Journal of Mammalogy, 96(6):1255–1274, 2015

DOI:10.1093/jmammal/gyv135
Published online September 24, 2015

Molecular systematic revision of tree bats (Lasiurini): doubling the native

mammals of the Hawaiian Islands
Amy B. Baird,* Janet K. Braun, Michael A. Mares, Juan Carlos Morales, John C. Patton, Christina
Q. Tran, and John W. Bickham
Department of Natural Sciences, University of Houston – Downtown, 1 Main St., Houston, TX 77002, USA (ABB, CQT)
Sam Noble Museum, University of Oklahoma, 2401 Chautauqua Ave., Norman, OK 73072, USA (JKB)
Sam Noble Museum and Department of Biology, University of Oklahoma, 2401 Chautauqua Ave., Norman, OK 73072, USA (MAM)
Global Footprint Network, 312 Clay St., Oakland, CA 94607, USA (JCM)

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Department of Forestry and Natural Resources, Purdue University, West Lafayette, IN 47907, USA (JCP, JWB)
Battelle Memorial Institute, 11767 Katy Freeway, Suite 340, Houston, TX 77079, USA (JWB)
* Correspondent: bairda@uhd.edu

This study reports the phylogenetic relationships of 13 species of lasiurine bats using 4 loci from mitochondrial
and Y-chromosomal DNA. Our results support a sister taxon relationship between the red and hoary bats, with
the yellow bats being more distantly related. Several taxonomic revisions are suggested based on the results of
this study. We support the recognition of 3 separate genera: Lasiurus (red bats), Dasypterus (yellow bats), and
Aeorestes (hoary bats, including A. egregius which groups more closely to the hoary bats than its traditional
placement with the red bats). We recognize L. frantzii as a distinct species and recognize L. blossevillii salinae as
a subspecies rather than species. We elevate 3 previously recognized subspecies of A. cinereus to specific status.
The phylogeography of the endangered Hawaiian hoary bat is studied in detail, and hoary bats are found to have
undergone multiple invasions of the Hawaiian Islands from North America over its evolutionary history. We also
report the presence of 2 species of Aeorestes on the Hawaiian Islands where only one previously had been known.

En este estudio reportamos las relaciones filogenéticas de 13 especies de Lasiurini, utilizando cuatro loci del ADN
mitocondrial y del cromosoma Y. Los resultados apoyan una relación filial cercana entre los murciélagos canosos
y los murciélagos rojos, con los murciélagos amarillos un tanto más distantes. Los resultados también sugieren
varias revisiones taxonómicas. Nosotros reconocemos tres géneros diferentes como sigue: Lasiurus (murciélagos
rojos), Dasypterus (murciélagos amarillos), y Aeorestes (murciélagos canosos o cenizos). Reconocemos a
L. frantzii como especie diferente, y a L. blossevillii salinae a nivel subespecífico en vez de específico. También
elevamos a nivel específico las tres subespecies de A. cinereus previamente reconocidas. Hemos estudiado en
detalle la filogeografía del los murciélagos canosos de Hawaii en peligro de extinción, y encontramos que durante
su historia evolutiva los murciélagos canosos habian invadido las islas hawaianas en múltiples ocasiones desde
Norte América. También en este estudio reconocemos las presencia de dos especies de Aeorestes en las islas
hawaianas, las cuales anteriormente se había reportado como solo una.

Key words: Aeorestes, Dasypterus, Hawaiian hoary bat, Lasiurus, molecular phylogenetics, tree bats

© 2015 American Society of Mammalogists, www.mammalogy.org

The tribe Lasiurini, currently comprised of a single genus,
Lasiurus, is a diverse assemblage of vespertilionid bats distrib-
uted in mainland North and South America and the Caribbean,
Hawaiian, and Galapagos Islands. These bats possess many
unique morphological characters in comparison to other ves-
pertilionids and were therefore placed in their own tribe by
Tate (1942), who considered them to be sufficiently distinct as
to possibly warrant their own subfamily. The monophyly and
distinction of Lasiurini was confirmed by Hoofer and Van Den
Bussche (2003) in their study of vespertilionid molecular phy-
logenetics based on mtDNA and by Roehrs et al. (2010) in their
study of vespertilionine phylogenetics based on mtDNA and
nuclear DNA. Despite the consistent findings of monophyly,
historically the taxonomy of Lasiurus has undergone significant

1255
1256 JOURNAL OF MAMMALOGY
changes and many aspects still are debated. For the purposes of
this study, we follow Wilson and Reeder (2005), who consider
the genus to contain 17 species, 4 of which are divided into
multiple subspecies. Lasiurus is considered by some authors
(including Wilson and Reeder [2005]) to be divided into 2 sub-
genera (previously defined by Tate [1942] as distinct genera):
Lasiurus for the red and hoary bats and Dasypterus for the yel-
low bats. This classification has been disputed by some authors
(e.g., Handley 1960; Baker et al. 1988). Baker et al. (1988)
rejected the subgeneric classification because the patterns of
genetic divergence they found were inconsistent with such
a classification. They noted that there are 3 distinct lineages
within the genus: the red, yellow, and hoary bats. They pro-
posed that these 3 groups should either be considered a single
genus with no subgenera, or that there should be 3 subgenera,
1 for each lineage.
The red bats include: L. blossevillii (South America, west-
ern North America, Trinidad and Tobago, Galapagos) with 4
subspecies, L. borealis (eastern United States), L. pfeifferi
(Cuba), L. degelidus (Jamaica), L. minor (Hispaniola, Puerto
Rico, Bahamas), L. atratus (northeastern South America),
L. castaneus (Panama, Costa Rica), L. ebenus (southeastern
Brazil), L. egregius (Brazil, French Guyana, Panama), L. sali-
nae (Argentina), L. seminolus (southern United States), and
L. varius (southern Argentina, Chile). The hoary bats include
a single species (L. cinereus) with 3 subspecies (1 each occur-
ring in Hawaii, North America, and South America). However,
5 subspecies, rather than 1, were recognized by Gardner and
Handley (2007) in South America. The yellow bats include:
L. ega (southern Texas to South America and Trinidad) with 4
and possibly 5 subspecies, L. insularis (Cuba), L. intermedius
(Central America to southern United States) with 2 subspecies,
and L. xanthinus (Mexico to southwestern United States).
Early morphological studies failed to distinguish many of
these species, especially within the red bats (Koopman and
McCracken 1998). Although not all authors agree on the tax-
onomy described above (e.g., Koopman and McCracken 1998),
we use these species designations as a hypothesis for testing
where species boundaries lie in this genus.
Intrageneric relationships of Lasiurus, although having
been studied with morphology (Hall and Jones 1961), allo-
zymes (Baker et al. 1988), chromosomes (Baker and Patton
1967; Bickham 1987), mtDNA restriction sites (Morales and
Bickham 1995), and mtDNA and nuclear DNA sequences (in
the context of overall Vespertilionidae phylogenetics—Hoofer
and Van Den Bussche 2003; Roehrs et al. 2010), remain unre-
solved. Hall and Jones (1961) hypothesized that the hoary bats,
due to their unique morphology, were the first to diverge in the
evolutionary history of this group and the yellow and red bats
are morphologically most similar to one another. Restriction
fragment analysis of mtDNA ribosomal genes (Morales and
Bickham 1995) placed the hoary and red bats as sister taxa
with some clustering algorithms; however, other clustering
algorithms placed the yellow and red bats as sister taxa, thus
leaving the question unresolved. Allozyme data (Baker et al.
1988) showed an unresolved trichotomy between the yellow,
red, and hoary bats. Mitochondrial and nuclear DNA sequences
confirmed the monophyly of the genus, as well as each species
group (Hoofer and Van Den Bussche 2003; Roehrs et al. 2010).
Like the aforementioned allozyme studies, Hoofer and Van Den
Bussche (2003) found an essentially unresolved trichotomy
among the 3 morphologically distinctive groups using mtDNA.
The authors note that because of the unresolved relationships
among the 3 species groups, their data could neither support nor
refute the validity of Dasypterus sensu Tate (1942). Similarly,
using a combination of mtDNA and nuclear sequences, Roehrs
et al. (2010) could not resolve the placement of the yellow bats
relative to the red and hoary bat.
Some relationships within Lasiurus have been resolved
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
using various genetic markers. The most complete and well-
resolved phylogeny was derived from mtDNA restriction-site
maps (Morales and Bickham 1995). The best-supported tree
recovered was: (yellow bats, (red bats, hoary bats)). Within
the yellow bats, the relationships were as follows: (L. xanthi-
nus, (L. insularis, (L. intermedius, L. ega))). The red bat rela-
tionship found was: (L. blossevillii, ((L. borealis, (L. pfeifferi,
L. seminolus)))). All 3 subspecies of hoary bats were studied,
but the relationships among them were not well resolved.
Allozymes (Baker et al. 1988) were not useful in revealing
structure within the genus. Hall and Jones (1961) proposed a
phylogeny based on morphological characters that disagrees
with the mtDNA phylogeny (Morales and Bickham 1995),
in that the red and yellow bats are sister taxa. It also dif-
fers from the tree recovered by Morales and Bickham (1995)
in the structure within the red bats, as it places L. borealis
and L. seminolus in the same clade (along with L. castaneus
and L. egregius), while L. pfeifferi groups with L. degelidus,
L. minor, and L. brachyotis (which is now a subspecies of
L. blossevillii). Because these studies used different combi-
nations of taxa and recovered different relationships, a com-
plete understanding of the evolutionary history of Lasiurus
still is lacking.
Lasiurus cinereus is unique among all extant bats in that
it has been able to successfully establish populations on the
Hawaiian Islands. Currently, the Hawaiian populations com-
pose a distinct subspecies, L. cinereus semotus. The relation-
ship of this subspecies to the North (L. c. cinereus) and South
American (L. c. villosissimus) subspecies has not been well
studied. The only genetic data addressing its relationship to
other L. cinereus came from mtDNA restriction data (Morales
and Bickham 1995). In that study, the authors found that there
was very low support for relationships within L. cinereus, and
their results showed 2 weakly supported clades within the spe-
cies: one that placed Hawaiian L. c. semotus within a clade of
North American L. c. cinereus and another that placed South
American L. c. villosissimus within a different clade of North
American L. c. cinereus. The low resolution of this study is
not unexpected given the relatively few informative charac-
ters that restriction mapping supplies. We aim to increase this
resolution with DNA sequence data and address the question
of whether the Hawaiian populations originated from North or
South America.
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS
The morphology and behavior of the Hawaiian hoary bats
have been studied. They exhibit a significant reduction in body
size (Jacobs 1996—although we note that this author only used
specimens from the Island of Hawaii), have a generalized diet
(Whitaker and Tomich 1983), and some individuals roost in
caves (Fujioka and Gon 1988), whereas all mainland L. cinereus
are known to be obligate tree roosters. It currently is unknown
when L. c. semotus arrived in Hawaii and began to differentiate
from mainland subspecies. These morphological and behav-
ioral differences from other L. cinereus make establishing an
accurate taxonomic and phylogeographic history of this sub-
species important for conservation purposes due to its listing as
endangered under the United States Endangered Species Act,
as well as to enhance our understanding of Hawaiian faunal
history.
The goal of this study is to produce a well-resolved phylog-
eny of interspecies and subspecies relationships of Lasiurus
and to present a timeline for the diversification of the major
clades within the genus. In particular, we aim to resolve the
existing trichotomy among the red, hoary, and yellow bats and
we examine the validity of certain species described based on
genetic markers. Additionally, we examine the phylogeogra-
phy and taxonomic status of the Hawaiian hoary bat. Finally,
we propose a new taxonomic arrangement of the group with
monophyletic taxa arranged hierarchically according to their
phylogenetic relationships and genetic divergence.
Materials and Methods
Sampling.—A total of 109 individuals was examined
(Appendix I). We obtained tissue samples from 13 of the
17 recognized species of Lasiurus: L. atratus, L. blossevil-
lii, L. borealis, L. cinereus, L. ega, L. egregius, L. insularis,
L. intermedius, L. pfeifferi, L. salinae, L. seminolus, L. varius,
and L. xanthinus. Of the species with recognized subspecies,
we sampled 3 subspecies of L. blossevillii (L. b. blossevillii,
L. b. frantzii, and L. b. teliotis), 3 subspecies of L. cinereus
(L. c. cinereus, L. c. seminolus, and L. c. villosissimus), 2 sub-
species of L. ega (L. e. ega and L. e. panamensis), and 1 sub-
species of L. intermedius (L. i. intermedius). A list of samples
used is found in Appendix I. We were unable to obtain tissue
samples for the remaining species (L. degelidus, L. minor,
L. ebenus, and L. castaneus).
DNA sequencing.—DNA was extracted from frozen tis-
sue and amplified and sequenced using the primers shown in
Table 1. We examined the mitochondrial genes NADH dehy-
drogenase 1 (ND1), NADH dehydrogenase 2 (ND2), and cyto-
chrome-b (Cytb), and 1 nuclear locus, the dead box Y (DBY)
gene on the Y chromosome. We attempted amplification and
sequencing for all individuals but were not successful for some.
Ninety-three of the 109 individuals were sequenced for ND1,
54 for Cytb, 44 for ND2, and 33 for DBY. GenBank accession
numbers for each sequence can be found in Appendix I.
Phylogenetic analyses.—Data from each gene were analyzed
independently. Each dataset was analyzed with jModelTest ver-
sion 2.1.4 (Darriba et al. 2012) to assess the appropriate model
of evolution. That model was implemented in a maximum
1257
likelihood analysis using GARLI version 0.96 (Zwickl 2006)
and a Bayesian analysis using MrBayes version 3.1.2 (Ronquist
and Huelsenbeck 2003). Each Bayesian analysis was per-
formed using 5 million generations with a sample frequency of
1,000 generations. The program Tracer version 1.5 (Rambaut
and Drummond 2009) was used to determine that the burn-in
selected (25%) was appropriate and that convergence had been
reached. Posterior probabilities were obtained by MrBayes and
100 bootstrap replicates were performed on the maximum like-
lihood data with GARLI. Trees were visualized using FigTree
version 1.4.0 (Rambaut 2012).
Additionally, we used a species tree approach implemented
in *BEAST version 1.7.5 (Drummond et al. 2012) to examine
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
the overall relationships among the major lineages of Lasiurus.
For this analysis, we used all individuals within a species that
had been sequenced for all 4 loci in order to minimize miss-
ing data, which can be problematic in model-based phylogeny
reconstruction (Lemmon et al. 2009). For some species, we did
not have representatives sampled at all loci. These included
L. cinereus from Hawaii (no DBY sequenced), L. insularis (no
DBY), L. intermedius (no Cytb), and another L. intermedius
sample with no DBY. L. salinae was left out of the analysis
because it had only been sequenced for 1 locus (ND1). The
models identified by jModelTest above were implemented for
each locus independently. We unlinked the DBY tree model
from the mtDNA loci (which remained linked to each other
because of the lack of recombination among mtDNA loci). We
used a strict clock model and default priors. The species tree
prior was set to species tree: Yule process. The MCMC was run
for 100,000,000 generations and the program Tracer version 1.5
(Rambaut and Drummond 2009) was used to ensure that con-
vergence had been reached using 10% burn-in. TreeAnnotator
version 1.7.5 (Drummond et al. 2012) was used to summarize
the results and generate the final tree file.
Divergence estimates.—The program BEAST version 1.7.5
(Drummond et al. 2012) was used to calculate divergence times
for the major clades of Lasiurus. We chose 1 individual from
each of the following species to use in the analysis: L. blossevillii
(1 each from North and South America), L. atratus, L. borealis,
L. pfeifferi, L. seminolus, L. insularis, L. intermedius, L. varius,
L. egregius, L. cinereus (including all 3 subspecies), L. xanthi-
nus, and L. ega (1 each from North and South America). In order
to calculate divergence times for the ingroup, 2 outgroup taxa
were used, Tadarida brasiliensis and Myotis lucifugus. Based on
oldest known fossils for the split between molossids and ves-
pertilionids, we used a minimum age for the Tadarida/vesper-
tilionid split as 37 Ma. For the Myotis/Lasiurus split, we used
a minimum age of 20 Ma (Teeling et al. 2005), as this is the
age of the oldest confirmed Myotis fossil. Because we were only
certain of minimum node ages based on fossil data, we applied
exponential distribution priors for node age distributions for
both the Tadarida/vespertilionid split and Myotis/Lasiurus split
(Ho and Phillips 2009). We did not include fossil data from
the ingroup (Lasiurus) as a way of testing the divergence esti-
mates given by this analysis against the known fossil record of
Lasiurus. The tree prior we selected was speciation birth-death,
as the speciation models are the most appropriate tree priors for
1258 JOURNAL OF MAMMALOGY

Table 1.—List of primers used in this study. Last column indicates whether the primer was used in a PCR reaction, sequencing reaction, or both.

Locus Primer name Sequence (5′-3′) PCR/Seq

Cytb LGL765 GAAAAACCAYCGTTGTWATTCAACT Both
Cytb LGL766 GTTTAATTAGAATYTYAGCTTTGGG Both
Cytb BLO Cytb 70 F YTWCCAGCCCCTTCAAAYATCT Seq
Cytb LA CIN Cytb 300 F GGTCGAGGCCTTTACTATGG Seq
Cytb EPT 400 F GAGGMCAAATATCTTTYTGAGG Seq
Cytb LA BLO Cytb 400 F GRGGYCAAATATCCTTCTGAGG Seq
Cytb Red Cytb 530 R GGAAGGCGAAGAATCGRGTCA Seq
Cytb Cin Cytb 520 R AARAATCGTGTYAAGGTGGGTTT Seq
Cytb Ega Cytb 525 R AGGYAAAAAATCGGGTYAAGG Seq
Cytb In Cytb 525 R AAGGYGAAAAATCGGGTTAGG Seq
Cytb LA TEL Cytb 580 R AGAAGGTGAACTATAACCATTGC Seq
Cytb L Cin Cytb 620 R GAATTCCYATCGGGTTATTRGATCC Seq

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Cytb L Cin Cytb 750 R ATCAGGTTCTCCTAGCATGTCG Seq
Cytb TEL Cytb 840 R GGYACTGATCGTAGRATTGCAT Seq
Cytb LAS Cytb 850 R GCRAATARGAARTATCAYTCTGG Seq
Cytb LAS Cytb 900 Red R CCYAGTTTGTTTGGYACTGATCG Seq
Cytb LAS Cytb 900 CY R CCTARTTTRTTGGGTACRGATCGTA Seq
ND1 LGL381 ACCCCGCCTGTTTACCAAAAACAT Both
ND1 LGL563 GGTATGAGCCCGATAGCTTA Both
ND1 LAS 287 F CCTACGTGATCTGAGTTCAGACC Both
ND1 L Cin ND1 F AAGTGGCAGAGACCGGTAAT Both
ND1 LAS 290 F CGGYAATTGCRTAAAACTTAAGCTT Both
ND1 LAS ND1 IN F TTGGTGCYCTACGYGCAGTAGC Seq
ND1 RD LAS ND1 F GGATGAGCYTCYAATTCAAARTATGC Seq
ND1 CIN LAS ND1 F GGATGAGCATCAAATTCTAARTATGC Seq
ND1 YEL LAS ND1 F GGATGAGCTTCAAATTCAAAATAYGC Seq
ND1 LAS ND1 500 R TCTATCARGTCAAAAGGAGCTCG Seq
ND1 L Cin ND1 800 R GGTATGATGCTCGGACTCATAGG Seq
ND1 YEL LAS ND1 R CRGCATATTCTACATTRAATCC Seq
ND1 RD LAS ND1 R CKGCATATTCTACATTAAAYCC Seq
ND1 L CIN ND1 R TCTTAGGGGTAGGTTCAATTCCT Both
ND2 LGL562 TAAGCTATCGGGCCCATACC Both
ND2 LGL452 ACTTCAGGGTGCCCAAAGAATCA Both
ND2 ART 562 AGTAAGGTCAGCTAAATAAGCTATCG Both
ND2 ART 562 SEQ CCGAAAATGTTGGTTTATATCC Seq
ND2 L Cin ND2 200 F ACAAGCAACAGCCTCAATGC Seq
ND2 LAS ND2 400 F TGAGTRCCAGAAGTGACCCAAGG Seq
ND2 CIN LAS ND2 400 F TGAGTRCCAGAAGTAACTCARGG Seq
ND2 L Cin ND2 950 R TGTTACGATAGGGAGGAATAGAGG Seq
ND2 ART ND2 R GCTTTGAAGGCTCTTGGTCT Both
DBY VDBYX7Y F GACTCCAGTGCAAAAATATGCC Both
DBY Ves DBin7Y F KCCTATGAKCCATAAAAATGTRGG Seq
DBY LA DBin7Y F2 CAAACCGGATTTGGCCAACACC Seq
DBY LA DBin7Y dnR CTYAGGGTGTACTGACTGC Seq
DBY HDBY 7R CAGCCAATTCTCTTGTTGGG Both

examining interspecies relationships. The clock model selected
was the lognormal relaxed clock. We used a concatenation of
the 3 mitochondrial gene sequences described above. Y chromo-
some sequences were not included in this analysis because of
the lack of data from 2 key taxa: L. cinereus from Hawaii and
L. salinae from Argentina. Because a major goal of the dating
analysis was to determine the time to colonization of Hawaii, we
chose to exclude the Y chromosome data from the analysis due
to concerns over missing data (see above), rather than to exclude
the Hawaiian Lasiurus from an analysis of all loci. Models of
evolution for each partition were specified independently. The
BEAST analysis was run for 100 million generations and the
software Tracer version 1.5 (Rambaut and Drummond 2009)
was used to determine that convergence had been reached. This
analysis was repeated a 2nd time to ensure maximum conver-
gence. TreeAnnotator version 1.7.5 (Drummond et al. 2012) was
used to summarize the BEAST results and generate the final tree.
Taxonomic revisions.—To determine whether any taxonomic
revisions needed to be applied to our study group, we gathered
data from both molecular and morphological sources. We first
compared molecular divergences recovered here to other molec-
ular studies on mammals, and particularly studies on vesper-
tilionid bats. We compared levels of molecular differentiation
at the intraspecific, interspecific, intrageneric, and intergeneric
levels of our taxa to those recovered in other mammalian stud-
ies. We also examined our data for consistent findings of recip-
rocal monophyly across the above levels of taxonomy for the
genetic markers we examined. If, based on the above steps, we
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS 1259

determined that a possible taxonomic change was warranted,
we went back to the morphological literature on Lasiurus to
determine whether there were also morphological justifications
for our hypothesized changes.
Results
The data we obtained were able to resolve 3 major lineages that
correspond to the red, yellow, and hoary bats. Three of the 4 loci
we examined (ND1, Cytb, and DBY) group the red and hoary
bats as sister taxa, separate from the yellow bats (Figs. 1, 2, and
4). The remaining locus, ND2, shows weak support for the hoary
and yellow bats as sister taxa (Fig. 3). However, the combined
dataset of all mtDNA loci used in the divergence time analysis
(Fig. 5) and the combined data from all loci in the species tree
analysis (Fig. 6) strongly supports the red and hoary bats as being
sister taxa. Furthermore, it is clear that the red, hoary, and yellow
bats each represent well-supported monophyletic groups with
the exception of one traditionally recognized red bat species,
L. egregius, which groups with the hoary bats.
Red bats.—Red bats form a monophyletic group, with the
exception of L. egregius, which groups sister to the traditionally
recognized hoary bat clade. The red bats are the sister group to
the hoary bats plus L. egregius. Each currently recognized spe-
cies included in our analysis formed a well-supported mono-
phyletic group, with the exception of L. salinae from Argentina,

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Fig. 1.—Maximum likelihood tree for the ND1 locus. Support values are given as bootstrap proportions/Bayesian posterior probabilities. They
are coded as follows: + indicates a bootstrap value > 80 or pp >0.95; − indicates bootstrap value from 51 to 79 or pp between 51 and 94; * indi-
cates bootstrap or pp < 50. Note that in the maximum likelihood tree shown, there is no support for a monophyletic South American L. cinereus.
However, with 100 bootstrap replicates and Bayesian analysis, the monophyletic relationship is supported at 53/0.89. HI = Hawaii; NA = North
America; pp = posterior probability; SA = South America.
1260 JOURNAL OF MAMMALOGY

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Fig. 2.—Maximum likelihood tree for the Cytb locus. Support values are given as bootstrap proportions/Bayesian posterior probabilities. They are
coded as follows: + indicates a bootstrap value > 80 or pp > 0.95; − indicates bootstrap value from 51 to 79 or pp between 51 and 94; * indicates
bootstrap or pp < 50. HI = Hawaii; NA = North America; pp = posterior probability; SA = South America.

Fig. 3.—Maximum likelihood tree for the ND2 locus. Support values are given as bootstrap proportions/Bayesian posterior probabilities. They are
coded as follows: + indicates a bootstrap value > 80 or pp > 0.95; − indicates bootstrap value from 51 to 79 or pp between 51 and 94; * indicates
bootstrap or pp < 50. HI = Hawaii; NA = North America; pp = posterior probability; SA = South America.

which appears to be a member of the L. blossevillii lineage. The the red bats are not resolved, we can conclude that the South
North American (L. borealis and L. seminolus) and Cuban (L. American red bat species examined are not monophyletic.
pfeifferi) species are supported as being a monophyletic group. L. atratus is quite distinct from the remaining red bats and does
Although some aspects of the phylogenetic structure within not group with the other South American species.
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS 1261

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Fig. 4.—Maximum likelihood tree for the DBY locus. Support values are given as bootstrap proportions/Bayesian posterior probabilities. They
are coded as follows: + indicates a bootstrap value > 80 or pp >0.95; − indicates bootstrap value from 51 to 79 or pp between 51 and 94. On this
phylogeny, 2 outgroups (Myotis lucifugus and Myotis velifer) have been omitted due to the length of the branches to save space. HI = Hawaii; NA
= North America; pp = posterior probability; SA = South America.

The Mexican and Central American subspecies of L. blos-
sevillii (L. b. teliotis/frantzii) are genetically quite divergent
from the remaining L. blossevillii from South America at all
of the mitochondrial loci (average of about 14% k2p dis-
tance at Cytb; Figs. 1–3); however, L. blossevillii from South
America is indistinguishable based on the Y chromosome
DBY sequence (Fig. 4). The relationship of the Galapagos
subspecies L. b. brachyotis from other L. blossevillii was not
evaluated due to the lack of sample material. Clustered well
within the L. blossevillii clade in the ND1 tree (Fig. 1) was
the single sample of L. salinae, a species whose existence has
been unclear for 100 years (see Mares et al. 1995; Barquez
et al. 1999). The average divergence between L. salinae and
L. blossevillii at the ND1 locus is about 2%, whereas the
average divergence within L. blossevillii is higher, at 2.6%.
The position of L. varius varies between loci examined. With
ND2 and DBY it is supported as being at the base of the red
bat clade, whereas with Cytb it is sister to L. blossevillii, and
with ND1 its position is not statistically supported, though it is
clearly a member of the red bat clade. In the combined mtDNA
analysis performed using BEAST, with a single specimen of
each species, the analysis supported L. varius at a basal posi-
tion relative to the remaining red bats (Fig. 5), and this basal
relationship was also recovered with the *BEAST species tree
using all 4 loci (Fig. 6).
Yellow bats.—The 4 recognized species of yellow bats are
all genetically differentiated from one another. L. xanthinus
from North America is quite distant (17–19% k2p dis-
tance at Cytb) and is the most basal lineage of yellow bats.
L. insularis and L. intermedius are sister taxa with about
13% divergence between them. This level of divergence
indicates that L. insularis is indeed a valid species, which
has been debated by several authors in the past (e.g., Hall
and Jones 1961; Silva-Taboada 1976). Within L. ega, the
South American specimens form a clade that is sister to
the remaining North and Central American specimens. The
North and South American L. ega differ from each other by
about 9% k2p distance at Cytb. One interesting observation
is that for ND1, L. ega is not monophyletic (Fig. 1), but for
the remaining loci examined, it is supported as being mono-
phyletic (Figs. 2–4).
Hoary bats.—We find 3 distinct mtDNA clades of L. cinereus
(Figs. 1–3; see Fig. 1 legend for explanation of depiction of
non-monophyly at that locus) that we interpret to represent the
3 subspecies recognized by Wilson and Reeder (2005). Our 2
samples of South American L. cinereus are from the geographic
range of L. c. villosissimus recognized by Gardner and Handley
(2007). The South American subspecies (L. c. villosissimus) is
the sister group to the other subspecies and is a monophyletic
clade in Fig. 3. L. cinereus from Hawaii are found in 2 dis-
tinct clades on the phylogeny: one consisting of only Hawaiian
L. c. semotus from Maui and the Big Island of Hawaii, whereas
other individuals from Maui group within a clade that includes
all North American specimens (L. c. cinereus). We consider
1262 JOURNAL OF MAMMALOGY

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Fig. 5.—Divergence time estimates. Results are from a concatenation of the 3 mitochondrial gene sequences. Scale is in millions of years before pres-
ent. Gray bars at nodes represent the 95% highest posterior density for the mean age. Asterisks represent nodes supported at 98% or greater posterior
probability. The node without an asterisk is supported at 55% posterior probability. HI = Hawaii; NA = North America; SA = South America.

Fig. 6.—Species tree analysis. Results are based on sequence data from all 4 loci using the species tree approach implemented in *BEAST.
Numbers at nodes represent Bayesian posterior probabilities. HI = Hawaii; NA = North America; SA = South America.

the uniquely Hawaiian clade to represent L. c. semotus and the
clade that includes both Hawaiian and North American speci-
mens to represent L. c. cinereus.
There are variable degrees of sequence divergence within and
among subspecies of L. cinereus. Within the South American
subspecies (L. c. villosissimus), there is about 4% (k2p)
sequence divergence at ND1 (multiple South American speci-
mens were not sequenced for Cytb); within the North American
subspecies (L. c. cinereus), there is only 0–1% k2p divergence
at Cytb. Within the L. c. semotus clade, there is < 1% divergence.
Between the South American subspecies and both the Hawaiian
(L. c. semotus) and North American (L. c. cinereus) subspecies,
there is greater than 11% k2p sequence divergence at Cytb,
while the Hawaiian and North American subspecies diverge
about 4% k2p at Cytb.
Species tree and divergence times.—Results from the BEAST
divergence time analysis are shown in Fig. 5. These data indi-
cate that the split between Myotis and Lasiurus occurred about
33 Ma (22.1–44.7 Ma, 95% highest posterior density), the split
between the yellow bats and the rest of Lasiurus occurred about
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS
18.5 Ma (12.2–26.5 Ma), and the split between the red and
hoary bats occurred about 14 Ma (9.1–20.8 Ma; Fig. 5). These
results are consistent with the fossil record of Lasiurus. The
earliest fossils known from Lasiurus date to the late Miocene,
circa 9 Ma (Czaplewski et al. 1999). Still other fossils of this
genus are known from the Pliocene in Florida (Morgan 1991).
The fossil record for extant Lasiurus is sparse, but most species
have fossil records extending into the Pleistocene (Shump and
Shump 1982; Kurta and Lehr 1995).
Results from the species tree analysis in *BEAST are shown
in Fig. 6. The phylogeny is more weakly supported than the
mtDNA concatenated analysis shown in Fig. 5; however, the 2
trees are not significantly different from each other. They only
vary in the placement of L. atratus, but the statistical support
for that species’ placement is low in both analyses.
Discussion
Using greater taxonomic and geographic sampling than previ-
ous genetic studies of Lasiurus (Baker et al. 1988; Morales and
Bickham 1995; Hoofer and Van Den Bussche 2003; Roehrs et al.
2010), we were able to resolve many of the ambiguous relation-
ships among most of the major lineages within this genus.
Red bats.—The placement of L. egregius has been problem-
atic in the past, but most authors have recognized it as a red bat.
Handley (1960) considered it a member of the L. borealis group
(red bats), but noted that previous authors considered it a member
of Dasypterus (yellow bats) because of the lack of the small P1
upper premolar. Handley’s opinion was that this was not a sig-
nificant morphological diagnosis, as roughly 10% of (non-Dasyp-
terus) Lasiurus lack this premolar. Our data clearly show that it
is neither a red bat nor a yellow bat, but rather (and surprisingly)
groups most closely with the traditionally recognized hoary bats.
Furthermore, our results show that the Mexican/Central
American subspecies of L. blossevillii (L. b. teliotis and
L. b. frantzii) are distinct from South American L. blossev-
illii at all mitochondrial loci, but that there is no distinc-
tion between L. b. teliotis and L. b. frantzii at these loci.
This result is similar to that found by Morales and Bickham
(1995) based on restriction fragment analysis and Baker
et al. (1988) based on allozymes. Our combined mtDNA
data indicate that the South and Central American lineages
of L. blossevillii diverged over 4 million years ago (2.3–6.9
Ma; Fig. 5). However, for the DBY gene, all of the L. blos-
sevillii are indistinguishable from one another. One possi-
ble explanation for this observation is that there has been
a recent Y chromosome sweep that involved both North
and South American populations of L. blossevillii. If this is
the case, we can conclude that the observable divergence
between North and South American L. blossevillii is due to
effects of females, rather than males.
Studies on other mammals have noted discordant patterns
of maternal and paternal penetration of species (or subspecies)
boundaries. Whereas spinner dolphins (Stenella longirostris—
Andrews et al. 2013) and Scotophilus (Trujillo et al. 2009)
show increased mtDNA penetration of species boundaries
compared to the Y chromosome, house mice (Mus musculus)
1263
show the pattern we observe here (Boissinot and Boursot 1997;
Albrechtova et al. 2012). Increased maternal penetration of a
species boundary is somewhat more expected due to Haldane’s
Rule, so the pattern exhibited in Lasiurus and house mice
appears to be unusual. As demonstrated by Albrechtova et al.
(2012), there may be greater selection on a particular sperm
phenotype in Lasiurus that has allowed it to cross the species
barrier and exhibit patterns associated with a selective sweep.
An alternative explanation could be that the DBY locus is sim-
ply more slowly evolving than the mtDNA loci examined. This
alternative does not appear to be likely, given that other lineages
of Lasiurus that diverged much more recently than the North
and South American L. blossevillii (such as L. pfeifferi/L. sem-
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
inolus, L. cinereus from North America and Hawaii, and the
North and South American lineages of L. ega; Fig. 5) are eas-
ily distinguishable at the DBY locus. Another alternative is that
there has been incomplete lineage sorting at the DBY locus. Our
data cannot rule out this possible explanation for the observed
patterns. We recommend that the above hypotheses be tested
further to determine with greater certainty whether a selective
Y sweep has indeed taken place in L. blossevillii, or whether the
observed pattern is simply due to incomplete lineage sorting.
Morales and Bickham (1995) noted that the name L. b. frant-
zii has priority over L. b. teliotis. These authors also suggested
that the divergence between L. b. blossevillii and L. b. frant-
zii could indicate that they are separate species, which is con-
firmed by our mtDNA data.
Yellow bats.—Baker and Patton (1967) and Bickham (1987)
noted that L. intermedius possessed a different karyotype than the
rest of the Lasiurini studied. They also indicated that L. xanthi-
nus has an identical karyotype to the red and hoary bats studied,
and L. ega panamensis has a unique X chromosome. Our analyses
place L. intermedius within the rest of the yellow bats. We can con-
clude, based on its position in the phylogenies reported here, that
the unique karyotype of L. intermedius is most likely a derived,
and not primitive, condition within the Lasiurini. Bickham (1987)
also concluded that it was a derived karyotype and proposed that
the common karyotype shared by the hoary bat L. cinereus, and the
red bats L. borealis, L. degelidus, L. seminolus, and L. minor, was
the primitive karyotype for the group. Because L. xanthinus also
possesses this common karyotype (Baker and Patton 1967) and is
placed at the base of the yellow bat lineage (this paper), we can
concur that the most likely primitive karyotype for the Lasiurini
is that possessed by L. xanthinus and the red and hoary bats.
Although not all lasiurines have been karyotyped, there appears to
be no karyotypic changes within the red bats, hoary bats, and the
base of the yellow bat lineage (L. xanthinus). The remaining yel-
low bats appear to have undergone a significant amount of chro-
mosomal evolution within about the last 10 My (6.5–16.2 Ma),
according to our divergence estimates from BEAST (Fig. 5).
The BEAST analysis indicates that the North and South
American L. ega lineages diverged from each other just over 2.6
Ma. Within the yellow bats, this is the most recent divergence
observed, but similar in timing to the split between L. borealis
and L. pfeifferi/L. seminolus and between the North and South
American lineages of L. cinereus. We conclude from these
results, as well as the high degree of genetic differentiation
1264 JOURNAL OF MAMMALOGY
observed, that the North and South American lineages of L. ega
that we sampled are most likely distinct species. However,
without a more complete sampling of the subspecies within
L. ega, we cannot recommend taxonomic changes. A more
detailed study of L. ega should be conducted to address the sta-
tus of these populations.
We note that the pattern shown by L. ega of high levels of
divergence between North and South American lineages is
repeated in other currently recognized species of Lasiurus,
including L. cinereus and L. blossevillii, and all occur during a
relatively short (about 1.5 My) time period. The split between
North and South American lineages of these species date to
about 2.63 Ma (1.2–4.5 Ma; L. ega), 3.41 Ma (1.7–5.7 Ma;
L. cinereus), and 4.32 Ma (2.3–6.9 Ma; L. blossevillii; Fig. 5).
We note that the divergences all occur shortly after the pro-
cess of closure of the Isthmus of Panama had affected ocean
currents, and thus had significant impact on climate differ-
entiation between North and South America (4.6 Ma—Haug
and Tiedemann 1998). We hypothesize that the relatively short
stretch of ocean between North and South America prior to
the Isthmus’ formation was not an effective isolating barrier
for Lasiurus. However, unlike the pattern in many other mam-
malian taxa of interchange between North and South America
after the formation of the Isthmus, we believe that the climate
differences caused by its formation could have acted as an iso-
lating mechanism for these different lineages of Lasiurus.
Additionally, all of our phylogenies demonstrate a high
degree of differentiation between L. xanthinus and the remain-
ing yellow bats. The BEAST analysis indicates that the split
between these lineages was about 10.7 Ma (6.5–16.2 Ma) and
is the oldest divergence recovered except for those among the 3
major lineages (red, yellow, and hoary lineages).
Hoary bats.—Our results indicate that L. egregius is sister
to the traditionally recognized hoary bats, and for simplic-
ity we will refer to that broader clade (traditional hoary bats
plus L. egregius) as the hoary bats. The molecular placement
of this species as more closely related to the traditional hoary
bats contrasts the morphological observations that L. egregius
has red bat characteristics. L. egregius being morphologically
more similar to the red bats, but more closely related to the
hoary bats, indicates that the common ancestor of these 2 lin-
eages most likely had a red bat-like phenotype. This is the most
parsimonious explanation due to the unexpected relationship
between L. egregius and the traditional hoary bats and therefore
only one phenotypic change to the hoary bat phenotype before
the common ancestor of the L. cinereus lineage needs to be
assumed.
The 3 subspecies of L. cinereus recognized by Wilson and
Reeder (2005) have widely disjunct distributions in Hawaii,
South America, and North America (Shump and Shump 1982)
and are genetically well differentiated from one another.
Data presented here indicate that the geographic origin for
Lasiurus on the Hawaiian Islands is North America. This result
was found by Morales and Bickham (1995) using a single spec-
imen, which we also sequenced. Their findings were different,
however, because the individual grouped within the North
American clade. Our results, with additional informative sites
provided by sequencing, found that the individual that they
studied grouped in the separate L. c. semotus clade.
We also found evidence to indicate multiple invasions of the
Hawaiian Islands from North America at very different times.
The older invasion, represented by the presumptive Lasiurus
c. semotus clade, and present on both Maui and the Big Island
(Fig. 2), occurred about 1 Ma (0.4–1.8 Ma; Fig. 5). The obser-
vation of 2 distinct North American L. c. cinereus haplotypes
(Fig. 2) on Maui indicates at least 1 and possibly as many as 2
more recent invasions. Remarkably, this observation confirms
a recent study modeling the possibility of the colonization of
Hawaii from North America by L. cinereus that concluded
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
that repeated colonization events are plausible given both the
physiology of this species and the wind conditions experienced
between North America and Hawaii (Bonaccorso and McGuire
2013). This indicates that the L. c. cinereus haplotypes may
have invaded Hawaii on their own and are not necessarily a
result of human introduction. Further studies using nuclear gene
sequences are needed to examine whether there is interbreeding
between the old (L. c. semotus) and new (L. c. cinereus) forms
that are both present on Maui.
The conservation impacts of this finding are unknown. We
can confirm that the older L. c. semotus lineage certainly pre-
dates humans inhabiting the islands (estimated to have occurred
between the 1st century BC to AD 800—Burney et al. 2001)
and do not represent an invasive species. The mechanism for
introduction of the younger L. c. cinereus haplotypes cannot be
confirmed by our data, and the possibility exists that they were
introduced by humans. We recommend that additional study
regarding the distribution, population size, and interactions of
these 2 lineages be performed prior to revisiting the conserva-
tion status of hoary bats on Hawaii.
Revised taxonomy.—The results presented here clearly
demonstrate that the red, yellow, and hoary bats are geneti-
cally well-differentiated groups. All molecular markers exam-
ined show strong support for the monophyly of each group, as
well as the sister taxa relationship of the red and hoary bats.
Previous morphological analyses (Tate 1942; Hill and Harrison
1987) concur that there is differentiation between at least 2 of
these groups. Hoofer and Van Den Bussche (2003) and Roehrs
et al. (2010) supported the monophyly of the Lasiurini within
the vespertilionids. Their data clearly showed that the level of
divergence between the red, yellow, and hoary bats is in line
with the level of divergence between other recognized vesper-
tilionid genera. Neither of the latter 2 studies supported taxo-
nomic changes within Lasiurus, however, because their data
did not resolve the relationships among the 3 species groups.
Due to the broader sampling of both taxa and genetic mark-
ers in our study, in combination with the overall perspective
on diversity between vespertilionid genera provided by Hoofer
and Van Den Bussche (2003) and Roehrs et al. (2010) and past
morphological studies, we propose that these 3 groups are most
appropriately divided into 3 separate genera as follows: The
name Lasiurus is applicable to the red bats, the name Aeorestes
is applicable to the hoary bats (including L. egregius) and the
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS
name Dasypterus is ascribed to the yellow bats. This arrange-
ment agrees with previous taxonomic classifications based
on morphology (Tate 1942). This arrangement also reflects
the widely accepted colloquial groupings of these bats (based
mainly on morphological divisions). Most scientists already
refer to “red bats,” “yellow bats,” and “hoary bats” when refer-
ring to these groups. Therefore, we feel it is appropriate to have
the taxonomy reflect these already used groupings because
molecular and morphological data support their delineation.
We raise L. blossevillii frantzii (including specimens of the
formerly recognized L. b. teliotis) to a species separate from
L. blossevillii: L. frantzii. This would place the mostly North
American forms into a single species (although we note that
L. frantzii does extend into northern South America), while the
strictly South American forms would be in a separate species,
L. blossevillii. This is supported by the deep split between these
2 groups, which diverged from each other more than 4.3 Ma
(Fig. 5). Although these 2 putative species are identical at the
DBY locus, we still support their separation based on the deep
divergence at the mtDNA loci examined. Ample precedents
exist in the mammalian literature for using mtDNA data alone
to revise taxonomy using a genetic species concept (Baker and
Bradley 2006). Moreover, the morphological differences used
in describing these subspecies support their being differentiated
from one another.
We recommend that L. salinae be considered a subspecies of
L. blossevillii. Our single sample of L. salinae is nested within
the L. blossevillii clade and does not show any evidence of
being genetically distinct from that group.
We recommend that the 3 subspecies of L. cinereus be raised
to species status. Because the exact locality of the type speci-
men for L. c. semotus is unclear, including the specific island
(Allen 1890; Lyon and Osgood 1909; Poole and Schantz 1942),
the most conservative approach to assigning names to the
Hawaiian subspecies is to assume that the more distinct clade
is semotus, while the Hawaiian individuals with haplotypes
more closely related to North American individuals belong to
cinereus. It is important to note that 2 species of hoary bats are
found on the Hawaiian Islands, which increases the number of
native land mammals in Hawaii from 1 to 2.
Synonymy:
Tribe Lasiurini Tate, 1942
Genus Lasiurus Gray, 1831
Synonyms:
Vespertilio: Müller, 1776: 20; part; not Vespertilio Linnaeus,
1758.
Nycteris Borkhausen, 1797: 86; type species Vespertilio nove-
boracensis. Nycteris Borkhausen is a homonym of Nycteris
Cuvier and Geoffroy St. Hilaire.
Atalapha Rafinesque, 1814: 12; part.
Nycticeius Rafinesque, 1819: 417; part.
Nycticejus Temminck, 1824: xviii; part; incorrect subsequent
spelling of Nycticeius Rafinesque, 1819.
Taphozous: Lesson, 1827: 84; part; not Taphozous É. Geoffroy
St.-Hilaire, 1818.
1265
Lasiurus Gray, 1831: 38; type species Vespertilio borealis
(Müller, 1776), by subsequent designation (Miller and Rehn
1902: 261).
Nyc[ticea]. LeConte, 1831: 432; part; incorrect subsequent
spelling of Nycticeius Rafinesque, 1819.
Nycticeius: Poeppig, 1835: 451; footnote; part; not Nycticeius
Rafinesque, 1819.
Scotophilus: Gray, 1838: 498; part; not Scotophilus Leach,
1821.
Atalapha: Gervais, 1854: 114; part; not Atalapha Rafinesque,
1814.
Remarks: We include the following species in this genus:
L. atratus, L. blossevillii, L. borealis, L. castaneus, L. degeli-
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
dus, L. ebenus, L. frantzii, L. minor, L. pfeifferi, L. seminolus,
and L. varius. Species with taxonomic changes are listed in
the synonymy below.
Lasiurus blossevillii (Lesson, 1826)
Synonyms: see under subspecies.
Subspecies:
L. b. salinae Thomas, 1902
Synonyms:
Lasiurus borealis salinae Thomas, 1902: 238; type locality
“Cruz del Eje, Central Cordova,” Argentina.
[Lasiurus (Lasiurus) borealis] salinae: Trouessart, 1904: 87;
name combination.
Lasiurus enslenii J. L. Lima, 1926: 113; type locality “Estado
do rio Grande do Sul, São Lourenço,” Brazil.
Lasiurus ensleveni G. M. Allen 1939: 155; incorrect spelling
of Lasiurus enslenii J. L. Lima.
Lasiurus borealis blossevillii: Handley, 1960: 469; part;
name combination.
Lasiurus borealis varius: Cabrera, 1958: 113; part; name
combination; not N[ycticeius]. varius, Poeppig, 1835.
Lasiurus salinae: Mares, Barquez, and Braun 1995: 229.
L. b. blossevillii (Lesson, 1826)
Synonyms:
Vesp[ertilio]. lasiurus: É. Geoffroy St.-Hilaire, 1806: 200; not
Vespertilio lasiurus Schreber, 1781.
Vespertilio Blossevillii Lesson, 1826: 95; type locality
“Monte-Video,” Uruguay; revised to “la rivière de la Plata,”
Buenos Aires, Argentina by Lesson and Garnot (1827: 139).
Vespertilio bonariensis Lesson, 1827, in Lesson and Garnot,
1827: 137, plate II, fig. 1 (in Atlas, vol. 2); type locality “la
rivière de la Plata,” Buenos Aires, Argentina.
Scotophilus lasiurus: Gray, 1838: 498; not Vespertilio lasi-
urus Schreber, 1781.
Scotophilus Blossevilii: Gray, 1838: 498; name combination.
Nycticejus bonariensis Temminck, 1840: 158; name
combination.
Vespertilio bursa Lund, 1842: 135; nomen nudum; part (see
Winge 1892).
Lasiurus noveboracensis: Tomes, 1857: 34; part; not
Vespertilio noveboracensis Erxleben, 1777.
Lasiurus Blossevillei: Fitzinger, 1870: 405; name combination.
Lasiurus Natterei Fitzinger, 1870: 407; type locality
“Cuyaba,” Mato Grosso, Brazil.
1266 JOURNAL OF MAMMALOGY
Lasiurus bonariensis: Fitzinger, 1870: 408; name
combination.
Atalapha Frantzii: Hensel, 1872: 25; not Atalapha frantzii
Peters, 1870.
Atalapha (Atalapha) noveboracensis: Dobson, 1878: 269;
part; not Vespertilio noveboracensis Erxleben, 1777.
[Nycticejus (]Atalapha[)] bonaërensis Burmeister, 1879: 93;
unjustified emendation of V. bonariensis Lesson.
Atalapha borealis frantzii: Thomas, 1898: 2; name combina-
tion; not Atalapha frantzii Peters, 1870.
Lasiurus borealis bonariensis: Thomas, 1901b: 435; name
combination.
Vespertilio aurantius Miranda-Ribeiro, 1903: 179;
nomen nudum.
Lariurus Frantzii: Cabrera, 1903: 293; name combination;
not Atalapha frantzii Peters.
Lasiurus borealis mexicanus: Lima, 1926: 108; part; not
Atalapha mexicana Saussure.
Lasiurus borealis blossevillii: Cabrera, 1930: 435; name
combination.
Lasiurus borealis blossevillii: Handley, 1960: 469; part; name
combination.
Atalapha franzu Ximénez, Langguth, and Praderi, 1972: 2:
incorrect spelling of, but not Atalapha frantzii Peters.
L[asiurus]. borealis blosseivillii Barquez and Ojeda, 1992:
248; incorrect spelling of Vespertilio blossevillii Lesson.
Lasiurus blossovillei Emmons, 1993: 64; incorrect spelling of
Vespertilio blossevillii Lesson.
L. b. brachyotis (J. A. Allen, 1892)
Synonyms:
Atalapha brachyotis J. A. Allen, 1892: 47; type locality
“Chatham Island,” Galápagos, Ecuador.
Lasiurus brachyotis Heller, 1904: 249; name combination.
Lasiurus bauri G. M. Allen, 1939: 259; incorrect subsequent
spelling for A. brachyotis J. A. Allen, 1892.
Lasiurus borealis [brachyotis]: Niethammer, 1965: 595;
name combination.
Lasiurus frantzii (Peters, 1870)
Synonyms: see under subspecies.
Subspecies:
L. f. frantzii (Peters, 1870)
Synonyms:
Atalapha [Atalapha] Frantzii Peters, 1870: 908; type locality
“Costa Rica.”
[Atalapha (Atalapha) noveboracensis] var. α Atalapha frant-
zii: Dobson, 1878: 271; part; name combination.
Atalapha noveboracensis: Alston, 1879: 22; not Vespertilio
noveboracensis Erxleben, 1777.
A[talapha]. frankii: H. Allen, 1891: 5; incorrect subsequent
spelling for Atalapha frantzii Peters, 1870.
Lasiurus borealis mexicanus: Miller, 1897: 111; part; not
A[talapha]. mexicana Saussure, 1861.
Nycteris borealis mexicana: Goldman, 1920: 216; not
A[talapha]. mexicana Saussure, 1861.
Lasiurus borealis mexicana: Lima, 1926: 108; part; not
A[talapha]. mexicana Saussure, 1861.
Lasiurus borealis frantzii: Goldman, 1932: 148; name
combination.
Nycteris borealis frantzii: Hall, 1981: 223; name combination.
Lasiurus blossevillii frantzii: Baker, Patton, Genoways, and
Bickham, 1988; name combination.
L. f. teliotis (H. Allen, 1891)
Synonyms:
Atalapha teliotis H. Allen, 1891: 5; type locality unknown,
“but probably Southern California.”
Lasiurus borealis teliotis: Miller, 1897: 110; name
combination.
[Lasiurus (Lasiurus) borealis] teliotis: Trouessart, 1904: 87;
name combination.
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
Nycteris borealis teliotis Miller 1912: 64.
Lasiurus borealis ornatus Hall, 1951: 226; type local-
ity “Peñuela, Veracruz,” Mexico; replacement name for
Lasiurus borealis mexicanus Miller, 1897; not A[talapha].
mexicana Saussure, 1861 (=Lasiurus cinereus Palisot de
Beauvois).
Genus Aeorestes Fitzinger, 1870
Vesp[ertilio]: É. Geoffroy St.-Hilaire, 1806: 204; part; not
Vespertilio Linnaeus, 1758.
Temminck 1824
Nycticeius: Poeppig, 1835: 451; footnote; part; not Nycticeius
Rafinesque, 1819.
Scotophilus: Gray, 1838: 498; part; not Scotophilus Leach,
1821.
Lasiurus: Gray, 1843: 32; part.
Atalapha: Gervais, 1854: 114; part; not Atalapha Rafinesque,
1814.
Aeorestes Fitzinger, 1870: 427; part; type species Aeorestes
villosissimus (É. Geoffroy St.-Hilaire, 1806) by original
designation.
Nycticejus Burmeister, 1879: 93; part; incorrect subsequent
spelling of Nycticeius Rafinesque, 1819.
Nycteris: Miller, 1912: 64; part; not Nycteris É. Geoffroy St.-
Hilaire and Cuvier, 1795.
Remarks: We include the following species in this genus:
A. cinereus, A. egregius, A. semotus, and A. villosissimus.
See discussion in Gardner and Handley (2007) for explana-
tion of the invalidity of Atalapha Rafinesque, 1814, for the
hoary bats.
Aeorestes cinereus (Palisot de Beauvois, 1796)
North American hoary bat
Synonyms:
Vespertilio linereus Palisot de Beauvois, 1796: 18 (spell-
ing corrected to cinereus before distribution); type locality
“Philadelphia,” Pennsylvania.
Vespertilio pruinosus Say in James, 1823: 167; type locality
“Engineer Cantonment,” Washington Co., Nebraska.
A[talapha]. mexicana Saussure, 1861: 97; type locality not
given, “but without a doubt in some one of the States of
southern Mexico, probably Veracruz, Puebla, or Oaxaca,
Mexico” (Miller 1897: 111).
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS
Aeorestes villosissimus (Geoffroy St.-Hilaire, 1806)
South American hoary bat
Synonyms: see under subspecies.
Subspecies:
A. v. brasiliensis (Pira, 1904)
Synonyms:
Atalapha cinerea brasiliensis Pira, 1904: 12; type locality
“Ignape,” [=Iguape] São Paulo, Brazil.
Lasiurus cinereus: Lima, 1926: 111; name combination.
Lasiurus cinereus grayi: Vieira, 1942: 416; part.
Lasiurus cinereus villosissimus: Cabrera, 1958: 114; part.
L[asiurus]. c[inereus]. brasiliensis: Gardner and Handley,
2007; name combination.
A. v. grayi (Tomes, 1857)
Synonyms:
Lasiurus Grayi Tomes, 1857: 40; type locality “Chili.”
Atalapha (Atalapha) Grayi: W. Peters, 1870: 910; part; name
combination
[Atalapha (Atalapha) cinerea] Var. α (Atalapha grayi):
Dobson, 1878: 273; part; name combination.
[Lasiurus (Lasiurus) cinereus] grayi: Trouessart, 1904: 87;
name combination.
Dasypterus villosissimus: J. A. Allen, 1905: 191, footnote;
part; not Vespertilio villosissimus É. Geoffroy St.-Hilaire,
1806.
Lasiurus cinereus villosissimus: Osgood, 1943: 53; part; not
Vespertilio villosissimus É. Geoffroy St.-Hilaire, 1806.
A. v. pallescens (W. Peters, 1870)
Synonyms:
Atalapha [(Atalapha)] pallescens W. Peters, 1870: 910; type
locality “Paramo de la Culata, Andes de Merida (Region
frigida), Venezuela.”
[Atalapha (Atalapha) cinerea] Var. α (Atalapha grayi):
Dobson, 1878: 273; part; name combination.
Lasiurus pallescens: J. A. Allen, 1900: 94; name combination.
Lasiurus cinereus pallescens: Hershkovitz, 1949: 452.
Lasiurus cinereus villosissimus: Cabrera, 1958: 114; part; not
Vespertilio villosissimus É. Geoffroy St.-Hilaire, 1806.
A. v. villosissimus (É. Geoffroy St.-Hilaire, 1806)
Synonyms:
Vesp[ertilio]. villosissimus É. Geoffroy St.-Hilaire, 1806:
204; type locality “Paraguay;” restricted to Asunción by
Cabrera (1958: 114).
Lasiurus noveboracensis: Tomes, 1857: 34; part; not
Vespertilio noveboracensis Erxleben, 1777.
Aeorestes villosissimus: Fitzinger, 1870: 427; name
combination.
Atalapha cinerea: Hensel, 1872: 25; name combination.
Atalapha (Atalapha) noveboracensis: Dobson, 1878: 269;
part; not Vespertilio noveboracensis Erxleben, 1777.
[Nycticejus (]Atalapha[)] villosissima: Burmeister, 1879: 95;
name combination.
Lasiurus villosissimus: J. A. Allen, 1901: 184; part; name
combination.
Lasiurus cinereus [villosissimus] Thomas, 1901: 435, name
combination.
1267
Dasypterus villosissimus: J. A. Allen, 1905: 191, footnote;
name combination.
Nycteris cinerea villosissima: Thomas, 1910: 240; name
combination.
Remarks: The only subspecies we examined in this study was
A. v. villosissimus. Therefore, the placement of the remaining
subspecies should be examined further. Based on our analy-
ses, we took the most conservative approach by considering
them subspecies of A. villosissimus because they are all from
South America. Previous authors (e.g., Shump and Shump
1982) considered all South American forms as synonyms of
L. c. villosissimus, prior to their being elevated to subspecific
status by Gardner and Handley (2007).
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
Aeorestes semotus (Allen, 1890)
Hawaiian hoary bat
Synonyms:
Atalapha semota Allen, 1890: 173; type locality “Sandwich
Islands” [ = Hawaiian Islands], United States; type not des-
ignated, but later designated by Lyon and Osgood (1909:
276) as specimen number 15631 from Hawaiian Islands (no
specific island designated).
[L]. semotus: Thomas, 1902: 238, name combination.
[Lasiurus (Lasiurus) semotus: Trouessart, 1904: 87; name
combination.
Lasiurus cinereus semotus: Hall and Jones, 1961: 95; name
combination.
Aeorestes egregius (W. Peters, 1870)
Giant red bat
Synonyms:
Atalapha [(Dasypterus)] egregia W. Peters, 1870: 912; type
locality “Sta. Catharina,” Brazil.
[Lasiurus (Dasypterus)] egregius: Trouessart, 1904: 86; name
combination.
Dasypterus egregius: Miller, 1907: 223; name combination.
Lasiurus egregius: Handley, 1960: 472; name combination.
Nycteris egregia: Hall, 1981: 225; name combination.
Genus Dasypterus W. Peters, 1870
Synonyms:
Nycticejus Gervais, 1856: 73.
Lasiurus Tomes, 1857: 42; part.
Atalapha (Dasypterus) W. Peters, 1870: 912; part; type spe-
cies Lasiurus intermedius (H. Allen, 1862) by subsequent
designation.
Remarks: We include the following species in this genus:
D. ega, D. insularis, D. intermedius, and D. xanthinus.
Dasypterus ega (Gervais, 1856)
Synonyms: see under subspecies.
Subspecies:
D. e. ega (Gervais, 1856)
Synonyms:
Vespertilio bursa Lund, 1842: 135; nomen nudum; part (see
Winge 1892).
Nycticejus Ega Gervais, 1856: 73, 87, plate 14, fig. 1. Type
locality, “Ega, ville du Brésil,” Amazonas, Brazil.
1268 JOURNAL OF MAMMALOGY
Lasiurus Aga Tomes, 1857: 43; incorrect subsequent spelling
of D. ega Gervais.
Atalapha (Dasypterus) Ega: W. Peters, 1870: 914; name
combination.
Dasypterus ega [ega] O. Thomas, 1901a: 247; part; name
combination.
[Lasiurus (Dasypterus)] ega: Trouessart, 1904: 86; part;
name combination.
Lasiurus ega ega: Handley, 1960: 474; name combination.
D. e. argentinus Thomas, 1901
Synonyms:
Dasypterus ega argentinus O. Thomas, 1901a: 247; type
locality “Goya, Corrientes, Argentina.”
[Lasiurus (Dasypterus)] ega argentinus: Trouessart, 1904:
86; name combination.
Dasypterus intermedius: J. L. Lima, 1926: 114; not Lasiurus
intermedius H. Allen, 1862.
Dasypterus intermedius: Vieira, 1942: 421; not Lasiurus
intermedius H. Allen, 1862.
Lasiurus ega argentinus: Handley, 1960: 473; name
combination.
Dasypterus ega caudatus: Barquez et al., 1999: 143; part; not
Lasiurus caudatus Tomes, 1857.
D. e. caudatus (Tomes, 1857)
Synonyms:
Lasiurus caudatus Tomes, 1857: 42; type locality
“Pernambuco,” Brazil.
Atalapha (Dasypterus) caudata: W. Peters, 1870: 914; name
combination.
Atalapha (Dasypterus) ega: Dobson, 1878: 276; part; not
Nycticejus Ega Gervais, 1856.
Dasypterus ega ega: Cabrera, 1958: 115; part; not Nycticejus
Ega Gervais, 1856.
Lasiurus ega argentinus: Handley, 1960: 473; part; not
Dasypterus ega argentinus Thomas, 1901.
Lasiurus ega ega: Hall and Jones, 1961: 94; part; not
Nycticejus Ega Gervais, 1856.
L[asiurus]. e[ga]. caudatus: Kurta and Lehr, 1995: 1; name
combination.
D. e. fuscatus Thomas, 1901
Synonyms:
Dasypterus ega fuscatus Thomas, 1901a: 246: type locality
“Rio Cauquete, Cauca River, Colombia. Altitude 1000 m.”
[Lasiurus (Dasypterus) ega] fuscatus: Trouessart, 1904: 86;
name combination.
Dasypterus ega punensis J. A. Allen, 1914: 382; type locality
“Puna Island,” Guayas, Ecuador.
Dasypterus ega panamensis: Cabrera, 1958: 115; part; not
Dasypterus ega panamensis Thomas, 1901.
Lasiurus ega fuscatus Handley, 1960: 474; name combination.
D. e. panamensis Thomas, 1901
Synonyms:
Dasypterus ega panamensis Thomas, 1901a: 246; type local-
ity “Bogava, Chiriqui, Panama. Altitude 250 m.”
[Lasiurus (Dasypterus) ega] panamensis: Trouessart, 1904:
86; name combination.
Lasiurus ega panamensis: Handley, 1960: 474; name
combination.
Nycteris ega panamensis: Hall, 1981: 221; name combination.
Dasypterus insularis (Hall and Jones, 1961)
Synonyms:
Lasiurus intermedius insularis Hall and Jones, 1961: 85; type
locality “Cienfuegos, Las Villa Province,” Cuba.
Lasiurus insularis Silva-Taboada, 1976.
Nycteris intermedia insularis: Hall, 1981: 220; name
combination.
Dasypterus intermedius (H. Allen, 1862)
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
Synonyms: see under subspecies.
Subspecies:
D. i. intermedius (H. Allen, 1862)
Synonyms:
Lasiurus intermedius H. Allen, 1862: 246; type locality
“Matamoros,” Tamaulipas, Mexico.
Atalapha [(Dasypterus)] intermedia: Peters, 1870: 912; name
combination.
Atalapha (Nycticejus) intermedius: Coues and Yarrow, 1875:
86; name combination.
Dasypterus intermedius: H. Allen, 1893: 137; name
combination.
[Lasiurus (Dasypterus)] intermedius: Trouessart, 1904: 86;
name combination.
Lasiurus intermedius intermedius: Hall and Jones, 1961: 84;
name combination.
Nycteris intermedia intermedia: Hall, 1981: 220; name
combination.
D. i. floridanus Miller, 1902
Synonyms:
Dasypterus floridanus Miller, 1902: 392; type locality “Lake
Kissimmee,” Oceola Co., Florida.
[Lasiurus (Dasypterus)] floridanus: Trouessart, 1904: 86;
name combination.
Lasiurus floridanus: Handley, 1960: 475; name combination.
Lasiurus intermedius floridanus: Hall and Jones, 1961: 84;
name combination.
Nycteris intermedia floridana: Hall, 1981: 220; name
combination.
Dasypterus xanthinus Thomas, 1897
Synonyms:
Dasypterus ega xanthinus Thomas, 1897: 544; type locality
“Sierra Laguna,” Baja California, Mexico.
D[asypterus]. xanthinus: Miller, 1902: 392; name combination.
[Lasiurus (Dasypterus) ega] xanthinus: Trouessart, 1904: 86;
name combination.
Lasiurus ega xanthinus: Handley, 1960: 474; name
combination.
Nycteris ega xanthina: Hall, 1981: 221; name combination.
Lasiurus xanthinus: Baker et al., 1988: 11. (Although never
formally elevated to specific status, the suggestion by Baker
et al. has been followed by many.)
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS
Acknowledgments
We greatly appreciate the assistance of the many biologists,
collectors, and museum curators for providing tissue samples
of lasiurine bats. Without their efforts, this work could not
have been accomplished. We thank Robert Fleischer of the
Smithsonian National Zoological Park and Molly Hagemann
of the Bishop Museum for providing specimens of Hawaiian
hoary bats. We thank the following for providing specimens
of additional taxa: Mark Engstrom and Burton Lim, Royal
Ontario Museum; Robert Dowler, Angelo State Natural History
Collection; University of New Mexico Museum of Southwestern
Biology; Duane Schlitter and Sue McLaren, Carnegie Museum
of Natural History; and Robert Baker, Texas Tech University
Natural Science Research Laboratory. Partial funding was pro-
vided through startup funds from the University of Houston –
Downtown to ABB. Valuable comments on previous versions
of this manuscript were provided by Robert J. Baker.
Literature Cited
Albrechtova, J., et al. 2012. Sperm-related phenotypes implicated
in both maintenance and breakdown of a natural species barrier
in the house mouse. Proceedings of the Royal Society of London,
Series B: Biological Sciences 279:4803–4810.
Allen, G. M. 1939. Bats. Harvard University Press, Cambridge,
Massachusetts.
Allen, H. 1862. Descriptions of 2 new species of Vespertilionidae,
and some remarks on the genus Antrozous. Proceedings of the
Academy of Natural Sciences of Philadelphia 14:246–248.
Allen, H. 1890. Description of a new species of bats, Atalapha
semota. Proceedings of the United States National Museum
13:173–175.
Allen, H. 1891. On a new species of Atalapha. Proceedings of the
American Philosophical Society 29:5–7.
Allen, H. 1893. A monograph of the bats of North America. Bulletin
of the United States National Museum 43:1–198.
Allen, J. A. 1892. On a small collection of mammals from the
Galapagos Islands, collected by Dr. G. Baur. Bulletin of the
American Museum of Natural History 4:47–50.
Allen, J. A. 1900. List of bats collected by Mr. H. H. Smith in the
Santa Marta region of Colombia, with descriptions of new species.
Bulletin of the American Museum of Natural History 13:87–94.
Allen, J. A. 1901. Note on the names of a few South American
mammals. Proceedings of the Biological Society of Washington
14:183–185.
Allen, J. A. 1905. Mammalia of southern Patagonia. Pp. 1–210 in
Reports of the Princeton University Expeditions to Patagonia, 1896–
1899 (W. B. Scott, ed.). E. Schweizerbart’sche Verlagshandlung (E.
Nägle), Stuttgart, Germany. Vol. 3: Zoology.
Allen, J. A. 1914. New South American bats and a new octodont.
Bulletin of the American Museum of Natural History 33:381–389.
Alston, E. R. 1879. Part 1: Mammalia. Pp. 1–40 in Biologia Centrali-
Americana. Taylor and Francis, London, United Kingdom.
Andrews, K. R., et al. 2013. The evolving male: spinner dolphin
(Stenella longirostris) ecotypes are divergent at Y chromo-
some but not mtDNA or autosomal markers. Molecular Ecology
22:2408–2423.
Baker, R. J., and R. D. Bradley. 2006. Speciation in mammals and
the genetic species concept. Journal of Mammalogy 87:643–662.
1269
Baker, R. J., and J. L. Patton. 1967. Karyotypes and karyotypic
variation of North American vespertilionid bats. Journal of
Mammalogy 48:270–286.
Baker, R. J., J. C. Patton, H. H. Genoways, and J. W. Bickham.
1988. Genic studies of Lasiurus (Chiroptera: Vespertilionidae).
Occasional Papers Museum Texas Tech University 117:1–15.
Barquez, R. M., M. A. Mares, and J. K. Braun. 1999. The bats of
Argentina. Special Publications, Museum of Texas Tech University
42:1–275.
Barquez, R. M., and R. A. Ojeda. 1992. The bats (Mammalia:
Chiroptera) of the Argentina Chaco. Annals of the Carnegie
Museum 61:239–261.
Bickham, J. W. 1987. Chromosomal variation among 7 spe-
cies of lasiurine bats (Chiroptera: Vespertilionidae). Journal of
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
Mammalogy 68:837–842.
Boissinot, S., and P. Boursot. 1997. Discordant phylogeographic
patterns between the Y chromosome and mitochondrial DNA
in the house mouse: Selection on the Y chromosome? Genetics
146:1019–1034.
Bonaccorso, F. J., and L. P. McGuire. 2013. Modeling the colo-
nization of Hawaii by hoary bats (Lasiurus cinereus). Pp. 187–
205 in Bat evolution, ecology, and conservation (R. A. Adams
and S. C. Pederson, eds.). Springer Science + Business Media,
New York.
Borkhausen, M. 1797. Deutsche Fauna, oder Kurzgefasste
Naturgeschichte der Thiere Deutschlands. Säugthiere und Vögel.
Barrentrapp und Wenner, Frankfurt, Germany 1:1–620.
Burmeister, H. 1879. Description physique de la République
Argentine d’après des observations personnelles et étrangères.
Pp. 556 in Animaux vertébrés. Paul-Émile Coni, Buenos Aires,
Argentina. Vol. 3.
Burney, D. A., et al. 2001. Fossil evidence for a diverse biota from
Kaua’i and its transformation since human arrival. Ecological
Monographs 71:615–641.
Cabrera, A. 1903. Catálogo descriptivo de los quirópteros chilenos.
Revista Chilena de Historia Natural 7:278–308.
Cabrera, A. 1930. Breve synopsis de los murciélagos argenti-
nos. Revista Centro de Estudiantes de Agronomia y Veterinaria,
Universidad de Buenos Aires 23:418–442.
Cabrera, A. 1958. Catálogo de los mamíferos de América del Sur.
Revista del Museo Argentino de Ciencias Naturales “Bernardino
Rivadavia” 4:1–308.
Coues, E., and H. C. Yarrow. 1875. Chapter II. Report upon the
collections of mammals made in portions of Nevada, Utah,
California, Colorado, New Mexico, and Arizona, during the
years 1871, 1872, 1873, and 1874. Pp. 35–129 in Report upon
geographical and geological explorations and surveys west of
the one hundredth meridian. U.S. Government Printing Office,
Washington, D. C. Vol. V: Zoology.
Czaplewski, N. J., B. E. Bailey, and R. G. Corner. 1999.
Tertiary bats (Mammalia: Chiroptera) from Northern Nebraska.
Transactions of the Nebraska Academy of Sciences 25:83–93.
Darriba, D., G. L. Taboada, R. Doallo, and D. Posada. 2012.
jModelTest 2: more models, new heuristics and parallel comput-
ing. Nature Methods 9:772.
Dobson, G. E. 1878. Catalogue of the Chiroptera in the collec-
tion of the British Museum. British Museum (Natural History),
London, United Kingdom 567.
Drummond, A. J., M. A. Suchard, D. Xie, and A. Rambaut. 2012.
Bayesian phylogenetics with BEAUti and the BEAST 1.7.
Molecular Biology and Evolution 29:1969–1973.
1270 JOURNAL OF MAMMALOGY
Emmons, L. H. 1993. Mammal list: Kanuku mountain region. Pp.
61–67 in A biological assessment of the Kanuku Mountain region
of southwestern Guyana (T. A. Parker, III, R. B. Foster, L. H.
Emmons, P. Freed, A. B. Forsyth, B. Hoffman, and B. D. Gill,
eds.). Conservation International RAP Working Papers 5.
Erxleben, J. C. P. 1777. Systema regni animalis per classes,
ordines, genera, species, varietates cum synonymia et histo-
ria animalium. Classis I, Mammalia. Impensis Weygandianis,
Lipsiae, Germany 636.
Fitzinger, L. J. 1870. Kritische durchsicht der ordnung der flat-
terthiere oder handflüger (Chiroptera). Sitzungsberichte der
Mathematisch-Naturwissenschaftlichen Classe der Kaiserlichen
Akademie der Wissenschaften 62:353–438.
Fujioka, K. K., and S. M. Gon. 1988. Observations of the Hawaiian
bat (Lasiurus cinereus semotus) in the Districts of Ka’ū and South
Kona, Island of Hawai’i. Journal of Mammalogy 69:369–371.
Gardner, A. L., and C. O. Handley, Jr. 2007. Genus Lasiurus
Gray, 1831. Pp. 457–468 in Mammals of South America.
Marsupials, xenarthrans, shrews, and bats (A. L. Gardner, ed.).
The University of Chicago Press, Chicago, Illinois. Vol. 1.
Geoffroy St.-Hilaire, É. 1806. Sur le genre et les espèces de vesper-
tilion, l’un des genres de la famille des chauve-souris. Annales du
Muséum d’Histoire Naturelle 1806:187–205.
Geoffroy St.-Hilaire, É. 1818. Description des mammifères qui
se trouvent en Egypte. Pp. 1–750 in Description de l’Egypte, ou
recueil des observations et des recherches qui ont ètè faites en Égypt
pendant l’Expédition de l’Armée Française, publié par les orders
de sa Majeste l’Empereur Napoléon Le Grand. Histoire naturelle,
pp. 99–144. Commission d’Egypte, l’Imprimerie Impériale, Paris,
France. Vol. 2.
Geoffroy St.-Hilaire, É., and P. Gervais. 1795. Mémoire sur une
nouvelle division des mammifères, et sur les principes qui doi-
vent server de base dans cette sorte de travail, lu à la société
de’histoire naturelle, le premier floréal de l’an troisième. Magasin
Encyclopédique, ou Journal des Sciences, des Lettres et des Arts,
année 1 2:164–190.
Gervais, P. 1854. Histoire naturelle des mammifères avec
l’indication de leurs moeurs, et de leurs rapports avec les arts,
le commerce et l’agriculture. L. Curmer, Paris, France 1:1–418.
Gervais, P. 1856. Deuxième mémoire. Documents zoologiques pour
server a la monographie des chéiroptères Sud-Américains. In
Mammifères (P. Gervais, ed.). Pp. 25–88 in Animaux nouveaux
ou rares recueillis pendant l’expédition dans les parties centrales
de l’Amérique du Sud de Rio de Janeiro a Lima, et de Lima au
Para; par ordre du gouvernement Français pendant les années 1843
a 1847 (F. de Castelnau, ed.). P. Bertrand, Paris, France.
Goldman, E. A. 1920. Mammals of Panama. Smithsonian
Miscellaneous Collections 69:1–309.
Goldman, E. A. 1932. The status of the Costa Rican red bat.
Proceedings of the Biological Society of Washington 45:148.
Gray, J. E. 1831. Descriptions of some new genera and species of
bats. The Zoological Miscellany 1831:37–38.
Gray, J. E. 1838. A revision of the genera of bats (Vespertilionidae),
and the description of some new genera and species. Magazine
of Zoology and Botany 2:483–505.
Gray, J. E. 1843. List of the specimens of Mammalia in the collec-
tion of the British Museum. British Museum (Natural History),
London, United Kingdom 216.
Hall, E. R. 1951. A new name for the Mexican red bat. University of
Kansas Publications, Museum of Natural History 5:225–226.
Hall, E. R. 1981. The mammals of North America. 2nd ed. John
Wiley and Sons, New York 1:600.
Hall, E. R., and J. K. Jones, Jr. 1961. North American yellow bats,
“Dasypterus,” and a list of the named kinds of the genus Lasiurus
Gray. University of Kansas Publications: Museum of Natural
History 14:73–98.
Handley, Jr., C. O. 1960. Descriptions of new bats from Panama.
Proceedings of the United States National Museum 112:459–479.
Haug, G. H., and R. Tiedemann. 1998. Effect of the formation of
the Isthmus of Panama on Atlantic Ocean thermohaline circula-
tion. Nature 393:673–676.
Heller, E. 1904. Papers from the Hopkins Stanford Galapagos
Expedition, 1898–1899. Mammals of the Galapagos Archipelago,
exclusive of the Cetacea. Proceedings of the California Academy
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
of Sciences, Zoology 3:233–250.
Hensel, R. 1872. Beiträge zur kenntniss der säugethiere Süd-
Brasiliens. Physikalische Abhandlungen der Königlichen
Akademie der Wissenschaften zu Berlin 1872:1–130.
Hershkovitz, P. 1949. Mammals of northern Colombia. Preliminary
report no. 5: bats (Chiroptera). Proceedings of the United States
National Museum 99:429–454.
Hill, J. E., and D. L. Harrison. 1987. The baculum in the
Vespertilioninae (Chiroptera: Vespertilionidae) with systematic
review, a synopsis of Pipistrellus and Eptesicus, and the descrip-
tion of a new genus and subgenus. Bulletin of the British Museum
(Natural History), Zoology Series 52:225–305.
Ho, S. Y. W., and M. J. Phillips. 2009. Accounting for calibration
uncertainty in phylogenetic estimation of evolutionary divergence
times. Systematic Biology 58:367–380.
Hoofer, S. R., and R. A. Van Den Bussche. 2003. Molecular phy-
logenetics of the chiropteran family Vespertilionidae. Acta
Chiropterologica 5:1–63.
Jacobs, D. S. 1996. Morphological divergence in an insular bat,
Lasiurus cinereus semotus. Functional Morphology 10:622–630.
James, E. 1823. Account of an expedition from Pittsburgh to the
Rocky Mountains, performed in the years 1819 and ‘20, by order
of the Hon. J. C. Calhoun, Sec’y. of War: under the command
of Major Stephen H. Long. H. G. Cary and I. Lea, Philadelphia,
Pennsylvania 1:1–503.
K oopman , K. F., and G. F. M c C racken . 1998. The taxonomic
status of Lasiurus (Chiroptera: Vespertilionidae) in the
Galapagos Islands. American Museum Novitates 3243:1–6.
Kurta, A., and G. C. Lehr. 1995. Lasiurus ega. Mammalian Species
515:1–7.
Leach, W. E. 1821. The characters of 3 new genera of bats without
foliaceous appendages to the nose. Transactions of the Linnean
Society of London 13:69–72.
LeConte, J. E. 1831. Appendix. Pp. 431–439 in The animal kingdom
arranged in conformity with its organization by the Baron Cuvier
(translated by H. McMurtrie). G. & C. & H. Carvill, New York. Vol. 1.
Lemmon, A. R., J. M. Brown, K. Stanger-Hall, and E. M. Lemmon.
2009. The effect of ambiguous data on phylogenetic estimates
obtained by maximum likelihood and Bayesian inference.
Systematic Biology 58:130–145.
Lesson, R.-P. 1826. Mammifères nouveaux ou peu connus, décrits
et figures dans l’Atlas zoologique du Voyage autour du monde
de la corvette le Coquille. Bulletin des Sciences Naturelles et de
Géologie 1826:95–96.
Lesson, R.-P. 1827. Manuel de mammalogy ou histoire naturelle
des mammifères. Roret, Paris, France 441.
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS
Lesson, R.-P., and P. Garnot. 1827. Zoologie. Pp. 360 in Voyage
autour du monde, execute par ordre du roi, sur la corvette de Sa
Majesté, la Coquille, pendant les années 1822, 1823, 1824, et 1825.
Arthus Bertrand, Paris, France. Vol. 1, part 1: Zoologie.
Lima, J. L. 1926. Os morcegos da collecção do Museu Paulista.
Revista do Museu Paulista 14:43–128.
Linnaeus, C. 1758. Systema naturae per regna tria naturae, secun-
dum classes, ordines, genera, species, cum characteribus, differen-
tiis, synonymis, locis. Editio decimal, reformata. Laurentii Salvii,
Holmiae 1:1–532.
Lund, P. W. 1842. Fortsatte Bemaerkninger over Brasiliens
uddöde Dyrskagning. Det Kongelige Danske Videnskabernes
Selskab. Skrifter. Naturvidenskabelig og Mathematisk Afdeling
9:123–136.
Lyon, M. W., and W. H. Osgood. 1909. Catalogue of the type-
specimens of mammals in the United States National Museum,
including the Biological Survey Collection. Bulletin of the
United States National Museum 62:1–325.
Mares, M. A., R. M. Barquez, and J. K. Braun. 1995. Distribution
and ecology of some Argentine bats. Annals of Carnegie Museum
64:219–237.
Miller, G. S. 1897. Revision of the North American bats of the fam-
ily Vespertilionidae. North American Fauna 13:1–135.
Miller, G. S. 1902. Twenty new American bats. Proceedings of the
Academy of Natural Sciences of Philadelphia 54:389–412.
Miller, G. S. 1907. The families and genera of bats. Bulletin of the
United States National Museum 57:1–282.
Miller, G. S. 1912. List of North American land mammals in the
United States National Museum, 1911. Bulletin of the United
States National Museum 79:1–455.
Miller, G. S., and J. A. G. Rehn. 1902. Systematic results of the study
of North American land mammals to the close of the year 1900.
Proceedings of the Boston Society of Natural History 30:1–352.
Miranda-Ribeiro, A. de. 1903. Basilia ferruginea genero novo e
especie nova da familia das nycteribias. Archivos do Museu
Nacional do Rio de Janeiro 12:175–179.
Morales, J. C., and J. W. Bickham. 1995. Molecular systematics of
the genus Lasiurus (Chiroptera: Vespertilionidae) based on restric-
tion-site maps of the mitochondrial ribosomal genes. Journal of
Mammalogy 76:730–749.
Morgan, G. S. 1991. Neotropical Chiroptera from the Pliocene
and Pleistocene of Florida. Bulletin of the American museum of
Natural History 206:176–213.
Müller, P. L. S. 1776. Des Ritters Carl von Linné Königlich
Schwedischen Leibarztes u. u. vollständigen Natursystems.
Supplements und Register Band über alle sechs Theile oder
Classen des Thierreichs mit einer ausführlichen Erklärung, ausge-
fertiget. Erste Classe Säugende Theire. Gabriel Nicolaus Raspe,
Nümberg, Germany 62.
Niethammer, J. 1965. Contribution à la connaissance des mam-
mifères terrestres de L’ile Indefatigable (=Santa Cruz), Galapagos.
Résyktats de l’Expédition allenmande aux Galapagos 1962/63. No.
VIII. Mammalia 28:593–606.
Osgood, W. H. 1943. The mammals of Chile. Field Museum of
Natural History, Zoological Series 30:1–268.
P alisot de B eauvois , A. M. F. J. 1796. Catalogue raisonné
du museum, de Mr. C. W. Peale, membre de la société phi-
losophique de Pensylvanie. De l’Imprinmerie de Parent,
Philadelphia, Pennsylvania 42.
Peters, W. 1870. Eine monographische übersicht der chiropter-
engattungen Nycteris und Atalapha vor. Monatsberichte der
1271
Königlich Preussischen Akademie der Wissenschaften zu Berlin
1871:900–914.
Pira, A. 1904. Über fledermäuse von São Paulo. Zoologischer
Anzeiger 28:12–19.
Poeppig, E. 1835. Reise in Chile, Peru, und auf dem Amazonenstrome
während der jahre 1827–1832. Friedrich Fleischer, Leipzig
1:1–466.
Poole, A. J., and V. S. Schantz. 1942. Catalog of the type speci-
mens of mammals in the United States National Museum, includ-
ing the Biological Surveys Collection. Bulletin of the United
States National Museum 178:1–705.
Rafinesque, C. S. 1814. Précis des découvertes et travaux somi-
ologiques de Mr. C. S. Rafinesque-Schmaltz, entre 1800 et 1814
ou choix raisonné de ses principals découvertes en zoologie et en
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
botanique, pour server d’introduction à ses ouvrages futurs. Royale
Typographie Militaire, aux dépens de l’Auteur, Palerme, Italy 56.
Rafinesque, C. S. 1819. Prodrome de 70 nouveaux genres
d’animaux découverts dan l’intérieur des États-Unis d’Amérique,
Durant l’année 1818. Journal de Physique, de Chimie, d’Histoire
Naturelle et des Arts 88:417–429.
Rambaut, A. 2012. FigTree v 1.4. http://beast.bio.ed.ac.uk/.
Accessed 28 October 2013.
Rambaut, A., and A. J. Drummond. 2009. Tracer v 1.5. http://beast.
bio.ed.ac.uk/. Accessed 3 October 2013.
R oehrs , Z. P., J. B. L ack , and R. A. V an D en B ussche . 2010.
Tribal phylogenetic relationships within Vespertilioninae
(Chiroptera: Vespertilionidae) based on mitochondrial and
nuclear sequence data. Journal of Mammalogy 91:1073–1092.
Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics
19:1572–1574.
Saussure, H. 1861. Diagnosis Cheiropterae Mexicanae e familia
Vespertilionidarum. Revue et Magasin de Zoologie pure et
Appliquée Series 2, 13:97.
Schreber, J. C. D., von. 1781. Die Säugthiere in Abbildungen nach
der Natur mit Beschreibungen. Wolfgang Walther, Erlangen 4:683–
690, plates 58B, 62B, 159B, C, D, 212-222.
Shump, K. A., and A. U. Shump. 1982. Lasiurus cinereus. Mammalian
Species 185:1–5.
Silva-Taboada, G. 1976. Historia y actualización taxonómica
de algunas especies antillanas de murciélagos de los géneros
Pteronotus, Brachyphylla, Lasiurus, y Antrozous (Mammalia:
Chiroptera). Poeyana, 153:1–24.
Tate, G. H. H. 1942. Review of the vespertilionine bats, with
special attention to the genera and species of the Archbold col-
lections. Bulletin of the American Museum of Natural History
80:221–297.
Teeling, E. C., M. S. Springer, O. Madsen, P. Bates, S. J. O’Brien,
and W. J. M urphy . 2005. A molecular phylogeny for bats illumi-
nates biogeography and the fossil record. Science 307:580–584.
Temminck, C. J. 1824. Tableau méthodique de mammifères, répartis en
orders, genres et sections, avec une enumeration approximative des
espèces comprises dans les groups, suivant le relevé le plus recent
dans cette classe du régne animal. Pp. 1–268 in Monographies de
mammalogy ou description de quelques genres de mammifères
don’t les espèces ont été observes dans les différens musées de
l’Europe. G. Dufour et E. d’Ocagne, Paris, France. Vol. 1.
Temminck, C. J. 1840. Treizième monographie sur les cheirop-
tères vespertilionides formant les genres Nyctice, Vespertilion et
Furie. Pp. 141–272 in Monographies de mammalogy ou descrip-
tion de quelques genres de mammifères dont les espèces ont été
1272 JOURNAL OF MAMMALOGY
observes dans les différens musées de l’Europe. C. C. Van der
Hoek, Leiden and d’Ocagne et A. Bertrand, Paris, France.
Thomas, O. 1897. Descriptions of new bats and rodents from America.
Annals and Magazine of Natural History, Series 6 20:514–553.
Thomas, O. 1898. On the small mammals collected by Dr. Borelli in
Bolivia and northern Argentina. Bollettino dei Musei di Zoologia ed
Anatomia Comparata della R. Università di Torino 13:1–4.
Thomas, O. 1901a. New Neotropical mammals, with a note on the
species of Reithrodon. Annals and Magazine of Natural History
Series 7, vol. 8:246–255.
Thomas, O. 1901b. On a collection of bats from Paraguay. Annals
and Magazine of Natural History Series 7, 8:435–443.
Thomas, O. 1902. On mammals collected at Cruz del Eje, central
Cordova, by Mr. P. O. Simons. Annals and Magazine of Natural
History Series 7, 9:237–245.
Thomas, O. 1910. A collection of mammals from eastern Buenos
Ayres, with descriptions of related new mammals from other locali-
ties. Annals and Magazine of Natural History Series 8, 5:239–247.
Tomes, R. F. 1857. A monograph of the genus Lasiurus. Proceedings
of the Zoological Society of London 1857:34–45.
Trouessart, E.-L. 1904. Catalogus mammalium tam viventium
quam fossilium. Quinquennale supplementium, anno 1904. Fasc.
1, 1–288. R. Friedländer and Sohn, Berolini, Germany 929.
Trujillo, R. G., J. C. Patton, D. A. Schlitter, and J. W. Bickham.
2009. Molecular phylogenetics of the bat genus Scotophilus
(Chiroptera: Vespertilionidae): perspectives from paternally and
maternally inherited genomes. Journal of Mammalogy 90:548–560.
Vieira, C. O. da C. 1942. Ensaio monográfico sobre os quirópteros
do Brasil. Arquivos de Zoologia do Estado de São Paulo
3:219–471.
Whitaker, J. O., Jr., and P. Q. Tomich. 1983. Food habits of the
hoary bat, Lasiurus cinereus, from Hawaii. Journal of Mammalogy
64:151–152.
Wilson, D. E., and D. M. Reeder. 2005. Mammal species of the
world: a taxonomic and geographic reference. 3rd ed. Johns
Hopkins University Press, Baltimore, Maryland.
Winge, H. 1892. Jordfundne og nulevende Flagermus (Chiroptera)
fra Lagoa Santa, Minas Geraes, Brasilien. E Museo Lundii,
Kjöbenhavn, Denmark 2:1–65.
Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024
Ximénez, A., A. Langguth, and R. Praderi. 1972. Lista sistemática
de los mamíferos del Uruguay. Anales Museo Nacional de Historia
Natural de Montevideo 7:1–49.
Zwickl, D. J. 2006. Genetic algorithm approaches for the phylo-
genetic analysis of large biological sequence datasets under the
maximum likelihood criterion. Ph.D. dissertation, University of
Texas at Austin, Austin.
Submitted 3 December 2014. Accepted 20 June 2015.
Associate Editor was Sharon A. Jansa.
 BAIRD ET AL.—MOLECULAR SYSTEMATICS OF TREE BATS 1273

Appendix I
List of samples used. General localities are given. GenBank accession numbers for each locus are provided. Empty cells indicate that a
particular sample was not sequenced for that locus.

Genus Species Tissue voucher Locality ND1 Cytb ND2 DBY

Lasiurus atratus F39221 Guyana KT148975
Lasiurus atratus F40753 Guyana KT148976
Lasiurus atratus F54400 Guyana KT148977 KP341704 KT149070 KT149115
Lasiurus blossevillii AK13464 Argentina KT148998 KP341705 KT149071
Lasiurus blossevillii AK15150 Argentina KT148999 KT149072
Lasiurus blossevillii F44348 Brazil KT148900 KP341706 KT149073 KT149116
Lasiurus blossevillii F44354 Brazil KT149001 KP341707 KT149074 KT149117
Lasiurus blossevillii F54778 Suriname KT149002 KT149075 KT149118
Lasiurus borealis AK10319 no data KP341708

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Lasiurus borealis AK10347 Texas KT148980
Lasiurus borealis AK10348 Texas KT148981
Lasiurus borealis AK10353 Texas KT148982
Lasiurus borealis AK21072 Kansas KT148983 KP341709 KT149076
Lasiurus borealis AK21073 Kansas KT148984 KP341710 KT149077 KT149124
Lasiurus borealis AK7214 Illinois KT148978 KT149122
Lasiurus borealis AK7215 Illinois KT148979 KT149123
Lasiurus borealis ASK1084 Texas KT148985
Lasiurus borealis ASK1085 Texas KT148986
Lasiurus borealis ASK1086 Texas KT148987
Lasiurus borealis ASK1087 Texas KT148988
Lasiurus borealis ASK3512 Texas KT148989
Lasiurus borealis NK16707 Oklahoma KT148990
Lasiurus borealis NK16710 Oklahoma KT148991
Lasiurus borealis SP1900 W. Virginia KT148994
Lasiurus borealis SP2255 W. Virginia KT148995
Lasiurus borealis SP2264 W. Virginia KT148996
Lasiurus borealis SP2267 W. Virginia KT148997
Lasiurus borealis SP920 W. Virginia KT148992
Lasiurus borealis SP921 W. Virginia KT148993
Lasiurus cinereus AK10350 Texas KT149022 KT149132
Lasiurus cinereus AK11006 Queretaro KT149023 KP341711 KT149103
Lasiurus cinereus AK11012 Queretaro KT149133
Lasiurus cinereus AK11013 Queretaro KT149068 KP341712 KT149112
Lasiurus cinereus AK11014 Queretaro KT149024 KP341713 KT149078 KT149134
Lasiurus cinereus AK11097 Queretaro KT149062 KP341714 KT149106
Lasiurus cinereus AK11210 Queretaro KP341715
Lasiurus cinereus AK11212 Queretaro KT149063 KP341716 KT149114
Lasiurus cinereus AK13938 Argentina KT149032 KT149079
Lasiurus cinereus AK21410 Arizona KT149025
Lasiurus cinereus ASK1079 Texas KT149064 KP341717 KT149110
Lasiurus cinereus ASK3520 Texas KT149066 KP341718 KT149109
Lasiurus cinereus BPBM178144 HI: Hawaii KT149027
Lasiurus cinereus BPBM178452 HI: Hawaii KT149028 KP341719
Lasiurus cinereus BPBM178453 HI: Hawaii KT149029 KP341720
Lasiurus cinereus BPBM185003 HI: Maui KT149030 KP341721
Lasiurus cinereus BPBM185245 HI: Hawaii KT149031 KP341722
Lasiurus cinereus BPBM185479 HI: Maui KP341723
Lasiurus cinereus BPBM185538 HI: Hawaii KT149065 KP341724 KT149104
Lasiurus cinereus BPBM185539 HI: Maui KT149058 KP341725 KT149105
Lasiurus cinereus BPBM185541 HI: Maui KT149059 KP341726 KT149102
Lasiurus cinereus NK11502 Bolivia KT149033 KP341727 KT149081 KT149136
Lasiurus cinereus NK3562 New Mexico KT149069 KP341728 KT149108
Lasiurus cinereus NK3563 New Mexico KP341729
Lasiurus cinereus NK3575 New Mexico KT149131
Lasiurus cinereus NK3580 New Mexico KP341730
Lasiurus cinereus NK3599 New Mexico KP341731
Lasiurus cinereus NK3625 New Mexico KP341732
Lasiurus cinereus NK3627 New Mexico KT149067 KP341733 KT149111
Lasiurus cinereus NK3642 New Mexico KP341734
Lasiurus cinereus NK6564 Sonora KP341735
1274 JOURNAL OF MAMMALOGY

Appendix I. Continued
Genus Species Tissue voucher Locality ND1 Cytb ND2 DBY
Lasiurus cinereus NK8096 Baja Cal KT149060 KP341736 KT149113 KT149135
Lasiurus cinereus NK9191 New Mexico KP341737
Lasiurus cinereus NK9250 Sonora KT149061 KP341738 KT149107
Lasiurus cinereus NK9273 Sonora KP341739
Lasiurus ega AK1635 Tamaulipas KT149038 KP341740 KT149094 KT149139
Lasiurus ega AK7636 Belize KT149039
Lasiurus ega AK7693 Belize KT149040 KP341741 KT149140
Lasiurus ega AK7697 Belize KT149042
Lasiurus ega AK7696 Belize KT149041
Lasiurus ega H4043 Tamaulipas KT149043
Lasiurus ega NK12302 Bolivia KT149044 KP341742 KT149142
Lasiurus ega NK15304 Bolivia KT149045 KP341743 KT149095 KT149143

Downloaded from https://academic.oup.com/jmammal/article/96/6/1255/1171864 by guest on 11 May 2024

Lasiurus ega NK22703 Bolivia KT149046 KT149096 KT149144
Lasiurus ega SP12622 Guatemala KT149047 KP341744 KT149097 KT149141
Lasiurus egregius F54345 Guyana KT149034
Lasiurus egregius F54554 Guyana KT149035 KP341745 KT149091 KT149137
Lasiurus egregius F54555 Guyana KT149036
Lasiurus egregius F54845 Suriname KT149037 KP341746 KT149092 KT149138
Lasiurus insularis TK32049 Cuba KT149053 KP341747 KT149098
Lasiurus intermedius AK11121 Tamaulipas KT149049 KT149145
Lasiurus intermedius AK11122 Tamaulipas KT149050 KT149099
Lasiurus intermedius AK11148 Tamaulipas KT149048 KT149100 KT149146
Lasiurus intermedius AK7624 Belize KT149051
Lasiurus intermedius ASK422 Guatemala KT149052 KP341748 KT149101
Lasiurus pfeifferi TK32016 Cuba KT149004 KP341749 KT149082 KT149125
Lasiurus pfeifferi TK32029 Cuba KT149005 KP341750 KT149083 KT149126
Lasiurus pfeifferi TK32056 Cuba KT149006 KT149084
Lasiurus salinae AK15126 Argentina KT149007
Lasiurus seminolus AK10351 Texas KT149010
Lasiurus seminolus AK10354 Texas KT149011
Lasiurus seminolus AK1566 Texas KT149127
Lasiurus seminolus AK1565 Texas KT149008 KP341751 KT149085
Lasiurus seminolus AK21348 Texas KT149012 KP341752 KT149087 KT149129
Lasiurus seminolus AK6912 Texas KT149009
Lasiurus seminolus AK6914 Texas KP341753 KT149086 KT149128
Lasiurus frantzii AK11179 Tamaulipas KP341754 KT149088
Lasiurus frantzii AK11119 Tamaulipas KT149016
Lasiurus frantzii AK11150 Tamaulipas KT149017 KT149119
Lasiurus frantzii AK1637 Tamaulipas KT149015
Lasiurus frantzii F34141 Guatemala KT149018
Lasiurus frantzii F34142 Guatemala KT149019 KP341755 KT149089 KT149120
Lasiurus frantzii F34143 Guatemala KT149020
Lasiurus frantzii F38183 Panama KT149021 KT149121
Lasiurus varius AK16070 Argentina KT149013 KP341756 KT149090 KT149130
Lasiurus varius AK16089 Argentina KT149014
Lasiurus xanthinus AK21099 Texas KT149054
Lasiurus xanthinus NK11102 New Mexico KT149055
Lasiurus xanthinus NK11103 New Mexico KT149056 KP341757 KT149093 KT149147
Lasiurus xanthinus NK3579 Sonora KT149057