furthermore, by applying ageing theory to our model, we gain insights to the
pathomechanism of ALS, and propose novel therapeutic targets.

1.1 ARGININE-RICH PEPTIDES PROMISCUOUSLY BIND TO NUCLEIC ACIDS

To date, each disturbance of normal function caused by R-rich peptides was assigned to an interaction with a
single protein, or at most a group of proteins. To name a few: heterochromatin dysfunction was argued to be due
to interaction with HP1α (Zhang et al., 2019), ribosome biogenesis inhibition through DEAD-box RNA helicases
(Suzuki et al., 2018), translational repression through interaction with ribosomal proteins (Y.-J. Zhang et al.,
2018), and nucleolar localisation through peptide sequestration by NPM1 (Hartmann et al., 2018). With each
report, the question arises: how can a single peptide cause so many specific effects, through what appear to be
arbitrary and generalised protein-protein interactions? An integral attempt towards uniting these observations
came from Lee and colleagues, who proposed that ALS-associated R-rich peptides have affinity for the IDRs of
these proteins, which, indeed, are a common element in many of the above (Lee et al., 2016). We offer an
alternative hypothesis, which can also unify all of the disruptions associated to poly(PR) and poly(GR) peptides.

We propose that through high-affinity electrostatic association, R-rich peptides are able to unspecifically bind to
nucleic acids, and displace the relevant RNA- and DNA- binding proteins. As such, any process that requires RNA
or DNA, will be inhibited by their presence. This simple premise unites the wide variety of cellular defects caused
by poly(PR) and poly(GR) under a single mechanism, and simplifies the disease model.

Various aspects of R-rich DPR activity align with our theory. Widely reported nucleolar accumulation of R-rich
peptides is consistent, the nucleolus containing the highest concentration of RNA in the cell; as are reports of
co-localisation with SGs (Lee et al., 2016; Y.-J. Zhang et al., 2018), RNA also being a prominent component of
these structures. Although numerous reports from proteomic studies identify protein components from both
organelles as interaction partners of poly(PR) and poly(GR) peptides (Hartmann et al., 2018; Kanekura et al.,
2016; Lee et al., 2016; Radwan et al., 2020; Suzuki et al., 2018; Tao et al., 2015) , we believe that these
interactions are also mediated by RNA. In agreement, Suzuki and colleagues show that the helicase interactions
identified by IP-proteomics in their work, was dependent on RNA (Suzuki et al., 2018). Digestion with RNase A
is a common step to control for indirect RNA-mediated interactions. In the light of our findings of RNase A
inhibition by R-rich peptides (Figure 14), in those cases where this step was not omitted, it is possible that RNA
persisted post-digestion.

An important caveat to this model is that not all interactions of R-rich peptides need to be restricted to nucleic
acids; in fact, several protein-protein interactions have been confirmed in cell-free settings (Hutten et al., 2020;
Nanaura et al., 2021; White et al., 2019). We predict that these interactions become secondary inside the cell,
as the affinity for RNA and DNA is superior, although further work would be needed to confirm this.

88
1.2 ARGININE-RICH PEPTIDES IN PHASE SEPARATION OF MEMBRANE-LESS ORGANELLES

The role or poly-R peptides in LLPS can also be explained from the model of RNA coating and RBP displacement,
keeping in mind that RNA is always a prominent component of the separated phase.

It was already known that R-rich peptides could undergo LLPS with RNA, the ratio of each depending on peptide
and RNA length (Aumiller and Keating, 2016). Specifically poly(PR) and poly(GR) can coacervate in
combination with numerous substrates, including RNA, heparans, the negatively charged polyphosphate moiety
(Boeynaems et al., 2019), and interestingly, NPM1 (White et al., 2019). In this last case, in a two-component
system, poly(PR) peptides could phase separate with NPM1, through interaction with an acidic domain. However,
in a three-component system, featuring NPM1, rRNA and poly(PR), the peptides preferentially bound to rRNA,
and only once these interactions were saturated, to NPM1. The authors suggested that poly(PR) peptides were
in competition with rRNA for NPM1 binding, and alter nucleolar function by sequestering NPM1.

Figure 44. Model of poly(PR) toxicity by protein displacement. R-rich peptides are positively-charged species with a high affinity for
nucleic acids. They are able to bind to both RNA and DNA, and displace the RBPs and chromatin-binding factors.

This study gives two pieces of information. The first is that poly(PR) peptides can interact with protein
components, and suggests that an acidic tract, such as the 25 amino-acid long region of aspartate and glutamate
residues inside the IDR of NPM1. Indeed, other proteins reported to directly interact with R-containing DPRs in
cell-free settings, such as TNPO1 and other importins (Hutten et al., 2020; Nanaura et al., 2021) also feature
acidic domains. These observations, however, must be tempered by the second conclusion from the study, which
supports our model: that while RNA is present in the system, arginine-rich peptides will preferentially bind to it.
This is the more relevant interaction because RNA is always present in biological systems; based on this, the
more biologically relevant interpretation of the three-component system is that NPM1 is in competition with
DPRs for rRNA.

Nucleoli and SGs are the most intensely studied MLOs in the context of changes in LLPS properties in ALS, and
both feature high RNA content. According to our model, R-rich peptides can infiltrate these organelles, and
displace the constituent proteins from RNA; however, as the peptides also have LLPS properties, a MLO is
maintained. In this light, the changes in the material state observed in MLOs exposed to R-rich DPRs are the
natural consequence of their interaction with the constituent nucleic acids, and the alterations in stoichiometry

89
caused by the eviction of a portion of RBPs. The liquid phase dynamic properties are not so much changed, as
the material nature of the organelle itself.

1.3 ARGININE-RICH PEPTIDES AND RNA-BINDING PROTEIN AGGREGATION

Our model can also explain why RBPs form cytoplasmic aggregates. RBPs, including both FUS, TDP-43, EWS,
TAF15, and hnRNPA1, are maintained in soluble form in the nucleus by the high RNA concentration, while the
absence of RNA, such as in the case of nuclear microinjection of RNase A, causes them to form a different phase
(Maharana et al., 2018). In accordance to this, pathological, weak RNA-binding FUS variants have a greater
tendency for aggregation than the wild-type protein, and form more aggregates.

By coating RNA, R-rich peptides force the displacement of RBPs, and decrease the effective concentration of
buffering RNA both in the nucleus, and in the cytosol, favouring the formation of RBP aggregates. Indeed, our
model is analogous to the use of the RNA dye, F22, which also displaced FUS from RNA, and promoted the
formation of FUS aggregates (Maharana et al., 2018).

While poly(PR) peptides can displace RBPs from RNA in the cytosol, the question remains as to why RNA-
unbound RBPs leave the nucleus. In the case of TDP-43, recent evidence suggests that only binding to RNA
retains TDP-43 inside the organelle, and that once free, export is passive (Duan et al., 2021); therefore, upon
displacement by poly(PR), unbound TDP-43 would tend to leave the nucleus and aggregate in the low-RNA
conditions of the cytosol. Indeed, although FUS aggregates were initially limited only to FUS-ALS, both soluble
and aggregated cytoplasmic mislocalisation of FUS has recently been linked to other forms of the disease (Deng
et al., 2010; Tyzack et al., 2019). The mode of nuclear egress of FUS, and other RBPs is unknown, but may
follow similar passive diffusion dynamics. The fact that FUS, TDP-43, EWS, TAF15, and hnRNPA1, all have very
high concentration gradients between the nucleus and cytoplasm hints that th is may be the case (Maharana et
al., 2018).

1.4 ARGININE-RICH PEPTIDES AND CHROMATIN

Reports of poly-R peptide perturbations of DNA processes are fewer than RNA; however, they also have a high
affinity for DNA, and affect chromatin function (Figure 18, 21). In our proteomic analysis we showed that, like
protamine, poly(PR) peptides can bind to chromatin, and evict chromatin-binding factors, including histones and
HMG proteins (Figure 23, Annex 2). Protamine is essential in spermatogenesis for chromatin compaction,
forming densely packed chromosomes. Given their high similarity, (PR)20 peptides are likely to do the same,
leading to aberrant DNA condensation and deviated gene expression patterns.

Such is the case in a mouse model expressing GFP-(PR)50, in which (PR)50 peptides colocalised with
heterochromatin markers, and altered the transcriptome profile (Zhang et al., 2019). Deregulation of
heterochromatin structure was attributed to the loss of the heterochromatin regulatory factor HP1α, through
perturbed LLPS by HP1α interaction with (PR) 50. Indeed, all these observations are also compatible with HP1α
eviction from chromatin by poly(PR) peptides.

1.5 ARGININE-RICH PEPTIDES CAN BIND NUCLEOTIDES

We have also shown that (PR) 20 peptides, not only bind RNA and DNA, but can also bind free deoxynucleotides
(Figure 18), and presumably, nucleotides. Sequestration of nucleotides from the cellular pool can have
implications in nucleic acid metabolism and might contribute to the many impairments associated to R-rich
peptides, however, the more interesting possibility is in the direct link to cellular energy balance. Adenosyl
triphosphase (ATP) is not only a constituent of RNA, but also the cell’s energetic currency. Depletion of cellular
ATP, if this were the case, would have profound metabolic implications.

90
Compellingly, there is evidence of a hypermetabolic state in fibroblasts derived from C9-ALS patients (Konrad
et al., 2017; Onesto et al., 2016). (GR)80 expression in motor neuron cultures was associated with ROS
accumulation, which can also be a product of mitochondrial hyperactivity (Lopez-Gonzalez et al., 2016). In line
with this, two of the top upregulated GSEA hallmarks in PR KI/KI mice were “oxidative phosphorylation”, and
“glycolysis” (Figure 39), which, in combination with mTOR activation (Figure 41), can form part of a compensatory
mechanism for insufficient ATP availability.

In fact, the protective effect of down-regulation of nucleolar activity may be, in part, due to relief from ATP
demand, as ribosome biogenesis is the single most energy-intensive process of the cell. Increased metabolic
demand can also explain the apparent paradox from our in vivo rescue experiments: mTOR inhibition by
rapamycin could rescue PRKI/KI animals (Figure 43), while calorie restriction was detrimental. Rapamycin
treatment decreases energy demand while maintaining energetic input, while calorie restriction decreases both.

It should be kept in mind that the perturbations of nucleolar and translational activity also have profound
implications on the energetic state of the cell, and that this hypothesis is complementary to those that will be
discussed in the following sections.

1.6 NUCLEOLAR STRESS AS A DRIVER OF CELL DEATH BY ARGININE-RICH PEPTIDES

Cell death by R-rich peptides probably occurs through an additive impairment of multiple cellular processes,
however, our experiments suggest that disintegration of nucleolar function and impairments in translation are
particularly relevant. Translation and ribosome biogenesis link our in vitro phenotypes and model, with the
translationally-repressed profile of spontaneously resistant NSC34 cells (Figure 31), and with the in vivo ageing
phenotype seen in (PR)97-expressing mice (Figure 38). Indeed, the insensitivity of (PR) 97-expressing U2OS (PR)97 to
RNA Pol I inhibitors, ActD and CX-5461 (Figure 29), suggests that ribosome biogenesis is impaired to such an
extent by poly(PR) peptides, that further inhibition of the same process confers no further toxicity.

Interestingly, in vitro evidence suggests that neuron-type cells are more sensitive to R-rich peptides than non-
differentiated cells, but not to other kinds of stress, such as H 2O2 (Gill et al., 2019). In our hands, differentiated
NSC34 were also more sensitive to (PR) 20 peptides in comparison to non-differentiated cells (data not shown),
and this correlated with a higher translation rate. Although these are preliminary results, higher translation rates
may justify that motor neurons are especially sensitive to nucleolar stress.

Nucleolar stress is a lax term in literature. We put forward a cohesive model of nucleolar stress, which gives a
framework for our most counterintuitive finding: that decreasing the signalling driving ribosome biogenesis and
translation alleviates toxicity caused by inhibiting the same processes.

1.6.1 Nucleolar stress or nucleolus under stress?

Nucleolar stress is an umbrella term, used to refer to any morphological or functional alteration of the nucleolus,
independently of cause. Genetic targeting of nucleolar components, such as UBF1 or r-proteins, as well as
chemical targeting of nucleolar function, such as with ActD, cause characteristic aberrant morphologies, and
ribosome biogenesis defects. Many treatments that generally inhibit growth, such as heat shock, UV exposure,
serum starvation, and cytotoxic agents, present a general shutdown of nucleolar activity as opposed to specific
defects, but are also commonly listed as causes of nucleolar stress (Yang et al., 2018). These phenomena are
fundamentally different, but generally lumped together as “nucleolar stress”, despite the latter group describing
nucleolar responses to cell damage, while the prior cellular responses to nucleolar damage.

One of the reasons for this ambiguity is the use of nucleoplasmic translocation of NPM1, which was understood
as nucleolar structure disruption, as a read-out for nucleolar stress. Since then, however, the nucleolar model has
undergone important reform, and in the updated biomolecular condensate interpretation, release of NPM1 to the
nucleoplasm can reflect a decreased output of rRNA, without nucleolar defects or impairments. Riback and
colleagues showed that heterotypic interactions of NPM1 with rRNA, along with other components, stabilise the
liquid phase of the granular centre. If transcription on rDNA slows, the remaining rRNA will be incorporated into

91
ribosomes; as NPM1 binding to rRNA is lost, NPM1 is released (Riback et al., 2020). This eviction becomes an
indicator of nucleolar inactivity, rather than dysfunction.

For example, in cells treated with rapamycin, rRNA synthesis is repressed and NPM1 is partially released from
nucleoli to the nucleoplasm, however, nucleolar structure is preserved, and ribosome biogenesis resumes once
rapamycin is removed (Iadevaia et al., 2012). Serum starvation is commonly named as a source of nucleolar
stress, although its effects are very similar to rapamycin, and reversible upon refeeding (Chan et al., 1985).
Given the tight coupling of ribosome biogenesis to the cell growth programme, it is perhaps unsurprising that the
response to anything that impairs growth also features inhibition of nucleolar activity. In such cases, the source
of stress is ontologically prior to nucleolar response; therefore, “nucleolar response to stress” would be a more
accurate term than “nucleolar stress”.

A very recent work by Szaflarski, and team, supports this distinction (Szaflarski et al., 2022). They showed that
stressors that triggered the integrated stress response (ISR) also repressed rRNA transcription and processing,
but maintained the rRNA intermediates and nucleolar integrity. On the other hand, ActD treatment completely
abolished nucleolar structure and rRNA transcription, without setting off the ISR. The question, however, arises:
how can a cell tell the difference?

1.6.2 Nucleolar stress as stoichiometric imbalance

After eliminating confounding examples of stress response, we are left with a clearer landscape on which to
define nucleolar stress. One of the basic forms of inducing nucleolar stress is the ablation of nucleolar
components, including r-proteins (Nicolas et al., 2016; Stamatopoulou et al., 2018), while the other is
depleting rRNA, such as with ActD (Burger et al., 2010). Indeed, as all the elements of the nucleolus must
function in concert, in order to maintain the phases, and sequentially manipulate pre-rRNA, stoichiometric
imbalance can affect the entire assembly line, not just a single step.

We propose that nucleolar stress is a matter of stoichiometric imbalance. In the crudest examples, it is imbalance
between mature rRNA and r-proteins, such as when rRNA transcription is ablated, or r-proteins are depleted.
Compellingly, treatment of HeLa cells with translation inhibitors to stop r-protein production, produced nucleolar
fractionation (Szaflarski et al., 2022), similar to the “beaded necklace” structures that are formed when certain
r-proteins are depleted (Nicolas et al., 2016).

As r-proteins are necessary for the maturation of pre-rRNA, the equivalence is not direct. Nonetheless, a clear
indicator of faulty assembly are “leftover” r-proteins. Nucleolar stress in ribosomopathies is a clear example
where this may be in play. Ribosomopathies are caused by mutations in r-proteins, or even haploinsufficiencies
(Kampen et al., 2020). R-protein genes are co-regulated as a single unit, however, as ribosomal stoichiometry
is 1:1 of each r-protein, only as many as the least abundant can be incorporated, while the rest are left in excess.

92
 Figure 45. Model of nucleolar stress as stoichiometric imbalance between rRNA and r-proteins. In the case of decreased rRNA production,
r-proteins that cannot be incorporated into ribosomes accumulate. In the second case, if one of the r-proteins is expressed at a lower
rate, it becomes the limiting factor of ribosome assembly, and all the rest of the proteins from that subunit, and component rRNA
intermediates, accumulate.

This formulation is also in agreement with a reported nucleolar stress detection mechanism, based on free 5S-
RNPs (Donati et al., 2013; Horn and Vousden, 2008; Sloan et al., 2013b) . Incorporation of the 5S-RNP into
the pre-60S subunit is a late event in assembly and therefore sensitive to any upstream disruptions. Indeed,
depletion of either of the 5S-RNP r-proteins, uL18 (RPL5), or uL5 (RPL11), disrupts nucleolar structure (Nicolas
et al., 2016). Other detection mechanisms may be based on the extra-nucleolar presence of r-proteins and
nucleolar factors, but further work is necessary to uncover them.

Of note, r-proteins are enriched in positively charged lysine and arginine moieties which are prone to aggregation
(Ben-Shem et al., 2010; Lott et al., 2013) , and even require a specific chaperone system, similar to that of
histones (Pillet et al., 2017). However, by virtue of the high positive charge, soluble r-proteins may also be
intrinsically toxic to the cell, through similar mechanisms to R-rich peptides.

93
 Figure 46. Mechanisms through which poly(PR) peptides can create stoichiometric imbalance between rRNA and r-proteins, and
therefore, nucleolar stress. As mature rRNA is subject to many more steps, involving many factors, the cumulative repression is higher
than of r-protein synthesis.

1.6.3 How do poly(PR) peptides create imbalance?

We have shown that cells expressing poly(PR) peptides accumulate an excess of free ribosomal proteins (Figure
29). Firstly, this is partially due to the up-regulation of r-proteins (Figure 41), and partly to compromised
degradation (Figure 29, Figure 34). Consistently, r-protein overexpression was previously reported in (PR) 20-
treated human astrocytes (Kwon et al., 2014), in mice expressing GFP-(GR)100 (Y.-J. Zhang et al., 2018), and
recently, in MNs derived from ALS patients’ iPSCs (Ho et al., 2021). We also saw r-protein up-regulation in data
sets from differentiated MNs of C9-ALS patients from the NeuroLINCs repository (Figure 40). Ribosome
biogenesis up-regulation may be part of a compensatory response to decreased translation. Indeed, activation
of mTOR signalling in (PR) 97-expressing mice could be part of such a response (Figure 41).

In second place, we believe that the main reason for the accumulation of r-proteins is the asymmetric effect of
poly(PR) peptides on rRNA maturation in comparison to r-protein production.

Ribosome assembly requires input from two major branches, r-proteins and rRNA. According to our nucleic acid
binding model, poly(PR) peptides interfere with every step in both arms, however, inhibition is predicted to be
heavier on rRNA synthesis. Sequence-specific interactions with the 45S rRNA must occur for every step of
processing, folding and modification, many of which require the participation of other snRNAs. Not only are each
of these steps susceptible to poly(PR) interference, but they are also sequential. Inhibition of rRNA synthesis is
cumulative. On the other hand, although the total number of reactions needed to express each of the 80 r-proteins
may be higher, they occur in parallel, and rate limitation is accumulated on fewer sequential steps. Simply put, r-
proteins are made at a faster rate than the rRNA needed to bind them.

2.

STRATEGIES TO OVERCOME POLY(PR) TOXICITY

2.1 REPRESSION OF NUCLEOLAR ACTIVITY TO OVERCOME NUCLEOLAR STRESS

In this thesis we generated a cell line which, through spontaneous mechanisms, became resistant to (PR) 20
peptides. Surprisingly, analysis of these NSC34 R cells revealed that they had down-regulated translation and
ribosome biogenesis through unknown mechanisms (Figure 31). Although this result is counterintuitive, we
found that targeting nucleolar activity, through the mTOR route or through MYC, was protective against poly(PR)
peptides. Paradoxically, repressing the signalling driving both ribosome biogenesis and translation, protects
against a treatment that already inhibits both processes.

2.1.1 Activation of ribosome biogenesis in response to poly(PR) peptides

Inhibition of translation is one of the most prominent effects of poly(PR) peptides, meaning that activation of
ribosome biogenesis through mTOR signalling and MYC activation (Figure 39, 41) may be a compensatory
mechanism to try restore proteostasis. In fact, translation inhibition in yeast leads to activation of ribosome
biogenesis genes, supporting the existence of a feedback mechanism in eukaryotes (Cheng and Brar, 2019).

Interestingly, treatment with translation poisons, such as cycloheximide, can l ead to amino acid accumulation,
which in turn, activates mTOR in direct response to the loss of protein synthesis (Beugnet et al., 2003; Vabulas

94
and Hartl, 2005). This can explain our observation that mTOR repression with rapamycin rescues mice
expressing (PR)97, while calorie restriction decreases survival (data not shown). Amino acid levels under calorie
restriction are maintained, meaning that mTOR will be equally activated through this branch, but with a lower
caloric input to maintain anabolic activity.

2.1.2 Inhibition of mTOR to rescue poly(PR) toxicity

Besides poly(PR) toxicity, inhibition of mTOR is protective against treatment with ActD (Goudarzi et al., 2014)
and CX-5461 (Figure 34), as well as in the context of ribosomopathy-induced apoptosis (Recasens-Alvarez et
al., 2021). Although mTOR activation in response to nucleolar stress has not been demonstrated in other
contexts, these data suggest that the effect may not unique to poly(PR) toxicity.

The imbalance between r-proteins and rRNA produced by poly(PR) peptides is parallel to that seen in
ribosomopathies, where excess r-proteins accumulate. Significantly, a recent study found that TOR inhibition can
ameliorate cell death brought about by haploinsufficiency of uS12 (formerly RPS23) in Drosophila (Recasens-
Alvarez et al., 2021). The cellular landscape of uS12+/- heterozygous flies was strikingly similar to PRKI/KI animals,
characterised by inhibited translation, overexpression of ribosome biogenesis components and r-proteins, and
toxicity, which could be alleviated by TOR inhibition. The authors attribute cell death to proteotoxic stress, derived
from the aggregates formed by “left-over” r-proteins.

Proteotoxicity may contribute to poly(PR) toxicity, however, cytosolic aggregate formation did not occur in the
majority of (PR)97-expressing cells, giving us reason to hypothesise that other mechanisms are responsible for
rescue with mTOR inhibitors. Indeed, r-protein aggregates may be cytoprotective.

We believe that mTOR activity is particularly deleterious in the context of nucleolar stress, because it uncouples
the sensed anabolic capacity of the cell from the real one, which is highly impaired by R-rich peptides. We propose
several non-mutually-exclusive mechanisms that can contribute to rescue by mTOR inhibition.

Figure 47. Rescue of stoichiometric imbalance. Mechanisms by which down-regulation of mTOR and MYC can rescue poly(PR)-induced
stoichiometric imbalance between rRNA, and protein components of ribosome biogenesis.

The first is that down-regulation of mTOR, and therefore the proliferation rate, decreases metabolic demand. By
more closely matching growth signalling to the real capacity of the cell, mTOR inhibition decreases the resources
spent on an anabolic programme that cannot be executed, and allows them to be dedicated to essential
processes.

We showed that R-rich peptides cause nucleolar stress, and an accumulation of unbound r-proteins (Figure 31),
as well as a generalised displacement of RBPs. R-proteins that fail to assemble into ribosomes, and nucleolar
proteins displaced from the nucleolus, are known to activate apoptosis in response to nucleolar stress (Yang et
al., 2018). Suppression of the entire ribosome biogenesis transcriptional programme means that in absolute
numbers, fewer r-proteins, and other potentially problematic proteins, are displaced.

Finally, mTOR repression can improve the stoichiometric imbalance. Ordinarily, excess r-proteins are not allowed
to accumulate and are rapidly degraded by the UPS (Sung et al., 2016b, 2016a). However, active mTOR
represses the protein degradation routes, through both autophagy and the UPS (Rousseau and Bertolotti,

95
2016; Zhao et al., 2015). Recovery of these processes can eliminate excess r-proteins, and help correct the
stoichiometry; as well as clear any proteotoxic aggregates that may accumulate, as previously suggested
(Recasens-Alvarez et al., 2021). Although rapamycin treatment did not rescue the increase in pre-existing r-
proteins caused by poly(PR) peptides, we cannot eliminate the possibility of degradation of excess newly-
syntehsised free r-proteins (Figure 34).

2.1.3 Inhibition of MYC to rescue poly(PR) toxicity

Like mTOR, MYC is a central regulator of ribosome biogenesis, and its depletion results in slower proliferation,
and lower levels of r-proteins and all rRNAs (Morcelle et al., 2019b), and likewise, we believe that MYC depletion
is protective against poly(PR) toxicity by similar mechanisms.

MYC depletion decreases proliferation rate, and therefore, metabolic demand (Morcelle et al., 2019b).
Furthermore, the absolute number of r-proteins is decreased in MYC-downregulated cells. This has been
demonstrated in the context of 5S RNP in p53 stabilisation by Marcelle and colleagues. When cells are treated
with ActD, 5S RNP components, uL18 (RPL5), uL5 (RPL11), and 5S rRNA, can be found in the ribosome-free
fraction, but are decreased upon MYC downregulation (Morcelle et al., 2019b). Finally, several groups found
that MYC activation repressed expression of autophagy genes (Annunziata et al., 2019; Schaub et al., 2015) ;
MYC silencing, therefore, may also contribute to restoring balance by r-protein clearance.

Interestingly, MYC-induced activation of r-protein translation can be dampened by mTOR inhibition (Elkon et al.,
2015), suggesting co-regulation. Although this could explain why we saw no additive effect in combining mTOR
inhibitors with MYC depletion (Figure 36), differential response to different sources of nucleolar stress would
argue against complete coincidence in the route (Figure 34, Figure 36). Based on our results, neither sequential
regulation, nor co-regulation can be ruled out.

Besides mTOR inhibitors, the signature of spontaneously resistant NSC34R cells showed an important similarity
with HDAC inhibitors (Annex 6, Annex 7). HDAC inhibition has proven to be effective against MYC-driven tumours
(Bhadury et al., 2014; Pei et al., 2016); in fact, modulation of MYC activity is thought to be a key target for this
group of compounds (Ecker et al., 2021; Nebbioso et al., 2017) . The HDAC inhibitor signature could reflect a
pharmacological approximation to inhibition of MYC activity.

The particular sensitivity of MYC-expressing cells to R-rich peptides could potentially be exploited in cancer
therapy. MYC is a potent oncogene, overexpressed in many human cancers. Interestingly, sources of nucleolar
stress, such as r-protein haploinsufficiency or CX-5461 (Barna et al., 2008; Bywater et al., 2012), are effective
against tumorigenesis driven by MYC. Indeed, given the dependence of these kinds of tumours on hyperactive
ribosome biogenesis, R-rich peptides may be a viable antitumoural therapy, given that a therapeutic window can
be established through adjustment of peptide length and composition, as well as dosage.

2.1.4 Spontaneous resistance for therapeutic target discovery

Deduction of spontaneous resistance mechanisms is an unconventional approach to therapeutic target

discovery; however, our work validates it as a valid methodology. When compared to directed methods, such as
genetic screening, it is particularly useful for detection of adaptive mechanisms involving highly essential
pathways.

The case of R-rich peptides is particularly illustrative; although several genetic screens in yeast have yielded r-
proteins and nucleolar components as suppressors of poly(PR) or poly(GR) toxicity (Chai and Gitler, 2018;
Jovičić et al., 2015), these routes have not been found in screens in mammalian cells (Kramer et al., 2018).
Indeed, we also failed to identify any useful hits in our attempts (data not shown). Genetic KO of the majority of
r-proteins or ribosome biogenesis factors is lethal, meaning these genes are depleted from KO libraries and
difficult to detect by screening approaches. Generation of spontaneously resistant cells retains intact pathways
and allows down-regulation without reaching lethality.

96
2.2 POLYANIONS TO OVERCOME POLY(PR) TOXICITY

Prion-like propagation of DPRs is believed to be responsible for the spread of motor neuron death from the site
of onset. In the case of C9-ALS/FTD, paracrine propagation of DPRs has been reported in vitro, and also in vivo
(Khosravi et al., 2020; Morón-Oset et al., 2019; Westergard et al., 2016; Zhou et al., 2017).

We have shown that polyanions, such as heparin or non-coding oligonucleoleotides, can rescue exogeously
applied R-rich peptide toxicity (Figure 24, Figure 26), however, these strategies were not able to rescue U2OS (PR)97-
expressing cells, possibly because they were unable to enter the cytoplasm (data not shown). Although drug-
delivery methods can be explored, it is not a viable therapeutic option for the rescue motor neurons. Exposure of
the cytosol to heparin may be inherently detrimental; in vitro it induces protein aggregation, and can even drive
the formation of amyloid fibrils (Ahanger et al., 2021; So et al., 2017). However, this strategy may be an
interesting option to halt the paracrine spreading of R-rich DPRs through the central nervous system, and could
be explored as treatment in this context.

Outside of ALS, heparin could help prevent the HIV-associated neurodegenerative disorder, neuroAIDS. The HIV-
associated R-rich TAT protein is believed to be responsible for the condition. While neurons cannot be directly
infected with HIV, the TAT protein can spread to the nervous system, and freely enter cells (Frankel and Pabo,
1988; Green and Loewenstein, 1988; King et al., 2006) . Heparin could be useful in preventing central nervous
system transmission of TAT protein.

3.

THE NUCLEOLUS IN AGEING AND NEURODEGENERATION

We generated an inducible mouse line, expressing 97 copies of PR DPR. One of the most significant findings of
this thesis is that PRKI/KI mice develop a premature ageing phenotype. In line with previous literature, and our in
vitro work, tissues and fibroblasts derived from PRKI/KI animals show enlarged nucleoli, characteristic of poly(PR)
peptide-induced nucleolar stress (Figure 41). Perhaps the most striking finding is that the mTOR inhibitor,
rapamycin, can extend lifespan in these animals (Figure 43). Rapamycin is a proven anti-ageing treatment, which
is also protective against nucleolar stress (Figure 34), and therefore, addresses the phenotype both at the cellular
and organismal level. Our mouse model not only gives insight to in vivo toxicity of poly(PR) peptides, but also to
mechanisms of ageing.

3.1 NUCLEOLAR ACTIVITY IN PROGERIA & AGEING

PRKI/KI animals present a phenotype consistent with a segmental progeroid syndrome, as they do not mirror the
full spectrum of age-associated diseases. While they develop grey fur, kyphosis, cachexia-like loss of
subcutaneous fat and body weight, cataracts, and bone marrow depletion, they do not show other signs of
ageing, such as increased incidence of cancer, or osteoporosis. To our knowledge, ours is the first animal model
that shows accelerated ageing in direct response to nucleolar stress.

Nucleolar and translational alterations have been seen in other progeroid disorders. HGPS is a progeroid
syndrome caused by a pathogenic version of nuclear lamin A/C, leading to perturbations in nuclear morphology
and function (Phan et al., 2019). Fibroblasts from HGPS patients showed accelerated translation, higher levels
of rRNA, and enlarged nucleoli (Buchwalter and Hetzer, 2017b). Cockayne Syndrome (CS) is another progeria,
which presented lower rRNA transcription levels, accompanied by a loss of proteostasis (Alupei et al., 2018).
CS is caused by mutations in Cockayne syndrome A (CSA), Cockayne syndrome B (CSB) proteins, and members

97
of the TFIIH transcription factor complex, all of which promote RNA Pol I activity (Phan et al., 2019). Finally,
fibroblasts from WRS progeria, caused by mutations in a subunit of RNA Pol III, presented disrupted nucleoli and
decreased rRNA levels (Báez-Becerra et al., 2020).

In these cases, nucleolar dysfunction accompanies aberrant ageing, however, nucleolar activity maybe even
more relevant in physiological ageing. Tiku and colleagues demonstrated that the nucleolus is a point of
convergence for lifespan modulation. Ablation of ncl-1 in C. elegans led to larger nucleoli and rRNA production,
and made them refractory to both lifespan extension and ribosome biogenesis inhibition by numerous
mechanisms, including dietary restriction, mTOR inhibition, translation reduction, and mitochondrial function
inhibition (Frank and Roth, 1998; Tiku et al., 2017). Apparently, modulation of ribosome biogenesis is
necessary for lifespan extension, however, the mechanistic contribution is poorly understood.

3.2 PROTEOSTATIC COLLAPSE THEORY OF AGEING

One of the first theories about longevity was formulated in the “rate of living theory”, at the beginning of the 20 th
century, which hypothesised that the higher an individual’s metabolic rate, the shorter the lifespan. In line with
this, some of the best-characterised lifespan-extending interventions inhibit metabolic signalling routes, such as
mTOR, and insulin/IGF1-like signalling (reviewed in (Johnson et al., 2013), and (Junnila et al., 2013)). Being
the largest energetic investment in the cell, repression of nucleolar activity to extend longevity can be interpreted
as the latest reiteration of the rate of living theory.

However, in reality ribosome and protein synthesis cannot be separated from the energy metabolism that
maintains them, therefore, the same observations are inherently linked to a proteomic basis of longevity.

The “proteostasis collapse” theory of ageing proposes that ageing is the result of cumulative dysfunction of the
processes necessary to maintain a functional proteome, mainly translation, chaperone systems, and protein
degradation systems (Taylor and Dillin, 2011). This idea is based on the premise that protein misfolding is
inherently deleterious, and that ageing occurs when the cellular systems become unable to cope with the
unfolded protein load. Indeed, a single misfolded protein in animal models is capable destabilising the entire
proteome (Gidalevitz et al., 2009, 2006).

98
 Figure 48. The proteostatic collapse model of ageing. The proteostatic collapse theory of ageing attributes ageing to the progressive
accumulation of misfolded proteins, as a result of compromised activity in the chaperone networks and in the protein degradation
pathways, as well as accumulation of misfolded proteins, damaged by oxidative stress. The siphoning of chaperones from nascent
peptides contributes to generalised proteome destabilisation, further compromising all related processes.

A basic corollary of this hypothesis is that as the cell’s resources are diverted towards controlling the damage
caused by non-functional proteins, fewer functional ones are made, as the vast majority of nascent proteins need
chaperones to gain the native conformation. This theory fits with experimental data, such as why lifespan can
be extended by activation of autophagy, or overexpression of molecular chaperones (Taylor and Dillin, 2011).
Indeed, according to computerised modelling of proteostatic collapse, the rate of living theory holds true for a
limited set of conditions within this model (Santra et al., 2019).

Importantly, our model of nucleolar stress can drive ageing through proteostatic collapse. Even in the absence
of mutations, r-proteins are prone to aggregation, and require molecular chaperones (Pillet et al., 2017). They
are also among the highest-expressed proteins in the proteome, making even a small excess a significant load
on the chaperone and degradation systems. As chaperones are diverted to r-proteins, essential nascent proteins
do not fold, unfolded proteins accumulate, and the quality of the proteome begins to fall. Likewise, accumulation
of r-proteins, even if they are functional, also taxes the UPS and autophagy systems, leading to an accumulation
of other dysfunctional proteins marked for degradation. Perhaps one of the most interesting phenotypes to
support proteostatic collapse is the presence of cataracts in PR KI/KI mice (Figure 38), which can be caused by
high molecular weight protein aggregates (Shiels and Hejtmancik, 2017).

In line with this hypothesis, both of the approaches that we have found to counteract nucleolar stress in (PR) 97-
expressing cells, mTOR inhibition and MYC down-regulation (Figure 34, Figure 36), extend lifespan in animals
(Hofmann et al., 2015; Johnson et al., 2013) . In fact, the other possible candidates isolated from analysis of
nucleolar stress resistant NSC34R cells, RAS down-regulation and HDAC inhibitors (Annex 6, Annex 7), have also

99
been implicated in lifespan extension. RAS is an upstream regulator of nucleolar activity (Stefanovsky et al.,
2001; Zhao et al., 2003), and its inhibition by trametinib increases longevity in Drosophila (Slack et al., 2015).
Likewise, a variety of HDAC inhibitors prolongs lifespan in invertebrates through unknown mechanisms
(reviewed in (McIntyre et al., 2019)).

3.3 CONTRIBUTION OF POLY(PR) PEPTIDES TO AGEING

The case of PRKI/KI mice is apparently contradictory, as both translation and ribosome biogenesis are repressed,
which in principle, is favourable to lifespan extension. However, these processes are inhibited in a context of
nucleolar stress, suggesting that neither translation nor ribosome biogenesis inherently drive ageing, but rather
their quality, and efficiency. We believe that proteostatic collapse is the principal molecular driver of ageing in
PRKI/KI mice, with contributions from the following mechanisms.

3.3.1 Proteostasis imbalance

Proteostasis imbalance is a recognised hallmark of ageing, characterised by the accumulation of protein

aggregates, presence of poor quality proteins, and collapse of protein degradation pathways (Santra et al.,
2019), each of which are negatively impacted by poly(PR) peptides.

Cells expressing poly(PR) peptides are particularly susceptible to protein misfolding. We have shown severa l
ways through which misfolded proteins accumulate: from RBP and chromatin factor displacement (Figure 23),
excess r-proteins from nucleolar stress (Figure 29), and possibly peptides from abortive translation (Figure 12).
All of these species are prone to misfolding and aggregation, RBPs and r-proteins due to the presence of IDRs,
and aborted peptides because they have no native conformation to assume.

Once misfolded proteins aggregate, they can be resolved by either chaperone activity, or failing that, cleared
away by the UPS or autophagy. While the cell’s protein degradation pathways are able to dispose of unbound
and defective proteins, balance is maintained, however, once they become saturated or dysfunctional,
proteostasis is lost. In agreement, activation of autophagy in mammals can extend lifespan (Fernández et al.,
2018; Pyo et al., 2013). As such, in PRKI/KI mice, protein aggregation is aggravated by mTOR activation (Figure
41), which on one hand, drives translation, and on the other, inhibits protein degradation machinery (Rousseau
and Bertolotti, 2016; Zhao et al., 2015).

3.3.2 Poor protein quality

We hypothesise that besides aggregation through these processes, exposure to poly(PR) peptides implicitly
leads to poor protein quality. Translation fidelity has recently been positively correlated with lifespan (Martinez-
Miguel et al., 2021; Suhm et al., 2018; von der Haar et al., 2017; Xie et al., 2019) . It is possible that this is
one of the contributors to loss of proteostasis. Poly(PR) peptides coat mRNA, which may increase the frequency
of ribosome stalling and tRNA mismatch events, leading to amino acid mis-incorporation.

Poor quality proteins may also accumulate due to saturation of the ribosome-associated protein quality control
(RQC) pathway. RQC is a co-translational surveillance mechanism, which detects stalled ribosomes, separates
the ribosome subunits, and extracts the defective nascent chain from the 60S subunit, marking it for degradation
(Joazeiro, 2019). Our polysome fractionation proteomics revealed that the detection component from the RQC
complex, NEMF, was displaced from polysomes to the soluble fraction in induced U2OS PR97 cells (Annex 4),
indicating that this pathway may be compromised by poly(PR) peptides. Although the RQC has not been directly
implicated in ageing yet, mutations in several members of this pathway, including NEMF, LTN1, and the ALS -
associated VCP, can cause neurodegeneration (Chu et al., 2009; Johnson et al., 2010; Martin et al., 2020) .

3.3.3 Oxidative stress

Although translation is physically inhibited, the energetic burden remains the same, or even higher, as suggested
by up-regulation of the glycolysis and oxidative phosphorylation hallmarks in PR KI/KI animals (Figure 39).

100
Metabolism-associated generation of ROS and other harmful waste products may also be instrumental to the
progeroid phenotype (López-Otín et al., 2013). Indeed, oxidative stress can damage functional proteins,
preventing them from assuming the native conformation (Fredriksson et al., 2005), and exacerbate the load of
unfolded proteins on the chaperone and degradation systems.

3.3.4 Chaperone saturation

Another important player in maintenance of proteostasis in the context of ageing is the molecular chaperone
system (Santra et al., 2019). The majority of newly synthesised proteins do not assume their native
conformation unassisted, but require molecular chaperones (Morimoto, 2008). Tellingly, chaperone over-
expression extends lifespan in several animal models (Bobkova et al., 2015; Hsu et al., 2003; Morley and
Morimoto, 2004; Morrow et al., 2016; Yokoyama et al., 2002) .

We predict molecular chaperone systems become saturated with displaced RBPs, excess r-proteins, and other
damaged proteins, which prevents them from assisting nascent peptides. On the one hand, even more
aggregation-prone species are made, and on the other, functional proteins are not.

3.3.5 Stem cell depletion

Overall, poly(PR) peptides kill cells throughout the organism through multiple mechanisms. This drives the
division of resident stem cells to repopulate the tissues, eventually leading them to exhaustion. In fact, persistent
mTORC1 signalling can accelerate stem cell depletion (Chen et al., 2009; Yilmaz et al., 2012) . Likewise, as
poly(PR) peptides are particularly toxic to cells with active mTOR or MYC, growing stem cells can be
disproportionately affected in comparison to their quiescent state, contributing to the loss of regenerative
capacity in PRKI/KI mice.

3.4 REINTERPRETATION OF ALS THROUGH AGEING THEORY

An assumed connection between ALS and ageing is prevalent; indeed, ageing is the most significant risk factor
for ALS, and there is overlap between features of both (Pandya and Patani, 2020). Alluring observations, such
as the resistance to ageing of the only neuromuscular junction saved from ALS, that of the extraocular muscles,
have hinted at intertwined mechanisms (Valdez et al., 2012).

Recent studies have begun to flesh out the inferred link. Maturation and ageing gene expression networks are
dysregulated in sALS induced motor neurons, and patient spinal cord neurons (Ho et al., 2021, 2016). SOD1
mutations have similar profiles to aged mouse spinal cords, and in fact, an anti-ageing intervention,
overexpression of SIRT1, can protect against neurodegeneration in these mice (Herskovits et al., 2018). The
field of longevity boasts many other successful interventions in animals, and mechanistic unification of ageing
and ALS can pave the way for these much-needed incorporations into ALS research.

Accelerated ageing in our PRKI/KI mice corroborates this link. The proteostasis collapse model of ageing not only
provides an explanation for the progeroid PRKI/KI phenotype, but also affords us general insights into ALS, outside
of the C9ORF72 mutation. Reinterpretation of ALS pathogenesis through ageing theory (Santra et al., 2019),
informed by the PRKI/KI phenotype, provides the basis for a unified mechanism of ALS, explanations for empirical
data, and allows predictions to be made.

3.4.1 Why do RNA binding proteins cause ALS?

Proteostatic collapse can account for the prominent role of RBPs in ALS, and even the type of mutations that
RBPs sustain. Partly, RBPs drive ALS by their nature: the presence of the IDR is an obligatory drain both on
chaperones, to maintain solubility, and on degradation machinery, in the case of aggregation. In line with this,
even overexpression of wild-type TDP-43 or FUS is sufficient to cause neurodegeneration (Ling et al., 2019;
Shan et al., 2010; Tsai et al., 2010; Yang et al., 2022). Wild-type RBPs are bound to RNA, or confined to the

101
nucleus, and therefore maintained soluble; but if either of these functions are compromised, such as in the case
of ALS mutations, they begin to tax the protein metabolism.

Figure 49. Protein abundance in human cell lines. Representation of the average abundance of each protein in four different human cell
lines (Wiśniewski et al., 2014). Proteins mutated in ALS (orange) are among the most abundant in the cell. Likewise, Lamin A/ C (blue),
the component of the nuclear envelope, which is mutated in HGPS, is among most expressed proteins in the proteome.

IDRs are a common element in biology, which raises the question as to why particular RBPs can cause ALS, while
others do not. The answer may lie in abundance.

Modelling of codon selection though molecular evolution found that avoidance of misfolding was the
fundamental selective driver for translation accuracy. Counterintuitively, the authors found that the biggest
pressure for translation accuracy was not on the most essential genes, but rather on those with the highest
expression levels (Drummond and Wilke, 2008). This implies that generalised cellular effects of misfolding
proteins is more a question of quantity rather than identity. This explains why an excess of unassembled r-
proteins can be so damaging; they are inherently unstructured with very high expression rates. Following this
logic, only high-expression genes can single-handedly collapse the proteostasis machinery, and consistently, the
most common mutated genes in ALS, FUS, TDP-43, hnRNPs, and even SOD1, are among the most abundant
proteins in mammalian cells (Wiśniewski et al., 2014). The observation that lamin A/C is in the top 1% of most
expressed proteins in four different cell lines, is even more striking, as it suggests that proteostatic collapse is
also an important driver of HGPS.

3.4.2 Why does RNA binding protein aggregation occur?

The proteostasis collapse theory also suggests a role for aggregates and molecular chaperones in ALS
pathogenesis. In analysis of ALS as a proteinopathy, attention is mostly given to the role of chaperones in
preventing aggregates, which are believed to be directly cytotoxic (Kalmar and Greensmith, 2017).

The second, and in our view more dangerous, aspect of chaperone involvement, namely that once molecular
chaperones become unavailable, nascent proteins do not receive the necessary guidance in folding, is generally
neglected. However, its implication is suggested by the beneficial effect of down-regulation of translation and
ribosome biogenesis (Chai and Gitler, 2018; Jovičić et al., 2015) . The rescue we see by inhibiting ribosome
biogenesis by MYC down-regulation (Figure 36) is also particularly significant in this line, as it decreases the
unfolded protein load of nascent proteins, rather than contributing to aggregate dissolution.

Nonetheless, according to the proteostasis model, maintenance of a free chaperone pool to sustain translation
is key in avoiding collapse, and free RBPs can interfere with it.

Under physiological conditions, ALS-associated RBPs are either kept soluble in the high RNA conditions of the
nucleus (Maharana et al., 2018), or sequestered in a partitioned liquid phase. Importantly, ALS-driving

102
mutations in RBPs often cause defects either in LLPS properties, nuclear localisation, or in RNA binding
(Harrison and Shorter, 2017; Portz et al., 2021) . Each of these mutations can force the RPB out of the liquid
phase, and once unbound, RBPs become a drain on chaperones until they are degraded or they aggregate. In this
light, protein aggregation can be a protective mechanism, as opposed to a cytotoxic driver of cell death. In line
with this, TDP-43 aggregation is not necessary for neurodegeneration (Baborie et al., 2015; Gami et al., 2015;
Gendron et al., 2015; Gijselinck et al., 2012; Mori et al., 2013b; Proudfoot et al., 2014; Vatsavayai et al.,
2016), and in fact has been detected in ordinary aged neurons (Valdez et al., 2012). Likewise, although
aggregates do appear in our U2OS (PR)97 cells, they are relatively infrequent (data not shown).

Importantly, expulsion of mutated RBPs from their native liquid phase alters its stoichiometry, and may result
liberation of other proteins, further adding to the unfolded protein load.

3.4.3 What is the role of molecular chaperones?

For decades, researchers have been unable to explain how mutations in ubiquitously expressed genes, such as
SOD1, TDP-43 or FUS, may be selectively pathogenic to motor neurons. Considering chaperones as a central
player in ALS pathogenesis can help explain this long-standing question. Motor neurons are especially
susceptible to protein misfolding as they have low levels of chaperones, and a repressed heat shock response
(Batulan et al., 2003; Zhao et al., 2017). Furthermore, the chaperone network declines with age and in
senescent cells (Brehme et al., 2014; Sabath et al., 2020; Yang et al., 2014) , which conforms with the age-
related onset of disease.

Another corollary of our hypothesis is that mutations in chaperones should be able to cause ALS.

Most molecular chaperones belong to the heat shock protein family. Members of this group have been
associated with several neuromuscular disorders, some with overlapping features with ALS (Sarparanta et al.,
2020), although it was not until 2019 that mutations in a heat shock protein, DNAJC7, were directly connected
to ALS (Farhan et al., 2019; Jih et al., 2020; Wang et al., 2020).

Given the participation of chaperones in the resolution of protein aggregates, the opposite has been known for
longer; that activation of chaperones can attenuate neurodegeneration. Unsurprisingly, overexpression of heat
shock proteins, or activation of heat shock factor 1 (HSF1), are moderately protective in several models of ALS
(Chen et al., 2016; Estes et al., 2011; Gifondorwa et al., 2007; Lin et al., 2013; Liu et al., 2022; Sharp et al.,
2008).

3.4.4 What is the contribution of protein degradation?

Compromised degradation pathways will result in accumulation of misfolded proteins, therefore, involvement of
UPS and autophagy genes in ALS fits perfectly into the ageing model. Interestingly, both autophagy and the UPS
are compromised with age (reviewed in (Kaushik et al., 2021; Saez and Vilchez, 2014) ), providing another
factor for age-related onset of ALS.

3.4.5 What is the role of oxidative stress?

In the model of ageing through proteostatic collapse, oxidative stress generates a portion of the unfolded protein
load through damage (Santra et al., 2019). In our model of ALS the primary accumulation of unfolded proteins
stems from mutations, therefore preventing oxidative damage cannot reverse accumulation, only attenuate the
load contributed by additional damage. Consistently, the antioxidant Edavarone yielded lacklustre results in
clinical trials, but did have sufficient effect for approval as treatment (Abe et al., 2014; Takei et al., 2017).

103
 4.

THE ROLE OF ARGININE-RICH PEPTIDES IN ALS PATHOGENESIS

ALS pathogenesis is characterised by a number of cellular perturbations, summarised in the introduction, section
1.2. The current view is that these occur in a cascade, early events provoking the later and eventually cell death.
We believe that the findings from this thesis place poly(PR) and poly(GR) DPRs at the beginning of the disease
cascade, as drivers of C9-ALS/FTD.

4.1 ARGININE-RICH DIPEPTIDE REPEATS AT THE SOURCE OF THE DISEASE CASCADE

Each of the early disease events (refer to introduction, section 1.2) can be explained as a direct consequence of
nucleic acid binding by R-rich DPRs. We have shown how poly(PR) and poly(GR) DPRs, avidly and unspecifically
bind to RNA and DNA. This allows them to displace RNA and DNA-binding factors, leading to a generalised
inhibition of processes relying on nucleic acids (Figure 14, Figure 16, Figure 17, Figure 19, Figure 21, Figure 23).
Among the displaced proteins are ALS-associated FUS and TDP-43 (Annex 3). These events compromise RNA
metabolism, nucleocytoplasmic transport of RNA, and mislocalise RBPs to the cytosol, accounting for three
hallmarks of ALS.

Ribosome biogenesis and translation repression are among the most harmful of the effects cause by poly(PR)
peptides. Asymmetric inhibition of rRNA processing over r-protein synthesis causes nucleolar stress, and allows
r-proteins to accumulate (Figure 29). This, along with displaced RBPs, begins proteostatic imbalance. Routes
driving ribosome biogenesis, mTOR and MYC, are activated (Figure 39, 41), possibly as a part of a compensatory
mechanism. Active mTOR signalling is known to inhibit protein degradation, bringing about the final stage for
proteostasis breakdown. Indeed, the accumulation of both newly synthesised and previously synthesised r-
proteins supports both claims (Figure 29, Figure 34).

An inferred part of proteostatic collapse remains to be demonstrated: that molecular chaperones become
saturated, and that proteome quality falls, however, the implication of the heat shock protein, DNAJC7, in ALS
suggests that this may be the case (Farhan et al., 2019; Jih et al., 2020; Wang et al., 2020).

Importantly, both mTOR and MYC can activate respiration, which generates oxidative stress, which in turn, can
cause DNA damage, both of which are hallmarks of ALS. Finally, the combined sources of damage can bring
about excitotoxicity, axonopathy, and eventually cell death.

Ageing is a key contributor to the development of ALS in this model, mirroring the age-dependent penetrance of
the HRE mutation in C9-ALS/FTD (Murphy et al., 2017). Besides age-associated degeneration of the chaperone
(Brehme et al., 2014; Sabath et al., 2020; Yang et al., 2014) and degradation capacities (reviewed in (Kaushik
et al., 2021; Saez and Vilchez, 2014)), ageing is also determinant for the concentration of DPRs. The triggers
of RAN translation are poorly understood, and ageing might be among them (Banez-Coronel and Ranum,
2019). Indeed, in HRE-harbouring mice, RAN translation products accumulated with age (Liu et al., 2016).

Dosage of R-rich peptides can help explain one other empirical observation. There are numerous reports of
ablation of components of the nucleocytoplasmic transport machinery being protective against R-rich DPR
toxicity (Chai and Gitler, 2018; Freibaum et al., 2015; Jovičić et al., 2015; Kramer et al., 2018) . Although
both poly(PR) and poly(GR) freely cross the cell membrane, the mode of entry to the nucleus is poorly understood,
and may depend on these transporters. Assuming that inhibition of ribosome biogenesis is pivotal in cell death,
exclusion of R-rich peptides from the nucleus can be a powerful mechanism of rescue.

Taken together, expression of R-rich peptides in C9-ALS/FTD can bring about the pathogenic landscape, and
cause ALS in mutation carriers. However, despite clear phenotypes both in vivo and in vitro, the relevance of

104
poly(GR) and poly(PR) peptides in C9-ALS pathogenesis is in active dispute, given their infrequency in post-
mortem tissues.

4.2 POST-MORTEM CONTROVERSY: ARE ARGININE-RICH PEPTIDES RELEVANT?

During World War II, the US military contacted the Columbia University statistics department in order to analyse
the hits taken in the field by bomber planes, and logically deduce the best armouring strategy. Contrary to the
contemporary military guidelines, the group recommended reinforcing the armour on the parts of the plane that
apparently sustained no damage (Wald, 1980). Why? Because, the bombers that received damage in these
components did not return.

This illustrates a logical error known as the “survivorship bias”, which is an implicit flaw in post-mortem tissue
analysis. It is difficult to draw accurate conclusions about a lethal disease based on the final stages, once enough
affected cells have died to kill the patient. There is no way of determining whether the post-mortem landscape
is a true representation of the mechanism of cell death or, conversely, adaptations that favour survival.

As such, the incongruent post-mortem observation, that DPRs were found in brain regions that are not affected
in ALS or FTD (Ash et al., 2013; Davidson et al., 2014; Mackenzie et al., 2015; Mann et al., 2013; Schludi et
al., 2015), is compatible with the relevant cells having died from DPR expression, and the patient dying before
cell death occurs in all regions.

The second conflict is that TDP-43 proteinopathy and DPRs infrequently coincided in the same neurons
(Gendron et al., 2015; Gomez-Deza et al., 2015; Mann et al., 2013; Mori et al., 2013b) . Likewise, as
previously discussed, TDP-43 aggregates are not necessarily the drivers of cell death. Again, these reports are
compatible with DPR-driven TDP-43 displacement, but cell death occurring before aggregates can be formed.
There are several descriptions of symptomatic ALS/FTD patients bearing DPR pathology without TDP-43
aggregation, which support a model in which TDP-43 proteinopathy is unnecessary for degeneration (Baborie et
al., 2015; Gami et al., 2015; Gendron et al., 2015; Gijselinck et al., 2012; Mori et al., 2013b; Proudfoot et
al., 2014; Vatsavayai et al., 2016).

Finally, one of the most obvious critiques to our approach is that the dosage of (PR) 20, or expressed (PR)97, is
likely to be superior to what is observed in ALS patients. This is probable, although for the aforementioned
reasons, indemonstrable from post-mortem data. Nevertheless, arguably, this would not invalidate our
conclusions; the proteostasis-collapse model is compatible with progressive accumulation of damage,
especially in post-mitotic neurons where misfolded proteins are not diluted by cell division. ALS takes half a
century to develop and long-term exposure to a low concentration of R-rich peptides may lead to the same
effects. Our data supports this assumption, as similar phenomena were observed both in 48-hour experiments
in MEFs, and in animals after months of induction (Figure 37, Figure 42).

4.3 ANTI-AGEING THERAPIES AS A TREATMENT FOR ALS

Considering our proposed order of disease events, the low efficacy of riluzole and edavarone in treating ALS fits.
Both excitotoxicity, targeted by riluzole, and oxidative stress, by edavarone (Chiò et al., 2020), are relatively late
events in the model. Presumably, targeting early events will have larger effects on survival. Rapamycin, and other
mTOR inhibitors, may fulfil this need.

Given its potential for stimulating autophagy, rapamycin has been tested in animal models of several
neurodegenerative disorders, including Alzheimer’s, Huntington’s, Parkinson’s, and ALS (Soo et al., 2020). It has
shown promising results in TDP-43-ALS both in vivo and in vitro (Caccamo et al., 2009; Cheng et al., 2015;
Wang et al., 2012), but mixed effects in models of SOD1-ALS (Granatiero et al., 2021; Staats et al., 2013;
Zhang et al., 2011). In fact, an Italian Phase II clinical trial to evaluate its efficacy in combination with riluzole is
currently underway ( (Mandrioli et al., 2018); ClinicalTrials.gov Identifier: NCT03359538).

105
This thesis endorses rapamycin as a possible therapy specifically for C9-ALS/FTD, however, the real novelty lies
unearthing nucleolar activity as a therapeutic target.

A long-standing observation in the field is that ALS has a higher incidence and lower age of onset in professional
athletes (Chiò et al., 2009), although association has been difficult to pin down. A recent analysis revealed that
age of onset was inversely proportional to strenuous exercise in C9ORF72 mutation carriers (Julian et al., 2021).
Ribosome biogenesis is activated in muscle hypertrophy (Figueiredo and McCarthy, 2019), and this correlation
supports that its inhibition can be advantageous in ALS.

Furthermore, by linking the nucleolus with ageing in our PR KI/KI mice, we propose that other anti-ageing
interventions may also be beneficial in ALS. Besides mTOR inhibition, we found that HDAC inhibitors,
downregulation of MYC and RAS/ERK signalling (Figure 33, Figure 35, Annex 6, Annex 7), could also be protective
against poly(PR) peptides. As previously mentioned, all four interventions extend lifespan in animals (Hofmann
et al., 2015; McIntyre et al., 2019; Slack et al., 2015) .

Based on our in vitro results, we believe that MYC may prove to be a valuable target for ALS. Besides up-regulation
of MYC hallmarks, and r-proteins identified in our analysis of NeuroLINCs data (Figure 40), a transcriptomic study
of laser-cut motor neurons from sALS patients’ spinal cords recently confirmed up-regulation of a number of r-
proteins (Ho et al., 2021).

The next stage in testing the viability of MYC-downregulation will be validation in our PRKI/KI animals crossed with
heterozygous Myc+/-, to test the effect of reduction of Myc in vivo. Should it prove to be successful, several
promising pharmacological approaches to attenuate MYC have recently emerged in the cancer field. These
include: the recently published family of MYC-inhibitors, the dominant-negative peptide OmoMYC, and stabilised
antisense oligonucleotides targeting MYC (Gill et al., 2021; Han et al., 2019; Soucek et al., 2008; Whitfield
and Soucek, 2021).

We should also bear in mind that the possible benefits of ribosome biogenesis inhibition are not exclusive to
ALS. The most obvious alternative candidates are ribosomopathies and progerias, although other
neurodegenerative diseases may also benefit from this approach. To date, over 20 neurodegenerative disorders
are associated to CNV expansions and more are likely to come as technologies capable of sequencing repetitive
regions become available. Indeed, R-rich peptides may be more prevalent than we currently know. RAN
translation products have been detected in at least nine other conditions (Banez-Coronel and Ranum, 2019),
spinocerebral ataxia 36 (SCA36) among them. SCA36 is particularly telling, because recently poly(PR) peptides
were also found in in this disorder, although their contribution to pathogenesis is still poorly understood
(McEachin et al., 2020).

In summary, we here have proposed a single molecular mechanism to account for the series of defects caused
by R-rich DPRs: due to their positive charge, poly(PR) and poly(GR) peptides bind to nucleic acids, and displace
the relevant binding factors. Among the resulting cellular disturbances, some of the most prominent are
problems in translation and ribosome biogenesis. We showed that as a result of perturbed rRNA processing,
cells exposed to poly(PR) peptides accumulated free r-proteins.

From analysis of cells that became spontaneously resistant to (PR) 20 peptides, we found that down-regulation of
nucleolar activity and translation, either through mTOR inhibition or c-MYC down-regulation, was protective
against the nucleolar stress and toxicity caused by these peptides.

Finally, we developed mouse model expressing poly(PR) peptides in all tissues, which developed an unexpected
premature ageing phenotype. To our knowledge, this is the first model to show ageing characteristics in direct
response to nucleolar stress. We believe that this phenotype manifests through proteostatic collapse, driven by
free r-proteins. Reducing nucleolar activity through mTOR inhibition extended lifespan in these animals.
Surprisingly, RNAseq data from differentiated motor neurons derived from C9-ALS patients showed that both of
these routes are also hyperactivated, suggesting that therapies targeting the nucleolus may be beneficial in C9-
ALS/FTD.

106
CONCLUSIONS

108
1. Poly(PR) peptides have a high affinity for nucleic acids, and thus collectively displace DNA- and RNA-binding
proteins from chromatin and mRNA, inhibiting RNA- and DNA-based reactions both in cells and in vitro.

2. The toxicity of arginine-rich DPRs can be mitigated by non-coding oligonucleotides and certain poly-anions
such as heparin.

3. Poly(PR) peptides cause nucleolar stress and the accumulation of free ribosomal proteins.

4. Acquired resistance to poly(PR) peptides in NSC34 mouse motor neuron-like cells is associated with a down-
regulation of translation and ribosome biogenesis.

5. Lowering translation and overall metabolism by inhibition of mTOR or depletion of MYC can rescue toxicity
by poly(PR) peptides in vitro.

6. Mice systemically expressing (PR)97 peptides develop a lethal premature ageing phenotype, associated to
an accumulation of nucleolar stress, overexpression of ribosomal proteins, and increased activity of mTOR
and MYC pathways.

7. Consistently, bioinformatic analysis on RNAseq data from iPSC-derived motor neurons of ALS patients
harbouring C9ORF72 mutations, show an overexpression of ribosomal proteins and the activation of mTOR
and MYC signalling.

8. Continuous oral treatment with the mTOR inhibitor rapamycin extends lifespan in (PR) 97-expressing mice.

109
1. Los péptidos poli(PR) tienen una alta afinidad por los ácidos nucleicos, por lo que desplazan de forma
generalizada las proteínas de unión a cromatina y ARNm inhibiendo las reacciones basadas en ARN y
ADN, tanto en células como in vitro.

2. La toxicidad de los péptidos ricos en arginina puede ser aliviada por el co-tratamiento con
oligonucleótidos no codificantes y algunos polianiones, como la heparina.

3. Los péptidos poli(PR) causan estrés nucleolar y la acumulación de proteínas ribosomales libres.

4. La resistencia adquirida a los péptidos poli(PR) en la línea NSC34 de motoneuronas de ratón NSC34 se
asocia con la represión de la traducción y la biogénesis ribosomal.

5. La represión de la traducción y del metabolismo general por la inhibición de mTOR o la depleción de

MYC puede rescatar la toxicidad de los péptidos poli(PR) in vitro.

6. Los ratones que expresan péptidos (PR) 97 de forma sistémica desarrollan un fenotipo letal de
envejecimiento prematuro, asociado con la acumulación de estrés nucleolar, la sobreexpresión de
proteínas ribosomales y la activación de las rutas mTOR y MYC.

7. Consistentemente, el análisis bioinformático del transcriptoma de motoneuronas diferenciadas a partir

de células madre pluripotentes inducidas, derivadas de células extraídas de pacientes de ELA con
mutaciones en C9ORF72, presentan una sobreexpresión de proteínas ribosomales, y la activación de la
señalización de mTOR y MYC.

8. El tratamiento oral con rapamicina, un inhibidor de mTOR, extiende la vida en los ratones que
sistémicamente expresan (PR)97.

110
ANNEXES

111
 ANNEXES

CONTENTS

1. Annex Table 1. Proteins with significantly reduced levels on ribosomal fractions purified from (PR) 20-
treated HeLa-RPS9SBP cells.

2. Annex Table 2. Proteins that show statistically significant reduced levels on chromatin after treatm ent
of U2OS cells with (PR)20 (20 μM) or protamine (30 μM).

3. Annex Table 3. Displacement of factors from RNA by protamine or (PR) 20 peptides. The first column
indicates the enrichment of the protein on RNA in control conditions and the next two how this binding
is affected by protamine or (PR) 20 peptides.

4. Annex Table 4. Proteins that show statistically significant increased levels in the ribosome-free fraction
after treatment of U2OS (PR)97 cells with doxycycline for 48h.

5. Annex Figure 5. GSEA of NSC34R proteomics.

6. Annex Figure 6. DSEA of NSC34R CMap signatures.

7. Annex Figure 7. Connectivity scores (CS) of PIK3i, IGFi, AKTi, and HDACi compound set in NSC34 R1 and
NSC34R2.

8. Annex Figure 8. Expression of (PR)97 by organ and kyphosis. Supplementary information to Figure 38.

9. Annex Table 9. GSEA of PR KI/KI RNAseq.

113
ANNEX 1

Annex Table 1. Proteins with significantly reduced levels on ribosomal fractions purified from (PR) 20-treated HeLa-
RPS9SBP cells.
Gene Symbol log2 ((PR)20/Control)
PSME3 -3.61
H1FX -1.94
RPL27A -1.76
RPLP2 -1.71
BRIX1 -1.52
GTPBP4 -1.35
RPL32 -1.32
KRR1 -1.22
NAP1L4 -1.21
HP1BP3 -1.20
RPL3 -0.99
RPL14 -0.87
RPL10A -0.70
RPL6 -0.66
UTP14A -0.65
RPL9 -0.63

ANNEX 2

Annex Table 2. Proteins that show statistically significant reduced levels on chromatin after treatment of U2OS
cells with (PR)20 (20 μM) or protamine (30 μM).
log2(Fold Change)
Gene Symbol (PR)20/Control Protamine/Control
FURIN -2.45 -3.61
POTEJ -2.05 -2.15
POTEKP -1.72 -1.63
TMEM126B -1.40 -1.19
POTEF -1.38 -1.20
HIST1H1C -1.33 -0.61
FARS2 -1.28 -0.75
HIST1H1A -1.27 -0.46
SNX5 -1.06 -0.82
H1F0 -1.05 -0.39
PITPNA -1.02 -0.60
PDK2 -1.01 -0.64
GLTSCR2 -1.01 -0.42
EEF1B2 -1.01 -0.86
EEF1G -0.98 -0.75
GAPDH -0.97 -0.80
NRF1 -0.96 -0.90
PSMF1 -0.93 -0.42
AURKC -0.92 -0.87
CORO1B -0.88 -0.47
EBAG9 -0.87 -0.64
APEX1 -0.86 -0.70
EEF1D -0.83 -0.69
ALDOC -0.82 -0.45
REPIN1 -0.82 -0.54
H2AFY -0.82 -0.43
RXRB -0.75 -0.50

114
 ANNEXES

HMGA1 -0.75 -0.68

TPT1 -0.73 -0.65
RPUSD4 -0.72 -0.87
DNAJC15 -0.70 -0.40
RING1 -0.70 -0.57
PCBP3 -0.67 -0.41
HMGA2 -0.66 -0.51
SLC25A40 -0.65 -0.41
HN1L -0.65 -0.40
MEN1 -0.65 -0.40
MSN -0.64 -0.58
HDGF -0.62 -0.44
HCFC1 -0.62 -0.52
TGIF2LX -0.62 -0.52
HMGB1;HMGB1P1 -0.62 -0.50
LRRC57 -0.60 -0.49
FLNA -0.60 -0.50
RANBP1 -0.60 -0.59
NCKIPSD -0.59 -0.61
EZR -0.58 -0.51
CMSS1 -0.58 -0.35
LANCL2 -0.58 -0.58
CSRP2 -0.58 -0.48
TMF1 -0.58 -0.44
EEF1A2 -0.56 -0.54
TARS -0.56 -0.45
CDYL -0.56 -0.75
DIDO1 -0.55 -0.44
AHNAK -0.55 -0.48
ACAP2 -0.55 -0.39
SYNGR3 -0.55 -0.60
PALM2 -0.55 -0.48
ARHGAP17 -0.55 -0.57
ID1 -0.55 -0.39
CCAR1 -0.54 -0.40
RPL18 -0.54 -0.38
COPS7A -0.54 -0.51
CCDC50 -0.53 -0.53
ZBTB10 -0.53 -0.88
CCNC -0.53 -0.38
SFSWAP -0.52 -0.60
SLC43A3 -0.52 -0.45
WASF2 -0.52 -0.61
SPR -0.52 -0.74
GAP43 -0.51 -0.97
FSCN1 -0.51 -0.40
VPS39 -0.51 -0.57
FUS -0.50 -0.46
SARS -0.50 -0.46
FIP1L1 -0.49 -0.38
DIAPH2 -0.49 -0.67
CSTF2 -0.49 -0.40
SCAF4 -0.49 -0.36
CBX8 -0.48 -0.47
PRPF38B -0.48 -0.35
DCUN1D1 -0.47 -0.61
DDX31 -0.47 -0.45
PDLIM7 -0.47 -0.41
RECQL -0.47 -0.36

115
 FNBP4 -0.47 -0.40
EHD3 -0.46 -0.38
SCAF1 -0.46 -0.37
MRGBP -0.46 -0.54
MAVS -0.45 -0.38
CORO1C -0.45 -0.55
MINA -0.45 -0.48
COPS8 -0.45 -0.74
TCERG1 -0.45 -0.42
NEDD1 -0.44 -0.59
SEPT9 -0.44 -0.43
HDGFRP3 -0.44 -0.36
FAHD1 -0.44 -0.73
FKBP3 -0.43 -0.42

ANNEX 3

Annex Table 3. Displacement of factors from RNA by protamine or (PR) 20 peptides. The first column indicates the
enrichment of the protein on RNA in control conditions and the next two how this binding is affected by protamine
or (PR)20 peptides.
log2(Fold Change)
Crosslink/No Crosslink (PR)20/control Protamine/control
Gene Symbol
Enrichment on RNA Effect of (PR)20 Effect of Protamine
PHYKPL 10.16 -9.39 -9.48
NPC1 6.89 -8.75 -1.75
NUP153 9.12 -8.35 -1.38
SCUBE1 6.73 -5.96 -1.72
PDE7B 6.93 -5.91 -1.69
G3BP2 4.13 -4.73 -1.95
CNBP 6.18 -4.55 -0.16
GLTSCR2 5.94 -4.09 -5.26
CSTF2T 8.29 -4.02 -1.05
ELAVL2 7.78 -3.86 -1.09
EIF3G 8.94 -3.68 -0.99
PPIL4 4.79 -3.65 -2.12
RNMTL1 4.41 -3.64 -0.76
RBMS2 4.01 -3.62 -0.44
RBM5 6.06 -3.62 -3.02
MRPL41 4.38 -3.61 -0.16
UGP2 4.34 -3.57 -0.69
CSTF2 8.91 -3.55 -1.43
SSB 6.28 -3.53 -0.57
FCF1 6.00 -3.49 -1.28
PSPC1 9.97 -3.48 -0.76
EIF4B 6.54 -3.48 -0.65
NUP107 6.73 -3.44 -1.59
R3HDM1 5.96 -3.41 -2.48
RBM47 4.93 -3.35 -1.00
RPL22L1 6.67 -3.31 -1.21
RPS28 4.68 -3.29 0.07
RBM6 5.97 -3.27 -0.66
KHSRP 7.45 -3.23 -0.71
PABPC5 3.98 -3.21 -0.58
REXO4 5.12 -3.19 -2.57
PURB 6.28 -3.18 -1.15
G3BP1 7.09 -3.1 -1.26
RPUSD4 4.4 -3.08 -1.2

116
 ANNEXES

PTBP2 7.57 -3.08 -0.48

UTP11L 6.12 -3.04 -0.61
EIF4H 6.8 -3.04 -0.85
HNRNPD 8.68 -3.00 -0.62
FUBP3 8.75 -2.98 -0.76
FUBP1 10.32 -2.95 -1.01
RBM3 6.75 -2.94 0.16
RRP36 7.74 -2.93 -2.26
RBM12 5.38 -2.9 -0.67
KHDRBS3 4.44 -2.89 0.37
NUDT21 4.46 -2.87 -0.18
LSM14A 4.34 -2.87 -1.04
CELF2 4.9 -2.85 -2.77
RBM4 5.83 -2.85 -0.75
HNRNPC 10.42 -2.82 -0.64
CAP1 3.31 -2.79 0.43
TIA1 8.42 -2.78 -0.94
NSUN5 5.85 -2.78 -2.61
NOP16 6.41 -2.75 -1.12
GRSF1 6.63 -2.74 -0.27
RBM4B 4.86 -2.69 -1.49
SLIRP 7.7 -2.64 -0.33
PRR3 4.55 -2.63 -1.15
RBM22 8.04 -2.59 -1.75
MYO5C 5.3 -2.58 -0.79
PUM2 8.26 -2.58 -0.89
ELAVL1 10.75 -2.57 -0.78
DSG3 6.11 -2.55 0.54
HNRNPA0 7.87 -2.55 -0.66
HNRNPDL 7.88 -2.54 -0.28
PURA 6.86 -2.54 -0.92
SYNCRIP 8.8 -2.52 -1.29
YBX3 9.75 -2.51 -0.97
TIAL1 9.93 -2.51 -1.13
LSM2 5.14 -2.49 -0.95
YBX1 6.95 -2.47 -1.09
RNMT 3.58 -2.46 -0.58
KRR1 7.19 -2.45 -2.19
DAZAP1 8.35 -2.44 -0.78
RAVER1 8.00 -2.44 -0.58
MSI1 3.2 -2.43 -2.52
EXOSC2 3.18 -2.42 -2.51
HDLBP 9.45 -2.41 -1.12
PUF60 8.67 -2.39 -0.78
MRPL13 6.85 -2.38 0.29
HNRNPH3 8.33 -2.38 -0.48
CELF1 8.5 -2.36 -0.95
URB1 8.82 -2.35 -2.17
MBNL1 5.07 -2.35 0.2
HNRNPA2B1 8.27 -2.35 -0.48
IMP4 4.07 -2.33 -1.33
EIF1 3.09 -2.32 1.93
NCKAP1 4.48 -2.32 -2.22
CCDC59 6.15 -2.32 -2.23
RBMS1 4.3 -2.29 -0.9
CSDE1 7.26 -2.29 -1.2
SEC61B 5.27 -2.28 -1.31
SFPQ 9.27 -2.28 -1.14
HNRNPAB 8.28 -2.28 -0.22

117
 DUSP14 3.04 -2.27 1.34
DCAF13 8.46 -2.26 -0.78
RBM10 7.97 -2.26 -1.33
FYTTD1 6.35 -2.26 -2.71
GAR1 8.95 -2.25 -1.2
NCL 8.53 -2.24 -1.04
HNRNPH1 6.77 -2.24 -0.68
MPHOSPH10 3.6 -2.21 -0.3
FUS 8.1 -2.21 -0.85
AKAP8 5.07 -2.19 -0.75
SURF6 5.71 -2.19 -2.67
MBNL2 4.13 -2.19 -0.94
UTP23 4.2 -2.17 -3.05
NXF1 4.13 -2.17 0.64
PSMC2 9.65 -2.16 -0.72
ZCCHC3 8.19 -2.15 -1.22
C14orf166 3.33 -2.14 1.35
SF3B4 8.37 -2.14 -0.88
RBM38 7.13 -2.13 -1.05
RPL7L1 5.79 -2.11 -2.65
GSTP1 3.13 -2.11 0.21
PCBP3 5.01 -2.08 -0.68
NONO 9.87 -2.08 -1.17
FAM98B 4.75 -2.06 -0.45
MRPS23 3.72 -2.03 -0.39
ATP6V1C2 4.38 -2.03 -0.06
SRSF9 6.46 -2.02 -0.1
EVPL 3.08 -2.01 0.67
IGF2BP3 7.09 -2.01 -0.5
RALY 13.95 -2.01 -0.94
MRPL42 5.06 -2.01 0.01
HNRNPF 7.67 -2.00 -0.57
RPF1 4.83 -2.00 -3.43
SAFB2 3.53 -2.00 0.98
IGF2BP2 7.97 -1.99 -0.93
RBMXL1 5.11 -1.96 0.36
RBM14 10.15 -1.96 -0.38
NGDN 5.29 -1.96 -1.35
MSI2 4.39 -1.95 -0.85
PABPN1 8.28 -1.94 -1.45
ZC3H7A 5.77 -1.94 -1.26
HNRNPA1 7.8 -1.94 -0.34
SERBP1 8.15 -1.94 -0.78
C3 4.92 -1.94 1.12
HNRNPM 5.25 -1.92 -0.61
ARHGDIA 7.11 -1.92 -0.51
BYSL 6.97 -1.91 -1.3
MRPL1 5.33 -1.9 0.28
TTN 4.28 -1.88 0.04
EDF1 3.39 -1.85 -0.51
GNL2 5.15 -1.85 -3.14
TACO1 4.95 -1.83 -0.78
PUM1 9.4 -1.83 -0.5
UTP14A 6.68 -1.81 -1.1
IMP3 5.59 -1.8 -0.47
DDX1 7.32 -1.79 0.18
FAM98A 7.00 -1.79 -0.64
FASTKD2 9.00 -1.77 -0.73
UTP3 7.65 -1.75 -1.58

118
 ANNEXES

CAPRIN1 9.6 -1.74 -0.96

TARDBP 8.71 -1.74 -0.47
HNRNPLL 8.00 -1.72 -0.82
HNRNPH2 6.7 -1.72 -0.65
CPEB4 3.68 -1.72 -0.94
API5 6.32 -1.72 0.61
PCBP1 6.35 -1.71 -0.94
SUB1 5.24 -1.71 0.18
FBLL1 5.44 -1.71 -1.09
SKIV2L2 5.33 -1.71 1.26
SF1 7.89 -1.71 -0.43
XPO5 4.29 -1.7 -0.82
NHP2 5.02 -1.7 -0.32
PSME2 3.67 -1.69 -0.04
RSL1D1 8.65 -1.68 -0.51
MEX3D 3.14 -1.66 -0.52
DDX56 8.23 -1.66 -1.15
PRPF6 3.29 -1.65 -0.26
WDR33 5.42 -1.64 -0.79
RRP7A 4.03 -1.64 -0.34
PPP1R10 5.78 -1.63 -0.86
ILF2 6.53 -1.63 -0.5
EBNA1BP2 9.1 -1.62 -1.63
SND1 10.16 -1.62 -1.43
NOC3L 6.32 -1.62 -1.51
HNRNPA3 6.82 -1.61 -0.04
MRPS18A 4.81 -1.61 1.8
NPM1 4.63 -1.6 0.12
RBM28 5.25 -1.58 -2.41
RBM19 6.23 -1.57 -1.13
RPL22 6.14 -1.57 -0.19
SRSF7 7.95 -1.56 -0.5
PCBP2 7.65 -1.55 -0.6
RAP1A 3.93 -1.55 -0.64
MRPS31 5.3 -1.55 -1.49
ILF3 5.02 -1.55 -0.59
HNRNPR 9.61 -1.54 -0.79
NSA2 5.87 -1.54 -3.98
ZC3H7B 4.26 -1.54 -0.89
LSM14B 5.12 -1.53 -0.16
SRSF3 9.4 -1.52 -0.15
PATL1 4.21 -1.51 -0.93
FAM120A 5.55 -1.47 -0.97
DDX47 6.08 -1.47 -1.25
YBX2 4.61 -1.46 -1.44
USP10 6.99 -1.46 -1.58
SFN 3.29 -1.46 1.39
ISG20L2 4.84 -1.45 -1.81
UTP15 7.82 -1.45 -0.07
RBM12B 5.07 -1.45 -0.74
QKI 3.99 -1.44 -1.17
CKAP4 3.18 -1.41 0.52
RRS1 8.18 -1.4 -0.93
DDX27 8.16 -1.39 -2.3
FBL 10.06 -1.39 -0.75
PTBP1 7.02 -1.39 -0.29
UBAP2 5.78 -1.38 -0.05
NOL8 3.85 -1.37 0.62
ARHGEF40 4.33 -1.36 -2.86

119
 PTBP3 6.22 -1.36 -0.08
PWP2 9.84 -1.35 0.11
TEX10 4.89 -1.33 -2.39
SRSF2 10.43 -1.33 -0.69
EWSR1 7.8 -1.33 -0.63
SDAD1 6.61 -1.33 -2.17
URB2 3.17 -1.32 -1.35
AQR 5.69 -1.32 -1.54
DDX31 6.52 -1.3 -2.93
NOLC1 6.05 -1.3 -1.62
RPL26 6.51 -1.27 -0.38
SRSF1 6.84 -1.27 -0.1
TRA2B 9.36 -1.26 0.5
DDX5 7.22 -1.25 -0.29
PARP12 3.22 -1.25 -1.77
SF3A3 5.28 -1.24 -0.68
SUGP2 6.75 -1.24 -1.18
U2AF2 10.26 -1.23 -0.94
APOBEC3B 8.26 -1.23 -0.02
ZCCHC7 3.43 -1.23 0.27
DKC1 6.57 -1.21 0.8
HNRNPL 8.02 -1.21 -0.28
NOP9 6.74 -1.2 0.42
DDX3X 7.93 -1.2 -0.59
RBM15 7.09 -1.18 -0.15
LLPH 4.44 -1.16 -2.29
LRPPRC 7.25 -1.16 -0.51
UPF1 6.51 -1.16 -0.94
DDX21 11.71 -1.15 -0.52
MRPL15 5.49 -1.14 -0.53
SRSF6 8.59 -1.1 -0.62
MATR3 3.69 -1.09 -0.15
RBM7 5.25 -1.09 0.21
PTCD1 6.01 -1.09 -0.74
IVL 3.02 -1.09 -0.01
RBM42 3.38 -1.09 -1.93
DHX15 8.22 -1.08 -0.33
NOL11 6.54 -1.08 -0.62
ZFR 5.93 -1.08 -0.53
KIAA0020 8.53 -1.07 -1.84
PI3 3.64 -1.07 -0.24
RPF2 6.7 -1.07 -1.37
ERAL1 5.28 -1.06 -0.37
CMPK1 3.27 -1.05 0.44
NOP14 7.27 -1.05 -0.83
RBM27 3.88 -1.05 -0.5
DDX24 6.34 -1.04 -2.04
ZNF326 8.07 -1.04 -0.17
PRRC2A 3.04 -1.04 -0.14
DDX6 5.97 -1.03 -0.06
CHD1 3.54 -1.03 -2.3
USP36 4.4 -1.02 -0.23
GNL3L 5.17 -1.02 -1.95
DYNC2H1 3.59 -1.01 -0.11
FARSA 3.24 -1.00 -0.45
FAM25G 4.31 -1.00 3.16
RBMX 7.89 -1.00 0.51
PRPF38A 3.2 -1.00 -2.52
CEBPZ 6.46 -0.99 -1.43

120
 ANNEXES

HNRNPK 6.06 -0.99 -0.17

CPSF4 4.08 -0.98 -1.24
ZCCHC6 3.87 -0.97 -1.14
RPA1 4.52 -0.97 -0.77
DDX18 8.15 -0.97 -0.65
RRP1 4.44 -0.96 -0.87
DHX36 4.42 -0.95 0.22
KTN1 4.13 -0.94 -0.34
RPS10 6.88 -0.94 -0.28
BMS1 7.46 -0.91 -1.24
AATF 4.92 -0.9 -0.59
EIF4G2 3.89 -0.9 -0.32
BRIX1 7.94 -0.89 -1.36
RPS3 7.44 -0.89 -1.11
KHDRBS1 5.91 -0.88 0.43
DDX28 3.29 -0.88 -1.27
NOP2 4.51 -0.88 -0.14
HSP90B1 3.01 -0.88 -0.25
PA2G4 6.35 -0.87 0.89
PPAN 7.85 -0.86 -0.14
XRN2 8.18 -0.86 -0.25
HNRNPUL2 7.83 -0.85 0.09
DBI 6.27 -0.85 -0.17
RPL29 3.66 -0.83 0.22
MRPL44 4.14 -0.82 -1.11
CHTOP 3.41 -0.82 -0.25
MTPAP 4.7 -0.82 -0.88
ZC3H14 7.18 -0.8 -0.28
FMR1 3.26 -0.8 -0.34
PABPC4 9.51 -0.79 -0.23
ZC3HAV1 4.57 -0.77 -0.94
SRSF5 5.76 -0.77 -0.24
PAPD5 3.98 -0.76 -0.1
LRRC59 5.48 -0.76 -0.05
APOBEC3F 5.16 -0.76 -0.63
PTCD3 8.65 -0.76 -0.39
MRPL3 5.16 -0.74 -0.35
WDR46 7.76 -0.73 0.53
KIF4B 4.9 -0.73 -2.01
MKI67 4.42 -0.73 -0.79
YTHDF3 5.09 -0.73 -0.18
ALYREF 6.82 -0.73 -0.27
EIF3A 5.92 -0.72 -0.24
MRPL4 4.92 -0.71 -0.08
RRP8 5.57 -0.7 -0.52
RPS24 7.3 -0.69 0.24
LARP7 5.33 -0.69 0.94
MRPS5 7.00 -0.69 -0.72
EIF4A1 3.35 -0.68 0.06
PNO1 3.27 -0.68 -0.31
UBAP2L 8.02 -0.68 -0.3
PARP1 3.92 -0.68 -0.3
DDX17 8.79 -0.67 -0.18
NSUN2 4.42 -0.66 -1.13
MYBBP1A 9.82 -0.66 -0.39
EIF4A3 3.51 -0.66 0.73
TBRG4 7.66 -0.65 -0.09
MRPS7 5.43 -0.64 -0.23
YTHDF1 7.28 -0.64 -0.64

121
 MRPL45 4.26 -0.63 -0.08
CCAR2 7.45 -0.63 -1.1
MAP4 4.29 -0.62 0.16
GTPBP4 3.59 -0.62 -1.36
NIFK 7.53 -0.62 -0.92
FAU 3.71 -0.59 0.55
ZNFX1 3.46 -0.56 0.19
NKRF 3.83 -0.56 -0.04
TRIM25 3.02 -0.56 -0.1
NOP58 7.84 -0.56 -0.8
RPL23A 3.74 -0.53 0.37
DHX9 4.6 -0.5 -0.03
SRSF4 4.04 -0.49 0.02
DDX54 6.13 -0.49 -1.91
SLTM 3.28 -0.48 0.31
RNPS1 4.28 -0.48 -0.33
HNRNPU 5.47 -0.47 -0.38
FEN1 3.25 -0.44 -0.4
SARS 3.2 -0.43 1.58
SUMO2 3.1 -0.43 1.77
FXR1 8.17 -0.42 -0.28
LARP1 3.39 -0.42 -0.74
WDR75 9.6 -0.42 -0.24
UTP20 6.98 -0.39 -0.85
DHX8 4.41 -0.38 -1.19
POLRMT 4.81 -0.38 -0.04
RBM39 5.22 -0.34 -0.39
RNH1 5.2 -0.34 0.57
GNL3 7.88 -0.32 -0.38
HNRNPUL1 3.07 -0.32 -0.39
RPS2 5.71 -0.32 0.24
L1RE1 4.02 -0.31 0.39
PABPC1 5.92 -0.31 0.02
PES1 7.8 -0.3 -1.47
RPS20 5.83 -0.29 0.53
MAGEB2 6.4 -0.28 0.39
TRIM29 3.58 -0.28 1.18
YTHDC1 4.92 -0.28 1.1
SRSF10 7.53 -0.27 0.52
AGO-02 4.47 -0.27 -1.94
DDX52 6.33 -0.26 -1.13
MRPS9 3.52 -0.26 -0.76
RPS18 4.88 -0.25 0.22
SPATS2L 5.43 -0.24 -0.44
RPS19 5.08 -0.24 0.96
CPSF6 4.31 -0.22 -0.48
XRCC6 5.4 -0.21 -0.11
DDX10 6.61 -0.2 -0.63
NOP56 7.52 -0.19 -0.5
RPS11 7.59 -0.18 -0.49
SEC61G 3.44 -0.17 -0.56
TOP1 4.47 -0.15 1.33
RRP12 5.46 -0.14 -0.8
STAU2 4.05 -0.12 -0.18
ADAR 5.68 -0.12 -0.47
U2AF1 5.61 -0.11 -0.2
ABT1 3.5 -0.11 -1.45
RPS15 7.05 -0.11 1.36
XRCC5 6.73 -0.09 -0.3

122
 ANNEXES

BCLAF1 6.47 -0.08 0.3

SECISBP2L 3.25 -0.08 -0.97
RRP1B 7.00 -0.06 -0.43
MRPL28 5.66 -0.05 -0.93
DDX50 8.06 -0.01 -0.01
THRAP3 5.75 -0.01 0.59
MOV10 7.65 0.00 -0.47
HP 3.15 0.00 1.82
RPS7 4.44 0.00 1.49
ATXN2L 3.92 0.01 0.27
ABCF1 5.05 0.03 0.59
UTP18 5.75 0.04 0.38
BZW1 4.73 0.05 0.61
RPL14 7.17 0.06 -0.68
SUPT6H 3.55 0.07 -0.94
NOL10 6.66 0.1 -0.49
EIF4A2 3.17 0.11 -3.15
EIF3C 9.54 0.12 0.14
RPS14 5.66 0.14 -0.03
CSNK2A2 3.42 0.18 -0.62
NOM1 5.46 0.18 -1.57
TFB2M 3.19 0.2 -0.56
WDR43 3.39 0.21 0.23
WDR3 6.68 0.27 -0.74
EXOSC10 6.35 0.28 0.31
TRMT10C 4.13 0.3 0.48
RANBP2 6.35 0.33 -0.88
YTHDF2 3.76 0.33 0.98
RPL8 9.86 0.35 0.27
SF3B1 4.78 0.36 -0.48
NAMPT 3.83 0.37 -0.17
NOC2L 5.11 0.39 -1.07
SF3B2 4.38 0.4 0.06
RPL27 4.31 0.41 0.27
ASS1 3.21 0.44 -0.95
DHX57 5.14 0.47 -0.43
DUSP11 3.36 0.47 0.59
EIF3D 8.47 0.5 0.19
SCAF11 3.36 0.5 0.7
NOL6 5.21 0.54 0.93
PPIG 3.59 0.55 -0.6
RPS21 3.08 0.59 1.23
STAU1 6.8 0.6 0.00
RPS26 3.44 0.62 0.63
PPP2R1A 3.96 0.72 1.67
DDX39B 4.34 0.73 0.74
RPS25 3.03 0.76 0.61
ETFA 3.04 0.76 -0.19
RPL27A 4.42 0.78 0.22
PSMC6 4.57 0.84 1.61
LARP4 5.27 0.85 0.24
LSM8 3.66 0.85 0.95
ACADVL 3.32 0.85 0.77
ZNF638 3.83 0.87 0.53
RPL18A 6.47 0.88 0.04
KIF11 3.91 0.92 -0.1
MTHFSD 3.13 0.93 -0.21
TUBB2A 3.14 0.99 -0.25
RPS6 3.33 0.99 -0.08

123
 FNDC3B 3.67 1.04 0.3
GBP1 4.41 1.13 -0.09
RPS13 4.88 1.19 0.23
RPL5 5.05 1.2 0.09
NES 4.65 1.2 -1.00
RPL17 4.4 1.21 0.47
CSE1L 3.12 1.21 0.9
EIF2B4 3.31 1.35 -0.09
STRAP 3.64 1.39 0.8
FASN 3.13 1.4 1.36
NOC4L 3.36 1.48 1.64
RPS4X 4.1 1.49 0.57
RPS16 4.11 1.53 0.72
RPL24 5.05 1.59 1.00
ATXN2 4.65 1.64 1.36
RPS5 5.03 1.65 0.22
DDX3Y 3.16 1.66 -2.49
RPL23 3.7 1.68 1.12
PSMC3 3.7 1.71 2.05
RPL11 3.87 1.73 0.58
RPL21 5.08 1.75 0.97
RPS3A 4.68 1.82 0.93
RPL7A 3.83 1.82 0.87
RPS17 3.33 1.82 0.98
EIF3L 4.5 1.86 1.32
POLR2B 3.79 1.9 0.92
RPS27 4.17 1.92 1.51
COPB1 3.11 2.00 1.4
BOP1 5.3 2.04 -0.66
MCM6 3.56 2.07 -1.21
GRHPR 3.03 2.1 1.14
RPL10A 4.65 2.1 0.71
RPSA 4.8 2.18 1.47
MMS19 3.15 2.28 -2.15
NAP1L1 3.27 2.37 2.22
RPL3 6.17 2.66 0.88
RPS8 4.42 2.74 1.06
NAT10 5.31 2.86 0.68
EIF2AK2 3.05 3.21 1.52
CCT8 4.26 3.24 1.37
HEATR1 6.4 3.46 0.51
RPL10 5.54 3.55 1.98
TUBB8 5.17 4.56 1.2
RPLP0 3.04 5.06 3.77

ANNEX 4

Annex Table 4. Proteins that show statistically significant increased levels in the ribosome-free fraction after
treatment of U2OS(PR)97 cells with doxycycline for 48h.

log2(Fold Change)

124
 ANNEXES

Gene Symbol Ribosome-free Fraction Polysome Fraction

RPS11 5.51 -0.04
PRPF8 4.56 0.07
PABPN1 2.96 -0.95
SBSN 2.94 -0.87
RPS7 2.91 -0.20
TRMT61A 2.88 0.38
RND3 2.80 -0.27
RPL26 2.77 -1.12
POLR2E 2.75 -1.39
SPRR2E;SPRR2F;SPRR2A 2.52 1.18
RPL30 2.29 -0.90
RPS20 2.29 0.03
FARSA 2.22 -0.26
KRT78 2.19 0.49
MRPS22 2.12 -0.73
USP10 2.12 -0.91
SCAMP4 2.11 -0.15
NDUFAB1 2.09 1.44
SNRPA 1.99 -0.63
POF1B 1.96 0.03
TBL2 1.95 0.52
RPS16 1.95 -0.08
VIM 1.92 2.85
SERBP1 1.89 -0.03
STX6 1.89 -1.95
CASP14 1.88 0.32
DYNLRB1 1.83 -0.64
IGF2BP2 1.80 0.06
MRPL45 1.76 -0.54
EXOSC9 1.75 -1.37
RPSA 1.75 -0.28
HNRNPDL 1.75 -0.22
DHX29 1.75 0.11
IARS 1.70 -0.83
IVL 1.69 -0.74
MCCC1 1.68 -0.91
RPS21 1.66 0.08
FARSB 1.64 -0.30
KPRP 1.63 0.86
KIF2A 1.61 -1.09
NAA38 1.60 -1.25
FAM21A;FAM21C 1.60 0.79
RPS12 1.58 -0.03
CTTNBP2NL 1.54 2.07

125
 FAM98A 1.51 -0.58
TGM3 1.50 0.68
RPL10A 1.50 -0.98
WIPI1 1.47 -0.15
C14orf142 1.41 0.25
PRPF19 1.41 0.12
NIPSNAP3A 1.41 -0.15
RPS25 1.40 -0.02
RPL29 1.40 -0.88
RPL5 1.37 -0.97
EPRS 1.36 -0.75
TMEM63A 1.36 0.78
DNPEP 1.34 -1.13
LAMB3 1.34 2.03
NEMF 1.33 -2.27
EIF3A 1.33 -0.13
DYNC1LI1 1.32 -0.26
GNB2L1 1.32 -0.01
ABCF2 1.27 -0.72
RPL12 1.23 -1.13
SGPL1 1.22 -0.24
DYNC1H1 1.19 -0.48
HYPK 1.18 -2.23
IMPDH1 1.18 -1.03
TBC1D10B 1.15 1.65
HNRNPL 1.15 -0.42
RPL7A 1.15 -1.06
SYNCRIP 1.10 -0.05
BRCC3 1.09 -1.09
SFPQ 1.08 -0.51
PTP4A1 1.08 -0.30
HIF1AN 1.08 -0.50
RPLP0;RPLP0P6 1.07 -0.80
CAPRIN1 1.05 -0.39
LARP1 1.04 0.31
RPS4X;RPS4Y2 1.04 -0.11
HNRNPA0 1.02 0.01
ATAD3A 1.01 0.43

126
 ANNEXES

ANNEX 5

Annex Figure 5. Cells spontaneously resistant to (PR)20 peptides have lower levels of translation and nucleolar
activity; additional information. A) Representation of statistically significant GO terms of downregulated biological
processes involved in translation and ribosome biogenesis, enriched in the GSEA analysis of proteomic
comparison of NSC34R2 with wild-type NSC34WT cells. The normalised enrichment score is indicated by the bars,
while the p-value is colour-coded according to the legend. B) Venn diagram illustrating the overlap among the
proteins that are up- and down-regulated in NSC34 R1 (blue) and NSC34 R2 (green).

127
ANNEX 6

Annex Figure 6. DSEA of NSC34R cells. A-B) Top 10 enriched drug classes, as analysed by DSEA, using the
Connectivity Map drug classes as the reference drug class sets, in NSC34R1 (A) and NSC34R2 (B). The normalised
enrichment score (NES), p-value (pval), and p adjusted value (padj) are indicated for each entry.

128
 ANNEXES

ANNEX 7

Annex Figure 7. DSEA of NSC34R cells, enriched drug classes. A-D) Connectivity scores (CS) of the PI3K (A), IGF1
(B), AKT (C), and HDAC (D) inhibitor compound sets in NSC34R1 and NSC34R2. The CS is represented by the colour
gradient, and the value indicated in each cell.

129
ANNEX 8

Annex Figure 8. Mice expressing (PR)97 present a lethal premature ageing phenotype; additional information. A)
Table indicating the levels and subcellular localisation of (PR) 97-HA-FLAG expression, as evaluated by HA
immunohistochemistry in different tissue sections in three representative animals. Expression levels are classed
as: ++++, very high; +++, high; ++, moderate; +, low; -, no expression. Subcellular localisation is indicated as: C,
cytoplasmic; N, nuclear; NO, nucleolar. B) Representative CT images of kyphosis in non-inducible PR+/+ and
inducible PRKI/KI littermates after 12 weeks’ treatment with doxycycline. The kyphotic angle was quantified
between the C1-T3-T9 vertebrae.

ANNEX 9

Annex Table 9. Enriched hallmarks in PRKI/+ mice, as analysed by GSEA. Last column indicates if the
hallmark appears enriched in the analysis of aged mouse livers from (White et al, 2015).

Aged
Enriched hallmarks NES P-value FDR Class
mice

Oxidative phosphorylation 1.673 0.000 0.153 Metabolic

MYC targets v1 1.607 0.000 0.153 Metabolic

UV response up 1.600 0.000 0.153 Stress

Xenobiotic metabolism 1.544 0.000 0.153 Y

DNA repair 1.535 0.000 0.153 Stress

WNT beta catenin signalling 1.511 0.000 0.153

Hypoxia 1.487 0.000 0.153 Stress Y

p53 pathway 1.457 0.000 0.153 Y

130
 ANNEXES

Heme metabolism 1.446 0.000 0.153

Glycolysis 1.432 0.000 0.153 Metabolic

E2F targets 1.422 0.000 0.153

Protein secretion 1.412 0.000 0.153

Peroxisome 1.404 0.000 0.177

Estrogen response late 1.386 0.000 0.195 Y

Unfolded protein response 1.380 0.000 0.192 Stress

Adipogenesis 1.368 0.000 0.190 Metabolic

Fatty acid metabolism 1.333 0.000 0.199 Metabolic Y

Estrogen response early 1.317 0.000 0.197 Y

TNFa signalling via NFkB 1.314 0.000 0.195 Inflammation Y

TGF beta signalling 1.311 0.000 0.192 Inflammation

Apoptosis 1.303 0.000 0.191 Stress Y

IL6 JAK STAT3 signalling 1.219 0.000 0.198 Inflammation

UV response down 1.209 0.000 0.196 Stress Y

Apical surface 1.202 0.247 0.203

K-RAS signalling down 1.196 0.000 0.220 Y

Coagulation 1.191 0.000 0.217

Myogenesis 1.190 0.000 0.215 Y

K-RAS signalling up 1.189 0.000 0.213 Y

Androgen response 1.179 0.000 0.218

Bile acid metabolism 1.174 0.000 0.215

Spermatogenesis 1.173 0.000 0.213

Inflammatory response 1.152 0.000 0.230 Inflammation Y

Apical junction 1.139 0.000 0.234

IL2 STAT5 signalling 1.127 0.000 0.232 Inflammation

PI3K AKT mTOR signalling 1.098 0.358 0.261 Metabolic

Pancreas beta cells 1.063 0.000 0.315

Angiogenesis 1.046 0.000 0.340

Complement 1.046 0.358 0.343

mTORC1 signalling 1.039 0.358 0.361 Metabolic

131
 MYC targets v2 0.996 0.303 0.406 Metabolic

Notch signalling 0.992 0.336 0.404

Hedgehog signalling 0.981 0.336 0.398

Mitotic spindle 0.940 0.358 0.409

Reactive oxygen species pathway 0.926 0.358 0.450 Stress

G2M checkpoint 0.908 0.679 0.457

Epithelial mesenchymal transition 0.892 0.694 0.455

Cholesterol homeostasis 0.855 0.694 0.494

132
REFERENCES

134
Abe, K., Itoyama, Y., Sobue, G., Tsuji, S., Aoki, M., Doyu, M., Hamada, C., Kondo, K., Yoneoka, T., Akimoto, M., Yoshino, H.,
Edaravone ALS Study Group, 2014. Confirmatory double-blind, parallel-group, placebo-controlled study of efficacy
and safety of edaravone (MCI-186) in amyotrophic lateral sclerosis patients. Amyotrophic lateral sclerosis &
frontotemporal degeneration 15, 610–7. https://doi.org/10.3109/21678421.2014.959024

Abo-Rady, M., Kalmbach, N., Pal, A., Schludi, C., Janosch, A., Richter, T., Freitag, P., Bickle, M., Kahlert, A.-K., Petri, S.,
Stefanov, S., Glass, H., Staege, S., Just, W., Bhatnagar, R., Edbauer, D., Hermann, A., Wegner, F., Sterneckert, J.L.,
2020. Knocking out C9ORF72 Exacerbates Axonal Trafficking Defects Associated with Hexanucleotide Repeat
Expansion and Reduces Levels of Heat Shock Proteins. Stem cell reports 14, 390–405.
https://doi.org/10.1016/j.stemcr.2020.01.010

Ahanger, I.A., Parray, Z.A., Nasreen, K., Ahmad, F., Hassan, Md.I., Islam, A., Sharma, A., 2021. Heparin Accelerates the
Protein Aggregation via the Downhill Polymerization Mechanism: Multi-Spectroscopic Studies to Delineate the
Implications on Proteinopathies. ACS Omega 6, 2328–2339. https://doi.org/10.1021/acsomega.0c05638

Ahmad, Y., Boisvert, F.-M., Gregor, P., Cobley, A., Lamond, A.I., 2009. NOPdb: Nucleolar Proteome Database--2008 update.
Nucleic acids research 37, D181-4. https://doi.org/10.1093/nar/gkn804

Aladesuyi Arogundade, O., Nguyen, S., Leung, R., Wainio, D., Rodriguez, M., Ravits, J., 2021. Nucleolar stress in C9orf72
and sporadic ALS spinal motor neurons precedes TDP-43 mislocalization. Acta Neuropathologica
Communications 9, 26. https://doi.org/10.1186/s40478-021-01125-6

Al-Chalabi, A., Hardiman, O., Kiernan, M.C., Chiò, A., Rix-Brooks, B., van den Berg, L.H., 2016. Amyotrophic lateral sclerosis:
moving towards a new classification system. The Lancet. Neurology 15, 1182–94. https://doi.org/10.1016/S1474-
4422(16)30199-5

Alupei, M.C., Maity, P., Esser, P.R., Krikki, I., Tuorto, F., Parlato, R., Penzo, M., Schelling, A., Laugel, V., Montanaro, L.,
Scharffetter-Kochanek, K., Iben, S., 2018. Loss of Proteostasis Is a Pathomechanism in Cockayne Syndrome. Cell
Reports 23, 1612–1619. https://doi.org/10.1016/J.CELREP.2018.04.041

Andrade, N.S., Ramic, M., Esanov, R., Liu, W., Rybin, M.J., Gaidosh, G., Abdallah, A., Del’Olio, S., Huff, T.C., Chee, N.T., Anatha,
S., Gendron, T.F., Wahlestedt, C., Zhang, Y., Benatar, M., Mueller, C., Zeier, Z., 2020. Dipeptide repeat proteins inhibit
homology-directed DNA double strand break repair in C9ORF72 ALS/FTD. Molecular neurodegeneration 15, 13.
https://doi.org/10.1186/s13024-020-00365-9

Anger, A.M., Armache, J.-P., Berninghausen, O., Habeck, M., Subklewe, M., Wilson, D.N., Beckmann, R., 2013. Structures
of the human and Drosophila 80S ribosome. Nature 497, 80–5. https://doi.org/10.1038/nature12104

Annunziata, I., van de Vlekkert, D., Wolf, E., Finkelstein, D., Neale, G., Machado, E., Mosca, R., Campos, Y., Tillman, H.,
Roussel, M.F., Andrew Weesner, J., Ellen Fremuth, L., Qiu, X., Han, M.-J., Grosveld, G.C., d’Azzo, A., 2019. MYC
competes with MiT/TFE in regulating lysosomal biogenesis and autophagy through an epigenetic rheostat. Nature
Communications 10, 3623. https://doi.org/10.1038/s41467-019-11568-0

Arabi, A., Wu, S., Ridderstråle, K., Bierhoff, H., Shiue, C., Fatyol, K., Fahlén, S., Hydbring, P., Söderberg, O., Grummt, I.,
Larsson, L.-G., Wright, A.P.H., 2005. c-Myc associates with ribosomal DNA and activates RNA polymerase I
transcription. Nature cell biology 7, 303–10. https://doi.org/10.1038/ncb1225

Arai, T., Hasegawa, M., Akiyama, H., Ikeda, K., Nonaka, T., Mori, H., Mann, D., Tsuchiya, K., Yoshida, M., Hashizume, Y., Oda,
T., 2006. TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration
and amyotrophic lateral sclerosis. Biochemical and biophysical research communications 351, 602–11.
https://doi.org/10.1016/j.bbrc.2006.10.093

Arenas, A., Chen, J., Kuang, L., Barnett, K.R., Kasarskis, E.J., Gal, J., Zhu, H., 2020. Lysine acetylation regulates the RNA
binding, subcellular localization and inclusion formation of FUS. Human molecular genetics 29, 2684–2697.
https://doi.org/10.1093/hmg/ddaa159

Armata, H.L., Garlick, D.S., Sluss, H.K., 2007. The ataxia telangiectasia-mutated target site Ser18 is required for p53-
mediated tumor suppression. Cancer research 67, 11696–703. https://doi.org/10.1158/0008-5472.CAN-07-1610

136
 REFERENCES

Arnold, E.S., Ling, S.-C., Huelga, S.C., Lagier-Tourenne, C., Polymenidou, M., Ditsworth, D., Kordasiewicz, H.B., McAlonis-
Downes, M., Platoshyn, O., Parone, P.A., da Cruz, S., Clutario, K.M., Swing, D., Tessarollo, L., Marsala, M., Shaw, C.E.,
Yeo, G.W., Cleveland, D.W., 2013. ALS-linked TDP-43 mutations produce aberrant RNA splicing and adult-onset
motor neuron disease without aggregation or loss of nuclear TDP-43. Proceedings of the National Academy of
Sciences of the United States of America 110, E736-45. https://doi.org/10.1073/pnas.1222809110

Ash, P.E.A., Bieniek, K.F., Gendron, T.F., Caulfield, T., Lin, W.-L., Dejesus-Hernandez, M., van Blitterswijk, M.M., Jansen-
West, K., Paul, J.W., Rademakers, R., Boylan, K.B., Dickson, D.W., Petrucelli, L., 2013. Unconventional translation of
C9ORF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77, 639–46.
https://doi.org/10.1016/j.neuron.2013.02.004

Aspesi, A., Ellis, S.R., 2019. Rare ribosomopathies: insights into mechanisms of cancer. Nature reviews. Cancer 19, 228–
238. https://doi.org/10.1038/s41568-019-0105-0

Aumiller, W.M., Keating, C.D., 2016. Phosphorylation-mediated RNA/peptide complex coacervation as a model for
intracellular liquid organelles. Nature chemistry 8, 129–37. https://doi.org/10.1038/nchem.2414

Avitabile, D., Bailey, B., Cottage, C.T., Sundararaman, B., Joyo, A., McGregor, M., Gude, N., Truffa, S., Zarrabi, A., Konstandin,
M., Khan, M., Mohsin, S., Völkers, M., Toko, H., Mason, M., Cheng, Z., Din, S., Alvarez, R., Fischer, K., Sussman, M.A.,
2011. Nucleolar stress is an early response to myocardial damage involving nucleolar proteins nucleostemin and
nucleophosmin. Proceedings of the National Academy of Sciences of the United States of America 108, 6145–50.
https://doi.org/10.1073/pnas.1017935108

Ayers, J.I., Cashman, N.R., 2018. Prion-like mechanisms in amyotrophic lateral sclerosis. Handbook of Clinical Neurology
153, 337–354. https://doi.org/10.1016/B978-0-444-63945-5.00018-0

Baborie, A., Griffiths, T.D., Jaros, E., Perry, R., McKeith, I.G., Burn, D.J., Masuda-Suzukake, M., Hasegawa, M., Rollinson, S.,
Pickering-Brown, S., Robinson, A.C., Davidson, Y.S., Mann, D.M.A., 2015. Accumulation of dipeptide repeat proteins
predates that of TDP-43 in frontotemporal lobar degeneration associated with hexanucleotide repeat expansions
in C9ORF72 gene. Neuropathology and Applied Neurobiology 41, 601–612. https://doi.org/10.1111/nan.12178

Báez-Becerra, C.T., Valencia-Rincón, E., Velásquez-Méndez, K., Ramírez-Suárez, N.J., Guevara, C., Sandoval-Hernandez,
A., Arboleda-Bustos, C.E., Olivos-Cisneros, L., Gutiérrez-Ospina, G., Arboleda, H., Arboleda, G., 2020. Nucleolar
disruption, activation of P53 and premature senescence in POLR3A-mutated Wiedemann-Rautenstrauch
syndrome fibroblasts. Mechanisms of Ageing and Development 192, 111360.
https://doi.org/10.1016/J.MAD.2020.111360

Balendra, R., Isaacs, A.M., 2018. C9orf72-mediated ALS and FTD: multiple pathways to disease. Nature Reviews
Neurology 14, 544–558. https://doi.org/10.1038/s41582-018-0047-2

Balhorn, R., 2007. The protamine family of sperm nuclear proteins. Genome biology 8, 227. https://doi.org/10.1186/gb-
2007-8-9-227

Banez-Coronel, M., Ranum, L.P.W., 2019. Repeat-associated non-AUG (RAN) translation: insights from pathology.
Laboratory Investigation 99, 929–942. https://doi.org/10.1038/s41374-019-0241-x

Barna, M., Pusic, A., Zollo, O., Costa, M., Kondrashov, N., Rego, E., Rao, P.H., Ruggero, D., 2008. Suppression of Myc
oncogenic activity by ribosomal protein haploinsufficiency. Nature 456, 971–975.
https://doi.org/10.1038/nature07449

Baßler, J., Hurt, E., 2019. Eukaryotic Ribosome Assembly. Annual review of biochemistry 88, 281–306.
https://doi.org/10.1146/annurev-biochem-013118-110817

Batulan, Z., Shinder, G.A., Minotti, S., He, B.P., Doroudchi, M.M., Nalbantoglu, J., Strong, M.J., Durham, H.D., 2003. High
threshold for induction of the stress response in motor neurons is associated with failure to activate HSF1. The
Journal of neuroscience : the official journal of the Society for Neuroscience 23, 5789–98.
https://doi.org/10.1523/JNEUROSCI.23-13-05789.2003

Beard, C., Hochedlinger, K., Plath, K., Wutz, A., Jaenisch, R., 2006. Efficient method to generate single-copy transgenic
mice by site-specific integration in embryonic stem cells. Genesis (New York, N.Y. : 2000) 44, 23–8.
https://doi.org/10.1002/gene.20180

137
Belzil, V. v, Bauer, P.O., Prudencio, M., Gendron, T.F., Stetler, C.T., Yan, I.K., Pregent, L., Daughrity, L., Baker, M.C.,
Rademakers, R., Boylan, K., Patel, T.C., Dickson, D.W., Petrucelli, L., 2013. Reduced C9orf72 gene expression in
c9FTD/ALS is caused by histone trimethylation, an epigenetic event detectable in blood. Acta neuropathologica
126, 895–905. https://doi.org/10.1007/s00401-013-1199-1

Bemiller, P.M., Lee, L.-H., 1978. Nucleolar changes in senescing WI-38 cells. Mechanisms of Ageing and Development 8,
417–427. https://doi.org/10.1016/0047-6374(78)90041-6

Ben-Shem, A., Jenner, L., Yusupova, G., Yusupov, M., 2010. Crystal structure of the eukaryotic ribosome. Science (New
York, N.Y.) 330, 1203–9. https://doi.org/10.1126/science.1194294

Berry, J., Weber, S.C., Vaidya, N., Haataja, M., Brangwynne, C.P., 2015. RNA transcription modulates phase transition-
driven nuclear body assembly. Proceedings of the National Academy of Sciences of the United States of America
112, E5237-45. https://doi.org/10.1073/pnas.1509317112

Beugnet, A., Tee, A.R., Taylor, P.M., Proud, C.G., 2003. Regulation of targets of mTOR (mammalian target of rapamycin)
signalling by intracellular amino acid availability. The Biochemical journal 372, 555–66.
https://doi.org/10.1042/BJ20021266

Bhadury, J., Nilsson, L.M., Muralidharan, S.V., Green, L.C., Li, Z., Gesner, E.M., Hansen, H.C., Keller, U.B., McLure, K.G.,
Nilsson, J.A., 2014. BET and HDAC inhibitors induce similar genes and biological effects and synergize to kill in
Myc-induced murine lymphoma. Proceedings of the National Academy of Sciences of the United States of America
111, E2721-30. https://doi.org/10.1073/pnas.1406722111

Bhat, K.P., Itahana, K., Jin, A., Zhang, Y., 2004. Essential role of ribosomal protein L11 in mediating growth inhibition-
induced p53 activation. The EMBO journal 23, 2402–12. https://doi.org/10.1038/sj.emboj.7600247

Bjedov, I., Rallis, C., 2020. The Target of Rapamycin Signalling Pathway in Ageing and Lifespan Regulation. Genes 11,
1043. https://doi.org/10.3390/genes11091043

Bobkova, N. v, Evgen’ev, M., Garbuz, D.G., Kulikov, A.M., Morozov, A., Samokhin, A., Velmeshev, D., Medvinskaya, N.,
Nesterova, I., Pollock, A., Nudler, E., 2015. Exogenous Hsp70 delays senescence and improves cognitive function
in aging mice. Proceedings of the National Academy of Sciences of the United States of America 112, 16006–11.
https://doi.org/10.1073/pnas.1516131112

Boeynaems, S., Alberti, S., Fawzi, N.L., Mittag, T., Polymenidou, M., Rousseau, F., Schymkowitz, J., Shorter, J., Wolozin, B. ,
van den Bosch, L., Tompa, P., Fuxreiter, M., 2018. Protein Phase Separation: A New Phase in Cell Biology 28, 420–
435.

Boeynaems, S., Bogaert, E., Kovacs, D., Konijnenberg, A., Timmerman, E., Volkov, A., Guharoy, M., de Decker, M., Jaspers,
T., Ryan, V.H., Janke, A.M., Baatsen, P., Vercruysse, T., Kolaitis, R.-M., Daelemans, D., Taylor, J.P., Kedersha, N.,
Anderson, P., Impens, F., Sobott, F., Schymkowitz, J., Rousseau, F., Fawzi, N.L., Robberecht, W., van Damme, P.,
Tompa, P., van den Bosch, L., 2017. Phase Separation of C9orf72 Dipeptide Repeats Perturbs Stress Granule
Dynamics. Molecular Cell 65, 1044-1055.e5. https://doi.org/10.1016/J.MOLCEL.2017.02.013

Boeynaems, S., Holehouse, A.S., Weinhardt, V., Kovacs, D., van Lindt, J., Larabell, C., van den Bosch, L., Das, R., Tompa,
P.S., Pappu, R. v, Gitler, A.D., 2019. Spontaneous driving forces give rise to protein-RNA condensates with coexisting
phases and complex material properties. Proceedings of the National Academy of Sciences of the United States
of America 116, 7889–7898. https://doi.org/10.1073/pnas.1821038116

Boisvert, F.-M., van Koningsbruggen, S., Navascués, J., Lamond, A.I., 2007. The multifunctional nucleolus. Nature Reviews
Molecular Cell Biology 8, 574–585. https://doi.org/10.1038/nrm2184

Bonavia, R., Bajetto, A., Barbero, S., Albini, A., Noonan, D.M., Schettini, G., 2001. HIV-1 Tat causes apoptotic death and
calcium homeostasis alterations in rat neurons. Biochemical and biophysical research communications 288, 301–
8. https://doi.org/10.1006/bbrc.2001.5743

Boon, K., Caron, H.N., van Asperen, R., Valentijn, L., Hermus, M.C., van Sluis, P., Roobeek, I., Weis, I., Voûte, P.A., Schwab,
M., Versteeg, R., 2001. N-myc enhances the expression of a large set of genes functioning in ribosome biogenesis
and protein synthesis. The EMBO journal 20, 1383–93. https://doi.org/10.1093/emboj/20.6.1383

138
 REFERENCES

Borrelli, A., Tornesello, A.L., Tornesello, M.L., Buonaguro, F.M., 2018. Cell Penetrating Peptides as Molecular Carriers for
Anti-Cancer Agents. Molecules (Basel, Switzerland) 23. https://doi.org/10.3390/molecules23020295

Bø, T.H., Dysvik, B., Jonassen, I., 2004. LSimpute: accurate estimation of missing values in microarray data with least
squares methods. Nucleic acids research 32, e34. https://doi.org/10.1093/nar/gnh026

Bradley, W.G., Borenstein, A.R., Nelson, L.M., Codd, G.A., Rosen, B.H., Stommel, E.W., Cox, P.A., 2013. Is exposure to
cyanobacteria an environmental risk factor for amyotrophic lateral sclerosis and other neurodegenerative
diseases? Amyotrophic lateral sclerosis & frontotemporal degeneration 14, 325–33.
https://doi.org/10.3109/21678421.2012.750364

Brangwynne, C.P., Mitchison, T.J., Hyman, A.A., 2011. Active liquid-like behavior of nucleoli determines their size and
shape in Xenopus laevis oocytes. Proceedings of the National Academy of Sciences of the United States of America
108, 4334–9. https://doi.org/10.1073/pnas.1017150108

Brehme, M., Voisine, C., Rolland, T., Wachi, S., Soper, J.H., Zhu, Y., Orton, K., Villella, A., Garza, D., Vidal, M., Ge, H., Morimoto,
R.I., 2014. A Chaperome Subnetwork Safeguards Proteostasis in Aging and Neurodegenerative Disease. Cell
Reports 9, 1135–1150. https://doi.org/10.1016/J.CELREP.2014.09.042

Brewer, L., Corzett, M., Lau, E.Y., Balhorn, R., 2003. Dynamics of protamine 1 binding to single DNA molecules. The Journal
of biological chemistry 278, 42403–8. https://doi.org/10.1074/jbc.M303610200

Buchwalter, A., Hetzer, M.W., 2017a. Nucleolar expansion and elevated protein translation in premature aging. Nature
Communications 8, 328. https://doi.org/10.1038/s41467-017-00322-z

Buchwalter, A., Hetzer, M.W., 2017b. Nucleolar expansion and elevated protein translation in premature aging. Nature
Communications 8, 328. https://doi.org/10.1038/s41467-017-00322-z

Burberry, A., Suzuki, N., Wang, J.-Y., Moccia, R., Mordes, D.A., Stewart, M.H., Suzuki-Uematsu, S., Ghosh, S., Singh, A.,
Merkle, F.T., Koszka, K., Li, Q.-Z., Zon, L., Rossi, D.J., Trowbridge, J.J., Notarangelo, L.D., Eggan, K., 2016. Loss-of-
function mutations in the C9ORF72 mouse ortholog cause fatal autoimmune disease. Science translational
medicine 8, 347ra93. https://doi.org/10.1126/scitranslmed.aaf6038

Burger, K., Mühl, B., Harasim, T., Rohrmoser, M., Malamoussi, A., Orban, M., Kellner, M., Gruber-Eber, A., Kremmer, E.,
Hölzel, M., Eick, D., 2010. Chemotherapeutic drugs inhibit ribosome biogenesis at various levels. The Journal of
biological chemistry 285, 12416–25. https://doi.org/10.1074/jbc.M109.074211

Bursać, S., Brdovčak, M.C., Pfannkuchen, M., Orsolić, I., Golomb, L., Zhu, Y., Katz, C., Daftuar, L., Grabušić, K., Vukelić, I.,
Filić, V., Oren, M., Prives, C., Volarevic, S., 2012. Mutual protection of ribosomal proteins L5 and L11 from
degradation is essential for p53 activation upon ribosomal biogenesis stress. Proceedings of the National Academy
of Sciences of the United States of America 109, 20467–72. https://doi.org/10.1073/pnas.1218535109

Buttgereit, F., Brand, M.D., 1995. A hierarchy of ATP-consuming processes in mammalian cells. The Biochemical journal
312 ( Pt 1), 163–7. https://doi.org/10.1042/bj3120163

Bywater, M.J., Poortinga, G., Sanij, E., Hein, N., Peck, A., Cullinane, C., Wall, M., Cluse, L., Drygin, D., Anderes, K., Hus er, N.,
Proffitt, C., Bliesath, J., Haddach, M., Schwaebe, M.K., Ryckman, D.M., Rice, W.G., Schmitt, C., Lowe, S.W., Johnstone,
R.W., Pearson, R.B., McArthur, G.A., Hannan, R.D., 2012. Inhibition of RNA Polymerase I as a Therapeutic Strategy
to Promote Cancer-Specific Activation of p53. Cancer Cell 22, 51–65. https://doi.org/10.1016/J.CCR.2012.05.019

Caccamo, A., Majumder, S., Deng, J.J., Bai, Y., Thornton, F.B., Oddo, S., 2009. Rapamycin Rescues TDP-43 Mislocalization
and the Associated Low Molecular Mass Neurofilament Instability. Journal of Biological Chemistry 284, 27416–
27424. https://doi.org/10.1074/JBC.M109.031278

Campbell, K.J., White, R.J., 2014. MYC regulation of cell growth through control of transcription by RNA polymerases I
and III. Cold Spring Harbor perspectives in medicine 4. https://doi.org/10.1101/cshperspect.a018408

Castello, A., Horos, R., Strein, C., Fischer, B., Eichelbaum, K., Steinmetz, L.M., Krijgsveld, J., Hentze, M.W., 2013. System-
wide identification of RNA-binding proteins by interactome capture. Nature protocols 8, 491–500.
https://doi.org/10.1038/nprot.2013.020

139
Chadi, G., Maximino, J.R., Jorge, F.M. de H., Borba, F.C. de, Gilio, J.M., Callegaro, D., Lopes, C.G., Santos, S.N. dos, Rebelo,
G.N.S., 2017. Genetic analysis of patients with familial and sporadic amyotrophic lateral sclerosis in a Brazilian
Research Center. Amyotrophic lateral sclerosis & frontotemporal degeneration 18, 249–255.
https://doi.org/10.1080/21678421.2016.1254245

Chai, N., Gitler, A.D., 2018. Yeast screen for modifiers of C9orf72 poly(glycine-arginine) dipeptide repeat toxicity. FEMS
Yeast Research 18. https://doi.org/10.1093/femsyr/foy024

Chan, P.K., Aldrich, M., Busch, H., 1985. Alterations in immunolocalization of the phosphoprotein B23 in HeLa cells during
serum starvation. Experimental cell research 161, 101–10. https://doi.org/10.1016/0014-4827(85)90494-x

Chan, P.K., Aldrich, M.B., Yung, B.Y., 1987. Nucleolar protein B23 translocation after doxorubicin treatment in murine
tumor cells. Cancer research 47, 3798–801.

Chan, P.K., Bloom, D.A., Hoang, T.T., 1999. The N-terminal half of NPM dissociates from nucleoli of HeLa cells after
anticancer drug treatments. Biochemical and biophysical research communications 264, 305–9.
https://doi.org/10.1006/bbrc.1999.1255

Chan, P.K., Chan, F.Y., 1999. A study of correlation between NPM-translocation and apoptosis in cells induced by
daunomycin. Biochemical pharmacology 57, 1265–73. https://doi.org/10.1016/s0006-2952(99)00043-x

Chauvin, C., Koka, V., Nouschi, A., Mieulet, V., Hoareau-Aveilla, C., Dreazen, A., Cagnard, N., Carpentier, W., Kiss, T.,
Meyuhas, O., Pende, M., 2014. Ribosomal protein S6 kinase activity controls the ribosome biogenesis
transcriptional program. Oncogene 33, 474–483. https://doi.org/10.1038/onc.2012.606

Chen, C., Liu, Yu, Liu, Yang, Zheng, P., 2009. mTOR regulation and therapeutic rejuvenation of aging hematopoietic stem
cells. Science signaling 2, ra75. https://doi.org/10.1126/scisignal.2000559

Chen, D., Zhang, Z., Li, M., Wang, W., Li, Y., Rayburn, E.R., Hill, D.L., Wang, H., Zhang, R., 2007. Ribosomal protein S7 as a
novel modulator of p53-MDM2 interaction: binding to MDM2, stabilization of p53 protein, and activation of p53
function. Oncogene 26, 5029–37. https://doi.org/10.1038/sj.onc.1210327

Cheng, C.-W., Lin, M.-J., Shen, C.-K.J., 2015. Rapamycin alleviates pathogenesis of a new Drosophila model of ALS-TDP.
Journal of neurogenetics 29, 59–68. https://doi.org/10.3109/01677063.2015.1077832

Cheng, Z., Brar, G.A., 2019. Global translation inhibition yields condition-dependent de-repression of ribosome biogenesis
mRNAs. Nucleic Acids Research 47, 5061–5073. https://doi.org/10.1093/nar/gkz231

Chen, H.-J., Mitchell, J.C., Novoselov, S., Miller, J., Nishimura, A.L., Scotter, E.L., Vance, C.A., Cheetham, M.E., Shaw, C.E.,
2016. The heat shock response plays an important role in TDP-43 clearance: evidence for dysfunction in
amyotrophic lateral sclerosis. Brain : a journal of neurology 139, 1417–32. https://doi.org/10.1093/brain/aww028

Chen-Plotkin, A.S., Lee, V.M.-Y., Trojanowski, J.Q., 2010. TAR DNA-binding protein 43 in neurodegenerative disease.
Nature reviews. Neurology 6, 211–20. https://doi.org/10.1038/nrneurol.2010.18

Chew, J., Cook, C., Gendron, T.F., Jansen-West, K., del Rosso, G., Daughrity, L.M., Castanedes-Casey, M., Kurti, A.,
Stankowski, J.N., Disney, M.D., Rothstein, J.D., Dickson, D.W., Fryer, J.D., Zhang, Y.-J., Petrucelli, L., 2019. Aberrant
deposition of stress granule-resident proteins linked to C9orf72-associated TDP-43 proteinopathy. Molecular
neurodegeneration 14, 9. https://doi.org/10.1186/s13024-019-0310-z

Chiò, A., Logroscino, G., Hardiman, O., Swingler, R., Mitchell, D., Beghi, E., Traynor, B.G., Eurals Consortium, 2009.
Prognostic factors in ALS: A critical review. Amyotrophic lateral sclerosis : official publication of the World
Federation of Neurology Research Group on Motor Neuron Diseases 10, 310–23.
https://doi.org/10.3109/17482960802566824

Chiò, A., Mazzini, L., Mora, G., 2020. Disease-modifying therapies in amyotrophic lateral sclerosis. Neuropharmacology
167, 107986. https://doi.org/10.1016/j.neuropharm.2020.107986

Chu, J., Hong, N.A., Masuda, C.A., Jenkins, B. v, Nelms, K.A., Goodnow, C.C., Glynne, R.J., Wu, H., Masliah, E., Joazeiro,
C.A.P., Kay, S.A., 2009. A mouse forward genetics screen identifies LISTERIN as an E3 ubiquitin ligase involved in

140
 REFERENCES

neurodegeneration. Proceedings of the National Academy of Sciences of the United States of America 106, 2097–
103. https://doi.org/10.1073/pnas.0812819106

Coller, H.A., Grandori, C., Tamayo, P., Colbert, T., Lander, E.S., Eisenman, R.N., Golub, T.R., 2000. Expression analysis with
oligonucleotide microarrays reveals that MYC regulates genes involved in growth, cell cycle, signaling, and
adhesion. Proceedings of the National Academy of Sciences of the United States of America 97, 3260–5.
https://doi.org/10.1073/pnas.97.7.3260

Colombo, E., Marine, J.-C., Danovi, D., Falini, B., Pelicci, P.G., 2002. Nucleophosmin regulates the stability and
transcriptional activity of p53. Nature cell biology 4, 529–33. https://doi.org/10.1038/ncb814

Cook, C.N., Wu, Y., Odeh, H.M., Gendron, T.F., Jansen-West, K., del Rosso, G., Yue, M., Jiang, P., Gomes, E., Tong, J.,
Daughrity, L.M., Avendano, N.M., Castanedes-Casey, M., Shao, W., Oskarsson, B., Tomassy, G.S., McCampbell, A.,
Rigo, F., Dickson, D.W., Shorter, J., Zhang, Y.-J., Petrucelli, L., 2020. C9orf72 poly(GR) aggregation induces TDP-43
proteinopathy. Science Translational Medicine 12. https://doi.org/10.1126/scitranslmed.abb3774

Cooper-Knock, J., Bury, J.J., Heath, P.R., Wyles, M., Higginbottom, A., Gelsthorpe, C., Highley, J.R., Hautbergue, G., Rattray,
M., Kirby, J., Shaw, P.J., 2015. C9ORF72 GGGGCC Expanded Repeats Produce Splicing Dysregulation which
Correlates with Disease Severity in Amyotrophic Lateral Sclerosis. PloS one 10, e0127376.
https://doi.org/10.1371/journal.pone.0127376

Cooper, T.A., Wan, L., Dreyfuss, G., 2009. RNA and Disease. Cell 136, 777–793.
https://doi.org/10.1016/J.CELL.2009.02.011

Copolovici, D.M., Langel, K., Eriste, E., Langel, Ü., 2014. Cell-penetrating peptides: design, synthesis, and applications. ACS
nano 8, 1972–94. https://doi.org/10.1021/nn4057269

Corbo, M., Hays, A.P., 1992. Peripherin and neurofilament protein coexist in spinal spheroids of motor neuron disease.
Journal of neuropathology and experimental neurology 51, 531–7. https://doi.org/10.1097/00005072-199209000-
00008

Corcia, P., Tauber, C., Vercoullie, J., Arlicot, N., Prunier, C., Praline, J., Nicolas, G., Venel, Y., Hommet, C., Baulieu, J.-L.,
Cottier, J.-P., Roussel, C., Kassiou, M., Guilloteau, D., Ribeiro, M.-J., 2012. Molecular imaging of microglial activation
in amyotrophic lateral sclerosis. PloS one 7, e52941. https://doi.org/10.1371/journal.pone.0052941

Cox, L.E., Ferraiuolo, L., Goodall, E.F., Heath, P.R., Higginbottom, A., Mortiboys, H., Hollinger, H.C., Hartley, J.A., Brockington,
A., Burness, C.E., Morrison, K.E., Wharton, S.B., Grierson, A.J., Ince, P.G., Kirby, J., Shaw, P.J., 2010. Mutations in
CHMP2B in lower motor neuron predominant amyotrophic lateral sclerosis (ALS). PloS one 5, e9872.
https://doi.org/10.1371/journal.pone.0009872

Cunha, B.A., 2000. Minocycline versus Doxycycline in the Treatment of Lyme Neuroborreliosis. Clinical Infectious
Diseases 30, 237–238. https://doi.org/10.1086/313604

Curran, S.P., Ruvkun, G., 2007. Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability. PLoS
Genetics 3, e56. https://doi.org/10.1371/journal.pgen.0030056

Dai, M.-S., Sears, R., Lu, H., 2007. Feedback regulation of c-Myc by ribosomal protein L11. Cell cycle (Georgetown, Tex.)
6, 2735–41. https://doi.org/10.4161/cc.6.22.4895

Dai, M.-S., Zeng, S.X., Jin, Y., Sun, X.-X., David, L., Lu, H., 2004. Ribosomal protein L23 activates p53 by inhibiting MDM2
function in response to ribosomal perturbation but not to translation inhibition. Molecular and cellular biology 24,
7654–68. https://doi.org/10.1128/MCB.24.17.7654-7668.2004

D’Aquila, P., Montesanto, A., Mandalà, M., Garasto, S., Mari, V., Corsonello, A., Bellizzi, D., Passarino, G., 2017. Methylat ion
of the ribosomal RNA gene promoter is associated with aging and age-related decline. Aging cell 16, 966–975.
https://doi.org/10.1111/acel.12603

David-Pfeuty, T., 1999. Potent inhibitors of cyclin-dependent kinase 2 induce nuclear accumulation of wild-type p53 and
nucleolar fragmentation in human untransformed and tumor-derived cells. Oncogene 18, 7409–22.
https://doi.org/10.1038/sj.onc.1203103

141
Davidson, Y., Robinson, A.C., Liu, X., Wu, D., Troakes, C., Rollinson, S., Masuda-Suzukake, M., Suzuki, G., Nonaka, T., Shi, J.,
Tian, J., Hamdalla, H., Ealing, J., Richardson, A., Jones, M., Pickering-Brown, S., Snowden, J.S., Hasegawa, M., Mann,
D.M.A., 2016. Neurodegeneration in frontotemporal lobar degeneration and motor neurone disease associated with
expansions in C9orf72 is linked to TDP-43 pathology and not associated with aggregated forms of dipeptide repeat
proteins. Neuropathology and applied neurobiology 42, 242–54. https://doi.org/10.1111/nan.12292

Davidson, Y.S., Barker, H., Robinson, A.C., Thompson, J.C., Harris, J., Troakes, C., Smith, B., Al-Saraj, S., Shaw, C., Rollinson,
S., Masuda-Suzukake, M., Hasegawa, M., Pickering-Brown, S., Snowden, J.S., Mann, D.M., 2014. Brain distribution
of dipeptide repeat proteins in frontotemporal lobar degeneration and motor neurone disease associated with
expansions in C9ORF72. Acta neuropathologica communications 2, 70. https://doi.org/10.1186/2051-5960-2-70

DeJesus-Hernandez, M., Mackenzie, I.R., Boeve, B.F., Boxer, A.L., Baker, M., Rutherford, N.J., Nicholson, A.M., Finch, N.A.,
Flynn, H., Adamson, J., Kouri, N., Wojtas, A., Sengdy, P., Hsiung, G.-Y.R., Karydas, A., Seeley, W.W., Josephs, K.A.,
Coppola, G., Geschwind, D.H., Wszolek, Z.K., Feldman, H., Knopman, D.S., Petersen, R.C., Miller, B.L., Dickson, D.W.,
Boylan, K.B., Graff-Radford, N.R., Rademakers, R., 2011. Expanded GGGGCC Hexanucleotide Repeat in Noncoding
Region of C9ORF72 Causes Chromosome 9p-Linked FTD and ALS. Neuron 72, 245–256.
https://doi.org/10.1016/J.NEURON.2011.09.011

Demontis, F., Patel, V.K., Swindell, W.R., Perrimon, N., 2014. Intertissue control of the nucleolus via a myokine-dependent
longevity pathway. Cell reports 7, 1481–1494. https://doi.org/10.1016/j.celrep.2014.05.001

Deng, H., Zhai, H., Bigio, E., Yan, J., Fecto, F., Ajroud, K., Mishra, M., Ajroud-Driss, S., Heller, S., Sufit, R., Siddique, N.,
Mugnaini, E., Siddique, T., 2010. FUS-immunoreactive inclusions are a common feature in sporadic and non-SOD1
familial amyotrophic lateral sclerosis. Annals of neurology 67. https://doi.org/10.1002/ANA.22051

DeRouchey, J., Hoover, B., Rau, D.C., 2013. A comparison of DNA compaction by arginine and lysine peptides: A physical
basis for arginine rich protamines. Biochemistry 52, 3000. https://doi.org/10.1021/BI4001408

Desnoyers, S., Kaufmann, S.H., Poirier, G.G., 1996. Alteration of the nucleolar localization of poly(ADP-ribose) polymerase
upon treatment with transcription inhibitors. Experimental cell research 227, 146–53.
https://doi.org/10.1006/excr.1996.0259

Donati, G., Peddigari, S., Mercer, C.A., Thomas, G., 2013. 5S ribosomal RNA is an essential component of a nascent
ribosomal precursor complex that regulates the Hdm2-p53 checkpoint. Cell reports 4, 87–98.
https://doi.org/10.1016/j.celrep.2013.05.045

Doron‐Mandel, E., Koppel, I., Abraham, O., Rishal, I., Smith, T.P., Buchanan, C.N., Sahoo, P.K., Kadlec, J., Oses‐Prieto, J.A.,
Kawaguchi, R., Alber, S., Zahavi, E.E., di Matteo, P., di Pizio, A., Song, D., Okladnikov, N., Gordon, D., Ben‐Dor, S.,
Haffner‐Krausz, R., Coppola, G., Burlingame, A.L., Jungwirth, P., Twiss, J.L., Fainzilber, M., 2021. The glycine
arginine‐rich domain of the RNA‐binding protein nucleolin regulates its subcellular localization. The EMBO Journal
40, e107158. https://doi.org/10.15252/embj.2020107158

Drummond, D.A., Wilke, C.O., 2008. Mistranslation-induced protein misfolding as a dominant constraint on coding-
sequence evolution. Cell 134, 341–52. https://doi.org/10.1016/j.cell.2008.05.042

Duangmano, S., Sae-Lim, P., Suksamrarn, A., Domann, F.E., Patmasiriwat, P., 2012. Cucurbitacin B inhibits human breast
cancer cell proliferation through disruption of microtubule polymerization and nucleophosmin/B23 translocation.
BMC complementary and alternative medicine 12, 185. https://doi.org/10.1186/1472-6882-12-185

Duan, L., Zaepfel, B.L., Aksenova, V., Dasso, M., Rothstein, J.D., Kalab, P., Hayes, L.R., 2021. Nuclear RNA binding regulates
TDP-43 nuclear localization and passive nuclear export. bioRxiv. https://doi.org/10.1101/2021.08.24.457459

Duncan, F.E., Jasti, S., Paulson, A., Kelsh, J.M., Fegley, B., Gerton, J.L., 2017. Age-associated dysregulation of protein
metabolism in the mammalian oocyte. Aging Cell 16, 1381–1393. https://doi.org/10.1111/acel.12676

Ecker, J., Thatikonda, V., Sigismondo, G., Selt, F., Valinciute, G., Oehme, I., Müller, C., Buhl, J.L., Ridinger, J., Usta, D ., Qin,
N., van Tilburg, C.M., Herold-Mende, C., Remke, M., Sahm, F., Westermann, F., Kool, M., Wechsler-Reya, R.J., Chavez,
L., Krijgsveld, J., Jäger, N., Pfister, S.M., Witt, O., Milde, T., 2021. Reduced chromatin binding of MYC is a key effect
of HDAC inhibition in MYC amplified medulloblastoma. Neuro-Oncology 23, 226–239.
https://doi.org/10.1093/neuonc/noaa191

142
 REFERENCES

Elamin, M., Bede, P., Byrne, S., Jordan, N., Gallagher, L., Wynne, B., O’Brien, C., Phukan, J., Lynch, C., Pender, N., Hardiman,
O., 2013. Cognitive changes predict functional decline in ALS: a population-based longitudinal study. Neurology 80,
1590–7. https://doi.org/10.1212/WNL.0b013e31828f18ac

Elkon, R., Loayza‐Puch, F., Korkmaz, G., Lopes, R., Breugel, P.C., Bleijerveld, O.B., Altelaar, A.M., Wolf, E., Lorenzin, F., Eilers,
M., Agami, R., 2015. Myc coordinates transcription and translation to enhance transformation and suppress
invasiveness. EMBO reports 16, 1723–1736. https://doi.org/10.15252/embr.201540717

Emi, N., Kidoaki, S., Yoshikawa, K., Saito, H., 1997. Gene transfer mediated by polyarginine requires a formation of big
carrier-complex of DNA aggregate. Biochemical and biophysical research communications 231, 421–4.
https://doi.org/10.1006/bbrc.1997.6125

Estes, P.S., Boehringer, A., Zwick, R., Tang, J.E., Grigsby, B., Zarnescu, D.C., 2011. Wild-type and A315T mutant TDP-43
exert differential neurotoxicity in a Drosophila model of ALS. Human molecular genetics 20, 2308–21.
https://doi.org/10.1093/hmg/ddr124

Farg, M.A., Konopka, A., Soo, K.Y., Ito, D., Atkin, J.D., 2017. The DNA damage response (DDR) is induced by the C9orf72
repeat expansion in amyotrophic lateral sclerosis. Human Molecular Genetics 26, 2882–2896.
https://doi.org/10.1093/hmg/ddx170

Farhan, S.M.K., Howrigan, D.P., Abbott, L.E., Klim, J.R., Topp, S.D., Byrnes, A.E., Churchhouse, C., Phatnani, H., Smith, B.N.,
Rampersaud, E., Wu, G., Wuu, J., Shatunov, A., Iacoangeli, A., al Khleifat, A., Mordes, D.A., Ghosh, S., Eggan, K.,
Rademakers, R., McCauley, J.L., Schüle, R., Züchner, S., Benatar, M., Taylor, J.P., Nalls, M., Gotkine, M., Shaw, P.J.,
Morrison, K.E., Al-Chalabi, A., Traynor, B., Shaw, C.E., Goldstein, D.B., Harms, M.B., Daly, M.J., Neale, B.M., 2019.
Exome sequencing in amyotrophic lateral sclerosis implicates a novel gene, DNAJC7, encoding a heat-shock
protein. Nature Neuroscience 22, 1966–1974. https://doi.org/10.1038/s41593-019-0530-0

Fawell, S., Seery, J., Daikh, Y., Moore, C., Chen, L.L., Pepinsky, B., Barsoum, J., 1994. Tat-mediated delivery of heterologous
proteins into cells. Proceedings of the National Academy of Sciences of the United States of America 91, 664–8.
https://doi.org/10.1073/pnas.91.2.664

Fazal, R., Boeynaems, S., Swijsen, A., de Decker, M., Fumagalli, L., Moisse, M., Vanneste, J., Guo, W., Boon, R., Vercruysse,
T., Eggermont, K., Swinnen, B., Beckers, J., Pakravan, D., Vandoorne, T., vanden Berghe, P., Verfaillie, C., van den
Bosch, L., van Damme, P., 2021. HDAC6 inhibition restores TDP-43 pathology and axonal transport defects in
human motor neurons with TARDBP mutations. The EMBO journal 40, e106177.
https://doi.org/10.15252/embj.2020106177

Feric, M., Vaidya, N., Harmon, T.S., Mitrea, D.M., Zhu, L., Richardson, T.M., Kriwacki, R.W., Pappu, R. v., Brangwynne, C.P.,
2016. Coexisting Liquid Phases Underlie Nucleolar Subcompartments. Cell 165, 1686–1697.
https://doi.org/10.1016/J.CELL.2016.04.047

Fernández, Á.F., Sebti, S., Wei, Y., Zou, Z., Shi, M., McMillan, K.L., He, C., Ting, T., Liu, Y., Chiang, W. -C., Marciano, D.K.,
Schiattarella, G.G., Bhagat, G., Moe, O.W., Hu, M.C., Levine, B., 2018. Disruption of the beclin 1–BCL2 autophagy
regulatory complex promotes longevity in mice. Nature 558, 136–140. https://doi.org/10.1038/s41586-018-0162-
7

Figueiredo, V.C., McCarthy, J.J., 2019. Regulation of Ribosome Biogenesis in Skeletal Muscle Hypertrophy. Physiology
(Bethesda, Md.) 34, 30–42. https://doi.org/10.1152/physiol.00034.2018

Filer, D., Thompson, M.A., Takhaveev, V., Dobson, A.J., Kotronaki, I., Green, J.W.M., Heinemann, M., Tullet, J.M.A., Alic, N. ,
2017. RNA polymerase III limits longevity downstream of TORC1. Nature 552, 263–267.
https://doi.org/10.1038/nature25007

Filippini, T., Fiore, M., Tesauro, M., Malagoli, C., Consonni, M., Violi, F., Arcolin, E., Iacuzio, L., Oliveri Conti, G., Cristaldi, A.,
Zuccarello, P., Zucchi, E., Mazzini, L., Pisano, F., Gagliardi, I., Patti, F., Mandrioli, J., Ferrante, M., Vinceti, M., 2020.
Clinical and Lifestyle Factors and Risk of Amyotrophic Lateral Sclerosis: A Population-Based Case-Control Study.
International journal of environmental research and public health 17. https://doi.org/10.3390/ijerph17030857

Finch, R.A., Revankar, G.R., Chan, P.K., 1997. Structural and functional relationships of toyocamycin on NPM-
translocation. Anti-Cancer Drug Design 12.

143
Frank, D.J., Roth, M.B., 1998. ncl-1 is required for the regulation of cell size and ribosomal RNA synthesis in Caenorhabditis
elegans. The Journal of cell biology 140, 1321–9. https://doi.org/10.1083/jcb.140.6.1321

Frankel, A.D., Pabo, C.O., 1988. Cellular uptake of the tat protein from human immunodeficiency virus. Cell 55, 1189–93.
https://doi.org/10.1016/0092-8674(88)90263-2

Fratta, P., Mizielinska, S., Nicoll, A.J., Zloh, M., Fisher, E.M.C., Parkinson, G., Isaacs, A.M., 2012. C9orf72 hexanucleotid e
repeat associated with amyotrophic lateral sclerosis and frontotemporal dementia forms RNA G-quadruplexes.
Scientific Reports 2, 1016. https://doi.org/10.1038/srep01016

Fredriksson, A., Ballesteros, M., Dukan, S., Nyström, T., 2005. Defense against protein carbonylation by DnaK/DnaJ and
proteases of the heat shock regulon. Journal of bacteriology 187, 4207–13.
https://doi.org/10.1128/JB.187.12.4207-4213.2005

Freibaum, B.D., Lu, Y., Lopez-Gonzalez, R., Kim, N.C., Almeida, S., Lee, K.-H., Badders, N., Valentine, M., Miller, B.L., Wong,
P.C., Petrucelli, L., Kim, H.J., Gao, F.-B., Taylor, J.P., 2015. GGGGCC repeat expansion in C9orf72 compromises
nucleocytoplasmic transport. Nature 525, 129–133. https://doi.org/10.1038/nature14974

Frottin, F., Schueder, F., Tiwary, S., Gupta, R., Körner, R., Schlichthaerle, T., Cox, J., Jungmann, R., Hartl, F.U., Hipp, M.S.,
2019. The nucleolus functions as a phase-separated protein quality control compartment. Science 365, 342–347.
https://doi.org/10.1126/science.aaw9157

Fujita, Y., Okamoto, K., 2005. Golgi apparatus of the motor neurons in patients with amyotrophic lateral sclerosis and in
mice models of amyotrophic lateral sclerosis. Neuropathology : official journal of the Japanese Society of
Neuropathology 25, 388–94. https://doi.org/10.1111/j.1440-1789.2005.00616.x

Fumagalli, L., Young, F.L., Boeynaems, S., de Decker, M., Mehta, A.R., Swijsen, A., Fazal, R., Guo, W., Moisse, M., Beckers,
J., Dedeene, L., Selvaraj, B.T., Vandoorne, T., Madan, V., van Blitterswijk, M., Raitcheva, D., McCampbell, A., Poesen,
K., Gitler, A.D., Koch, P., Berghe, P. vanden, Thal, D.R., Verfaillie, C., Chandran, S., van den Bosch, L., Bullock, S.L., van
Damme, P., 2021. C9orf72-derived arginine-containing dipeptide repeats associate with axonal transport
machinery and impede microtubule-based motility. Science advances 7. https://doi.org/10.1126/sciadv.abg3013

Fumagalli, S., Ivanenkov, V. v, Teng, T., Thomas, G., 2012. Suprainduction of p53 by disruption of 40S and 60S ribosome
biogenesis leads to the activation of a novel G2/M checkpoint. Genes & development 26, 1028–40.
https://doi.org/10.1101/gad.189951.112

Gami, P., Murray, C., Schottlaender, L., Bettencourt, C., de Pablo Fernandez, E., Mudanohwo, E., Mizielinska, S., Polke, J.M. ,
Holton, J.L., Isaacs, A.M., Houlden, H., Revesz, T., Lashley, T., 2015. A 30-unit hexanucleotide repeat expansion in
C9orf72 induces pathological lesions with dipeptide-repeat proteins and RNA foci, but not TDP-43 inclusions and
clinical disease. Acta Neuropathologica 130, 599–601. https://doi.org/10.1007/s00401-015-1473-5

Gems, D., Partridge, L., 2013. Genetics of longevity in model organisms: debates and paradigm shifts. Annual review of
physiology 75, 621–44. https://doi.org/10.1146/annurev-physiol-030212-183712

Gendron, T.F., Bieniek, K.F., Zhang, Y.-J., Jansen-West, K., Ash, P.E.A., Caulfield, T., Daughrity, L., Dunmore, J.H.,
Castanedes-Casey, M., Chew, J., Cosio, D.M., van Blitterswijk, M., Lee, W.C., Rademakers, R., Boylan, K.B., Dickson,
D.W., Petrucelli, L., 2013. Antisense transcripts of the expanded C9ORF72 hexanucleotide repeat form nuclear RNA
foci and undergo repeat-associated non-ATG translation in c9FTD/ALS. Acta neuropathologica 126, 829–44.
https://doi.org/10.1007/s00401-013-1192-8

Gendron, T.F., van Blitterswijk, M., Bieniek, K.F., Daughrity, L.M., Jiang, J., Rush, B.K., Pedraza, O., Lucas, J.A., Murray, M.E.,
Desaro, P., Robertson, A., Overstreet, K., Thomas, C.S., Crook, J.E., Castanedes-Casey, M., Rousseau, L., Josephs,
K.A., Parisi, J.E., Knopman, D.S., Petersen, R.C., Boeve, B.F., Graff-Radford, N.R., Rademakers, R., Lagier-Tourenne,
C., Edbauer, D., Cleveland, D.W., Dickson, D.W., Petrucelli, L., Boylan, K.B., 2015. Cerebellar c9RAN proteins associate
with clinical and neuropathological characteristics of C9ORF72 repeat expansion carriers. Acta neuropathologica
130, 559–73. https://doi.org/10.1007/s00401-015-1474-4

Geuskens, M., Bernhard, W., 1966. Ultrastructural cytochemistry of the nucleolus. 3. The effect of actinomycin D on the
metabolism of nucleolar RNA. Experimental cell research 44, 579–98. https://doi.org/10.1016/0014-
4827(66)90462-9

144
 REFERENCES

Gidalevitz, T., Ben-Zvi, A., Ho, K.H., Brignull, H.R., Morimoto, R.I., 2006. Progressive disruption of cellular protein folding in
models of polyglutamine diseases. Science (New York, N.Y.) 311, 1471–4.
https://doi.org/10.1126/science.1124514

Gidalevitz, T., Krupinski, T., Garcia, S., Morimoto, R.I., 2009. Destabilizing protein polymorphisms in the genetic
background direct phenotypic expression of mutant SOD1 toxicity. PLoS genetics 5, e1000399.
https://doi.org/10.1371/journal.pgen.1000399

Gifondorwa, D.J., Robinson, M.B., Hayes, C.D., Taylor, A.R., Prevette, D.M., Oppenheim, R.W., Caress, J., Milligan, C.E., 2007.
Exogenous delivery of heat shock protein 70 increases lifespan in a mouse model of amyotrophic lateral sclerosis.
The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 13173–80.
https://doi.org/10.1523/JNEUROSCI.4057-07.2007

Gijselinck, I., van Langenhove, T., van der Zee, J., Sleegers, K., Philtjens, S., Kleinberger, G., Janssens, J., Bettens, K., van
Cauwenberghe, C., Pereson, S., Engelborghs, S., Sieben, A., de Jonghe, P., Vandenberghe, R., Santens, P., de
Bleecker, J., Maes, G., Bäumer, V., Dillen, L., Joris, G., Cuijt, I., Corsmit, E., Elinck, E., van Dongen, J., Vermeulen, S.,
van den Broeck, M., Vaerenberg, C., Mattheijssens, M., Peeters, K., Robberecht, W., Cras, P., Martin, J.-J., de Deyn,
P.P., Cruts, M., van Broeckhoven, C., 2012. A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort with
disorders of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis spectrum: a gene identification
study. The Lancet. Neurology 11, 54–65. https://doi.org/10.1016/S1474-4422(11)70261-7

Gill, A.L., Wang, M.Z., Levine, B., Premasiri, A., Vieira, F.G., 2019. Primary Neurons and Differentiated NSC-34 Cells Are
More Susceptible to Arginine-Rich ALS Dipeptide Repeat Protein-Associated Toxicity than Non-Differentiated NSC-
34 and CHO Cells. International journal of molecular sciences 20. https://doi.org/10.3390/ijms20246238

Gill, T., Wang, H., Bandaru, R., Lawlor, M., Lu, C., Nieman, L.T., Tao, J., Zhang, Y., Anderson, D.G., Ting, D.T., Chen, X.,
Bradner, J.E., Ott, C.J., 2021. Selective targeting of MYC mRNA by stabilized antisense oligonucleotides. Oncogene
40, 6527–6539. https://doi.org/10.1038/s41388-021-02053-4

Girard, J.P., Lehtonen, H., Caizergues-Ferrer, M., Amalric, F., Tollervey, D., Lapeyre, B., 1992. GAR1 is an essential small
nucleolar RNP protein required for pre-rRNA processing in yeast. The EMBO journal 11, 673–82.

Gitcho, M.A., Baloh, R.H., Chakraverty, S., Mayo, K., Norton, J.B., Levitch, D., Hatanpaa, K.J., White, C.L., Bigio, E.H., Ca selli,
R., Baker, M., Al-Lozi, M.T., Morris, J.C., Pestronk, A., Rademakers, R., Goate, A.M., Cairns, N.J., 2008. TDP-43 A315T
mutation in familial motor neuron disease. Annals of neurology 63, 535–8. https://doi.org/10.1002/ana.21344

Gomez-Deza, J., Lee, Y.-B., Troakes, C., Nolan, M., Al-Sarraj, S., Gallo, J.-M., Shaw, C.E., 2015. Dipeptide repeat protein
inclusions are rare in the spinal cord and almost absent from motor neurons in C9ORF72 mutant amyotrophic
lateral sclerosis and are unlikely to cause their degeneration. Acta neuropathologica communications 3, 38.
https://doi.org/10.1186/s40478-015-0218-y

Gomez-Roman, N., Grandori, C., Eisenman, R.N., White, R.J., 2003. Direct activation of RNA polymerase III transcription
by c-Myc. Nature 421, 290–4. https://doi.org/10.1038/nature01327

Gonatas, N.K., Stieber, A., Mourelatos, Z., Chen, Y., Gonatas, J.O., Appel, S.H., Hays, A.P., Hickey, W.F., Hauw, J.J., 1992.
Fragmentation of the Golgi apparatus of motor neurons in amyotrophic lateral sclerosis. The American journal of
pathology 140, 731–7.

Goudarzi, K.M., Nistér, M., Lindström, M.S., 2014. mTOR inhibitors blunt the p53 response to nucleolar stress by regulating
RPL11 and MDM2 levels. Cancer biology & therapy 15, 1499–514. https://doi.org/10.4161/15384047.2014.955743

Granatiero, V., Sayles, N.M., Savino, A.M., Konrad, C., Kharas, M.G., Kawamata, H., Manfredi, G., 2021. Modulation of the
IGF1R-MTOR pathway attenuates motor neuron toxicity of human ALS SOD1G93A astrocytes. Autophagy 17,
4029–4042. https://doi.org/10.1080/15548627.2021.1899682

Grandori, C., Gomez-Roman, N., Felton-Edkins, Z.A., Ngouenet, C., Galloway, D.A., Eisenman, R.N., White, R.J., 2005. c-Myc
binds to human ribosomal DNA and stimulates transcription of rRNA genes by RNA polymerase I. Nature cell
biology 7, 311–8. https://doi.org/10.1038/ncb1224

145
Green, M., Loewenstein, P.M., 1988. Autonomous functional domains of chemically synthesized human
immunodeficiency virus tat trans-activator protein. Cell 55, 1179–88. https://doi.org/10.1016/0092-
8674(88)90262-0

Grese, Z.R., Bastos, A.C., Mamede, L.D., French, R.L., Miller, T.M., Ayala, Y.M., 2021. Specific RNA interactions promote
TDP-43 multivalent phase separation and maintain liquid properties. EMBO reports 22, e53632.
https://doi.org/10.15252/embr.202153632

Grewal, S.S., Li, L., Orian, A., Eisenman, R.N., Edgar, B.A., 2005. Myc-dependent regulation of ribosomal RNA synthesis
during Drosophila development. Nature cell biology 7, 295–302. https://doi.org/10.1038/ncb1223

Grieb, B.C., Boyd, K., Mitra, R., Eischen, C.M., 2016. Haploinsufficiency of the Myc regulator Mtbp extends survival and
delays tumor development in aging mice. Aging 8, 2590–2602. https://doi.org/10.18632/aging.101092

Haeusler, A.R., Donnelly, C.J., Periz, G., Simko, E.A.J.J., Shaw, P.G., Kim, M.-S.S., Maragakis, N.J., Troncoso, J.C., Pandey,
A., Sattler, R., Rothstein, J.D., Wang, J., 2014. C9orf72 nucleotide repeat structures initiate molecular cascades of
disease. Nature 507, 195–200. https://doi.org/10.1038/nature13124

Han, H., Jain, A.D., Truica, M.I., Izquierdo-Ferrer, J., Anker, J.F., Lysy, B., Sagar, V., Luan, Y., Chalmers, Z.R., Unno, K., Mok,
H., Vatapalli, R., Yoo, Y.A., Rodriguez, Y., Kandela, I., Parker, J.B., Chakravarti, D., Mishra, R.K., Schiltz, G.E., Abdulkadir,
S.A., 2019. Small-Molecule MYC Inhibitors Suppress Tumor Growth and Enhance Immunotherapy. Cancer Cell 36,
483-497.e15. https://doi.org/10.1016/J.CCELL.2019.10.001

Hannan, K.M., Brandenburger, Y., Jenkins, A., Sharkey, K., Cavanaugh, A., Rothblum, L., Moss, T., Poortinga, G., McArthur,
G.A., Pearson, R.B., Hannan, R.D., 2003. mTOR-dependent regulation of ribosomal gene transcription requires S6K1
and is mediated by phosphorylation of the carboxy-terminal activation domain of the nucleolar transcription factor
UBF. Molecular and cellular biology 23, 8862–77. https://doi.org/10.1128/MCB.23.23.8862-8877.2003

Hansen, M., Taubert, S., Crawford, D., Libina, N., Lee, S.-J., Kenyon, C., 2007. Lifespan extension by conditions that inhibit
translation in Caenorhabditis elegans. Aging Cell 6, 95–110. https://doi.org/10.1111/j.1474-9726.2006.00267.x

Hao, Z., Liu, L., Tao, Z., Wang, R., Ren, H., Sun, H., Lin, Z., Zhang, Z., Mu, C., Zhou, J., Wang, G., 2019. Motor dysfunction
and neurodegeneration in a C9orf72 mouse line expressing poly-PR. Nature Communications 10, 2906.
https://doi.org/10.1038/s41467-019-10956-w

Hardiman, O., Al-Chalabi, A., Chio, A., Corr, E.M., Logroscino, G., Robberecht, W., Shaw, P.J., Simmons, Z., van den Berg,
L.H., 2017. Amyotrophic lateral sclerosis. Nature Reviews Disease Primers 3, 17071.
https://doi.org/10.1038/nrdp.2017.71

Harrison, A.F., Shorter, J., 2017. RNA-binding proteins with prion-like domains in health and disease. The Biochemical
journal 474, 1417–1438. https://doi.org/10.1042/BCJ20160499

Hartmann, H., Hornburg, D., Czuppa, M., Bader, J., Michaelsen, M., Farny, D., Arzberger, T., Mann, M., Meissner, F., Edbauer,
D., 2018. Proteomics and C9orf72 neuropathology identify ribosomes as poly-GR/PR interactors driving toxicity.
Life science alliance 1, e201800070. https://doi.org/10.26508/lsa.201800070

Hart, S.N., Cui, Y., Klaassen, C.D., Zhong, X., 2009. Three patterns of cytochrome P450 gene expression during liver
maturation in mice. Drug metabolism and disposition: the biological fate of chemicals 37, 116–21.
https://doi.org/10.1124/dmd.108.023812

Haughey, N.J., Nath, A., Mattson, M.P., Slevin, J.T., Geiger, J.D., 2001. HIV-1 Tat through phosphorylation of NMDA
receptors potentiates glutamate excitotoxicity. Journal of neurochemistry 78, 457–67.
https://doi.org/10.1046/j.1471-4159.2001.00396.x

Hayashi, Y., Homma, K., Ichijo, H., 2016. SOD1 in neurotoxicity and its controversial roles in SOD1 mutation-negative ALS.
Advances in biological regulation 60, 95–104. https://doi.org/10.1016/j.jbior.2015.10.006

Hayes, L.R., Duan, L., Bowen, K., Kalab, P., Rothstein, J.D., 2020. C9orf72 arginine-rich dipeptide repeat proteins disrupt
karyopherin-mediated nuclear import. eLife 9. https://doi.org/10.7554/eLife.51685

146
 REFERENCES

He, H., Ye, J., Liu, E., Liang, Q., Liu, Q., Yang, V.C., 2014. Low molecular weight protamine (LMWP): a nontoxic protamine
substitute and an effective cell-penetrating peptide. Journal of controlled release : official journal of the Controlled
Release Society 193, 63–73. https://doi.org/10.1016/j.jconrel.2014.05.056

Heissenberger, C., Liendl, L., Nagelreiter, F., Gonskikh, Y., Yang, G., Stelzer, E.M., Krammer, T.L., Micutkova, L., Vogt, S.,
Kreil, D.P., Sekot, G., Siena, E., Poser, I., Harreither, E., Linder, A., Ehret, V., Helbich, T.H., Grillari-Voglauer, R., Jansen-
Dürr, P., Koš, M., Polacek, N., Grillari, J., Schosserer, M., 2019. Loss of the ribosomal RNA methyltransferase NSUN5
impairs global protein synthesis and normal growth. Nucleic acids research 47, 11807–11825.
https://doi.org/10.1093/nar/gkz1043

Henras, A.K., Plisson-Chastang, C., O’Donohue, M.-F., Chakraborty, A., Gleizes, P.-E., 2015. An overview of pre-ribosomal
RNA processing in eukaryotes. Wiley interdisciplinary reviews. RNA 6, 225–42. https://doi.org/10.1002/wrna.1269

Hernandez-Verdun, D., Roussel, P., Thiry, M., Sirri, V., Lafontaine, D.L.J., 2010. The nucleolus: structure/function
relationship in RNA metabolism. Wiley Interdisciplinary Reviews: RNA 1, 415–431. https://doi.org/10.1002/wrna.39

Herrmann, D., Parlato, R., 2018. C9orf72-associated neurodegeneration in ALS-FTD: breaking new ground in ribosomal
RNA and nucleolar dysfunction. Cell and tissue research 373, 351–360. https://doi.org/10.1007/s00441-018-2806-
1

Herskovits, A.Z., Hunter, T.A., Maxwell, N., Pereira, K., Whittaker, C.A., Valdez, G., Guarente, L.P., 2018. SIRT1 deacetylase
in aging-induced neuromuscular degeneration and amyotrophic lateral sclerosis. Aging cell 17, e12839.
https://doi.org/10.1111/acel.12839

Herter, E.K., Stauch, M., Gallant, M., Wolf, E., Raabe, T., Gallant, P., 2015. snoRNAs are a novel class of biologically relevant
Myc targets. BMC biology 13, 25. https://doi.org/10.1186/s12915-015-0132-6

Hill, S.J., Mordes, D.A., Cameron, L.A., Neuberg, D.S., Landini, S., Eggan, K., Livingston, D.M., 2016. Two familial ALS
proteins function in prevention/repair of transcription-associated DNA damage. Proceedings of the National
Academy of Sciences of the United States of America 113, E7701–E7709.
https://doi.org/10.1073/pnas.1611673113

Hirano, A., Nakano, I., Kurland, L.T., Mulder, D.W., Holley, P.W., Saccomanno, G., 1984. Fine structural study of
neurofibrillary changes in a family with amyotrophic lateral sclerosis. Journal of neuropathology and experimental
neurology 43, 471–80. https://doi.org/10.1097/00005072-198409000-00002

Hofmann, J.W., Zhao, X., de Cecco, M., Peterson, A.L., Pagliaroli, L., Manivannan, J., Hubbard, G.B., Ikeno, Y., Zhang, Y.,
Feng, B., Li, X., Serre, T., Qi, W., van Remmen, H., Miller, R.A., Bath, K.G., de Cabo, R., Xu, H., Neretti, N., Sedivy, J.M. ,
2015. Reduced expression of MYC increases longevity and enhances healthspan. Cell 160, 477–88.
https://doi.org/10.1016/j.cell.2014.12.016

Holland, M.L., Lowe, R., Caton, P.W., Gemma, C., Carbajosa, G., Danson, A.F., Carpenter, A.A.M., Loche, E., Ozanne, S.E.,
Rakyan, V.K., 2016. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.
Science (New York, N.Y.) 353, 495–8. https://doi.org/10.1126/science.aaf7040

Horn, H.F., Vousden, K.H., 2008. Cooperation between the ribosomal proteins L5 and L11 in the p53 pathway. Oncogene
27, 5774–84. https://doi.org/10.1038/onc.2008.189

Ho, R., Sances, S., Gowing, G., Amoroso, M.W., O’Rourke, J.G., Sahabian, A., Wichterle, H., Baloh, R.H., Sareen, D., Svendsen,
C.N., 2016. ALS disrupts spinal motor neuron maturation and aging pathways within gene co-expression networks.
Nature Neuroscience 19, 1256–1267. https://doi.org/10.1038/nn.4345

Ho, R., Workman, M.J., Mathkar, P., Wu, K., Kim, K.J., O’Rourke, J.G., Kellogg, M., Montel, V., Banuelos, M.G., Arogundade,
O.A., Diaz-Garcia, S., Oheb, D., Huang, S., Khrebtukova, I., Watson, L., Ravits, J., Taylor, K., Baloh, R.H., Svendsen,
C.N., 2021. Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early
and Convergent Transcriptomic Disease Signatures. Cell Systems 12, 159-175.e9.
https://doi.org/10.1016/J.CELS.2020.10.010

Hsu, A.-L., Murphy, C.T., Kenyon, C., 2003. Regulation of aging and age-related disease by DAF-16 and heat-shock factor.
Science (New York, N.Y.) 300, 1142–5. https://doi.org/10.1126/science.1083701

147
Hughes, C.S., Moggridge, S., Müller, T., Sorensen, P.H., Morin, G.B., Krijgsveld, J., 2019. Single-pot, solid-phase-enhanced
sample preparation for proteomics experiments. Nature protocols 14, 68–85. https://doi.org/10.1038/s41596-
018-0082-x

Hutten, S., Usluer, S., Bourgeois, B., Simonetti, F., Odeh, H.M., Fare, C.M., Czuppa, M., Hruska-Plochan, M., Hofweber, M.,
Polymenidou, M., Shorter, J., Edbauer, D., Madl, T., Dormann, D., 2020. Nuclear Import Receptors Directly Bind to
Arginine-Rich Dipeptide Repeat Proteins and Suppress Their Pathological Interactions. Cell Reports 33, 108538.
https://doi.org/10.1016/J.CELREP.2020.108538

Iadevaia, V., Zhang, Z., Jan, E., Proud, C.G., 2012. mTOR signaling regulates the processing of pre-rRNA in human cells.
Nucleic acids research 40, 2527–39. https://doi.org/10.1093/nar/gkr1040

Inoki, K., Li, Y., Zhu, T., Wu, J., Guan, K.-L., 2002. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR
signalling. Nature cell biology 4, 648–57. https://doi.org/10.1038/ncb839

Iritani, B.M., Eisenman, R.N., 1999. c-Myc enhances protein synthesis and cell size during B lymphocyte development.
Proceedings of the National Academy of Sciences of the United States of America 96, 13180–5.
https://doi.org/10.1073/pnas.96.23.13180

Jay, A.M., Conway, R.L., Thiffault, I., Saunders, C., Farrow, E., Adams, J., Toriello, H. v, 2016. Neonatal progeriod syndrome
associated with biallelic truncating variants in POLR3A. American journal of medical genetics. Part A 170, 3343–
3346. https://doi.org/10.1002/ajmg.a.37960

Jiang, J., Zhu, Q., Gendron, T.F., Saberi, S., McAlonis-Downes, M., Seelman, A., Stauffer, J.E., Jafar-nejad, P., Drenner, K.,
Schulte, D., Chun, S., Sun, S., Ling, S.-C.C., Myers, B., Engelhardt, J., Katz, M., Baughn, M., Platoshyn, O., Marsala, M.,
Watt, A., Heyser, C.J., Ard, M. ?Colin C., de Muynck, L., Daughrity, L.M., Swing, D.A., Tessarollo, L., Jung, C.J., Delpoux,
A., Utzschneider, D.T., Hedrick, S.M., de Jong, P.J., Edbauer, D., van Damme, P., Petrucelli, L., Shaw, C.E., Bennett,
C. ?Frank F., da Cruz, S., Ravits, J., Rigo, F., Cleveland, D.W., Lagier-Tourenne, C., De?Muynck, L., Daughrity, L.M.,
Swing, D.A., Tessarollo, L., Jung, C.J., Delpoux, A., Utzschneider, D.T., Hedrick, S.M., de?Jong, P., Edbauer, D.,
Van?Damme, P., Petrucelli, L., Shaw, C.E., Bennett, C. ?Frank F., Da?Cruz, S., Ravits, J., Rigo, F., Cleveland, D.W.,
Lagier-Tourenne, C., 2016. Gain of Toxicity from ALS/FTD-Linked Repeat Expansions in C9ORF72 Is Alleviated by
Antisense Oligonucleotides Targeting GGGGCC-Containing RNAs. Neuron 90, 535–550.
https://doi.org/10.1016/j.neuron.2016.04.006

Jih, K.-Y., Tsai, P.-C., Tsai, Y.-S., Liao, Y.-C., Lee, Y.-C., 2020. Rapid progressive ALS in a patient with a DNAJC7 loss-of-
function mutation. Neurology. Genetics 6, e503. https://doi.org/10.1212/NXG.0000000000000503

Ji, H., Wu, G., Zhan, X., Nolan, A., Koh, C., de Marzo, A., Doan, H.M., Fan, J., Cheadle, C., Fallahi, M., Cleveland, J.L., Dang, C.
v, Zeller, K.I., 2011. Cell-type independent MYC target genes reveal a primordial signature involved in biomass
accumulation. PloS one 6, e26057. https://doi.org/10.1371/journal.pone.0026057

Joazeiro, C.A.P., 2019. Mechanisms and functions of ribosome-associated protein quality control. Nature reviews.
Molecular cell biology 20, 368–383. https://doi.org/10.1038/s41580-019-0118-2

Johnson, J.O., Mandrioli, J., Benatar, M., Abramzon, Y., van Deerlin, V.M., Trojanowski, J.Q., Gibbs, J.R., Brunetti, M.,
Gronka, S., Wuu, J., Ding, J., McCluskey, L., Martinez-Lage, M., Falcone, D., Hernandez, D.G., Arepalli, S., Chong, S.,
Schymick, J.C., Rothstein, J., Landi, F., Wang, Y.-D., Calvo, A., Mora, G., Sabatelli, M., Monsurrò, M.R., Battistini, S.,
Salvi, F., Spataro, R., Sola, P., Borghero, G., Galassi, G., Scholz, S.W., Taylor, J.P., Restagno, G., Chiò, A., Traynor, B.J.,
2010. Exome Sequencing Reveals VCP Mutations as a Cause of Familial ALS. Neuron 68, 857–864.
https://doi.org/10.1016/J.NEURON.2010.11.036

Johnson, J.O., Pioro, E.P., Boehringer, A., Chia, R., Feit, H., Renton, A.E., Pliner, H.A., Abramzon, Y., Marangi, G., Winborn,
B.J., Gibbs, J.R., Nalls, M.A., Morgan, S., Shoai, M., Hardy, J., Pittman, A., Orrell, R.W., Malaspina, A., Sidle, K.C., Fratta,
P., Harms, M.B., Baloh, R.H., Pestronk, A., Weihl, C.C., Rogaeva, E., Zinman, L., Drory, V.E., Borghero, G., Mora, G. ,
Calvo, A., Rothstein, J.D., ITALSGEN, D., Drepper, C., Sendtner, M., Singleton, A.B., Taylor, J.P., Cookson, M.R.,
Restagno, G., Sabatelli, M., Bowser, R., Chiò, A., Traynor, B.J., 2014. Mutations in the Matrin 3 gene cause familial
amyotrophic lateral sclerosis. Nature neuroscience 17, 664–666. https://doi.org/10.1038/nn.3688

Johnson, S.C., Rabinovitch, P.S., Kaeberlein, M., 2013. mTOR is a key modulator of ageing and age-related disease. Nature
493, 338–45. https://doi.org/10.1038/nature11861

148
 REFERENCES

Johnston, L.A., Prober, D.A., Edgar, B.A., Eisenman, R.N., Gallant, P., 1999. Drosophila myc regulates cellular growth during
development. Cell 98, 779–90. https://doi.org/10.1016/s0092-8674(00)81512-3

Jones, S.W., Christison, R., Bundell, K., Voyce, C.J., Brockbank, S.M. v, Newham, P., Lindsay, M.A., 2005. Characterisation
of cell-penetrating peptide-mediated peptide delivery. British journal of pharmacology 145, 1093–102.
https://doi.org/10.1038/sj.bjp.0706279

Jovičić, A., Mertens, J., Boeynaems, S., Bogaert, E., Chai, N., Yamada, S.B., Paul, J.W., Sun, S., Herdy, J.R., Bieri, G., Kramer,
N.J., Gage, F.H., van den Bosch, L., Robberecht, W., Gitler, A.D., 2015. Modifiers of C9orf72 dipeptide repeat toxicity
connect nucleocytoplasmic transport defects to FTD/ALS. Nature neuroscience 18, 1226–9.
https://doi.org/10.1038/nn.4085

Julian, T.H., Glascow, N., Barry, A.D.F., Moll, T., Harvey, C., Klimentidis, Y.C., Newell, M., Zhang, S., Snyder, M.P., Cooper-
Knock, J., Shaw, P.J., 2021. Physical exercise is a risk factor for amyotrophic lateral sclerosis: Convergent evidence
from Mendelian randomisation, transcriptomics and risk genotypes. EBioMedicine 68, 103397.
https://doi.org/10.1016/j.ebiom.2021.103397

Jung, M., Jin, S.-G., Zhang, X., Xiong, W., Gogoshin, G., Rodin, A.S., Pfeifer, G.P., 2015. Longitudinal epigenetic and gene
expression profiles analyzed by three-component analysis reveal down-regulation of genes involved in protein
translation in human aging. Nucleic acids research 43, e100. https://doi.org/10.1093/nar/gkv473

Junnila, R.K., List, E.O., Berryman, D.E., Murrey, J.W., Kopchick, J.J., 2013. The GH/IGF-1 axis in ageing and longevity.
Nature reviews. Endocrinology 9, 366–376. https://doi.org/10.1038/nrendo.2013.67

Kabashi, E., Valdmanis, P.N., Dion, P., Spiegelman, D., McConkey, B.J., vande Velde, C., Bouchard, J.-P., Lacomblez, L.,
Pochigaeva, K., Salachas, F., Pradat, P.-F., Camu, W., Meininger, V., Dupre, N., Rouleau, G.A., 2008. TARDBP
mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nature genetics 40, 572–4.
https://doi.org/10.1038/ng.132

Kaeberlein, M., Powers, R.W., Steffen, K.K., Westman, E.A., Hu, D., Dang, N., Kerr, E.O., Kirkland, K.T., Fields, S., Kennedy,
B.K., 2005. Regulation of yeast replicative life span by TOR and Sch9 in response to nutrients. Science (New York,
N.Y.) 310, 1193–6. https://doi.org/10.1126/science.1115535

Kalkat, M., Resetca, D., Lourenco, C., Chan, P.-K., Wei, Y., Shiah, Y.-J., Vitkin, N., Tong, Y., Sunnerhagen, M., Done, S.J.,
Boutros, P.C., Raught, B., Penn, L.Z., 2018. MYC Protein Interactome Profiling Reveals Functionally Distinct Regions
that Cooperate to Drive Tumorigenesis. Molecular cell 72, 836-848.e7.
https://doi.org/10.1016/j.molcel.2018.09.031

Kalmar, B., Greensmith, L., 2017. Cellular Chaperones As Therapeutic Targets in ALS to Restore Protein Homeostasis and
Improve Cellular Function. Frontiers in Molecular Neuroscience 10, 251.
https://doi.org/10.3389/fnmol.2017.00251

Kampen, K.R., Sulima, S.O., Vereecke, S., De Keersmaecker, K., 2020. Hallmarks of ribosomopathies. Nucleic Acids
Research 48, 1013–1028. https://doi.org/10.1093/nar/gkz637

Kanekura, K., Yagi, T., Cammack, A.J., Mahadevan, J., Kuroda, M., Harms, M.B., Miller, T.M., Urano, F., 2016. Poly-
dipeptides encoded by the C9ORF72 repeats block global protein translation. Human Molecular Genetics 25, 1803–
1813. https://doi.org/10.1093/hmg/ddw052

Kang, S.H., Li, Y., Fukaya, M., Lorenzini, I., Cleveland, D.W., Ostrow, L.W., Rothstein, J.D., Bergles, D.E., 2013. Degenerat ion
and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis. Nature neuroscience
16, 571–9. https://doi.org/10.1038/nn.3357

Kapahi, P., Zid, B.M., Harper, T., Koslover, D., Sapin, V., Benzer, S., 2004. Regulation of lifespan in Drosophila by modulation
of genes in the TOR signaling pathway. Current biology : CB 14, 885–90. https://doi.org/10.1016/j.cub.2004.03.059

Kasselimi, E., Pefani, D.-E., Taraviras, S., Lygerou, Z., 2022. Ribosomal DNA and the nucleolus at the heart of aging. Trends
in biochemical sciences 0. https://doi.org/10.1016/j.tibs.2021.12.007

Kaushik, S., Tasset, I., Arias, E., Pampliega, O., Wong, E., Martinez-Vicente, M., Cuervo, A.M., 2021. Autophagy and the
hallmarks of aging. Ageing research reviews 72, 101468. https://doi.org/10.1016/j.arr.2021.101468

149
Kerkhoff, E., Houben, R., Löffler, S., Troppmair, J., Lee, J.E., Rapp, U.R., 1998. Regulation of c-myc expression by Ras/Raf
signalling. Oncogene 16, 211–6. https://doi.org/10.1038/sj.onc.1201520

Khosravi, B., LaClair, K.D., Riemenschneider, H., Zhou, Q., Frottin, F., Mareljic, N., Czuppa, M., Farny, D., Hartmann, H.,
Michaelsen, M., Arzberger, T., Hartl, F.U., Hipp, M.S., Edbauer, D., 2020. Cell‐to‐cell transmission of C9orf72 poly‐
(Gly‐Ala) triggers key features of ALS / FTD. The EMBO Journal 39, e102811.
https://doi.org/10.15252/embj.2019102811

Kierszenbaum, A.L., Tres, L.L., 1975. Structural and transcriptional features of the mouse spermatid genome. The Journal
of cell biology 65, 258–70. https://doi.org/10.1083/jcb.65.2.258

Kim, H.J., Kim, N.C., Wang, Y.-D., Scarborough, E.A., Moore, J., Diaz, Z., MacLea, K.S., Freibaum, B., Li, S., Molliex, A.,
Kanagaraj, A.P., Carter, R., Boylan, K.B., Wojtas, A.M., Rademakers, R., Pinkus, J.L., Greenberg, S.A., Trojanowski,
J.Q., Traynor, B.J., Smith, B.N., Topp, S., Gkazi, A.-S., Miller, J., Shaw, C.E., Kottlors, M., Kirschner, J., Pestronk, A., Li,
Y.R., Ford, A.F., Gitler, A.D., Benatar, M., King, O.D., Kimonis, V.E., Ross, E.D., Weihl, C.C., Shorter, J., Taylor, J.P., 2013.
Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS. Nature
495, 467–73. https://doi.org/10.1038/nature11922

Kim, J.-Y., Seok, K.-O., Kim, Y.-J., Bae, W.K., Lee, S., Park, J.-H., 2011. Involvement of GLTSCR2 in the DNA Damage
Response. The American journal of pathology 179, 1257–64. https://doi.org/10.1016/j.ajpath.2011.05.041

Kim, S., Li, Q., Dang, C. v, Lee, L.A., 2000. Induction of ribosomal genes and hepatocyte hypertrophy by adenovirus-
mediated expression of c-Myc in vivo. Proceedings of the National Academy of Sciences of the United States of
America 97, 11198–202. https://doi.org/10.1073/pnas.200372597

Kim, Y.-I., Bandyopadhyay, J., Cho, I., Lee, J., Park, D.H., Cho, J.H., 2014. Nucleolar GTPase NOG-1 regulates development,
fat storage, and longevity through insulin/IGF signaling in C. elegans. Molecules and cells 37, 51–7.
https://doi.org/10.14348/molcells.2014.2251

King, J.E., Eugenin, E.A., Buckner, C.M., Berman, J.W., 2006. HIV tat and neurotoxicity. Microbes and infection 8, 1347–
57. https://doi.org/10.1016/j.micinf.2005.11.014

Komine, O., Yamanaka, K., 2015. Neuroinflammation in motor neuron disease. Nagoya journal of medical science 77,
537–49.

Konrad, C., Kawamata, H., Bredvik, K.G., Arreguin, A.J., Cajamarca, S.A., Hupf, J.C., Ravits, J.M., Miller, T.M., Maragakis,
N.J., Hales, C.M., Glass, J.D., Gross, S., Mitsumoto, H., Manfredi, G., 2017. Fibroblast bioenergetics to classify
amyotrophic lateral sclerosis patients. Molecular Neurodegeneration 12, 76. https://doi.org/10.1186/s13024-017-
0217-5

Koppers, M., Blokhuis, A.M., Westeneng, H.-J., Terpstra, M.L., Zundel, C.A.C., Vieira de Sá, R., Schellevis, R.D., Waite, A.J.,
Blake, D.J., Veldink, J.H., van den Berg, L.H., Pasterkamp, R.J., 2015. C9orf72 ablation in mice does not cause motor
neuron degeneration or motor deficits. Annals of neurology 78, 426–38. https://doi.org/10.1002/ana.24453

Korotkevich, G., Sukhov, V., Sergushichev, A., 2019. Fast gene set enrichment analysis. bioRxiv 060012.
https://doi.org/10.1101/060012

Kramer, N.J., Haney, M.S., Morgens, D.W., Jovičić, A., Couthouis, J., Li, A., Ousey, J., Ma, R., Bieri, G., Tsui, C.K., Shi, Y.,
Hertz, N.T., Tessier-Lavigne, M., Ichida, J.K., Bassik, M.C., Gitler, A.D., 2018. CRISPR–Cas9 screens in human cells
and primary neurons identify modifiers of C9ORF72 dipeptide-repeat-protein toxicity. Nature Genetics 50, 603–
612. https://doi.org/10.1038/s41588-018-0070-7

Kurki, S., Peltonen, K., Latonen, L., Kiviharju, T.M., Ojala, P.M., Meek, D., Laiho, M., 2004. Nucleolar protein NPM interacts
with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer cell 5, 465–75.
https://doi.org/10.1016/s1535-6108(04)00110-2

Kwiatkowski, T.J., Bosco, D.A., Leclerc, A.L., Tamrazian, E., Vanderburg, C.R., Russ, C., Davis, A., Gilchrist, J., Kasarskis,
E.J., Munsat, T., Valdmanis, P., Rouleau, G.A., Hosler, B.A., Cortelli, P., de Jong, P.J., Yoshinaga, Y., Haines, J.L.,
Pericak-Vance, M.A., Yan, J., Ticozzi, N., Siddique, T., McKenna-Yasek, D., Sapp, P.C., Horvitz, H.R., Landers, J.E.,
Brown, R.H., 2009. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis.
Science (New York, N.Y.) 323, 1205–8. https://doi.org/10.1126/science.1166066

150
 REFERENCES

Kwon, I., Xiang, S., Kato, M., Wu, L., Theodoropoulos, P., Wang, T., Kim, J., Yun, J., Xie, Y., McKnight, S.L., 2014. Poly-
dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells. Science (New York,
N.Y.) 345, 1139–45. https://doi.org/10.1126/science.1254917

Lafontaine, D.L.J., 2019. Birth of Nucleolar Compartments: Phase Separation-Driven Ribosomal RNA Sorting and
Processing. Molecular cell 76, 694–696. https://doi.org/10.1016/j.molcel.2019.11.015

Lafontaine, D.L.J., Riback, J.A., Bascetin, R., Brangwynne, C.P., 2021. The nucleolus as a multiphase liquid condensate.
Nature Reviews Molecular Cell Biology 22, 165–182. https://doi.org/10.1038/s41580-020-0272-6

Lan, J., Rollins, J.A., Zang, X., Wu, D., Zou, L., Wang, Z., Ye, C., Wu, Z., Kapahi, P., Rogers, A.N., Chen, D., 2019. Translational
Regulation of Non-autonomous Mitochondrial Stress Response Promotes Longevity. Cell reports 28, 1050-
1062.e6. https://doi.org/10.1016/j.celrep.2019.06.078

Lattante, S., Rouleau, G.A., Kabashi, E., 2013. TARDBP and FUS mutations associated with amyotrophic lateral sclerosis:
summary and update. Human mutation 34, 812–26. https://doi.org/10.1002/humu.22319

Law, C.W., Chen, Y., Shi, W., Smyth, G.K., 2014. voom: precision weights unlock linear model analysis tools for RNA-seq
read counts. Genome Biology 15, R29. https://doi.org/10.1186/gb-2014-15-2-r29

Lazdins, I.B., Delannoy, M., Sollner-Webb, B., 1997. Analysis of nucleolar transcription and processing domains and pre-
rRNA movements by in situ hybridization. Chromosoma 105, 481–95. https://doi.org/10.1007/BF02510485

Lee, K.-H., Zhang, P., Kim, H.J.J., Mitrea, D.M., Sarkar, M., Freibaum, B.D., Cika, J., Coughlin, M., Messing, J., Molliex, A.,
Maxwell, B.A., Kim, N.C.C., Temirov, J., Moore, J., Kolaitis, R.-M., Shaw, T.I., Bai, B., Peng, J., Kriwacki, R.W., Taylor,
J.P.P., 2016. C9orf72 Dipeptide Repeats Impair the Assembly, Dynamics, and Function of Membrane-Less
Organelles. Cell 167, 774-788.e17.

Lee, S., Kim, J.-Y., Kim, Y.-J., Seok, K.-O., Kim, J.-H., Chang, Y.-J., Kang, H.-Y., Park, J.-H., 2012. Nucleolar protein GLTSCR2
stabilizes p53 in response to ribosomal stresses. Cell death and differentiation 19, 1613–22.
https://doi.org/10.1038/cdd.2012.40

Lehmer, C., Oeckl, P., Weishaupt, J.H., Volk, A.E., Diehl‐Schmid, J., Schroeter, M.L., Lauer, M., Kornhuber, J., Levin, J.,
Fassbender, K., Landwehrmeyer, B., Schludi, M.H., Arzberger, T., Kremmer, E., Flatley, A., Feederle, R., Steinacker, P.,
Weydt, P., Ludolph, A.C., Edbauer, D., Otto, M., Danek, A., Feneberg, E., Anderl‐Straub, S., Arnim, C., Jahn, H.,
Schneider, A., Maler, M., Polyakova, M., Riedl, L., Wiltfang, J., Ziegler, G., 2017. Poly‐ GP in cerebrospinal fluid links
C9orf72 ‐associated dipeptide repeat expression to the asymptomatic phase of ALS / FTD. EMBO Molecular
Medicine 9, 859–868. https://doi.org/10.15252/emmm.201607486

Lezhava, T., Buadze, T., Monaselidze, J., Jokhadze, T., Sigua, N., Jangulashvili, N., Gaiozishvili, M., Koridze, M., Zosidze, N.,
Rukhadze, M., 2020. Epigenetic Changes of Activity of the Ribosomal Cistrons of Human Acrocentric Chromatids
in Fetuses, Middle-aged (22–45 years) and Old Individuals (80–106 years). Cytology and Genetics 54, 233–242.
https://doi.org/10.3103/S009545272003007X

Liberzon, A., Birger, C., Thorvaldsdóttir, H., Ghandi, M., Mesirov, J.P., Tamayo, P., 2015. The Molecular Signatures Database
(MSigDB) hallmark gene set collection. Cell systems 1, 417–425. https://doi.org/10.1016/j.cels.2015.12.004

Liddelow, S.A., Guttenplan, K.A., Clarke, L.E., Bennett, F.C., Bohlen, C.J., Schirmer, L., Bennett, M.L., Münch, A.E., Chung, W.-
S., Peterson, T.C., Wilton, D.K., Frouin, A., Napier, B.A., Panicker, N., Kumar, M., Buckwalter, M.S., Rowitch, D.H.,
Dawson, V.L., Dawson, T.M., Stevens, B., Barres, B.A., 2017. Neurotoxic reactive astrocytes are induced by activated
microglia. Nature 541, 481–487. https://doi.org/10.1038/nature21029

Ling, S.-C., Dastidar, S.G., Tokunaga, S., Ho, W.Y., Lim, K., Ilieva, H., Parone, P.A., Tyan, S.-H., Tse, T.M., Chang, J.-C.,
Platoshyn, O., Bui, N.B., Bui, A., Vetto, A., Sun, S., McAlonis-Downes, M., Han, J.S., Swing, D., Kapeli, K., Yeo, G.W.,
Tessarollo, L., Marsala, M., Shaw, C.E., Tucker-Kellogg, G., la Spada, A.R., Lagier-Tourenne, C., da Cruz, S., Cleveland,
D.W., 2019. Overriding FUS autoregulation in mice triggers gain-of-toxic dysfunctions in RNA metabolism and
autophagy-lysosome axis. eLife 8. https://doi.org/10.7554/eLife.40811

Lin, P.-Y., Simon, S.M., Koh, W.K., Folorunso, O., Umbaugh, C.S., Pierce, A., 2013. Heat shock factor 1 over-expression
protects against exposure of hydrophobic residues on mutant SOD1 and early mortality in a mouse model of
amyotrophic lateral sclerosis. Molecular neurodegeneration 8, 43. https://doi.org/10.1186/1750-1326-8-43

151
Lin, Y., Mori, E., Kato, M., Xiang, S., Wu, L., Kwon, I., McKnight, S.L.L., 2016. Toxic PR Poly-Dipeptides Encoded by the
C9orf72 Repeat Expansion Target LC Domain Polymers. Cell 167, 789-802.e12.
https://doi.org/10.1016/j.cell.2016.10.003

Liu, D., Ou, L., Clemenson, G.D., Chao, C., Lutske, M.E., Zambetti, G.P., Gage, F.H., Xu, Y., 2010. Puma is required for p53-
induced depletion of adult stem cells. Nature cell biology 12, 993–8. https://doi.org/10.1038/ncb2100

Liu, F., Morderer, D., Wren, M.C., Vettleson-Trutza, S.A., Wang, Y., Rabichow, B.E., Salemi, M.R., Phinney, B.S., Oskarsson,
B., Dickson, D.W., Rossoll, W., 2022. Proximity proteomics of C9orf72 dipeptide repeat proteins identifies molecular
chaperones as modifiers of poly-GA aggregation. Acta neuropathologica communications 10, 22.
https://doi.org/10.1186/s40478-022-01322-x

Liu, G.Y., Sabatini, D.M., 2020. mTOR at the nexus of nutrition, growth, ageing and disease. Nature Reviews Molecular Cell
Biology 21, 183–203. https://doi.org/10.1038/s41580-019-0199-y

Liu, Y., Mi, Y., Mueller, T., Kreibich, S., Williams, E.G., van Drogen, A., Borel, C., Frank, M., Germain, P.-L., Bludau, I., Mehnert,
M., Seifert, M., Emmenlauer, M., Sorg, I., Bezrukov, F., Bena, F.S., Zhou, H., Dehio, C., Testa, G., Saez-Rodriguez, J.,
Antonarakis, S.E., Hardt, W.-D., Aebersold, R., 2019. Multi-omic measurements of heterogeneity in HeLa cells across
laboratories. Nature Biotechnology 37, 314–322. https://doi.org/10.1038/s41587-019-0037-y

Liu, Y., Pattamatta, A., Zu, T., Reid, T., Bardhi, O., Borchelt, D.R.R.D., Yachnis, A.A.T.T., Ranum, L.P.W.L.W.P.W., 2016.
C9orf72 BAC Mouse Model with Motor Deficits and Neurodegenerative Features of ALS/FTD. Neuron 90, 521–534.
https://doi.org/10.1016/j.neuron.2016.04.005

Li, Y.R., King, O.D., Shorter, J., Gitler, A.D., 2013. Stress granules as crucibles of ALS pathogenesis. The Journal of cell
biology 201, 361–72. https://doi.org/10.1083/jcb.201302044

Logroscino, G., Traynor, B.J., Hardiman, O., Chiò, A., Mitchell, D., Swingler, R.J., Millul, A., Benn, E., Beghi, E., EURALS, 2010.
Incidence of amyotrophic lateral sclerosis in Europe. Journal of neurology, neurosurgery, and psychiatry 81, 385–
90. https://doi.org/10.1136/jnnp.2009.183525

Lohrum, M.A.E., Ludwig, R.L., Kubbutat, M.H.G., Hanlon, M., Vousden, K.H., 2003. Regulation of HDM2 activity by the
ribosomal protein L11. Cancer cell 3, 577–87. https://doi.org/10.1016/s1535-6108(03)00134-x

Lopez-Gonzalez, R., Lu, Y., Gendron, T.F., Karydas, A., Tran, H., Yang, D., Petrucelli, L., Miller, B.L., Almeida, S., Gao, F. -B.,
2016. Poly(GR) in C9ORF72-Related ALS/FTD Compromises Mitochondrial Function and Increases Oxidative
Stress and DNA Damage in iPSC-Derived Motor Neurons. Neuron 92, 383–391.

López-Otín, C., Blasco, M.A., Partridge, L., Serrano, M., Kroemer, G., 2013. The Hallmarks of Aging. Cell 153, 1194–1217.
https://doi.org/10.1016/j.cell.2013.05.039

Lott, B.B., Wang, Y., Nakazato, T., 2013. A comparative study of ribosomal proteins: linkage between amino acid
distribution and ribosomal assembly. BMC biophysics 6, 13. https://doi.org/10.1186/2046-1682-6-13

Mackenzie, I.R.A., Frick, P., Grässer, F.A., Gendron, T.F., Petrucelli, L., Cashman, N.R., Edbauer, D., Kremmer, E., Prudlo, J.,
Troost, D., Neumann, M., 2015. Quantitative analysis and clinico-pathological correlations of different dipeptide
repeat protein pathologies in C9ORF72 mutation carriers. Acta neuropathologica 130, 845–61.
https://doi.org/10.1007/s00401-015-1476-2

Mackenzie, I.R., Arzberger, T., Kremmer, E., Troost, D., Lorenzl, S., Mori, K., Weng, S.-M., Haass, C., Kretzschmar, H.A.,
Edbauer, D., Neumann, M., 2013. Dipeptide repeat protein pathology in C9ORF72 mutation cases: clinico-
pathological correlations. Acta neuropathologica 126, 859–79. https://doi.org/10.1007/s00401-013-1181-y

Magrané, J., Cortez, C., Gan, W.-B., Manfredi, G., 2014. Abnormal mitochondrial transport and morphology are common
pathological denominators in SOD1 and TDP43 ALS mouse models. Human molecular genetics 23, 1413–24.
https://doi.org/10.1093/hmg/ddt528

Maharana, S., Wang, J., Papadopoulos, D.K., Richter, D., Pozniakovsky, A., Poser, I., Bickle, M., Rizk, S., Guillén-Boixet, J.,
Franzmann, T.M., Jahnel, M., Marrone, L., Chang, Y.-T., Sterneckert, J., Tomancak, P., Hyman, A.A., Alberti, S., 2018.
RNA buffers the phase separation behavior of prion-like RNA binding proteins. Science 360, 918–921.
https://doi.org/10.1126/science.aar7366

152
 REFERENCES

Maier, B., Gluba, W., Bernier, B., Turner, T., Mohammad, K., Guise, T., Sutherland, A., Thorner, M., Scrable, H., 2004.
Modulation of mammalian life span by the short isoform of p53. Genes & development 18, 306–19.
https://doi.org/10.1101/gad.1162404

Majcher, V., Goode, A., James, V., Layfield, R., 2015. Autophagy receptor defects and ALS-FTLD. Molecular and cellular
neurosciences 66, 43–52. https://doi.org/10.1016/j.mcn.2015.01.002

Mandrioli, J., D’Amico, R., Zucchi, E., Gessani, A., Fini, N., Fasano, A., Caponnetto, C., Chiò, A., Dalla Bella, E., Lunetta , C.,
Mazzini, L., Marinou, K., Sorarù, G., de Biasi, S., lo Tartaro, D., Pinti, M., Cossarizza, A., RAP-ALS investigators group,
R.-A. investigators, 2018. Rapamycin treatment for amyotrophic lateral sclerosis: Protocol for a phase II
randomized, double-blind, placebo-controlled, multicenter, clinical trial (RAP-ALS trial). Medicine 97, e11119.
https://doi.org/10.1097/MD.0000000000011119

Mann, D.M.A., Rollinson, S., Robinson, A., Bennion Callister, J., Thompson, J.C., Snowden, J.S., Gendron, T., Petrucelli, L.,
Masuda-Suzukake, M., Hasegawa, M., Davidson, Y., Pickering-Brown, S., 2013. Dipeptide repeat proteins are present
in the p62 positive inclusions in patients with frontotemporal lobar degeneration and motor neurone disease
associated with expansions in C9ORF72. Acta neuropathologica communications 1, 68.
https://doi.org/10.1186/2051-5960-1-68

Mansisidor, A., Molinar, T., Srivastava, P., Dartis, D.D., Pino Delgado, A., Blitzblau, H.G., Klein, H., Hochwagen, A., 2018.
Genomic Copy-Number Loss Is Rescued by Self-Limiting Production of DNA Circles. Molecular cell 72, 583-593.e4.
https://doi.org/10.1016/j.molcel.2018.08.036

Martínez Corrales, G., Filer, D., Wenz, K.C., Rogan, A., Phillips, G., Li, M., Feseha, Y., Broughton, S.J., Alic, N., 2020. Partial
Inhibition of RNA Polymerase I Promotes Animal Health and Longevity. Cell reports 30, 1661-1669.e4.
https://doi.org/10.1016/j.celrep.2020.01.017

Martinez-Miguel, V.E., Lujan, C., Espie--Caullet, T., Martinez-Martinez, D., Moore, S., Backes, C., Gonzalez, S., Galimov, E.R.,
Brown, A.E.X., Halic, M., Tomita, K., Rallis, C., von der Haar, T., Cabreiro, F., Bjedov, I., 2021. Increased fidelity of
protein synthesis extends lifespan. Cell Metabolism. https://doi.org/10.1016/J.CMET.2021.08.017

Martin, P.B., Kigoshi-Tansho, Y., Sher, R.B., Ravenscroft, G., Stauffer, J.E., Kumar, R., Yonashiro, R., Müller, T., Griffith, C.,
Allen, W., Pehlivan, D., Harel, T., Zenker, M., Howting, D., Schanze, D., Faqeih, E.A., Almontashiri, N.A.M., Maroofian,
R., Houlden, H., Mazaheri, N., Galehdari, H., Douglas, G., Posey, J.E., Ryan, M., Lupski, J.R., Laing, N.G., Joazeiro,
C.A.P., Cox, G.A., 2020. NEMF mutations that impair ribosome-associated quality control are associated with
neuromuscular disease. Nature communications 11, 4625. https://doi.org/10.1038/s41467-020-18327-6

Mascotti, D.P., Lohman, T.M., 1997. Thermodynamics of oligoarginines binding to RNA and DNA. Biochemistry 36, 7272–
9. https://doi.org/10.1021/bi970272n

Mateyak, M.K., Obaya, A.J., Adachi, S., Sedivy, J.M., 1997. Phenotypes of c-Myc-deficient rat fibroblasts isolated by
targeted homologous recombination. Cell Growth and Differentiation 8, 1039–1048.

Matthews, D.A., 2001. Adenovirus protein V induces redistribution of nucleolin and B23 from nucleolus to cytoplasm.
Journal of virology 75, 1031–8. https://doi.org/10.1128/JVI.75.2.1031-1038.2001

Mayer, C., Grummt, I., 2005. Cellular stress and nucleolar function. Cell cycle (Georgetown, Tex.) 4, 1036–8.
https://doi.org/10.4161/cc.4.8.1925

Mayer, C., Zhao, J., Yuan, X., Grummt, I., 2004. mTOR-dependent activation of the transcription factor TIF-IA links rRNA
synthesis to nutrient availability. Genes & development 18, 423–34. https://doi.org/10.1101/gad.285504

Mayford, M., Bach, M.E., Huang, Y.Y., Wang, L., Hawkins, R.D., Kandel, E.R., 1996. Control of memory formation through
regulated expression of a CaMKII transgene. Science (New York, N.Y.) 274, 1678–83.
https://doi.org/10.1126/science.274.5293.1678

McCord, J.M., Fridovich, I., 1969. Superoxide Dismutase: AN ENZYMIC FUNCTION FOR ERYTHROCUPREIN
(HEMOCUPREIN). Journal of Biological Chemistry 244, 6049–6055. https://doi.org/10.1016/S0021-
9258(18)63504-5

153
McEachin, Z.T., Gendron, T.F., Raj, N., García-Murias, M., Banerjee, A., Purcell, R.H., Ward, P.J., Todd, T.W., Merritt-Garza,
M.E., Jansen-West, K., Hales, C.M., García-Sobrino, T., Quintáns, B., Holler, C.J., Taylor, G., San Millán, B., Teijeira, S.,
Yamashita, T., Ohkubo, R., Boulis, N.M., Xu, C., Wen, Z., Streichenberger, N., Fogel, B.L., Kukar, T., Abe, K., Dickson,
D.W., Arias, M., Glass, J.D., Jiang, J., Tansey, M.G., Sobrido, M.-J., Petrucelli, L., Rossoll, W., Bassell, G.J., 2020.
Chimeric Peptide Species Contribute to Divergent Dipeptide Repeat Pathology in c9ALS/FTD and SCA36. Neuron
107, 292-305.e6. https://doi.org/10.1016/J.NEURON.2020.04.011

McIntyre, R.L., Daniels, E.G., Molenaars, M., Houtkooper, R.H., Janssens, G.E., 2019. From molecular promise to preclinical
results: HDAC inhibitors in the race for healthy aging drugs. EMBO Molecular Medicine 11, e9854.
https://doi.org/10.15252/emmm.201809854

Mejzini, R., Flynn, L.L., Pitout, I.L., Fletcher, S., Wilton, S.D., Akkari, P.A., 2019. ALS Genetics, Mechanisms, and
Therapeutics: Where Are We Now? 13, 1310. https://doi.org/10.3389/fnins.2019.01310

Michels, A.A., Robitaille, A.M., Buczynski-Ruchonnet, D., Hodroj, W., Reina, J.H., Hall, M.N., Hernandez, N., 2010. mTORC1
directly phosphorylates and regulates human MAF1. Molecular and cellular biology 30, 3749–57.
https://doi.org/10.1128/MCB.00319-10

Mieulet, V., Roceri, M., Espeillac, C., Sotiropoulos, A., Ohanna, M., Oorschot, V., Klumperman, J., Sandri, M., Pende, M.,
2007. S6 kinase inactivation impairs growth and translational target phosphorylation in muscle cells maintaining
proper regulation of protein turnover. American Journal of Physiology-Cell Physiology 293, C712–C722.
https://doi.org/10.1152/ajpcell.00499.2006

Mills, E.W., Green, R., 2017. Ribosomopathies: There’s strength in numbers. Science (New York, N.Y.) 358.
https://doi.org/10.1126/science.aan2755

Minnerop, M., Kurzwelly, D., Wagner, H., Soehn, A.S., Reichbauer, J., Tao, F., Rattay, T.W., Peitz, M., Rehbach, K., Giorgetti,
A., Pyle, A., Thiele, H., Altmüller, J., Timmann, D., Karaca, I., Lennarz, M., Baets, J., Hengel, H., Synofzik, M., Atasu, B. ,
Feely, S., Kennerson, M., Stendel, C., Lindig, T., Gonzalez, M.A., Stirnberg, R., Sturm, M., Roeske, S., Jung, J., Bauer,
P., Lohmann, E., Herms, S., Heilmann-Heimbach, S., Nicholson, G., Mahanjah, M., Sharkia, R., Carloni, P., Brüstle, O.,
Klopstock, T., Mathews, K.D., Shy, M.E., de Jonghe, P., Chinnery, P.F., Horvath, R., Kohlhase, J., Schmitt, I., Wolf, M.,
Greschus, S., Amunts, K., Maier, W., Schöls, L., Nürnberg, P., Zuchner, S., Klockgether, T., Ramirez, A., Schüle, R.,
2017. Hypomorphic mutations in POLR3A are a frequent cause of sporadic and recessive spastic ataxia. Brain 140.
https://doi.org/10.1093/brain/awx095

Mitrea, D.M., Cika, J.A., Guy, C.S., Ban, D., Banerjee, P.R., Stanley, C.B., Nourse, A., Deniz, A.A., Kriwacki, R.W., 2016.
Nucleophosmin integrates within the nucleolus via multi-modal interactions with proteins displaying R-rich linear
motifs and rRNA. eLife 5. https://doi.org/10.7554/eLife.13571

Mitrea, D.M., Cika, J.A., Stanley, C.B., Nourse, A., Onuchic, P.L., Banerjee, P.R., Phillips, A.H., Park, C.-G., Deniz, A.A., Kriwacki,
R.W., 2018. Self-interaction of NPM1 modulates multiple mechanisms of liquid–liquid phase separation. Nature
Communications 9, 842. https://doi.org/10.1038/s41467-018-03255-3

Mizielinska, S., Grönke, S., Niccoli, T., Ridler, C.E., Clayton, E.L., Devoy, A., Moens, T., Norona, F.E., Woollacott, I.O.C.,
Pietrzyk, J., Cleverley, K., Nicoll, A.J., Pickering-Brown, S., Dols, J., Cabecinha, M., Hendrich, O., Fratta, P., Fisher,
E.M.C., Partridge, L., Isaacs, A.M., Gronke, S., Niccoli, T., Ridler, C.E., Clayton, E.L., Devoy, A., Moens, T., Norona, F.E. ,
Woollacott, I.O.C., Pietrzyk, J., Cleverley, K., Nicoll, A.J., Pickering-Brown, S., Dols, J., Cabecinha, M., Hendrich, O.,
Fratta, P., Fisher, E.M.C., Partridge, L., Isaacs, A.M., 2014. C9orf72 repeat expansions cause neurodegeneration in
Drosophila through arginine-rich proteins. Science 345, 1192–1194. https://doi.org/10.1126/science.1256800

Mizielinska, S., Ridler, C.E., Balendra, R., Thoeng, A., Woodling, N.S., Grässer, F.A., Plagnol, V., Lashley, T., Partridge, L.,
Isaacs, A.M., 2017. Bidirectional nucleolar dysfunction in C9orf72 frontotemporal lobar degeneration. Acta
Neuropathologica Communications 5, 29. https://doi.org/10.1186/s40478-017-0432-x

Moens, T.G., Mizielinska, S., Niccoli, T., Mitchell, J.S., Thoeng, A., Ridler, C.E., Grönke, S., Esser, J., Heslegrave, A.,
Zetterberg, H., Partridge, L., Isaacs, A.M., 2018. Sense and antisense RNA are not toxic in Drosophila models of
C9orf72-associated ALS/FTD. Acta neuropathologica 135, 445–457. https://doi.org/10.1007/s00401-017-1798-3

154
 REFERENCES

Molliex, A., Temirov, J., Lee, J., Coughlin, M., Kanagaraj, A.P., Kim, H.J., Mittag, T., Taylor, J.P., 2015. Phase separation by
low complexity domains promotes stress granule assembly and drives pathological fibrillization. Cell 163, 123–33.
https://doi.org/10.1016/j.cell.2015.09.015

Moore, S., Alsop, E., Lorenzini, I., Starr, A., Rabichow, B.E., Mendez, E., Levy, J.L., Burciu, C., Reiman, R., Chew, J., Belzil, V.
v, W Dickson, D., Robertson, J., Staats, K.A., Ichida, J.K., Petrucelli, L., van Keuren-Jensen, K., Sattler, R., 2019. ADAR2
mislocalization and widespread RNA editing aberrations in C9orf72-mediated ALS/FTD. Acta neuropathologica
138, 49–65. https://doi.org/10.1007/s00401-019-01999-w

Morcelle, C., Menoyo, S., Morón-Duran, F.D., Tauler, A., Kozma, S.C., Thomas, G., Gentilella, A., 2019a. Oncogenic MYC
Induces the Impaired Ribosome Biogenesis Checkpoint and Stabilizes p53 Independent of Increased Ribosome
Content. Cancer research 79, 4348–4359. https://doi.org/10.1158/0008-5472.CAN-18-2718

Morcelle, C., Menoyo, S., Morón-Duran, F.D., Tauler, A., Kozma, S.C., Thomas, G., Gentilella, A., 2019b. Oncogenic MYC
Induces the Impaired Ribosome Biogenesis Checkpoint and Stabilizes p53 Independent of Increased Ribosome
Content. Cancer Research 79, 4348–4359. https://doi.org/10.1158/0008-5472.CAN-18-2718

Mordes, D.A., Morrison, B.M., Ament, X.H., Cantrell, C., Mok, J., Eggan, P., Xue, C., Wang, J.-Y., Eggan, K., Rothstein, J.D.,
2020. Absence of Survival and Motor Deficits in 500 Repeat C9ORF72 BAC Mice. Neuron 108, 775-783.e4.
https://doi.org/10.1016/j.neuron.2020.08.009

Mori, K., Lammich, S., Mackenzie, I.R.A., Forné, I., Zilow, S., Kretzschmar, H., Edbauer, D., Janssens, J., Kleinberger, G.,
Cruts, M., Herms, J., Neumann, M., van Broeckhoven, C., Arzberger, T., Haass, C., 2013a. hnRNP A3 binds to
GGGGCC repeats and is a constituent of p62-positive/TDP43-negative inclusions in the hippocampus of patients
with C9orf72 mutations. Acta neuropathologica 125, 413–23. https://doi.org/10.1007/s00401-013-1088-7

Mori, K., Nihei, Y., Arzberger, T., Zhou, Q., Mackenzie, I.R., Hermann, A., Hanisch, F., Kamp, F., Nuscher, B., Orozco, D.,
Edbauer, D., Haass, C., Edbauer, D., Haass, C., 2016. Reduced hn RNPA 3 increases C9orf72 repeat RNA levels and
dipeptide‐repeat protein deposition. EMBO reports 17, 1314–1325. https://doi.org/10.15252/embr.201541724

Mori, K., Weng, S.-M., Arzberger, T., May, S., Rentzsch, K., Kremmer, E., Schmid, B., Kretzschmar, H.A., Cruts, M., van
Broeckhoven, C., Haass, C., Edbauer, D., 2013b. The C9orf72 GGGGCC repeat is translated into aggregating
dipeptide-repeat proteins in FTLD/ALS. Science (New York, N.Y.) 339, 1335–8.
https://doi.org/10.1126/science.1232927

Morimoto, R.I., 2008. Proteotoxic stress and inducible chaperone networks in neurodegenerative disease and aging.
Genes & development 22, 1427–38. https://doi.org/10.1101/gad.1657108

Morley, J.F., Morimoto, R.I., 2004. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular
chaperones. Molecular biology of the cell 15, 657–64. https://doi.org/10.1091/mbc.e03-07-0532

Morón-Oset, J., Supèr, T., Esser, J., Isaacs, A.M., Grönke, S., Partridge, L., 2019. Glycine-alanine dipeptide repeats spread
rapidly in a repeat length- and age-dependent manner in the fly brain. Acta Neuropathologica Communications 7,
209. https://doi.org/10.1186/s40478-019-0860-x

Morrow, G., Kim, H.-J., Pellerito, O., Bourrelle-Langlois, M., le Pécheur, M., Groebe, K., Tanguay, R.M., 2016. Changes in
Drosophila mitochondrial proteins following chaperone-mediated lifespan extension confirm a role of Hsp22 in
mitochondrial UPR and reveal a mitochondrial localization for cathepsin D. Mechanisms of ageing and
development 155, 36–47. https://doi.org/10.1016/j.mad.2016.02.011

Mourelatos, Z., Hirano, A., Rosenquist, A.C., Gonatas, N.K., 1994. Fragmentation of the Golgi apparatus of motor neurons
in amyotrophic lateral sclerosis (ALS). Clinical studies in ALS of Guam and experimental studies in deafferented
neurons and in beta,beta’-iminodipropionitrile axonopathy. The American journal of pathology 144, 1288–300.

Murphy, N.A., Arthur, K.C., Tienari, P.J., Houlden, H., Chiò, A., Traynor, B.J., 2017. Age-related penetrance of the C9orf72
repeat expansion. Scientific Reports 7, 2116. https://doi.org/10.1038/s41598-017-02364-1

Nanaura, H., Kawamukai, H., Fujiwara, A., Uehara, T., Aiba, Y., Nakanishi, M., Shiota, T., Hibino, M., Wiriyasermkul, P.,
Kikuchi, S., Nagata, R., Matsubayashi, M., Shinkai, Y., Niwa, T., Mannen, T., Morikawa, N., Iguchi, N., Kiriyama, T.,
Morishima, K., Inoue, R., Sugiyama, M., Oda, T., Kodera, N., Toma-Fukai, S., Sato, M., Taguchi, H., Nagamori, S., Shoji,
O., Ishimori, K., Matsumura, H., Sugie, K., Saio, T., Yoshizawa, T., Mori, E., 2021. C9orf72-derived arginine-rich poly-

155
 dipeptides impede phase modifiers. Nature Communications 12, 5301. https://doi.org/10.1038/s41467-021-
25560-0

Nassif, M., Woehlbier, U., Manque, P.A., 2017. The Enigmatic Role of C9ORF72 in Autophagy. Frontiers in neuroscience
11, 442. https://doi.org/10.3389/fnins.2017.00442

Natchiar, S.K., Myasnikov, A.G., Kratzat, H., Hazemann, I., Klaholz, B.P., 2017. Visualization of chemical modifications in
the human 80S ribosome structure. Nature 551, 472–477. https://doi.org/10.1038/nature24482

Nebbioso, A., Carafa, V., Conte, M., Tambaro, F.P., Abbondanza, C., Martens, J., Nees, M., Benedetti, R., Pallavicini, I.,
Minucci, S., Garcia-Manero, G., Iovino, F., Lania, G., Ingenito, C., Belsito Petrizzi, V., Stunnenberg, H.G., Altucci, L.,
2017. c-Myc Modulation and Acetylation Is a Key HDAC Inhibitor Target in Cancer. Clinical cancer research : an
official journal of the American Association for Cancer Research 23, 2542–2555. https://doi.org/10.1158/1078-
0432.CCR-15-2388

Neumann, M., Bentmann, E., Dormann, D., Jawaid, A., DeJesus-Hernandez, M., Ansorge, O., Roeber, S., Kretzschmar, H.A.,
Munoz, D.G., Kusaka, H., Yokota, O., Ang, L.-C., Bilbao, J., Rademakers, R., Haass, C., Mackenzie, I.R.A., 2011. FET
proteins TAF15 and EWS are selective markers that distinguish FTLD with FUS pathology from amyotrophic lateral
sclerosis with FUS mutations. Brain : a journal of neurology 134, 2595–609. https://doi.org/10.1093/brain/awr201

Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi, M.C., Chou, T.T., Bruce, J., Schuck, T., Grossman, M.,
Clark, C.M., McCluskey, L.F., Miller, B.L., Masliah, E., Mackenzie, I.R., Feldman, H., Feiden, W., Kretzschmar, H.A.,
Trojanowski, J.Q., Lee, V.M.-Y., 2006. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic
lateral sclerosis. Science (New York, N.Y.) 314, 130–3. https://doi.org/10.1126/science.1134108

Neumüller, R.A., Gross, T., Samsonova, A.A., Vinayagam, A., Buckner, M., Founk, K., Hu, Y., Sharifpoor, S., Rosebrock, A.P.,
Andrews, B., Winston, F., Perrimon, N., 2013. Conserved regulators of nucleolar size revealed by global phenotypic
analyses. Science signaling 6, ra70. https://doi.org/10.1126/scisignal.2004145

Nguyen, L., Laboissonniere, L.A., Guo, S., Pilotto, F., Scheidegger, O., Oestmann, A., Hammond, J.W., Li, H., Hyysalo, A.,
Peltola, R., Pattamatta, A., Zu, T., Voutilainen, M.H., Gelbard, H.A., Saxena, S., Ranum, L.P.W., 2020. Survival and
Motor Phenotypes in FVB C9-500 ALS/FTD BAC Transgenic Mice Reproduced by Multiple Labs. Neuron 108, 784-
796.e3. https://doi.org/10.1016/J.NEURON.2020.09.009

Nicolas, E., Parisot, P., Pinto-Monteiro, C., de Walque, R., de Vleeschouwer, C., Lafontaine, D.L.J., 2016. Involvement of
human ribosomal proteins in nucleolar structure and p53-dependent nucleolar stress. Nature communications 7,
11390. https://doi.org/10.1038/ncomms11390

Nihei, Y., Mori, K., Werner, G., Arzberger, T., Zhou, Q., Khosravi, B., Japtok, J., Hermann, A., Sommacal, A., Weber, M., Kamp,
F., Nuscher, B., Edbauer, D., Haass, C., 2020. Poly-glycine–alanine exacerbates C9orf72 repeat expansion-mediated
DNA damage via sequestration of phosphorylated ATM and loss of nuclear hnRNPA3. Acta Neuropathologica 139,
99–118. https://doi.org/10.1007/s00401-019-02082-0

Nizami, Z., Deryusheva, S., Gall, J.G., 2010. The Cajal body and histone locus body. Cold Spring Harbor perspectives in
biology 2, a000653. https://doi.org/10.1101/cshperspect.a000653

Onesto, E., Colombrita, C., Gumina, V., Borghi, M.O., Dusi, S., Doretti, A., Fagiolari, G., Invernizzi, F., Moggio, M., Tiranti, V.,
Silani, V., Ratti, A., 2016. Gene-specific mitochondria dysfunctions in human TARDBP and C9ORF72 fibroblasts.
Acta neuropathologica communications 4, 47. https://doi.org/10.1186/s40478-016-0316-5

O’Rourke, J.G., Bogdanik, L., Muhammad, A.K.M.G., Gendron, T.F., Kim, K.J., Austin, A., Cady, J., Liu, E.Y., Zarrow, J., Grant,
S., Ho, R., Bell, S., Carmona, S., Simpkinson, M., Lall, D., Wu, K., Daughrity, L., Dickson, D.W., Harms, M.B., Petrucelli,
L., Lee, E.B., Lutz, C.M., Baloh, R.H., 2015. C9orf72 BAC Transgenic Mice Display Typical Pathologic Features of
ALS/FTD. Neuron 88, 892–901. https://doi.org/10.1016/j.neuron.2015.10.027

O’Rourke, J.G., Bogdanik, L., Yáñez, A., Lall, D., Wolf, A.J., Muhammad, A.K.M.G., Ho, R., Carmona, S., Vit, J.P., Zarrow, J.,
Kim, K.J., Bell, S., Harms, M.B., Miller, T.M., Dangler, C.A., Underhill, D.M., Goodridge, H.S., Lutz, C.M., Baloh, R.H.,
2016. C9orf72 is required for proper macrophage and microglial function in mice. Science (New York, N.Y.) 351,
1324–9. https://doi.org/10.1126/science.aaf1064

156
 REFERENCES

Palanca, A., Casafont, I., Berciano, M.T., Lafarga, M., 2014. Reactive nucleolar and Cajal body responses to proteasome
inhibition in sensory ganglion neurons. Biochimica et biophysica acta 1842, 848–59.
https://doi.org/10.1016/j.bbadis.2013.11.016

Pandya, V.A., Patani, R., 2020. Decoding the relationship between ageing and amyotrophic lateral sclerosis: a cellular
perspective. Brain 143, 1057–1072. https://doi.org/10.1093/brain/awz360

Pan, K.Z., Palter, J.E., Rogers, A.N., Olsen, A., Chen, D., Lithgow, G.J., Kapahi, P., 2007. Inhibition of mRNA translation
extends lifespan in Caenorhabditis elegans. Aging Cell 6, 111–119. https://doi.org/10.1111/j.1474-
9726.2006.00266.x

Paolacci, S., Li, Y., Agolini, E., Bellacchio, E., Arboleda-Bustos, C.E., Carrero, D., Bertola, D., Al-Gazali, L., Alders, M., Altmüller,
J., Arboleda, G., Beleggia, F., Bruselles, A., Ciolfi, A., Gillessen-Kaesbach, G., Krieg, T., Mohammed, S., Müller, C.,
Novelli, A., Ortega, J., Sandoval, A., Velasco, G., Yigit, G., Arboleda, H., Lopez-Otin, C., Wollnik, B., Tartaglia, M.,
Hennekam, R.C., 2018. Specific combinations of biallelic POLR3A variants cause Wiedemann-Rautenstrauch
syndrome. Journal of medical genetics 55, 837–846. https://doi.org/10.1136/jmedgenet-2018-105528

Parker, S.J., Meyerowitz, J., James, J.L., Liddell, J.R., Crouch, P.J., Kanninen, K.M., White, A.R., 2012. Endogenous TDP-43
localized to stress granules can subsequently form protein aggregates. Neurochemistry international 60, 415–24.
https://doi.org/10.1016/j.neuint.2012.01.019

Park, J., Ryu, J., Kim, K.-A., Lee, H.J., Bahn, J.H., Han, K., Choi, E.Y., Lee, K.S., Kwon, H.Y., Choi, S.Y., 2002. Mutational
analysis of a human immunodeficiency virus type 1 Tat protein transduction domain which is required for delivery
of an exogenous protein into mammalian cells. The Journal of general virology 83, 1173–1181.
https://doi.org/10.1099/0022-1317-83-5-1173

Pederson, T., 1998. The plurifunctional nucleolus. Nucleic acids research 26, 3871–6.
https://doi.org/10.1093/nar/26.17.3871

Pei, Y., Liu, K.-W., Wang, J., Garancher, A., Tao, R., Esparza, L.A., Maier, D.L., Udaka, Y.T., Murad, N., Morrissy, S., Seker-Cin,
H., Brabetz, S., Qi, L., Kogiso, M., Schubert, S., Olson, J.M., Cho, Y.-J., Li, X.-N., Crawford, J.R., Levy, M.L., Kool, M.,
Pfister, S.M., Taylor, M.D., Wechsler-Reya, R.J., 2016. HDAC and PI3K Antagonists Cooperate to Inhibit Growth of
MYC-Driven Medulloblastoma. Cancer Cell 29, 311–323. https://doi.org/10.1016/J.CCELL.2016.02.011

Pende, M., Um, S.H., Mieulet, V., Sticker, M., Goss, V.L., Mestan, J., Mueller, M., Fumagalli, S., Kozma, S.C., Thomas, G.,
2004. S6K1(-/-)/S6K2(-/-) mice exhibit perinatal lethality and rapamycin-sensitive 5’-terminal oligopyrimidine mRNA
translation and reveal a mitogen-activated protein kinase-dependent S6 kinase pathway. Molecular and cellular
biology 24, 3112–24. https://doi.org/10.1128/mcb.24.8.3112-3124.2004

Perez-Riverol, Y., Csordas, A., Bai, J., Bernal-Llinares, M., Hewapathirana, S., Kundu, D.J., Inuganti, A., Griss, J., Mayer, G.,
Eisenacher, M., Pérez, E., Uszkoreit, J., Pfeuffer, J., Sachsenberg, T., Yilmaz, S., Tiwary, S., Cox, J., Audain, E., Walzer,
M., Jarnuczak, A.F., Ternent, T., Brazma, A., Vizcaíno, J.A., 2019. The PRIDE database and related tools and
resources in 2019: improving support for quantification data. Nucleic acids research 47, D442–D450.
https://doi.org/10.1093/nar/gky1106

Perlaky, L., Valdez, B.C., Busch, H., 1997. Effects of cytotoxic drugs on translocation of nucleolar RNA helicase RH-II/Gu.
Experimental cell research 235, 413–20. https://doi.org/10.1006/excr.1997.3686

Pestov, D.G., Strezoska, Z., Lau, L.F., 2001. Evidence of p53-dependent cross-talk between ribosome biogenesis and the
cell cycle: effects of nucleolar protein Bop1 on G(1)/S transition. Molecular and cellular biology 21, 4246–55.
https://doi.org/10.1128/MCB.21.13.4246-4255.2001

Petrov, D., Mansfield, C., Moussy, A., Hermine, O., 2017. ALS Clinical Trials Review: 20 Years of Failure. Are We Any Closer
to Registering a New Treatment? Frontiers in aging neuroscience 9, 68. https://doi.org/10.3389/fnagi.2017.00068

Phan, T., Khalid, F., Iben, S., 2019. Nucleolar and Ribosomal Dysfunction-A Common Pathomechanism in Childhood
Progerias? Cells 8. https://doi.org/10.3390/cells8060534

Philips, T., Bento-Abreu, A., Nonneman, A., Haeck, W., Staats, K., Geelen, V., Hersmus, N., Küsters, B., van den Bosch, L.,
van Damme, P., Richardson, W.D., Robberecht, W., 2013. Oligodendrocyte dysfunction in the pathogenesis of
amyotrophic lateral sclerosis. Brain : a journal of neurology 136, 471–82. https://doi.org/10.1093/brain/aws339

157
Phukan, J., Elamin, M., Bede, P., Jordan, N., Gallagher, L., Byrne, S., Lynch, C., Pender, N., Hardiman, O., 2012. The syndrome
of cognitive impairment in amyotrophic lateral sclerosis: a population-based study. Journal of neurology,
neurosurgery, and psychiatry 83, 102–8. https://doi.org/10.1136/jnnp-2011-300188

Piazzi, M., Bavelloni, A., Gallo, A., Faenza, I., Blalock, W.L., 2019. Signal Transduction in Ribosome Biogenesis: A Recipe t o
Avoid Disaster. International journal of molecular sciences 20. https://doi.org/10.3390/ijms20112718

Pillet, B., Mitterer, V., Kressler, D., Pertschy, B., 2017. Hold on to your friends: Dedicated chaperones of ribosomal proteins.
BioEssays 39, e201600153. https://doi.org/10.1002/bies.201600153

Pinho, M., Macedo, J.C., Logarinho, E., Pereira, P.S., 2019. NOL12 Repression Induces Nucleolar Stress-Driven Cellular
Senescence and Is Associated with Normative Aging. Molecular and cellular biology 39.
https://doi.org/10.1128/MCB.00099-19

Pisarev, A. v, Unbehaun, A., Hellen, C.U.T., Pestova, T. v, 2007. Assembly and analysis of eukaryotic translation initiation
complexes. Methods in enzymology 430, 147–77. https://doi.org/10.1016/S0076-6879(07)30007-4

Poortinga, G., Hannan, K.M., Snelling, H., Walkley, C.R., Jenkins, A., Sharkey, K., Wall, M., Brandenburger, Y., Palatsides, M.,
Pearson, R.B., McArthur, G.A., Hannan, R.D., 2004. MAD1 and c-MYC regulate UBF and rDNA transcription during
granulocyte differentiation. The EMBO journal 23, 3325–35. https://doi.org/10.1038/sj.emboj.7600335

Poortinga, G., Wall, M., Sanij, E., Siwicki, K., Ellul, J., Brown, D., Holloway, T.P., Hannan, R.D., McArthur, G.A., 2011. c-MYC
coordinately regulates ribosomal gene chromatin remodeling and Pol I availability during granulocyte
differentiation. Nucleic acids research 39, 3267–81. https://doi.org/10.1093/nar/gkq1205

Portz, B., Lee, B.L., Shorter, J., 2021. FUS and TDP-43 Phases in Health and Disease. Trends in Biochemical Sciences 46,
550–563. https://doi.org/10.1016/J.TIBS.2020.12.005

Proudfoot, M., Gutowski, N.J., Edbauer, D., Hilton, D.A., Stephens, M., Rankin, J., Mackenzie, I.R.A., 2014. Early dipeptide
repeat pathology in a frontotemporal dementia kindred with C9ORF72 mutation and intellectual disability. Acta
neuropathologica 127, 451–8. https://doi.org/10.1007/s00401-014-1245-7

Puls, I., Jonnakuty, C., LaMonte, B.H., Holzbaur, E.L.F., Tokito, M., Mann, E., Floeter, M.K., Bidus, K., Drayna, D., Oh, S.J.,
Brown, R.H., Ludlow, C.L., Fischbeck, K.H., 2003. Mutant dynactin in motor neuron disease. Nature genetics 33,
455–6. https://doi.org/10.1038/ng1123

Pyo, J.-O., Yoo, S.-M., Ahn, H.-H., Nah, J., Hong, S.-H., Kam, T.-I., Jung, S., Jung, Y.-K., 2013. Overexpression of Atg5 in mice
activates autophagy and extends lifespan. Nature Communications 4, 2300.
https://doi.org/10.1038/ncomms3300

Radwan, M., Ang, C.-S., Ormsby, A.R., Cox, D., Daly, J.C., Reid, G.E., Hatters, D.M., 2020. Arginine in C9ORF72
Dipolypeptides Mediates Promiscuous Proteome Binding and Multiple Modes of Toxicity. Molecular & cellular
proteomics : MCP 19, 640–654. https://doi.org/10.1074/mcp.RA119.001888

Ratti, A., Buratti, E., 2016. Physiological functions and pathobiology of TDP-43 and FUS/TLS proteins. Journal of
Neurochemistry 138, 95–111. https://doi.org/10.1111/jnc.13625

Recasens-Alvarez, C., Alexandre, C., Kirkpatrick, J., Nojima, H., Huels, D.J., Snijders, A.P., Vincent, J.-P., 2021.
Ribosomopathy-associated mutations cause proteotoxic stress that is alleviated by TOR inhibition. Nature Cell
Biology 23, 127–135. https://doi.org/10.1038/s41556-020-00626-1

Renton, A.E., Majounie, E., Waite, A., Simón-Sánchez, J., Rollinson, S., Gibbs, J.R., Schymick, J.C., Laaksovirta, H.,
van Swieten, J.C., Myllykangas, L., Kalimo, H., Paetau, A., Abramzon, Y., Remes, A.M., Kaganovich, A., Scholz, S.W.,
Duckworth, J., Ding, J., Harmer, D.W., Hernandez, D.G., Johnson, J.O., Mok, K., Ryten, M., Trabzuni, D., Guerreiro,
R.J., Orrell, R.W., Neal, J., Murray, A., Pearson, J., Jansen, I.E., Sondervan, D., Seelaar, H., Blake, D., Young, K., Halliwell,
N., Callister, J.B., Toulson, G., Richardson, A., Gerhard, A., Snowden, J., Mann, D., Neary, D., Nalls, M.A., Peuralinna,
T., Jansson, L., Isoviita, V.-M., Kaivorinne, A.-L., Hölttä-Vuori, M., Ikonen, E., Sulkava, R., Benatar, M., Wuu, J., Chiò, A.,
Restagno, G., Borghero, G., Sabatelli, M., Heckerman, D., Rogaeva, E., Zinman, L., Rothstein, J.D., Sendtner, M.,
Drepper, C., Eichler, E.E., Alkan, C., Abdullaev, Z., Pack, S.D., Dutra, A., Pak, E., Hardy, J., Singleton, A., Williams, N.M.,
Heutink, P., Pickering-Brown, S., Morris, H.R., Tienari, P.J., Traynor, B.J., 2011. A Hexanucleotide Repeat Expansion

158
 REFERENCES

in C9ORF72 Is the Cause of Chromosome 9p21-Linked ALS-FTD. Neuron 72, 257–268.

https://doi.org/10.1016/J.NEURON.2011.09.010

Riback, J.A., Zhu, L., Ferrolino, M.C., Tolbert, M., Mitrea, D.M., Sanders, D.W., Wei, M.-T., Kriwacki, R.W., Brangwynne, C.P.,
2020. Composition-dependent thermodynamics of intracellular phase separation. Nature 581, 209–214.
https://doi.org/10.1038/s41586-020-2256-2

Rogers, A.N., Chen, D., McColl, G., Czerwieniec, G., Felkey, K., Gibson, B.W., Hubbard, A., Melov, S., Lithgow, G.J., Kapahi,
P., 2011. Life span extension via eIF4G inhibition is mediated by posttranscriptional remodeling of stress response
gene expression in C. elegans. Cell metabolism 14, 55–66. https://doi.org/10.1016/j.cmet.2011.05.010

Romano, G., Veneziano, D., Acunzo, M., Croce, C.M., 2017. Small non-coding RNA and cancer. Carcinogenesis 38, 485–
491. https://doi.org/10.1093/carcin/bgx026

Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O’Regan, J.P., Deng,
H.-X., Rahmani, Z., Krizus, A., McKenna-Yasek, D., Cayabyab, A., Gaston, S.M., Berger, R., Tanzi, R.E., Halperin, J.J.,
Herzfeldt, B., van den Bergh, R., Hung, W.-Y., Bird, T., Deng, G., Mulder, D.W., Smyth, C., Laing, N.G., Soriano, E.,
Pericak–Vance, M.A., Haines, J., Rouleau, G.A., Gusella, J.S., Horvitz, H.R., Brown, R.H., 1993. Mutations in Cu/Zn
superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59–62.
https://doi.org/10.1038/362059a0

Rossi, S., Serrano, A., Gerbino, V., Giorgi, A., di Francesco, L., Nencini, M., Bozzo, F., Schininà, M.E., Bagni, C., Cestra, G.,
Carrì, M.T., Achsel, T., Cozzolino, M., 2015. Nuclear accumulation of mRNAs underlies G4C2‐repeat‐induced
translational repression in a cellular model of C9orf72 ALS. Journal of Cell Science 128.

Rouleau, G.A., Clark, A.W., Rooke, K., Pramatarova, A., Krizus, A., Suchowersky, O., Julien, J.P., Figlewicz, D., 1996. SOD1
mutation is associated with accumulation of neurofilaments in amyotrophic lateral sclerosis. Annals of neurology
39, 128–31. https://doi.org/10.1002/ana.410390119

Rousseau, A., Bertolotti, A., 2016. An evolutionarily conserved pathway controls proteasome homeostasis. Nature 536,
184–189. https://doi.org/10.1038/nature18943

Roussel, P., André, C., Comai, L., Hernandez-Verdun, D., 1996. The rDNA transcription machinery is assembled during
mitosis in active NORs and absent in inactive NORs. The Journal of cell biology 133, 235–46.
https://doi.org/10.1083/jcb.133.2.235

Rubbi, C.P., Milner, J., 2003. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and
other stresses. The EMBO journal 22, 6068–77. https://doi.org/10.1093/emboj/cdg579

Ruiz, S., Mayor-Ruiz, C., Lafarga, V., Murga, M., Vega-Sendino, M., Ortega, S., Fernandez-Capetillo, O., 2016. A Genome-
wide CRISPR Screen Identifies CDC25A as a Determinant of Sensitivity to ATR Inhibitors. Molecular cell 62, 307–
313. https://doi.org/10.1016/j.molcel.2016.03.006

Russo, A., Esposito, D., Catillo, M., Pietropaolo, C., Crescenzi, E., Russo, G., 2013. Human rpL3 induces G₁/S arrest or
apoptosis by modulating p21 (waf1/cip1) levels in a p53-independent manner. Cell cycle (Georgetown, Tex.) 12,
76–87. https://doi.org/10.4161/cc.22963

Ruvinsky, I., Sharon, N., Lerer, T., Cohen, H., Stolovich-Rain, M., Nir, T., Dor, Y., Zisman, P., Meyuhas, O., 2005. Ribosomal
protein S6 phosphorylation is a determinant of cell size and glucose homeostasis. Genes & development 19, 2199–
211. https://doi.org/10.1101/gad.351605

Sabath, N., Levy-Adam, F., Younis, A., Rozales, K., Meller, A., Hadar, S., Soueid-Baumgarten, S., Shalgi, R., 2020. Cellular
proteostasis decline in human senescence. Proceedings of the National Academy of Sciences of the United States
of America 117, 31902–31913. https://doi.org/10.1073/pnas.2018138117

Saberi, S., Stauffer, J.E., Jiang, J., Garcia, S.D., Taylor, A.E., Schulte, D., Ohkubo, T., Schloffman, C.L., Maldonado, M.,
Baughn, M., Rodriguez, M.J., Pizzo, D., Cleveland, D., Ravits, J., 2018. Sense-encoded poly-GR dipeptide repeat
proteins correlate to neurodegeneration and uniquely co-localize with TDP-43 in dendrites of repeat-expanded
C9orf72 amyotrophic lateral sclerosis. Acta neuropathologica 135, 459–474. https://doi.org/10.1007/s00401-017-
1793-8

159
Saez, I., Vilchez, D., 2014. The Mechanistic Links Between Proteasome Activity, Aging and Age-related Diseases. Current
genomics 15, 38–51. https://doi.org/10.2174/138920291501140306113344

Sakae, N., Bieniek, K.F., Zhang, Y.-J., Ross, K., Gendron, T.F., Murray, M.E., Rademakers, R., Petrucelli, L., Dickson, D.W.,
2018. Poly-GR dipeptide repeat polymers correlate with neurodegeneration and Clinicopathological subtypes in
C9ORF72-related brain disease. Acta Neuropathologica Communications 6, 63. https://doi.org/10.1186/s40478-
018-0564-7

Salim, D., Bradford, W.D., Freeland, A., Cady, G., Wang, J., Pruitt, S.C., Gerton, J.L., 2017. DNA replication stress restricts
ribosomal DNA copy number. PLoS genetics 13, e1007006. https://doi.org/10.1371/journal.pgen.1007006

Sanchez-Burgos, L., Gómez-López, G., Al-Shahrour, F., Fernandez-Capetillo, O., 2022. An in silico analysis identifies drugs
potentially modulating the cytokine storm triggered by SARS-CoV-2 infection. Scientific Reports 12, 1626.
https://doi.org/10.1038/s41598-022-05597-x

Sanna, S., Esposito, S., Masala, A., Sini, P., Nieddu, G., Galioto, M., Fais, M., Iaccarino, C., Cestra, G., Crosio, C., 2020. HDAC1
inhibition ameliorates TDP-43-induced cell death in vitro and in vivo. Cell Death & Disease 11, 369.
https://doi.org/10.1038/s41419-020-2580-3

Santra, M., Dill, K.A., de Graff, A.M.R., 2019. Proteostasis collapse is a driver of cell aging and death. Proceedings of the
National Academy of Sciences of the United States of America 116, 22173–22178.
https://doi.org/10.1073/pnas.1906592116

Sarparanta, J., Jonson, P.H., Kawan, S., Udd, B., 2020. Neuromuscular Diseases Due to Chaperone Mutations: A Review
and Some New Results. International journal of molecular sciences 21. https://doi.org/10.3390/ijms21041409

Sasaki, S., Iwata, M., 1996. Ultrastructural study of synapses in the anterior horn neurons of patients with amyotrophic
lateral sclerosis. Neuroscience letters 204, 53–6. https://doi.org/10.1016/0304-3940(96)12314-4

Sawada, H., 2017. Clinical efficacy of edaravone for the treatment of amyotrophic lateral sclerosis. Expert opinion on
pharmacotherapy 18, 735–738. https://doi.org/10.1080/14656566.2017.1319937

Schaub, F.X., Li, W., Fallahi, M., Yang, C., Schaub, S.K., Lee, S., Tzankov, A., Schmitt, C., Amelio, A.L., Cleveland, J.L., 2015.
Myc-Directed Suppression of Autophagy Provides Therapeutic Vulnerabilities Targeting Amino Acid Homeostasis.
Blood 126, 2450–2450. https://doi.org/10.1182/blood.V126.23.2450.2450

Scheicher, B., Schachner-Nedherer, A.-L., Zimmer, A., 2015. Protamine–oligonucleotide-nanoparticles: Recent advances
in drug delivery and drug targeting. European Journal of Pharmaceutical Sciences 75, 54–59.
https://doi.org/10.1016/j.ejps.2015.04.009

Schiaffino, L., Bonafede, R., Scambi, I., Parrella, E., Pizzi, M., Mariotti, R., 2018. Acetylation state of RelA modulated by
epigenetic drugs prolongs survival and induces a neuroprotective effect on ALS murine model. Scientific Reports
8, 12875. https://doi.org/10.1038/s41598-018-30659-4

Schlosser, I., Hölzel, M., Mürnseer, M., Burtscher, H., Weidle, U.H., Eick, D., 2003. A role for c-Myc in the regulation of
ribosomal RNA processing. Nucleic acids research 31, 6148–56. https://doi.org/10.1093/nar/gkg794

Schludi, M.H., May, S., Grässer, F.A., Rentzsch, K., Kremmer, E., Küpper, C., Klopstock, T., Arzberger, T., Edbauer, D.,
Arzberger, T., Edbauer, D., 2015. Distribution of dipeptide repeat proteins in cellular models and C9orf72 mutation
cases suggests link to transcriptional silencing. Acta Neuropathologica 130, 537–555.
https://doi.org/10.1007/s00401-015-1450-z

Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH Image to ImageJ: 25 years of image analysis. Nature methods 9,
671–5. https://doi.org/10.1038/nmeth.2089

Schosserer, M., Minois, N., Angerer, T.B., Amring, M., Dellago, H., Harreither, E., Calle-Perez, A., Pircher, A., Gerstl, M.P.,
Pfeifenberger, S., Brandl, C., Sonntagbauer, M., Kriegner, A., Linder, A., Weinhäusel, A., Mohr, T., Steiger, M.,
Mattanovich, D., Rinnerthaler, M., Karl, T., Sharma, S., Entian, K.-D., Kos, M., Breitenbach, M., Wilson, I.B.H., Polacek,
N., Grillari-Voglauer, R., Breitenbach-Koller, L., Grillari, J., 2015. Methylation of ribosomal RNA by NSUN5 is a
conserved mechanism modulating organismal lifespan. Nature Communications 6, 6158.
https://doi.org/10.1038/ncomms7158

160
 REFERENCES

Schuhmacher, M., Kohlhuber, F., Hölzel, M., Kaiser, C., Burtscher, H., Jarsch, M., Bornkamm, G.W., Laux, G., Polack, A.,
Weidle, U.H., Eick, D., 2001. The transcriptional program of a human B cell line in response to Myc. Nucleic acids
research 29, 397–406. https://doi.org/10.1093/nar/29.2.397

Schwartz, J.C., Wang, X., Podell, E.R., Cech, T.R., 2013. RNA seeds higher-order assembly of FUS protein. Cell reports 5,
918–25. https://doi.org/10.1016/j.celrep.2013.11.017

Schwarze, S.R., Ho, A., Vocero-Akbani, A., Dowdy, S.F., 1999. In vivo protein transduction: delivery of a biologically active
protein into the mouse. Science (New York, N.Y.) 285, 1569–72. https://doi.org/10.1126/science.285.5433.1569

Scott, M.S., Boisvert, F.-M., McDowall, M.D., Lamond, A.I., Barton, G.J., 2010. Characterization and prediction of protein
nucleolar localization sequences. Nucleic acids research 38, 7388–99. https://doi.org/10.1093/nar/gkq653

Selman, C., Tullet, J.M.A., Wieser, D., Irvine, E., Lingard, S.J., Choudhury, A.I., Claret, M., Al-Qassab, H., Carmignac, D.,
Ramadani, F., Woods, A., Robinson, I.C.A., Schuster, E., Batterham, R.L., Kozma, S.C., Thomas, G., Carling, D.,
Okkenhaug, K., Thornton, J.M., Partridge, L., Gems, D., Withers, D.J., 2009. Ribosomal protein S6 kinase 1 signaling
regulates mammalian life span. Science (New York, N.Y.) 326, 140–4. https://doi.org/10.1126/science.1177221

Shan, X., Chiang, P.-M., Price, D.L., Wong, P.C., 2010. Altered distributions of Gemini of coiled bodies and mitochondria in
motor neurons of TDP-43 transgenic mice. Proceedings of the National Academy of Sciences of the United States
of America 107, 16325–30. https://doi.org/10.1073/pnas.1003459107

Sharma, S., Lafontaine, D.L.J., 2015. “View From A Bridge”: A New Perspective on Eukaryotic rRNA Base Modification.
Trends in biochemical sciences 40, 560–575. https://doi.org/10.1016/j.tibs.2015.07.008

Sharp, P.S., Akbar, M.T., Bouri, S., Senda, A., Joshi, K., Chen, H.-J., Latchman, D.S., Wells, D.J., de Belleroche, J., 2008.
Protective effects of heat shock protein 27 in a model of ALS occur in the early stages of disease progression.
Neurobiology of disease 30, 42–55. https://doi.org/10.1016/j.nbd.2007.12.002

Sheaffer, K.L., Updike, D.L., Mango, S.E., 2008. The Target of Rapamycin pathway antagonizes pha-4/FoxA to control
development and aging. Current biology : CB 18, 1355–64. https://doi.org/10.1016/j.cub.2008.07.097

Shibata, N., Nagai, R., Uchida, K., Horiuchi, S., Yamada, S., Hirano, A., Kawaguchi, M., Yamamoto, T., Sasaki, S., Kobayashi,
M., 2001. Morphological evidence for lipid peroxidation and protein glycoxidation in spinal cords from sporadic
amyotrophic lateral sclerosis patients. Brain research 917, 97–104. https://doi.org/10.1016/s0006-
8993(01)02926-2

Shiels, A., Hejtmancik, J.F., 2017. Mutations and mechanisms in congenital and age-related cataracts. Experimental eye
research 156, 95–102. https://doi.org/10.1016/j.exer.2016.06.011

Shi, K.Y., Mori, E., Nizami, Z.F., Lin, Y., Kato, M., Xiang, S., Wu, L.C., Ding, M., Yu, Y., Gall, J.G., McKnight, S.L., 2017. Toxic
PRn poly-dipeptides encoded by the C9orf72 repeat expansion block nuclear import and export. Proceedings of the
National Academy of Sciences of the United States of America 114, E1111–E1117.
https://doi.org/10.1073/pnas.1620293114

Shiue, C.-N., Berkson, R.G., Wright, A.P.H., 2009. c-Myc induces changes in higher order rDNA structure on stimulation of
quiescent cells. Oncogene 28, 1833–42. https://doi.org/10.1038/onc.2009.21

Shi, Y., Lin, S., Staats, K.A., Li, Y., Chang, W.-H., Hung, S.-T., Hendricks, E., Linares, G.R., Wang, Y., Son, E.Y., Wen, X., Kisler,
K., Wilkinson, B., Menendez, L., Sugawara, T., Woolwine, P., Huang, M., Cowan, M.J., Ge, B., Koutsodendris, N.,
Sandor, K.P., Komberg, J., Vangoor, V.R., Senthilkumar, K., Hennes, V., Seah, C., Nelson, A.R., Cheng, T.-Y., Lee, S.-
J.J., August, P.R., Chen, J.A., Wisniewski, N., Hanson-Smith, V., Belgard, T.G., Zhang, A., Coba, M., Grunseich, C.,
Ward, M.E., van den Berg, L.H., Pasterkamp, R.J., Trotti, D., Zlokovic, B. v, Ichida, J.K., 2018. Haploinsufficiency leads
to neurodegeneration in C9ORF72 ALS/FTD human induced motor neurons. Nature Medicine 24, 313–325.
https://doi.org/10.1038/nm.4490

Shor, B., Wu, J., Shakey, Q., Toral-Barza, L., Shi, C., Follettie, M., Yu, K., 2010. Requirement of the mTOR kinase for the
regulation of Maf1 phosphorylation and control of RNA polymerase III-dependent transcription in cancer cells. The
Journal of biological chemistry 285, 15380–15392. https://doi.org/10.1074/jbc.M109.071639

161
Shubina, M.Y., Arifulin, E.A., Sorokin, D. v, Sosina, M.A., Tikhomirova, M.A., Serebryakova, M. v, Smirnova, T., Sokolov, S.S.,
Musinova, Y.R., Sheval, E. v, 2020. The GAR domain integrates functions that are necessary for the proper
localization of fibrillarin (FBL) inside eukaryotic cells. PeerJ 8, e9029. https://doi.org/10.7717/peerj.9029

Sinha, S., Cheng, K., Schäffer, A.A., Aldape, K., Schiff, E., Ruppin, E., 2020. In vitro and in vivo identification of clinically
approved drugs that modify ACE2 expression. Molecular systems biology 16, e9628.
https://doi.org/10.15252/msb.20209628

Slack, C., Alic, N., Foley, A., Cabecinha, M., Hoddinott, M.P., Partridge, L., 2015. The Ras-Erk-ETS-Signaling Pathway Is a
Drug Target for Longevity. Cell 162, 72–83. https://doi.org/10.1016/j.cell.2015.06.023

Sloan, K.E., Bohnsack, M.T., Watkins, N.J., 2013a. The 5S RNP couples p53 homeostasis to ribosome biogenesis and
nucleolar stress. Cell reports 5, 237–47. https://doi.org/10.1016/j.celrep.2013.08.049

Sloan, K.E., Bohnsack, M.T., Watkins, N.J., 2013b. The 5S RNP couples p53 homeostasis to ribosome biogenesis and
nucleolar stress. Cell reports 5, 237–47. https://doi.org/10.1016/j.celrep.2013.08.049

Smith, B.N., Ticozzi, N., Fallini, C., Gkazi, A.S., Topp, S., Kenna, K.P., Scotter, E.L., Kost, J., Keagle, P., Miller, J.W., Calini, D.,
Vance, C., Danielson, E.W., Troakes, C., Tiloca, C., Al-Sarraj, S., Lewis, E.A., King, A., Colombrita, C., Pensato, V.,
Castellotti, B., de Belleroche, J., Baas, F., ten Asbroek, A.L.M.A., Sapp, P.C., McKenna-Yasek, D., McLaughlin, R.L.,
Polak, M., Asress, S., Esteban-Pérez, J., Muñoz-Blanco, J.L., Simpson, M., SLAGEN Consortium, van R., van Rheenen,
W., Diekstra, F.P., Lauria, G., Duga, S., Corti, S., Cereda, C., Corrado, L., Sorarù, G., Morrison, K.E., Williams, K.L.,
Nicholson, G.A., Blair, I.P., Dion, P.A., Leblond, C.S., Rouleau, G.A., Hardiman, O., Veldink, J.H., van den Berg, L.H., Al-
Chalabi, A., Pall, H., Shaw, P.J., Turner, M.R., Talbot, K., Taroni, F., García-Redondo, A., Wu, Z., Glass, J.D., Gellera, C.,
Ratti, A., Brown, R.H., Silani, V., Shaw, C.E., Landers, J.E., 2014. Exome-wide rare variant analysis identifies TUBA4A
mutations associated with familial ALS. Neuron 84, 324–31. https://doi.org/10.1016/j.neuron.2014.09.027

SMULL, C.E., LUDWIG, E.H., 1962. Enhancement of the plaque-forming capacity of poliovirus ribonucleic acid with basic
proteins. Journal of bacteriology 84, 1035–40. https://doi.org/10.1128/jb.84.5.1035-1040.1962

Sokolowska, E., Kalaska, B., Miklosz, J., Mogielnicki, A., 2016. The toxicology of heparin reversal with protamine: past,
present and future. Expert Opinion on Drug Metabolism & Toxicology 12, 897–909.
https://doi.org/10.1080/17425255.2016.1194395

So, M., Hata, Y., Naiki, H., Goto, Y., 2017. Heparin-induced amyloid fibrillation of β2-microglobulin explained by solubility
and a supersaturation-dependent conformational phase diagram. Protein Science 26, 1024–1036.
https://doi.org/10.1002/pro.3149

Soo, S.K., Rudich, P.D., Traa, A., Harris-Gauthier, N., Shields, H.J., van Raamsdonk, J.M., 2020. Compounds that extend
longevity are protective in neurodegenerative diseases and provide a novel treatment strategy for these devastating
disorders. Mechanisms of Ageing and Development 190, 111297. https://doi.org/10.1016/J.MAD.2020.111297

Soucek, L., Whitfield, J., Martins, C.P., Finch, A.J., Murphy, D.J., Sodir, N.M., Karnezis, A.N., Swigart, L.B., Nasi, S., Ev an, G.I.,
2008. Modelling Myc inhibition as a cancer therapy. Nature 455, 679–83. https://doi.org/10.1038/nature07260

Soulé, S., Mellottée, L., Arab, A., Chen, C., Martin, J.-R., 2020. Jouvence a small nucleolar RNA required in the gut extends
lifespan in Drosophila. Nature Communications 11, 987. https://doi.org/10.1038/s41467-020-14784-1

Sreedharan, J., Blair, I.P., Tripathi, V.B., Hu, X., Vance, C., Rogelj, B., Ackerley, S., Durnall, J.C., Williams, K.L., Bura tti, E.,
Baralle, F., de Belleroche, J., Mitchell, J.D., Leigh, P.N., Al-Chalabi, A., Miller, C.C., Nicholson, G., Shaw, C.E., 2008.
TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science (New York, N.Y.) 319, 1668–72.
https://doi.org/10.1126/science.1154584

Sriskanthadevan-Pirahas, S., Lee, J., Grewal, S.S., 2018. The EGF/Ras pathway controls growth in Drosophila via
ribosomal RNA synthesis. Developmental Biology 439, 19–29. https://doi.org/10.1016/J.YDBIO.2018.04.006

Staats, K.A., Hernandez, S., Schönefeldt, S., Bento-Abreu, A., Dooley, J., van Damme, P., Liston, A., Robberecht, W., van den
Bosch, L., 2013. Rapamycin increases survival in ALS mice lacking mature lymphocytes. Molecular
Neurodegeneration 8, 31. https://doi.org/10.1186/1750-1326-8-31

162
 REFERENCES

Stamatopoulou, V., Parisot, P., de Vleeschouwer, C., Lafontaine, D.L.J., 2018. Use of the iNo score to discriminate normal
from altered nucleolar morphology, with applications in basic cell biology and potential in human disease
diagnostics. Nature Protocols 13, 2387–2406. https://doi.org/10.1038/s41596-018-0044-3

Stefanovsky, V.Y., Pelletier, G., Hannan, R., Gagnon-Kugler, T., Rothblum, L.I., Moss, T., 2001. An immediate response of
ribosomal transcription to growth factor stimulation in mammals is mediated by ERK phosphorylation of UBF.
Molecular cell 8, 1063–73. https://doi.org/10.1016/s1097-2765(01)00384-7

Steffen, K.K., Dillin, A., 2016. A Ribosomal Perspective on Proteostasis and Aging. Cell metabolism 23, 1004–1012.
https://doi.org/10.1016/j.cmet.2016.05.013

Steffen, K.K., MacKay, V.L., Kerr, E.O., Tsuchiya, M., Hu, D., Fox, L.A., Dang, N., Johnston, E.D., Oakes, J.A., Tchao, B.N., Pak,
D.N., Fields, S., Kennedy, B.K., Kaeberlein, M., 2008. Yeast life span extension by depletion of 60s ribosomal subunits
is mediated by Gcn4. Cell 133, 292–302. https://doi.org/10.1016/j.cell.2008.02.037

Steiger, D., Furrer, M., Schwinkendorf, D., Gallant, P., 2008. Max-independent functions of Myc in Drosophila melanogaster.
Nature genetics 40, 1084–91. https://doi.org/10.1038/ng.178

Stenström, L., Mahdessian, D., Gnann, C., Cesnik, A.J., Ouyang, W., Leonetti, M.D., Uhlén, M., Cuylen-Haering, S., Thul, P.J.,
Lundberg, E., 2020. Mapping the nucleolar proteome reveals a spatiotemporal organization related to intrinsic
protein disorder. Molecular systems biology 16, e9469. https://doi.org/10.15252/msb.20209469

Stoklund Dittlau, K., Krasnow, E.N., Fumagalli, L., Vandoorne, T., Baatsen, P., Kerstens, A., Giacomazzi, G., Pavie, B.,
Rossaert, E., Beckers, J., Sampaolesi, M., van Damme, P., van den Bosch, L., 2021. Human motor units in
microfluidic devices are impaired by FUS mutations and improved by HDAC6 inhibition. Stem cell reports 16, 2213–
2227. https://doi.org/10.1016/j.stemcr.2021.03.029

Stout, G.J., Stigter, E.C.A., Essers, P.B., Mulder, K.W., Kolkman, A., Snijders, D.S., van den Broek, N.J.F., Betist, M.C.,
Korswagen, H.C., MacInnes, A.W., Brenkman, A.B., 2013. Insulin/IGF‐1‐mediated longevity is marked by reduced
protein metabolism. Molecular Systems Biology 9, 679. https://doi.org/10.1038/msb.2013.35

Subramanian, A., Narayan, R., Corsello, S.M., Peck, D.D., Natoli, T.E., Lu, X., Gould, J., Davis, J.F., Tubelli, A.A., Asiedu, J.K.,
Lahr, D.L., Hirschman, J.E., Liu, Z., Donahue, M., Julian, B., Khan, M., Wadden, D., Smith, I.C., Lam, D., Liberzon, A.,
Toder, C., Bagul, M., Orzechowski, M., Enache, O.M., Piccioni, F., Johnson, S.A., Lyons, N.J., Berger, A.H., Shamji, A.F.,
Brooks, A.N., Vrcic, A., Flynn, C., Rosains, J., Takeda, D.Y., Hu, R., Davison, D., Lamb, J., Ardlie, K., Hogstrom, L.,
Greenside, P., Gray, N.S., Clemons, P.A., Silver, S., Wu, Xiaoyun, Zhao, W.-N., Read-Button, W., Wu, Xiaohua, Haggarty,
S.J., Ronco, L. v, Boehm, J.S., Schreiber, S.L., Doench, J.G., Bittker, J.A., Root, D.E., Wong, B., Golub, T.R., 2017. A
Next Generation Connectivity Map: L1000 Platform and the First 1,000,000 Profiles. Cell 171, 1437-1452.e17.
https://doi.org/10.1016/j.cell.2017.10.049

Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub,
T.R., Lander, E.S., Mesirov, J.P., 2005. Gene set enrichment analysis: a knowledge-based approach for interpreting
genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of
America 102, 15545–50. https://doi.org/10.1073/pnas.0506580102

Suhm, T., Kaimal, J.M., Dawitz, H., Peselj, C., Masser, A.E., Hanzén, S., Ambrožič, M., Smialowska, A., Björck, M.L.,
Brzezinski, P., Nyström, T., Büttner, S., Andréasson, C., Ott, M., 2018. Mitochondrial Translation Efficiency Controls
Cytoplasmic Protein Homeostasis. Cell metabolism 27, 1309-1322.e6.
https://doi.org/10.1016/j.cmet.2018.04.011

Sundaramoorthy, V., Walker, A.K., Tan, V., Fifita, J.A., Mccann, E.P., Williams, K.L., Blair, I.P., Guillemin, G.J., Farg, M. A.,
Atkin, J.D., 2015. Defects in optineurin- and myosin VI-mediated cellular trafficking in amyotrophic lateral sclerosis.
Human molecular genetics 24, 3830–46. https://doi.org/10.1093/hmg/ddv126

Sung, M.-K., Porras-Yakushi, T.R., Reitsma, J.M., Huber, F.M., Sweredoski, M.J., Hoelz, A., Hess, S., Deshaies, R.J., 2016a.
A conserved quality-control pathway that mediates degradation of unassembled ribosomal proteins. eLife 5.
https://doi.org/10.7554/eLife.19105

163
Sung, M.-K., Reitsma, J.M., Sweredoski, M.J., Hess, S., Deshaies, R.J., 2016b. Ribosomal proteins produced in excess are
degraded by the ubiquitin–proteasome system. Molecular Biology of the Cell 27, 2642–2652.
https://doi.org/10.1091/mbc.e16-05-0290

Suzuki, H., Shibagaki, Y., Hattori, S., Matsuoka, M., 2018. The proline–arginine repeat protein linked to C9-ALS/FTD causes
neuronal toxicity by inhibiting the DEAD-box RNA helicase-mediated ribosome biogenesis. Cell Death & Disease 9,
975. https://doi.org/10.1038/s41419-018-1028-5

Suzuki, N., Maroof, A.M., Merkle, F.T., Koszka, K., Intoh, A., Armstrong, I., Moccia, R., Davis-Dusenbery, B.N., Eggan, K.,
2013. The mouse C9ORF72 ortholog is enriched in neurons known to degenerate in ALS and FTD. Nature
Neuroscience 16, 1725–1727. https://doi.org/10.1038/nn.3566

Syntichaki, P., Troulinaki, K., Tavernarakis, N., 2007. eIF4E function in somatic cells modulates ageing in Caenorhabditis
elegans. Nature 445, 922–926. https://doi.org/10.1038/nature05603

Szaflarski, W., Leśniczak-Staszak, M., Sowiński, M., Ojha, S., Aulas, A., Dave, D., Malla, S., Anderson, P., Ivanov, P., Lyons,
S.M., 2022. Early rRNA processing is a stress-dependent regulatory event whose inhibition maintains nucleolar
integrity. Nucleic Acids Research 50, 1033–1051. https://doi.org/10.1093/nar/gkab1231

Szklarczyk, D., Franceschini, A., Wyder, S., Forslund, K., Heller, D., Huerta-Cepas, J., Simonovic, M., Roth, A., Santos, A.,
Tsafou, K.P., Kuhn, M., Bork, P., Jensen, L.J., von Mering, C., 2015. STRING v10: protein-protein interaction networks,
integrated over the tree of life. Nucleic acids research 43, D447-52. https://doi.org/10.1093/nar/gku1003

Takei, K., Watanabe, K., Yuki, S., Akimoto, M., Sakata, T., Palumbo, J., 2017. Edaravone and its clinical development for
amyotrophic lateral sclerosis. Amyotrophic lateral sclerosis & frontotemporal degeneration 18, 5–10.
https://doi.org/10.1080/21678421.2017.1353101

Tang, X., Toro, A., T.G., S., Gao, J., Chalk, J., Oskarsson, B.E., Zhang, K., 2020. Divergence, Convergence, and Therapeutic
Implications: A Cell Biology Perspective of C9ORF72-ALS/FTD. Molecular Neurodegeneration 15, 34.
https://doi.org/10.1186/s13024-020-00383-7

Tan, R., Frankel, A.D., 1995. Structural variety of arginine-rich RNA-binding peptides. Proceedings of the National Academy
of Sciences of the United States of America 92, 5282–6. https://doi.org/10.1073/pnas.92.12.5282

Tao, Z., Wang, H., Xia, Q., Li, Ke, Li, Kai, Jiang, X., Xu, G., Wang, G., Ying, Z., 2015. Nucleolar stress and impaired stres s
granule formation contribute to C9orf72 RAN translation-induced cytotoxicity. Human Molecular Genetics 24,
2426–2441. https://doi.org/10.1093/hmg/ddv005

Taylor, R.C., Dillin, A., 2011. Aging as an event of proteostasis collapse. Cold Spring Harbor perspectives in biology 3.
https://doi.org/10.1101/cshperspect.a004440

Tejido, C., Pakravan, D., Bosch, L. van den, 2021. Potential Therapeutic Role of HDAC Inhibitors in FUS-ALS. Frontiers in
molecular neuroscience 14, 686995. https://doi.org/10.3389/fnmol.2021.686995

Thandapani, P., O’Connor, T.R., Bailey, T.L., Richard, S., 2013. Defining the RGG/RG motif. Molecular cell 50, 613–23.
https://doi.org/10.1016/j.molcel.2013.05.021

Thielmann, H.W., Popanda, O., Staab, H.J., 1999. Subnuclear distribution of DNA topoisomerase I and Bax protein in
normal and xeroderma pigmentosum fibroblasts after irradiation with UV light and gamma rays or treatment with
topotecan. Journal of cancer research and clinical oncology 125, 193–208.
https://doi.org/10.1007/s004320050263

Thomson, E., Ferreira-Cerca, S., Hurt, E., 2013. Eukaryotic ribosome biogenesis at a glance. Journal of Cell Science 126,
4815–4821. https://doi.org/10.1242/jcs.111948

Tiku, V., Antebi, A., 2018. Nucleolar Function in Lifespan Regulation. Trends in Cell Biology 28, 662–672.
https://doi.org/10.1016/J.TCB.2018.03.007

Tiku, V., Jain, C., Raz, Y., Nakamura, S., Heestand, B., Liu, W., Späth, M., Suchiman, H.Eka.D., Müller, R.-U., Slagboom, P.E.,
Partridge, L., Antebi, A., 2017. Small nucleoli are a cellular hallmark of longevity. Nature Communications 8, 16083.
https://doi.org/10.1038/ncomms16083

164
 REFERENCES

Tohyama, D., Yamaguchi, A., Yamashita, T., 2008. Inhibition of a eukaryotic initiation factor (eIF2Bdelta/F11A3.2) during
adulthood extends lifespan in Caenorhabditis elegans. FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 22, 4327–37. https://doi.org/10.1096/fj.08-112953

Tsai, K.-J., Yang, C.-H., Fang, Y.-H., Cho, K.-H., Chien, W.-L., Wang, W.-T., Wu, T.-W., Lin, C.-P., Fu, W.-M., Shen, C.-K.J., 2010.
Elevated expression of TDP-43 in the forebrain of mice is sufficient to cause neurological and pathological
phenotypes mimicking FTLD-U. The Journal of experimental medicine 207, 1661–73.
https://doi.org/10.1084/jem.20092164

Turner, M.R., Cagnin, A., Turkheimer, F.E., Miller, C.C.J., Shaw, C.E., Brooks, D.J., Leigh, P.N., Banati, R.B., 2004. Evidence
of widespread cerebral microglial activation in amyotrophic lateral sclerosis: an [11C](R)-PK11195 positron
emission tomography study. Neurobiology of disease 15, 601–9. https://doi.org/10.1016/j.nbd.2003.12.012

Tyner, S.D., Venkatachalam, S., Choi, J., Jones, S., Ghebranious, N., Igelmann, H., Lu, X., Soron, G., Cooper, B., Brayton, C .,
Park, S.H., Thompson, T., Karsenty, G., Bradley, A., Donehower, L.A., 2002. p53 mutant mice that display early
ageing-associated phenotypes. Nature 415, 45–53. https://doi.org/10.1038/415045a

Tyzack, G.E., Luisier, R., Taha, D.M., Neeves, J., Modic, M., Mitchell, J.S., Meyer, I., Greensmith, L., Newcombe, J., Ule, J.,
Luscombe, N.M., Patani, R., 2019. Widespread FUS mislocalization is a molecular hallmark of amyotrophic lateral
sclerosis. Brain 142, 2572–2580. https://doi.org/10.1093/brain/awz217

Urushitani, M., Kurisu, J., Tsukita, K., Takahashi, R., 2002. Proteasomal inhibition by misfolded mutant superoxide
dismutase 1 induces selective motor neuron death in familial amyotrophic lateral sclerosis. Journal of
neurochemistry 83, 1030–42. https://doi.org/10.1046/j.1471-4159.2002.01211.x

Urwin, H., Authier, A., Nielsen, J.E., Metcalf, D., Powell, C., Froud, K., Malcolm, D.S., Holm, I., Johannsen, P., Brown, J., Fisher,
E.M.C., van der Zee, J., Bruyland, M., FReJA Consortium, V.B., van Broeckhoven, C., Collinge, J., Brandner, S., Futter,
C., Isaacs, A.M., 2010. Disruption of endocytic trafficking in frontotemporal dementia with CHMP2B mutations.
Human molecular genetics 19, 2228–38. https://doi.org/10.1093/hmg/ddq100

Vabulas, R.M., Hartl, F.U., 2005. Protein Synthesis upon Acute Nutrient Restriction Relies on Proteasome Function.
Science 310, 1960–1963. https://doi.org/10.1126/science.1121925

Valdez, B.C., Perlaky, L., Cai, Z.J., Henning, D., Busch, H., 1998. Green fluorescent protein tag for studies of drug-induced
translocation of nucleolar protein RH-II/Gu. BioTechniques 24, 1032–6. https://doi.org/10.2144/98246cr03

Valdez, G., Tapia, J.C., Lichtman, J.W., Fox, M.A., Sanes, J.R., 2012. Shared Resistance to Aging and ALS in Neuromuscular
Junctions of Specific Muscles. PLoS ONE 7, e34640. https://doi.org/10.1371/journal.pone.0034640

van Blitterswijk, M., Gendron, T.F., Baker, M.C., DeJesus-Hernandez, M., Finch, N.A., Brown, P.H., Daughrity, L.M., Murray,
M.E., Heckman, M.G., Jiang, J., Lagier-Tourenne, C., Edbauer, D., Cleveland, D.W., Josephs, K.A., Parisi, J.E.,
Knopman, D.S., Petersen, R.C., Petrucelli, L., Boeve, B.F., Graff-Radford, N.R., Boylan, K.B., Dickson, D.W.,
Rademakers, R., 2015. Novel clinical associations with specific C9ORF72 transcripts in patients with repeat
expansions in C9ORF72. Acta neuropathologica 130, 863–76. https://doi.org/10.1007/s00401-015-1480-6

Vance, C., Rogelj, B., Hortobágyi, T., de Vos, K.J., Nishimura, A.L., Sreedharan, J., Hu, X., Smith, B., Ruddy, D., Wright, P.,
Ganesalingam, J., Williams, K.L., Tripathi, V., Al-Saraj, S., Al-Chalabi, A., Leigh, P.N., Blair, I.P., Nicholson, G., de
Belleroche, J., Gallo, J.-M., Miller, C.C., Shaw, C.E., 2009. Mutations in FUS, an RNA processing protein, cause familial
amyotrophic lateral sclerosis type 6. Science (New York, N.Y.) 323, 1208–1211.
https://doi.org/10.1126/science.1165942

van Deerlin, V.M., Leverenz, J.B., Bekris, L.M., Bird, T.D., Yuan, W., Elman, L.B., Clay, D., Wood, E.M., Chen-Plotkin, A.S.,
Martinez-Lage, M., Steinbart, E., McCluskey, L., Grossman, M., Neumann, M., Wu, I.-L., Yang, W.-S., Kalb, R., Galasko,
D.R., Montine, T.J., Trojanowski, J.Q., Lee, V.M.-Y., Schellenberg, G.D., Yu, C.-E., 2008. TARDBP mutations in
amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. The Lancet.
Neurology 7, 409–16. https://doi.org/10.1016/S1474-4422(08)70071-1

Vanderweyde, T., Youmans, K., Liu-Yesucevitz, L., Wolozin, B., 2013. Role of stress granules and RNA-binding proteins in
neurodegeneration: a mini-review. Gerontology 59, 524–33. https://doi.org/10.1159/000354170

165
vande Velde, C., McDonald, K.K., Boukhedimi, Y., McAlonis-Downes, M., Lobsiger, C.S., Bel Hadj, S., Zandona, A., Julien, J.-
P., Shah, S.B., Cleveland, D.W., 2011. Misfolded SOD1 associated with motor neuron mitochondria alters
mitochondrial shape and distribution prior to clinical onset. PloS one 6, e22031.
https://doi.org/10.1371/journal.pone.0022031

Vanneste, J., Vercruysse, T., Boeynaems, S., Sicart, A., van Damme, P., Daelemans, D., van den Bosch, L., 2019. C9orf72-
generated poly-GR and poly-PR do not directly interfere with nucleocytoplasmic transport. Scientific Reports 9,
15728. https://doi.org/10.1038/s41598-019-52035-6

van Riggelen, J., Yetil, A., Felsher, D.W., 2010. MYC as a regulator of ribosome biogenesis and protein synthesis. Nature
Reviews Cancer 10, 301–309. https://doi.org/10.1038/nrc2819

Vatsavayai, S.C., Yoon, S.J., Gardner, R.C., Gendron, T.F., Vargas, J.N.S., Trujillo, A., Pribadi, M., Phillips, J.J., Gaus, S.E.,
Hixson, J.D., Garcia, P.A., Rabinovici, G.D., Coppola, G., Geschwind, D.H., Petrucelli, L., Miller, B.L., Seeley, W.W., 2016.
Timing and significance of pathological features in C9orf72 expansion-associated frontotemporal dementia. Brain :
a journal of neurology 139, 3202–3216. https://doi.org/10.1093/brain/aww250

Vidal-Taboada, J.M., Lopez-Lopez, A., Salvado, M., Lorenzo, L., Garcia, C., Mahy, N., Rodríguez, M.J., Gamez, J., 2015.
UNC13A confers risk for sporadic ALS and influences survival in a Spanish cohort. Journal of neurology 262, 2285–
92. https://doi.org/10.1007/s00415-015-7843-z

von der Haar, T., Leadsham, J.E., Sauvadet, A., Tarrant, D., Adam, I.S., Saromi, K., Laun, P., Rinnerthaler, M., Breitenbach-
Koller, H., Breitenbach, M., Tuite, M.F., Gourlay, C.W., 2017. The control of translational accuracy is a determinant
of healthy ageing in yeast. Open biology 7. https://doi.org/10.1098/rsob.160291

Waite, A.J., Bäumer, D., East, S., Neal, J., Morris, H.R., Ansorge, O., Blake, D.J., 2014. Reduced C9orf72 protein levels in
frontal cortex of amyotrophic lateral sclerosis and frontotemporal degeneration brain with the C9ORF72
hexanucleotide repeat expansion. Neurobiology of aging 35, 1779.e5-1779.e13.
https://doi.org/10.1016/j.neurobiolaging.2014.01.016

Wald, A., 1980. A Reprint of ’A Method of Estimating Plane Vulnerability Based on Damage of Survivors.

Walker, C., Herranz-Martin, S., Karyka, E., Liao, C., Lewis, K., Elsayed, W., Lukashchuk, V., Chiang, S.-C., Ray, S., Mulcahy,
P.J., Jurga, M., Tsagakis, I., Iannitti, T., Chandran, J., Coldicott, I., de Vos, K.J., Hassan, M.K., Higginbottom, A., Shaw,
P.J., Hautbergue, G.M., Azzouz, M., El-Khamisy, S.F., 2017. C9orf72 expansion disrupts ATM-mediated
chromosomal break repair. Nature Neuroscience 20, 1225–1235. https://doi.org/10.1038/nn.4604

Walsh, M.J., Cooper-Knock, J., Dodd, J.E., Stopford, M.J., Mihaylov, S.R., Kirby, J., Shaw, P.J., Hautbergue, G.M., 2015.
Invited review: decoding the pathophysiological mechanisms that underlie RNA dysregulation in neurodegenerative
disorders: a review of the current state of the art. Neuropathology and applied neurobiology 41, 109–34.
https://doi.org/10.1111/nan.12187

Wang, I.-F., Guo, B.-S., Liu, Y.-C., Wu, C.-C., Yang, C.-H., Tsai, K.-J., Shen, C.-K.J., 2012. Autophagy activators rescue and
alleviate pathogenesis of a mouse model with proteinopathies of the TAR DNA-binding protein 43. Proceedings of
the National Academy of Sciences of the United States of America 109, 15024–9.
https://doi.org/10.1073/pnas.1206362109

Wang, M., Lemos, B., 2019. Ribosomal DNA harbors an evolutionarily conserved clock of biological aging. Genome
research 29, 325–333. https://doi.org/10.1101/gr.241745.118

Wang, M., Liu, Z., Yuan, Y., Ni, J., Li, W., Hu, Y., Liu, P., Hou, X., Huang, L., Jiao, B., Shen, L., Jiang, H., Tang, B., Wa ng, J.,
2020. A Novel Potentially Pathogenic Rare Variant in the DNAJC7 Gene Identified in Amyotrophic Lateral Sclerosis
Patients From Mainland China. Frontiers in genetics 11, 821. https://doi.org/10.3389/fgene.2020.00821

Warner, J.R., 1999. The economics of ribosome biosynthesis in yeast. Trends in biochemical sciences 24, 437–40.
https://doi.org/10.1016/s0968-0004(99)01460-7

Watson, J.D., Oster, S.K., Shago, M., Khosravi, F., Penn, L.Z., 2002. Identifying genes regulated in a Myc-dependent manner.
The Journal of biological chemistry 277, 36921–30. https://doi.org/10.1074/jbc.M201493200

166
 REFERENCES

Weinmann, R., Roeder, R.G., 1974. Role of DNA-dependent RNA polymerase 3 in the transcription of the tRNA and 5S RNA
genes. Proceedings of the National Academy of Sciences of the United States of America 71, 1790–4.
https://doi.org/10.1073/pnas.71.5.1790

Wen, X., Tan, W., Westergard, T., Krishnamurthy, K., Markandaiah, S.S., Shi, Y., Lin, S., Shneider, N.A., Monaghan, J., Pandey,
U.B., Pasinelli, P., Ichida, J.K., Trotti, D., 2014. Antisense Proline-Arginine RAN Dipeptides Linked to C9ORF72-
ALS/FTD Form Toxic Nuclear Aggregates that Initiate In Vitro and In Vivo Neuronal Death. Neuron 84, 1213–1225.
https://doi.org/10.1016/J.NEURON.2014.12.010

Westeneng, H.-J., van Veenhuijzen, K., van der Spek, R.A., Peters, S., Visser, A.E., van Rheenen, W., Veldink, J.H., van den
Berg, L.H., 2021. Associations between lifestyle and amyotrophic lateral sclerosis stratified by C9orf72 genotype:
a longitudinal, population-based, case-control study. The Lancet. Neurology 20, 373–384.
https://doi.org/10.1016/S1474-4422(21)00042-9

Westergard, T., Jensen, B.K., Wen, X., Cai, J., Kropf, E., Iacovitti, L., Pasinelli, P., Trotti, D., 2016. Cell-to-Cell Transmission
of Dipeptide Repeat Proteins Linked to C9orf72-ALS/FTD. Cell Reports 17, 645–652.
https://doi.org/10.1016/J.CELREP.2016.09.032

White, M.R., Mitrea, D.M., Zhang, P., Stanley, C.B., Cassidy, D.E., Nourse, A., Phillips, A.H., Tolbert, M., Taylor, J.P., Kriwacki,
R.W., 2019. C9orf72 Poly(PR) Dipeptide Repeats Disturb Biomolecular Phase Separation and Disrupt Nucleolar
Function. Molecular Cell 74, 713-728.e6. https://doi.org/10.1016/J.MOLCEL.2019.03.019

White, R.R., Milholland, B., MacRae, S.L., Lin, M., Zheng, D., Vijg, J., 2015. Comprehensive transcriptional landscape of
aging mouse liver. BMC genomics 16, 899. https://doi.org/10.1186/s12864-015-2061-8

Whitfield, J.R., Soucek, L., 2021. The long journey to bring a Myc inhibitor to the clinic. The Journal of cell biology 220.
https://doi.org/10.1083/jcb.202103090

Wichterle, H., Lieberam, I., Porter, J.A., Jessell, T.M., 2002. Directed differentiation of embryonic stem cells into motor
neurons. Cell 110, 385–97. https://doi.org/10.1016/s0092-8674(02)00835-8

Wieczorek, S., Combes, F., Lazar, C., Giai Gianetto, Q., Gatto, L., Dorffer, A., Hesse, A.-M., Couté, Y., Ferro, M., Bruley, C.,
Burger, T., 2017. DAPAR &amp; ProStaR: software to perform statistical analyses in quantitative discovery
proteomics. Bioinformatics (Oxford, England) 33, 135–136. https://doi.org/10.1093/bioinformatics/btw580

Winton, M.J., Igaz, L.M., Wong, M.M., Kwong, L.K., Trojanowski, J.Q., Lee, V.M.-Y., 2008. Disturbance of nuclear and
cytoplasmic TAR DNA-binding protein (TDP-43) induces disease-like redistribution, sequestration, and aggregate
formation. The Journal of biological chemistry 283, 13302–9. https://doi.org/10.1074/jbc.M800342200

Wiśniewski, J.R., Hein, M.Y., Cox, J., Mann, M., 2014. A “Proteomic Ruler” for Protein Copy Number and Concentration
Estimation without Spike-in Standards. Molecular & Cellular Proteomics 13, 3497–3506.
https://doi.org/10.1074/MCP.M113.037309

Wormser, G.P., Halperin, J.J., 2008. Oral doxycycline for neuroborreliosis. The Lancet. Neurology 7, 665–6.
https://doi.org/10.1016/S1474-4422(08)70120-0

Wu, C.-H., Fallini, C., Ticozzi, N., Keagle, P.J., Sapp, P.C., Piotrowska, K., Lowe, P., Koppers, M., McKenna-Yasek, D., Baron,
D.M., Kost, J.E., Gonzalez-Perez, P., Fox, A.D., Adams, J., Taroni, F., Tiloca, C., Leclerc, A.L., Chafe, S.C., Mangroo, D.,
Moore, M.J., Zitzewitz, J.A., Xu, Z.-S., van den Berg, L.H., Glass, J.D., Siciliano, G., Cirulli, E.T., Goldstein, D.B.,
Salachas, F., Meininger, V., Rossoll, W., Ratti, A., Gellera, C., Bosco, D.A., Bassell, G.J., Silani, V., Drory, V.E., Brown,
R.H., Landers, J.E., 2012. Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis. Nature 488,
499–503. https://doi.org/10.1038/nature11280

Xie, J., de Souza Alves, V., von der Haar, T., O’Keefe, L., Lenchine, R. v, Jensen, K.B., Liu, R., Coldwell, M.J., Wang, X., Proud,
C.G., 2019. Regulation of the Elongation Phase of Protein Synthesis Enhances Translation Accuracy and Modulates
Lifespan. Current biology : CB 29, 737-749.e5. https://doi.org/10.1016/j.cub.2019.01.029

Xu, S.-F., Hu, A.-L., Xie, L., Liu, J.-J., Wu, Q., Liu, J., 2019. Age-associated changes of cytochrome P450 and related phase-
2 gene/proteins in livers of rats. PeerJ 7, e7429. https://doi.org/10.7717/peerj.7429

167
Xu, Z., Poidevin, M., Li, X., Li, Y., Shu, L., Nelson, D.L., Li, H., Hales, C.M., Gearing, M., Wingo, T.S., Jin, P., 2013. Ex panded
GGGGCC repeat RNA associated with amyotrophic lateral sclerosis and frontotemporal dementia causes
neurodegeneration. Proceedings of the National Academy of Sciences of the United States of America 110, 7778–
83. https://doi.org/10.1073/pnas.1219643110

Yadavilli, S., Mayo, L.D., Higgins, M., Lain, S., Hegde, V., Deutsch, W.A., 2009. Ribosomal protein S3: A multi-functional
protein that interacts with both p53 and MDM2 through its KH domain. DNA repair 8, 1215–24.
https://doi.org/10.1016/j.dnarep.2009.07.003

Yamakawa, M., Ito, D., Honda, T., Kubo, K., Noda, M., Nakajima, K., Suzuki, N., 2015. Characterization of the dipeptide
repeat protein in the molecular pathogenesis of c9FTD/ALS. Human Molecular Genetics 24, 1630–1645.
https://doi.org/10.1093/hmg/ddu576

Yamashita, S., Ando, Y., 2015. Genotype-phenotype relationship in hereditary amyotrophic lateral sclerosis. Translational
neurodegeneration 4, 13. https://doi.org/10.1186/s40035-015-0036-y

Yang, C., Qiao, T., Yu, J., Wang, H., Guo, Y., Salameh, J., Metterville, J., Parsi, S., Yusuf, I., Brown, R.H., Cai, H., Xu, Z., 2022.
Low-level overexpression of wild type TDP-43 causes late-onset, progressive neurodegeneration and paralysis in
mice. PLOS ONE 17, e0255710. https://doi.org/10.1371/journal.pone.0255710

Yang, K., Wang, M., Zhao, Y., Sun, X., Yang, Y., Li, X., Zhou, A., Chu, H., Zhou, H., Xu, J., Wu, M., Yang, J., Yi, J., 2016. A redox
mechanism underlying nucleolar stress sensing by nucleophosmin. Nature communications 7, 13599.
https://doi.org/10.1038/ncomms13599

Yang, K., Yang, J., Yi, J., 2018. Nucleolar Stress: hallmarks, sensing mechanism and diseases. Cell stress 2, 125–140.
https://doi.org/10.15698/cst2018.06.139

Yang, S., Huang, S., Gaertig, M.A., Li, X.-J., Li, S., 2014. Age-dependent decrease in chaperone activity impairs MANF
expression, leading to Purkinje cell degeneration in inducible SCA17 mice. Neuron 81, 349–65.
https://doi.org/10.1016/j.neuron.2013.12.002

Yao, R.-W., Xu, G., Wang, Ying, Shan, L., Luan, P.-F., Wang, Yang, Wu, M., Yang, L.-Z., Xing, Y.-H., Yang, L., Chen, L.-L., 2019.
Nascent Pre-rRNA Sorting via Phase Separation Drives the Assembly of Dense Fibrillar Components in the Human
Nucleolus. Molecular cell 76, 767-783.e11. https://doi.org/10.1016/j.molcel.2019.08.014

Yilmaz, Ö.H., Katajisto, P., Lamming, D.W., Gültekin, Y., Bauer-Rowe, K.E., Sengupta, S., Birsoy, K., Dursun, A., Yilmaz, V.O.,
Selig, M., Nielsen, G.P., Mino-Kenudson, M., Zukerberg, L.R., Bhan, A.K., Deshpande, V., Sabatini, D.M., 2012.
mTORC1 in the Paneth cell niche couples intestinal stem-cell function to calorie intake. Nature 486, 490–5.
https://doi.org/10.1038/nature11163

Ying, H., Yue, B.Y.J.T., 2016. Optineurin: The autophagy connection. Experimental eye research 144, 73–80.
https://doi.org/10.1016/j.exer.2015.06.029

Yin, S., Lopez-Gonzalez, R., Kunz, R.C., Gangopadhyay, J., Borufka, C., Gygi, S.P., Gao, F.-B., Reed, R., 2017. Evidence that
C9ORF72 Dipeptide Repeat Proteins Associate with U2 snRNP to Cause Mis-splicing in ALS/FTD Patients 19,
2244–2256.

Yi, W.-J., Yang, J., Li, C., Wang, H.-Y., Liu, C.-W., Tao, L., Cheng, S.-X., Zhuo, R.-X., Zhang, X.-Z., 2012. Enhanced nuclear
import and transfection efficiency of TAT peptide-based gene delivery systems modified by additional nuclear
localization signals. Bioconjugate chemistry 23, 125–34. https://doi.org/10.1021/bc2005472

Yogev, O., Saadon, K., Anzi, S., Inoue, K., Shaulian, E., 2008. DNA damage-dependent translocation of B23 and p19 ARF is
regulated by the Jun N-terminal kinase pathway. Cancer research 68, 1398–406. https://doi.org/10.1158/0008-
5472.CAN-07-2865

Yokoseki, A., Shiga, A., Tan, C.-F., Tagawa, A., Kaneko, H., Koyama, A., Eguchi, H., Tsujino, A., Ikeuchi, T., Kakita, A.,
Okamoto, K., Nishizawa, M., Takahashi, H., Onodera, O., 2008. TDP-43 mutation in familial amyotrophic lateral
sclerosis. Annals of neurology 63, 538–42. https://doi.org/10.1002/ana.21392

168
 REFERENCES

Yokoyama, K., Fukumoto, K., Murakami, T., Harada, S., Hosono, R., Wadhwa, R., Mitsui, Y., Ohkuma, S., 2002. Extended
longevity of Caenorhabditis elegans by knocking in extra copies of hsp70F, a homolog of mot-2
(mortalin)/mthsp70/Grp75. FEBS letters 516, 53–7. https://doi.org/10.1016/s0014-5793(02)02470-5

Yuan, X., Zhou, Y., Casanova, E., Chai, M., Kiss, E., Gröne, H.-J., Schütz, G., Grummt, I., 2005. Genetic inactivation of the
transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis. Molecular
cell 19, 77–87. https://doi.org/10.1016/j.molcel.2005.05.023

Yung, B.Y., Busch, H., Chan, P.K., 1985. Translocation of nucleolar phosphoprotein B23 (37 kDa/pI 5.1) induced by
selective inhibitors of ribosome synthesis. Biochimica et biophysica acta 826, 167–73.
https://doi.org/10.1016/0167-4781(85)90002-8

Zaqout, S., Becker, L.-L., Kaindl, A.M., 2020. Immunofluorescence Staining of Paraffin Sections Step by Step. Frontiers in
neuroanatomy 14, 582218. https://doi.org/10.3389/fnana.2020.582218

Zhang, K., Daigle, J.G., Cunningham, K.M., Coyne, A.N., Ruan, K., Grima, J.C., Bowen, K.E., Wadhwa, H., Yang, P., Rigo, F.,
Taylor, J.P., Gitler, A.D., Rothstein, J.D., Lloyd, T.E., 2018. Stress Granule Assembly Disrupts Nucleocytoplasmic
Transport. Cell 173, 958-971.e17. https://doi.org/10.1016/J.CELL.2018.03.025

Zhang, K., Donnelly, C.J., Haeusler, A.R., Grima, J.C., Machamer, J.B., Steinwald, P., Daley, E.L., Miller, S.J., Cunningham,
K.M., Vidensky, S., Gupta, S., Thomas, M.A., Hong, I., Chiu, S.-L., Huganir, R.L., Ostrow, L.W., Matunis, M.J., Wang, J.,
Sattler, R., Lloyd, T.E., Rothstein, J.D., 2015. The C9orf72 repeat expansion disrupts nucleocytoplasmic transport.
Nature 525, 56–61. https://doi.org/10.1038/nature14973

Zhang, W.W., Cheng, W., Parlato, R., Guo, X., Cui, X., Dai, C., Xu, L., Zhu, J., Zhu, M., Luo, K., Zhang, W.W., Dong, B., Wang,
J., Jiang, F., 2020. Nucleolar stress induces a senescence-like phenotype in smooth muscle cells and promotes
development of vascular degeneration. Aging 12, 22174–22198. https://doi.org/10.18632/aging.104094

Zhang, Xiaojie, Li, L., Chen, S., Yang, D., Wang, Y., Zhang, Xin, Wang, Z., Le, W., 2011. Rapamycin treatment augments
motor neuron degeneration in SOD1(G93A) mouse model of amyotrophic lateral sclerosis. Autophagy 7, 412–25.
https://doi.org/10.4161/auto.7.4.14541

Zhang, Y.-J., Gendron, T.F., Ebbert, M.T.W., O’Raw, A.D., Yue, M., Jansen-West, K., Zhang, X., Prudencio, M., Chew, J., Cook,
C.N., Daughrity, L.M., Tong, J., Song, Y., Pickles, S.R., Castanedes-Casey, M., Kurti, A., Rademakers, R., Oskarsson,
B., Dickson, D.W., Hu, W., Gitler, A.D., Fryer, J.D., Petrucelli, L., 2018. Poly(GR) impairs protein translation and stress
granule dynamics in C9orf72-associated frontotemporal dementia and amyotrophic lateral sclerosis. Nature
Medicine 24, 1136–1142. https://doi.org/10.1038/s41591-018-0071-1

Zhang, Y.-J., Gendron, T.F., Grima, J.C., Sasaguri, H., Jansen-West, K., Xu, Y.-F., Katzman, R.B., Gass, J., Murray, M.E.,
Shinohara, M., Lin, W.-L., Garrett, A., Stankowski, J.N., Daughrity, L., Tong, J., Perkerson, E.A., Yue, M., Chew, J.,
Castanedes-Casey, M., Kurti, A., Wang, Z.S., Liesinger, A.M., Baker, J.D., Jiang, J., Lagier-Tourenne, C., Edbauer, D.,
Cleveland, D.W., Rademakers, R., Boylan, K.B., Bu, G., Link, C.D., Dickey, C.A., Rothstein, J.D., Dickson, D.W., Fryer,
J.D., Petrucelli, L., 2016. C9ORF72 poly(GA) aggregates sequester and impair HR23 and nucleocytoplasmic
transport proteins. Nature neuroscience 19, 668–677. https://doi.org/10.1038/nn.4272

Zhang, Y.-J., Guo, L., Gonzales, P.K., Gendron, T.F., Wu, Y., Jansen-West, K., O’Raw, A.D., Pickles, S.R., Prudencio, M.,
Carlomagno, Y., Gachechiladze, M.A., Ludwig, C., Tian, R., Chew, J., DeTure, M., Lin, W.-L., Tong, J., Daughrity, L.M.,
Yue, M., Song, Y., Andersen, J.W., Castanedes-Casey, M., Kurti, A., Datta, A., Antognetti, G., McCampbell, A.,
Rademakers, R., Oskarsson, B., Dickson, D.W., Kampmann, M., Ward, M.E., Fryer, J.D., Link, C.D., Shorter, J.,
Petrucelli, L., 2019. Heterochromatin anomalies and double-stranded RNA accumulation underlie C9orf72 poly(PR)
toxicity. Science 363. https://doi.org/10.1126/science.aav2606

Zhao, J., Yuan, X., Frödin, M., Grummt, I., 2003. ERK-dependent phosphorylation of the transcription initiation factor TIF-
IA is required for RNA polymerase I transcription and cell growth. Molecular cell 11, 405–13.
https://doi.org/10.1016/s1097-2765(03)00036-4

Zhao, J., Zhai, B., Gygi, S.P., Goldberg, A.L., 2015. mTOR inhibition activates overall protein degradation by the ubiquitin
proteasome system as well as by autophagy. Proceedings of the National Academy of Sciences of the United
States of America 112, 15790–7. https://doi.org/10.1073/pnas.1521919112

169
Zhao, T., Hong, Y., Yin, P., Li, S., Li, X.-J., 2017. Differential HspBP1 expression accounts for the greater vulnerability of
neurons than astrocytes to misfolded proteins. Proceedings of the National Academy of Sciences of the United
States of America 114, E7803–E7811. https://doi.org/10.1073/pnas.1710549114

Zhou, Q., Lehmer, C., Michaelsen, M., Mori, K., Alterauge, D., Baumjohann, D., Schludi, M.H., Greiling, J., Farny, D., Flatley,
A., Feederle, R., May, S., Schreiber, F., Arzberger, T., Kuhm, C., Klopstock, T., Hermann, A., Haass, C., Edbauer, D.,
2017. Antibodies inhibit transmission and aggregation of C9orf72 poly‐ GA dipeptide repeat proteins. EMBO
Molecular Medicine 9, 687–702. https://doi.org/10.15252/emmm.201607054

Zhu, L., Richardson, T.M., Wacheul, L., Wei, M.-T., Feric, M., Whitney, G., Lafontaine, D.L.J., Brangwynne, C.P., 2019.
Controlling the material properties and rRNA processing function of the nucleolus using light. Proceedings of the
National Academy of Sciences of the United States of America 116, 17330–17335.
https://doi.org/10.1073/pnas.1903870116

Zhu, Q., Jiang, J., Gendron, T.F., McAlonis-Downes, M., Jiang, L., Taylor, A., Diaz Garcia, S., Ghosh Dastidar, S., Rodriguez,
M.J., King, P., Zhang, Y., la Spada, A.R., Xu, H., Petrucelli, L., Ravits, J., da Cruz, S., Lagier-Tourenne, C., Cleveland,
D.W., 2020. Reduced C9ORF72 function exacerbates gain of toxicity from ALS/FTD-causing repeat expansion in
C9orf72. Nature neuroscience 23, 615–624. https://doi.org/10.1038/s41593-020-0619-5

Zhu, Y., Poyurovsky, M. v, Li, Y., Biderman, L., Stahl, J., Jacq, X., Prives, C., 2009. Ribosomal protein S7 is both a regula tor
and a substrate of MDM2. Molecular cell 35, 316–26. https://doi.org/10.1016/j.molcel.2009.07.014

Zid, B.M., Rogers, A.N., Katewa, S.D., Vargas, M.A., Kolipinski, M.C., Lu, T.A., Benzer, S., Kapahi, P., 2009. 4E -BP Extends
Lifespan upon Dietary Restriction by Enhancing Mitochondrial Activity in Drosophila. Cell 139, 149–160.
https://doi.org/10.1016/j.cell.2009.07.034

Zink, D., Fischer, A.H., Nickerson, J.A., 2004. Nuclear structure in cancer cells. Nature Reviews Cancer 4, 677–687.
https://doi.org/10.1038/nrc1430

Zou, Z.-Y., Zhou, Z.-R., Che, C.-H., Liu, C.-Y., He, R.-L., Huang, H.-P., 2017. Genetic epidemiology of amyotrophic lateral
sclerosis: a systematic review and meta-analysis. Journal of neurology, neurosurgery, and psychiatry 88, 540–549.
https://doi.org/10.1136/jnnp-2016-315018

Zu, T., Liu, Y., Bañez-Coronel, M., Reid, T., Pletnikova, O., Lewis, J., Miller, T.M., Harms, M.B., Falchook, A.E., Subramony,
S.H., Ostrow, L.W., Rothstein, J.D., Troncoso, J.C., Ranum, L.P.W., 2013. RAN proteins and RNA foci from antisense
transcripts in C9ORF72 ALS and frontotemporal dementia. Proceedings of the National Academy of Sciences of
the United States of America 110, E4968-77. https://doi.org/10.1073/pnas.1315438110

170