Applied Microbiology and Biotechnology (2021) 105:4329–4337

https://doi.org/10.1007/s00253-021-11290-2

ENVIRONMENTAL BIOTECHNOLOGY

Bacterial bioreporters for the detection of trace explosives:

performance enhancement by DNA shuffling and random
mutagenesis
Etai Shpigel 1 & Benjamin Shemer 1 & Tal Elad 1 & Anat Glozman 1 & Shimshon Belkin 1

Received: 10 February 2021 / Revised: 28 March 2021 / Accepted: 8 April 2021 / Published online: 4 May 2021
# The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature 2021

Abstract
Landmines and other explosive remnants of war pose a global humanitarian problem that claims numerous casualties long after
the conflict has ended. As there are no acceptable methodologies for the remote discovery of such devices, current detection
practices still require the risky presence of personnel in the minefield. We have recently described bacterial sensor strains capable
of reporting the existence of 2,4-dinitrotoluene (DNT) vapors in the soil above 2,4,6-trinitrotoluene (TNT)-based landmines, by
generating a bioluminescent or a fluorescent signal. This may allow the identification of landmine location by remote imaging of
an area over which the bacteria have been spread. In the study reported herein, we have improved the DNT-detection capabilities
of these sensor strains by combining two DNT-responsive Escherichia coli gene promoters, yqjF and azoR, and subjecting them
to three cycles of random mutagenesis by error-prone PCR, combined with segmentation and rearrangement (“DNA shuffling”).
The activity of selected modified promoters was evaluated with the Aliivibrio fischeri and Photobacterium leiognathi
luxCDABEG gene cassettes as the bioluminescent reporters, exhibiting a ten-fold background reduction that has led to a three-
fold decrease in detection threshold. Signal intensity was further enhanced by modifying the ribosomal binding site of the yqjF
gene promoter. The superior DNT detection capabilities on a solid matrix by the improved sensor strain were demonstrated.

Key points
• Performance of microbial sensor strains for buried explosives was molecularly enhanced.
• Manipulations included random mutagenesis, “DNA shuffling,” and RBS reprogramming.
• The re-engineered constructs exhibited superior detection of trace explosives.

Keywords 2,4-Dinitrotoluene (DNT) . 2,4,6-Trinitrotoluene (TNT) . Microbial bioreporters . Biosensors . Landmines .

Explosives

Introduction risks to personnel and equipment. Furthermore, these technol-

The prevalence of landmines and other explosive remnants
from past conflicts is a global problem that has claimed nu-
merous victims and continues to do so every year. A crucial
difficulty in the demining of large areas is the lack of a reliable
and safe means to detect the landmines’ locations. Current
methodologies, mostly based on metal detection, require the
actual presence of operators in the minefield, with obvious
* Shimshon Belkin
shimshon.belkin@mail.huji.ac.il
1
Department of Plant & Environmental Sciences, Institute of Life
Sciences, The Hebrew University of Jerusalem, Jerusalem, Israel
ogies are characterized by a very high false positive rate and
are highly inefficient in the detection of non-metallic mines
(MacDonald et al. 2003). Alternative approaches, based on
the use of animals to detect explosive vapors emitted from
landmines, suffer from low consistency, and still require
the presence of personnel in proximity to undetected
landmines. As far as we are aware, there is no commer-
cial solution currently available for the remote detection
of buried explosive devices.
One possible answer to this need may be provided by the
use of microorganisms, genetically engineered to respond to
the presence of explosives’ vapors by the generation of a dose-
dependent quantifiable signal. Such microbial bioreporters,
spread across the minefield, would indicate by an optical
4330
signal (fluorescence, luminescence or color generation) the
presence of a landmine in the soil below them; this activity
can then be imaged remotely, providing a map of mine loca-
tions (Burlage et al. 1999). With this or with similar schemes
in mind, several microbial bioreporters, engineered to gener-
ate a dose-dependent optical signal in the presence of 2,4,6-
trinitrotoluene (TNT) and its synthesis byproduct 2,4-
dinitrotoluene (DNT), have been described (Looger et al.
2003; Altamirano et al. 2004; Radhika et al. 2007;
Garmendia et al. 2008; Kim et al. 2008; Davidson et al.
2012; Yagur-Kroll et al. 2014; Shemer et al. 2015; Tan et al.
2015; Yagur-Kroll et al. 2015; Shemer et al. 2017; Shemer
et al. 2020; Shemer et al. 2021). Most of these bioreporters are
based on a plasmid-borne fusion between a gene promoter,
induced by the target analyte, to a reporting element.
While TNT is the most prevalent explosive component of
landmines, the more volatile DNT is considered a better indi-
cator of their presence and is found at higher concentrations at
ground level above buried landmines (Jenkins et al. 1999;
Jenkins et al. 2001; Leggett et al. 2001). Two Escherichia
coli gene promoters, yqjF (Yagur-Kroll et al. 2014) and
azoR (Henshke et al. 2021), were identified as potential sens-
ing elements for the construction of a microbial DNT
bioreporter. Following a series of molecular manipulations
of the yqjF promoter (Yagur-Kroll et al. 2015; Shemer et al.
2020; Shemer et al. 2021), several E. coli TNT/DNT
bioreporter strains have been described, in which the yqjF
gene promoter served as the sensing element and either the
GFPmut2 fluorescent protein gene or bacterial luxCDABE
bioluminescence genes as the reporting elements. The former
bioreporters, immobilized in hydrogel beads, were successful-
ly used to detect actual landmines from a distance of ca. 20 m
(Kabessa et al. 2016; Belkin et al. 2017).
While highly promising, the results of the latter experiment
also highlighted the need for an additional enhancement of
sensor performance, in terms of both signal intensity and de-
tection sensitivity. Several successful attempts towards
achieving these goals were previously reported; these includ-
ed sequential series of random mutagenesis of the yqjF pro-
moter region (Yagur-Kroll et al. 2015), manipulations of
YhaJ, the LysR-type transcriptional regulator of yqjF
(Palevsky et al. 2016, Elad et al, in preparation), the use of
different lux gene cassettes (Shemer et al. 2021), and a high
throughput screening for beneficial host mutations (Shemer
et al. 2020).
In this report, we describe a different approach successfully
implemented for improving DNT detection by an E. coli-
based sensor: employing a combination of error-prone PCR
and DNA shuffling for the generation of a large number of
sequence variants. This powerful approach has been shown to
yield fundamental improvements of diverse target regions,
including both genes and gene promoters (Stemmer 1994a;
Stemmer 1994b; Bacher et al. 2002). The technique is based
Appl Microbiol Biotechnol (2021) 105:4329–4337
on error-prone PCR followed by digestion of the mutated
target DNA into relatively small segments (50-100 bp), which
are then “shuffled” by primer-free PCR followed by regular
PCR. The resulting products are cloned into a relevant vector
and screened for activity. In the present study, we have
adopted this approach to a fusion of the two previously de-
scribed DNT-responsive gene promoters: yqjF and azoR.
Three rounds of the described process have yielded signifi-
cantly improved sensor strains with superior DNT detection
capabilities. Following this procedure, a sensor strain was se-
lected, characterized by a greatly reduced background signal
and by a 3-fold reduction in the DNT detection threshold.
Further enhancement of signal intensity, without sacrificing
detection sensitivity, was achieved by optimizing the ribosom-
al binding site sequence of the yqjF promoter. The latter sen-
sor exhibited a similar detection threshold, with up to a 70-
fold higher signal.
Materials and methods
Chemicals
All chemicals were analytical grade and were purchased from
Sigma-Aldrich. DNT stock solution (27 g/L) was prepared in
ethanol. Restriction enzymes were purchased from New
England Biolabs and DNA purification kits from Qiagen.
Primers, bacterial strains, and plasmids used in this study are
listed in Table 1.
Plasmid construction
The construction of plasmids pBR-C55-luxPl (pBR-C55-Pl),
pBR-C55-luxAf (pBR-C55-Af), and pBR-C55-luxPleio (pBR-
C55-Pleio) harboring a fusion between an improved pyqjF
gene promoter (pC55) and the luxCDABE gene cassette of
the terrestrial bacterium Photorhabdus luminescens, or
luxCDABEG of the marine bacteria Aliivibrio fischeri and
Photobacterium leiognathi, was previously reported
(Shemer et al. 2021). Plasmid pACYC-yhaJ-G2 harbors a mu-
tated version of the yhaJ gene, the yqjF regulator (Palevsky
et al. 2016), following two rounds of random mutagenesis
(Elad et al., unpublished). The plasmids are schematically il-
lustrated in supplementary Figures S1 and S2.
Plasmid pBR-2P-Pl, constructed in the course of the pres-
ent study, contains two gene promoters joined together, as the
starting template for the DNA shuffling procedure. Both pro-
moters, yqjF (version C55) and azoR (version P2G2), are in-
dividually inducible by DNT. Each promoter segment extend-
ed into the initial region of its own gene downstream to the
ATG start codon (see supplementary Fig. S3). The fused pro-
moters were cloned upstream to the luxCDABE gene cassette
of P. Luminescens (luxPl). Construction of the C55 version of
Appl Microbiol Biotechnol (2021) 105:4329–4337 4331

Table 1 Primers, bacterial strains, and plasmids used in this study

Primers Sequence 5′➔3′

13_kpn_F GATCGGGATCCCCGGGTACC
14_SacI_R TCATATTTGCCCCTCCTGAGCTC
28_C55_P2G2_F AACAATCAGCAGCCTGAGTGGCCAGTCTGTCACGCAGCATCAG
29_C55_P2G2_R CTGATGCTGCGTGACAGACTGGCCACTCAGGCTGCTGATTGTT
75_RBS_A2 GCTAAACAGCAGGTCGCGATCACGACTCAAACGTAAGGAGGTTTTTTATGATTAAGAAGATCCCAATG
181_BlpI_R GGCAATATGTCTTTATATTTATTTAATTGCTGAGC
76_RBS_B1 CGCGACCTGCTGTTTAGCGGCCGCGAGCTCGCCACTCAGGCTGC
178_smaI_F GGGATCGGGATCCCCGGGTACC
183_2P_NotI_R CCTCCTGCGGCCGCGCCAGGATGCTGGATTTAAGAAC
234_65_NotI_R CGACCTGCTGTTTAGCGGCCGCGCCAGGATG
Bacterial strains Description Reference
E.coli BW25113 ΔpykF pykF deleted strain (KanR) Baba et al. (2006)
E.coli BL21(DE3) ΔpykF pykF deleted strain (KanR) This work
Plasmids (Fig. S1) Description Reference
pBR-yqjF-Pl Photorhabdus luminescens lux genes, driven by the original yqjF promoter Yagur-Kroll et al. (2014)
pBR-azoR-Pl Photorhabdus luminescens lux genes, driven by the azoR promoter Henshke et al. (2021)
pBR-C55-Pl Photorhabdus luminescens lux genes, driven by the C55 version of the yqjF promoter Shemer et al. (2020)
pBR-2P-Pl Photorhabdus luminescens lux genes, driven by the joined azoR-yqjF promoters This work
pBR-C55-Af Aliivibrio fischeri lux genes, driven by the C55 version of the yqjF promoter Shemer et al. (2020)
pBR-65-Af Aliivibrio fischeri lux genes, driven by the 2PG3-65 (65) promoter This work
pBR-C55-Pleio Photobacterium leiognathi lux genes, driven by the C55 version of the yqjF promoter Shemer et al. (2020)
pBR-65-Pleio Photobacterium leiognathi lux genes, driven by the 65 promoter This work
pBR-65-RBSopt-Pleio Photobacterium leiognathi lux genes, driven by the 65 promoter with an optimized RBS This work
pACYC-yhaJ(G2) Transcription factor of the yqjF gene, yhaJ, after 2 rounds of random mutagenesis. Elad et al., in preparation

the yqjF promoter was reported by Shemer et al. (2020). An
enhanced version of the azoR promoter, denoted P2G2, was
obtained by performing a single round of error-prone PCR
with primers azoR-kpnI-F and azoR-sacI-R, followed by
screening with DNT. The enhanced promoter, incorporating
6 point-mutations in the azoR promoter region, including two
mutations directly in the promoter itself, demonstrated a 10-
fold enhancement in signal intensity (Supplementary Figs S3
and S4). The two joined promoters are referred to below as 2P,
the sequence of which is provided in Figure S5. Cloning was
conducted by PCR amplification of each promoter separately,
using primers 13_kpn_F and 29_C55_P2G2_R for yqjF, and
primers 28_C55_P2G2_F and 14_SacI_R for azoR (Table 1).
The two PCR products were gel-purified, mixed together, and
subjected to another PCR amplification procedure using the
flanking primers 13_kpn_F and 14_SacI_R. The full-length
PCR product, consisting of the two promoters in tandem, was
digested with KpnI and SacI restriction enzymes, and cloned into
plasmid pBR-C55-Pl predigested with the same restriction en-
zymes, to generate plasmid pBR-2P-Pl (Supplementary Fig. S1).
This plasmid was transformed into chemically competent DH5α
cells, and successful transformants were confirmed by
sequencing.
Random mutagenesis by a combination of error-
prone PCR and DNA shuffling
Three rounds of mutagenesis were carried out as follows: error
prone PCR (primers 13_kpn_F and 14_SacI_R) was conducted,
with plasmid pBR-2P-Pl as the targeted template, using Hy-Taq
PCR Ready Mix (Hylabs, Rehovot, Israel) with the addition of
1 mM MnCl2. The ca. 600 bp-PCR product was purified by
agarose gel electrophoresis, partially digested by DNaseI, and sep-
arated again by agarose gel electrophoresis. Digested products
(50–100 bp) were extracted from the gel and subjected to another
PCR step, without primers, followed by a final PCR step with the
above-mentioned primers. A PCR product of the expected full size
of the joined promoters (ca. 600 bp) was purified and cloned into
plasmid pBR-C55-PI, predigested with KpnI and SacI, using the
Gibson assembly technique (New England Biolabs Inc.). The
resulting plasmid library was chemically transformed into compe-
tent DH5α cells and plated on LB-agar plates supplemented with
100 μg/ml ampicillin. The best performing clones from this round
(see below) were used as the templates for the next round of
mutagenesis. The four best promoter variants obtained from the
first and second rounds were combined in equivalent amounts to
serve as the template for the third round of mutagenesis.
4332
Library screening for responses to DNT
Colonies from each of the DNA shuffling mutagenesis rounds
were picked (Microlab Star, HAMILTON, Switzerland) and
inoculated into sterile 96-well plates (Greiner Bio-One) con-
taining 200 μl of LB supplemented with ampicillin. The in-
oculated plates were incubated overnight at 37°C with shaking
(200 rpm), following which every four 96-well plates were
replicated using a 96-pin replicator into a clear sterile 384-
well plate (Greiner Bio-One), each well containing 50 μL
LB supplemented with ampicillin. Following overnight incu-
bation (37°C, 200 rpm), the plates were replicated twice into
two additional 384-well plates (opaque white, clear bottom)
containing LB (20 μl), and regrown for 3h under the same
conditions. Thirty microliter of LB supplemented with DNT
(5 mg/L for the first and 2 mg/L for the second and third
mutagenesis rounds) was then added to one of each pair of
plates, and an equal volume of DNT-free LB to the second
plate. The plates were incubated at room temperature, and
measurements of the bioluminescent signal and OD600 were
performed every 45 min. The responses were compared to
those of plasmid pBR-C55-Pl in DH5α under the same con-
ditions, and colonies exhibiting a superior response were se-
lected for further evaluation. Reporter plasmids from the best
performing clones were extracted, purified, and se-
quenced. Further evaluation of the best-performing
clones was conducted by co-transformation of their plas-
mids with plasmid pACYC-yhaJ-yhaJ(G2) into a pykF-
deleted strain (Shemer et al. 2020).
Bioreporter responses to DNT in liquid media and on
solid matrix
Bioreporter colonies harboring the two plasmids and carrying
a pykF mutation were grown overnight at 37°C with vigorous
agitation in LB supplemented with ampicillin, chlorampheni-
col, or kanamycin (100, 30, and 50 mg/L, respectively). The
culture was diluted ×1/100 in LB without antibiotics, and
regrown under the same conditions to an OD600 = 0.3.
Bacterial aliquots (50 μl) were transferred to an opaque white
96-well plate (Greiner Bio-One), already containing 50 μl of
DNT at various concentrations in 4% ethanol.
Bioluminescence was measured every 15 min at ambient tem-
perature, using a microplate reader (either a TECAN Infinite®
200 PRO, Männedorf, Switzerland, or a Wallac VICTOR2,
Turku, Finland). Each experiment was conducted in duplicate,
and all experiments were repeated at least three times.
The response of bacterial bioreporters to DNT on solid
matrix was measured by immobilizing the bacteria in 1.5-
mm 2% alginate/1% polyacrylic acid beads, as previously
described by Shemer et al. (2021). Bacterial concentration in
the beads, which were kept at 4oC, was ca. 1.5 × 105 cells per
bead. Solid matrix was prepared using 800 μl per well of LB-
Appl Microbiol Biotechnol (2021) 105:4329–4337
agar in a 24-well microtiter plate (Greiner, Bio-One), and
supplementing it with 10 μL of 100% ethanol containing dif-
ferent amounts of DNT. To allow ethanol evaporation, the 24-
well plates were left open in a chemical hood for 1h. Prior to
the experiment, the encapsulated bacteria were removed from
refrigeration and incubated in LB for 2 h at 30°C with shaking
(200 rpm). The beads were then drained of medium and
placed in a single layer over the LB-agar surface of the micro-
titer plate wells (20–30 beads per well). Bioluminescence was
measured in a microplate reader (Infinite® 200 PRO, Tecan)
every 15 min at room temperature. Imaging of the biolumi-
nescent response was performed every 20 min in a dark cham-
ber, using a Sony α7SII camera equipped with a 28-mm lens
(10-s exposure, f=2 and ISO=5000).
Optimization of the yqjF ribosomal binding site
An additional attempt to improve sensor performance was
conducted by manipulating the ribosomal binding site (RBS)
of plasmid pBR-C55-Pleio (Shemer et al. 2021). The RBS
was replaced with a modified sequence designed for maximal
transcription rate of the luxC gene, obtained from de Novo
DNA RBS calculator (Salis Lab, https://salislab.net/
software/), and cloned by overlapping PCR. Since the new
RBS was too long to amplify using one primer, two PCR
amplicons with overlapping end regions were employed.
Primers 75_RBS_A2 and 181_BlpI_R were used to amplify
amplicon A (3′ of the RBS), while primers 76_RBS_B1 and
178_smaI_F were used to amplify amplicon B (5′ of the
RBS). The two amplicons were then mixed with plasmid
pBR-C55-Pleio, predigested with restriction enzymes BlpI
and SmaI, and assembled by the Gibson assembly protocol.
The resulting plasmid, pBR-C55-RBSopt-Pleio (Table 1),
was transformed into competent DH5α cells. The C55 pro-
moter, with and without the optimized RBS, was then re-
placed with one of the selected DNA-shuffled 2P promoters,
2PG3-65 (65). This was achieved by PCR amplification of the
65 promoter using primers 183_2P_NotI_R and 178_SmaI_F
(for cloning promoter 65 with the original RBS), or primers
234_65_NotI_R and 178_SmaI_F (for cloning promoter 65
with the optimized RBS); plasmid pBR-65-Af was used as
target. The amplified PCR products were cloned into plasmids
pBR-C55-Pleio and pBR-C55-RBSopt-Pleio, predigested
with SmaI and NotI restriction enzymes. The resulting plas-
mids were designated pBR-65-Pleio and pBR-65-RBSopt-
Pleio, respectively (Table 1).
Calculations
Luminescence data are presented in the instruments’ arbitrary
relative light units (RLU), either as the difference in the intensity
of the signal in the presence and absence of the inducer (ΔRLU)
or as the response ratio, the luminescence in the presence of the
Appl Microbiol Biotechnol (2021) 105:4329–4337
inducer divided by that in its absence. Detection sensitivity of the
bioreporters to DNT is presented as the EC200 value, representing
the DNT concentration at which the response ratio is equal to 2
(Belkin et al. 1997; Belkin 1998).
Results
Basal activity of the fused promoters
The DNA shuffling procedure described above has been applied
to modified versions of the two E. coli gene promoters previously
shown to be induced by DNT, fused together to form a ca 600 bp
long sequence: C55 (an enhanced version of the yqjF gene
promoter, Shemer et al. 2021) and P2G2 (an enhanced version
of the azoR gene promoter). The response to DNT of the com-
bined construct, prior to subjecting it to the DNA shuffling proce-
dure, is compared in Fig. 1 to that of the two individual promoters,
fused to the same reporter cassette. Signal intensity of the com-
bined promoter (2P) in response to DNT was higher than that of
azoR but lower than yqjF (Fig. 1a); in terms of the response ratio
(Fig. 1b), activation of the fused promoters by DNT was practi-
cally identical to azoR, both being lower than yqjF.
Fig. 1 Responses to DNT of the combined yqjF/azoR gene promoters
(2P) and of the two individual promoters. P. luminescens luxCDABE
gene cassette (luxPl) served as the reporting element for all constructs.
Maximal signal intensity (a) and response ratio (b) in the course of a 5-h
exposure are displayed as a function of DNT concentration.
Luminescence intensity is displayed in the plate reader’s arbitrary relative
light units (RLU) or as the ratio to the uninduced control (response ratio)
4333
Random mutagenesis and DNA shuffling
As described under “Materials and methods,” the 2P promoter
was subjected to three rounds of error-prone PCR, each
followed by a DNA shuffling step. The first round of muta-
genesis yielded ca. 1100 colonies harboring mutated plas-
mids, while the second and third rounds yielded ca. 1500
colonies each. Following each round, a preliminary screening
assay identified several strains harboring mutated plasmids,
the responses of which towards DNT were superior to the
parental plasmids. The plasmids from these transformants
were extracted, sequenced, and transformed into an E. coli
host with a deletion of the pykF gene (Baba et al. 2006;
Shemer et al. 2020), along with the pACYC-yhaJ-G2 plasmid
(Supplementary Figs. S1, S2).
The main improvements in the first two mutagenesis
rounds were reflected by enhanced detection sensitivity (not
shown), an effect which may partially be attributed to the
lower background luminescence that characterized these
clones, and a resulting increase in response ratios. The third
round of mutagenesis resulted in the isolation of several
clones that, in addition, exhibited increased signal intensities,
while maintaining low background activity. The best of these
mutated promoter clones, denoted 65, exhibited a 3-fold lower
detection threshold than the original clone (an EC200 value of
0.06 ± 0.002 mg/L, compared to 0.18 ± 0.006 mg/L). Figure 2
compares the performance of this plasmid with that of its
parent 2P plasmid, displaying the DNT-dependent response
of both bioreporters in terms of signal intensity (Fig. 2a) and
response ratio (Fig. 2b). The significant increase in the re-
sponse ratio was a direct result of the decrease of background
luminescence in variant 65: after 5 h of exposure, for example,
luminescence of the uninduced control was 230,000 RLU for
the 2P-based reporter but <9000 RLU for the 65-based one.
The promoter regions of selected clones from all three mu-
tagenesis rounds were sequenced and aligned against the 2P
parental plasmid (Fig. 3). The average mutation rate in the first
two mutagenesis rounds was 4.25 mutations per clone, and 8
mutations per clone in the 3rd round.
In an attempt to further improve DNT detection, we
have fused the best performing promoter among the
third round clones, variant 65, to two additional lux
gene cassettes, derived from Aliivibrio fischeri (luxAf)
and Photobacterium leiognathi (luxPleio). This resulted
in further background reduction, while maintaining a
high signal intensity, leading to further improvement in
the detection limit. This is demonstrated in Fig. 4,
which displays the EC200 value of each of the three
bioreporters and the signal intensity at that DNT con-
centration. This result is in accordance with earlier data
highlighting the advantages of luxAf and luxPleio over
luxPl (Photorhabdus luminescens), especially at temper-
atures below 30°C (Shemer et al. 2021).
4334
Fig. 2 Responses to DNT of promoter 65, obtained in the third round of
random mutagenesis/DNA shuffling, in comparison to the parental pro-
moter (2P). Maximal signal intensity (a) and response ratio (b) in the
course of a 5-h exposure are displayed as a function of DNT concentra-
tion. Luminescence intensity is displayed in the plate reader’s arbitrary
relative light units (RLU) or as the ratio to the uninduced control (re-
sponse ratio)
Modifications in the ribosomal binding site
A modified RBS, optimized as described under “Materials and
methods,” has been introduced into variant 65; its responses to
DNT have been compared to that of this construct with its native
RBS, as well to those of the yqjF C55 promoter. From the results
presented in Fig. 5, it may be observed that the RBS modification
has caused a marked increase in signal intensity, apparent even in
response to a low DNT concentration (0.12 mg/L), which was
about 70-fold higher than that of the 65-based strain with the
unmodified RBS sequence and 30-fold higher than the C55-
based strain (Fig. 5a). At the same time, a minor increase in the
EC200 value was observed (Fig. 5b).
Fig. 3 Sequence alignment of
selected representatives from the
three random mutagenesis rounds
with the parent 2P sequence.
White bars represent mutations
located in the full-length 2P
promoter. Full sequence
alignment is presented in
supplementary Fig. S6
Appl Microbiol Biotechnol (2021) 105:4329–4337
Fig. 4 Responses to DNT of the promoter variant 65, fused to three lux
reporter cassettes: Photorhabdus luminescens (Pl), Aliivibrio fischeri
(Af), and Photobacterium leiognathi (Pleio), at 27 °C. Results are
presented as signal intensity (ΔRLU, maximal value over 5h) at a DNT
concentration equal to EC200, plotted against the EC200 value
Responses to DNT on a solid matrix
For testing the responses of the bioreporters to traces of DNT on
a solid matrix, they were immobilized in 1.5-mm hydrogel beads
(2% alginate, 1% polyacrylic acid), and placed in a single layer
over LB-agar in the wells of a 24-well microtiter plate. Figure 6 a
is a photographic image acquired 7 h after placing the encapsu-
lated sensor cells on top of the agar; the progressive increase in
signal intensity from the C55 promoter to the 65 promoter and
then to the 65 promoter with the improved RPS sequence is
clearly observed. The response ratio (Fig. 6b) and detection sen-
sitivity, as reflected by the EC200 value (Fig. 6c) remained basi-
cally unmodified in this genetic background. The development
of the bioluminescent signal over the 11:40 h experiment is
shown in supplementary movie S1.
Discussion
Two E. coli gene promoters have previously been shown to be
induced by DNT, the volatile “signature chemical” of buried
TNT-based landmines: yqjF (Yagur-Kroll et al. 2014) and
azoR (Henshke et al. 2021). In the study described herein,
we have fused these two gene promoters together; while this
Appl Microbiol Biotechnol (2021) 105:4329–4337
Fig. 5 Effect of the RBS modification on the response to DNT of
promoter variant 65, compared to the yqjF C55 promoter, with
P. leiognathi’s luxCDABEG gene cassette as the reporter. a
fusion did not offer a significant advantage as a DNT sensing
element over its individual components (Fig. 1), further mo-
lecular manipulations have turned it into a considerably im-
proved sensor. These manipulations included three rounds of
error-prone PCR combined with DNA digestion and
reshuffling (Fig. 2), changing the lux reporter gene cassette
(Fig. 4) and modifying the ribosomal binding site sequence
(Fig. 5). The final construct, when encapsulated in alginate
beads, displayed superior DNT detection over a solid agar
medium (Fig. 6).
DNA shuffling has been demonstrated to be a powerful
tool for enhancing the performance of proteins (Stemmer
1994a; Stemmer 1994b), but employing this approach for
the enhancement of promoter activity was addressed to a
much lesser extent, probably due to the relatively short DNA
sequence that characterizes gene promoters (Wright et al.
2005; Ranjan et al. 2012). Once this problem was solved by
the fusion of two promoters in tandem, the method proved its
efficiency also for sensor design, generating a DNT-sensor var-
iant characterized by a higher luminescence intensity as well as
by a reduced background (uninduced) signal. The combined
Fig. 6 Effect of an RBS modification on the responses to DNT of
promoter variant 65, with P. leiognathi’s luxCDABEG gene cassette as
the reporter, using alginate-encapsulated sensor cells. a Plates imaged in a
dark cell after 7h). b Luminescence response ratio as a function of DNT
concentration. c Signal intensity at the DNT concentration equal to EC200
(maximal value over 5h), plotted against the EC200 value. The image in
4335
Luminescent signal in response to a single DNT concentration (0.12
mg/L). b Signal intensity (maximal value over 5h) at the DNT
concentration equal to EC200, plotted against the EC200 value
effect of both of these changes has been to increase the response
ratio (luminescence in the presence of DNT divided by that in its
absence) by over an order of magnitude in the presence of 1 mg/
L DNT and over 2-fold for 0.1 mg/L. This, in turn, has allowed a
3-fold lower DNT detection threshold. Both operational
parameters—luminescence intensity and detection threshold—
were further improved by switching the reporter genes from the
P. luminescens luxCDABE cassette to the P. leiognathi
luxCDABEG genes. Modification of the RBS sequence has led
to a yet stronger DNT-induced signal, without compromising
detection sensitivity.
Regarding the mutations obtained by the three rounds of
DNA shuffling, it may be noted that some third round clones,
such as 20, 65, or 71 (Fig. 3), could be generated only by
mixing the DNA of the first two mutagenesis rounds followed
by DNA shuffling; a simple error-prone PCR would not be
capable of generating these combinations. This emphasizes
the strength of DNA shuffling as a tool for increasing variabil-
ity. Interestingly, the mutations found were neither in the −10
nor in the −35 regions of either of the two joined promoters. In
addition, two of the clones of the third generation (65 and 71)
panel a was obtained with a Sony α7SII camera equipped with a 28-mm
lens (10-s exposure, f=2, ISO=5,000). Data in panels b and c were derived
from an identical plate incubated in a microtiter plate reader (Infinite®
200 PRO, Tecan). Both sets of measurement were carried out in parallel at
room temperature
4336
were mutated in the ATG start codon of the azoR gene (Fig.
S6). The specific effects of each of the individual mutations
have yet to be determined.
Actual DNT concentrations above buried landmines are high-
ly variable (MacDonald et al. 2003), depending upon landmine
type, soil characteristics, and moisture content. Similar to other
recently E. coli-based DNT sensors (Shemer et al. 2020, 2021),
the enhanced performance of the modified bioreporter described
in this communication should allow the detection of buried ex-
plosive devices at the medium to high concentration range of this
spectrum (mostly characterized by higher soil moisture;
MacDonald et al. 2003). Indeed, while the work described in
the present article was carried out under laboratory conditions,
previously described yqjF-based sensors have already exhibited
mine detection capabilities under field conditions (Belkin et al.
1997; Shemer et al. 2021). The shift to a real minefield will most
likely require further performance enhancement, as well as adap-
tation to specific environmental conditions, most importantly
temperature. Additional concerns that need to be addressed be-
fore larger scale operations can be initiated relate to bioreporter
mass production and encapsulation, shelf life, and ground dis-
persal. In parallel, the engineering aspects involved in the remote
and rapid acquisition of the optical signal emitted by the bacterial
sensors, as well as in real-time signal analysis and interpretation,
need to be resolved. All of these issues are currently under
investigation.
Supplementary Information The online version contains supplementary
material available at https://doi.org/10.1007/s00253-021-11290-2.
Author contribution SB and ES conceived and designed research. ES,
AG, TE, and BS conducted experiments and analyzed data. ES and SB
wrote the manuscript. All authors read and approved the manuscript.
Funding Research was sponsored by the Army Research Office and the
Defense Advanced Research Projects Agency (DARPA) Biological
Technologies Office (BTO) and was accomplished under Cooperative
Agreement Number W911NF-18-2-0002. Research was also partially
supported by the Minerva Center for Bio-Hybrid Complex Systems.
Data availability The datasets generated during and/or analyzed during
the current study are available from the corresponding author on reason-
able request.
Declarations
Disclaimer The views and conclusions contained in this document are
those of the authors and should not be interpreted as representing the
official policies, either expressed or implied, of the Army Research
Office and the Defense Advanced Research Projects Agency (DARPA)
Biological Technologies Office (BTO) or the U.S. Government. The U.S.
Government is authorized to reproduce and distribute reprints for
Government purposes notwithstanding any copyright notation herein.
Ethical approval This article does not contain any studies with human
participants or animals performed by any of the authors.
Appl Microbiol Biotechnol (2021) 105:4329–4337
Conflict of Interest The authors declare no competing interests.
References
Altamirano M, Garcia-Villada L, Agrelo M, Sánchez-Martin L, Martin-
Otero L, Flores-Moya A, Rico M, López-Rodas V, Costas E (2004)
A novel approach to improve specificity of algal biosensors using
wild-type and resistant mutants: an application to detect TNT.
Biosens Bioelectron 19:1319–1323. https://doi.org/10.1016/j.bios.
2003.11.001
Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko
KA, Tomita M, Wanner BL, Mori H (2006) Construction of
Escherichia coli K-12 in-frame, single-gene knockout mutants: the
Keio collection. Mol Syst Biol 2. https://doi.org/10.1038/
msb4100050
Bacher JM, Reiss BD, Ellington AD (2002) Anticipatory evolution and
DNA shuffling. Genome Biol 3:reviews1021.1. https://doi.org/10.
1186/gb-2002-3-8-reviews1021
Belkin S (1998) A panel of stress-responsive luminous bacteria for mon-
itoring wastewater toxicity. In: Bioluminescence methods and pro-
tocols. Springer, pp 247–258. https://doi.org/10.1385/0-89603-520-
4:247
Belkin S, Smulski DR, Dadon S, Vollmer AC, Van Dyk TK, Larossa RA
(1997) A panel of stress-responsive luminous bacteria for the detec-
tion of selected classes of toxicants. Water Res 31:3009–3016.
https://doi.org/10.1016/S0043-1354(97)00169-3
Belkin S, Yagur-Kroll S, Kabessa Y, Korouma V, Septon T, Anati Y,
Zohar-Perez C, Rabinovitz Z, Nussinovitch A, Agranat AJ (2017)
Remote detection of buried landmines using a bacterial sensor. Nat
Biotechnol 35:308–310. https://doi.org/10.1038/nbt.3791
Burlage RS, Patek DR, Everman KR (1999) Method for detection of
buried explosives using a biosensor. US patent, US5972638A
Davidson ME, Harbaugh SV, Chushak YG, Stone MO, Kelley-
Loughnane N (2012) Development of a 2, 4-dinitrotoluene-
responsive synthetic riboswitch in E. coli cells. ACS Chem Biol 8:
234–241. https://doi.org/10.1021/cb300274g
Garmendia J, De Las HA, Galvão TC, De Lorenzo V (2008) Tracing
explosives in soil with transcriptional regulators of Pseudomonas
putida evolved for responding to nitrotoluenes. Microb Biotechnol
1:236–246. https://doi.org/10.1111/j.1751-7915.2008.00027.x
Henshke Y, Shemer B, Belkin S (2021) The Escherichia coli azoR gene
promoter: a new sensing element for microbial biodetection of trace
explosives. Curr Res Biotechnol 3:21–28. https://doi.org/10.1016/j.
crbiot.2021.01.003
Jenkins TF, Leggett DC, Miyares PH, Walsh ME, Ranney TA, Cragin
JH, George V (2001) Chemical signatures of TNT-filled land mines.
Talanta 54:501–513. https://doi.org/10.1016/s0039-9140(00)
00547-6
Jenkins TF, Leggett DC, Ranney TA (1999) Vapor Signatures from
Military Explosives. Part 1. Vapor transport from buried military-
grade TNT. Special Report 99-21, Cold Regions Research &
Engineering Laboratory, US Army Corps of Engineers. https://
apps.dtic.mil/sti/citations/ADA373402
Kabessa Y, Eyal O, Bar-On O, Korouma V, Yagur-Kroll S, Belkin S,
Agranat AJ (2016) Standoff detection of explosives and buried
landmines using fluorescent bacterial sensor cells. Biosens
Bioelectron 79:784–788. https://doi.org/10.1016/j.bios.2016.01.011
Kim J-W, Kim J-H, Tung S (2008) Nanoscale flagellar-motor based
MEMS biosensor for explosive detection. IEEE, pp 630–632.
https://doi.org/10.1109/NEMS.2008.4484411
Leggett DC, Cragin JH, Jenkins TF, Ranney T (2001) Release of
explosive-related vapors from land mines. ERDC/CRREL TR-01-
6, Cold Regions Research & Engineering Laboratory, US Army
Corps of Engineers. https://www.researchgate.net/publication/
Appl Microbiol Biotechnol (2021) 105:4329–4337
235084639_Release_of_Explosive-Related_Vapors_from_Land_
Mines
Looger LL, Dwyer MA, Smith JJ, Hellinga HW (2003) Computational
design of receptor and sensor proteins with novel functions. Nature
423:185–190. https://doi.org/10.1038/nature01556
MacDonald J, Lockwood J, McFee J, Altshuler T, Broach T (2003)
Alternatives for landmine detection. Rand Corporation, Arlington
https://www.rand.org/pubs/monograph_reports/MR1608.html
Palevsky N, Shemer B, Connolly JP, Belkin S (2016) The highly con-
served Escherichia coli transcription factor YhaJ regulates aromatic
compound degradation. Front Microbiol 7:1490. https://doi.org/10.
3389/fmicb.2016.01490
Radhika V, Proikas-Cezanne T, Jayaraman M, Onesime D, Ha JH,
Dhanasekaran DN (2007) Chemical sensing of DNT by engineered
olfactory yeast strain. Nat Chem Biol 3:325–330. https://doi.org/10.
1038/nchembio882
Ranjan R, Patro S, Pradhan B, Kumar A, Maiti IB, Dey N (2012)
Development and functional analysis of novel genetic promoters
using DNA shuffling, hybridization and a combination thereof.
PLoS ONE 7:e31931. https://doi.org/10.1371/journal.pone.
0031931
Shemer B, Koshet O, Yagur-Kroll S, Belkin S (2017) Microbial
bioreporters of trace explosives. Curr Opin Biotechnol 45:113–
119. https://doi.org/10.1016/j.copbio.2017.03.003
Shemer B, Palevsky N, Yagur-Kroll S, Belkin S (2015) Genetically
engineered microorganisms for the detection of explosives’ resi-
dues. Front Microbiol 6:1175. https://doi.org/10.3389/fmicb.2015.
01175
Shemer B, Shpigel E, Glozman A, Yagur-Kroll S, Kabessa Y, Agranat
AJ, Belkin S (2020) Genome-wide gene-deletion screening iden-
tifies mutations that significantly enhance explosives vapor detec-
tion by a microbial sensor. New Biotechnol 59:65–73. https://doi.
org/10.1016/j.nbt.2020.06.002
4337
Shemer B, Shpigel E, Hazan C, Kabessa Y, Agranat AJ, Belkin S (2021)
Detection of buried explosives with immobilized bacterial
bioreporters. Microb Biotechnol 14:251–261. https://doi.org/10.
1111/1751-7915.13683
Stemmer WP (1994a) Rapid evolution of a protein in vitro by DNA
shuffling. Nature 370:389–391. https://doi.org/10.1038/370389a0
Stemmer WP (1994b) DNA shuffling by random fragmentation and re-
assembly: in vitro recombination for molecular evolution. Proc Natl
Acad Sci U S A 91:10747–10751. https://doi.org/10.1073/pnas.91.
22.10747
Tan J, Kan N, Wang W, Ling J, Qu G, Jin J, Shao Y, Liu G, Chen H
(2015) Construction of 2, 4, 6-trinitrotoluene biosensors with novel
sensing elements from Escherichia coli K-12 MG1655. Cell
Biochem Biophys 72:417–428. https://doi.org/10.1007/s12013-
014-0481-8
Wright A, Semyonov A, Dawes G, Crameri A, Lyons R, Stemmer WPC,
Apt D, Punnonen DJ (2005) Diverse plasmid DNA vectors by di-
rected molecular evolution of cytomegalovirus promoters. Hum
Gene Ther 16:881–892. https://doi.org/10.1089/hum.2005.16.881
Yagur-Kroll S, Amiel E, Rosen R, Belkin S (2015) Detection of 2,4-
dinitrotoluene and 2,4,6-trinitrotoluene by an Escherichia coli
bioreporter: performance enhancement by directed evolution. Appl
Microbiol Biotechnol 99:7177–7188. https://doi.org/10.1007/
s00253-015-6607-0
Yagur-Kroll S, Lalush C, Rosen R, Bachar N, Moskovitz Y, Belkin S
(2014) Escherichia coli bioreporters for the detection of 2,4-
dinitrotoluene and 2,4,6-trinitrotoluene. Appl Microbiol
Biotechnol 98:885–895. https://doi.org/10.1007/s00253-013-4888-
8
Publisher’s note Springer Nature remains neutral with regard to jurisdic-
tional claims in published maps and institutional affiliations.