Virology | Full-Length Text

Macrophages derived from human induced pluripotent stem

cells (iPSCs) serve as a high-fidelity cellular model for
investigating HIV-1, dengue, and influenza viruses
Qing Yang,1,2 Arturo Barbachano-Guerrero,1 Laurence M. Fairchild,2 Teisha J. Rowland,2 Robin D. Dowell,1,2,3,4,5 Mary A. Allen,1,2,3,4
Cody J. Warren,1,6,7,8,9 Sara L. Sawyer1,2

AUTHOR AFFILIATIONS See affiliation list on p. 19.

ABSTRACT Macrophages are important target cells for diverse viruses and thus
represent a valuable system for studying virus biology. Isolation of primary human
macrophages is done by culture of dissociated tissues or from differentiated blood
monocytes, but these methods are both time consuming and result in low numbers of
recovered macrophages. Here, we explore whether macrophages derived from human
induced pluripotent stem cells (iPSCs)—which proliferate indefinitely and potentially
provide unlimited starting material—could serve as a faithful model system for studying
virus biology. Human iPSC-derived monocytes were differentiated into macrophages
and then infected with HIV-1, dengue virus, or influenza virus as model human viru­
ses. We show that iPSC-derived macrophages support the replication of these viruses
with kinetics and phenotypes similar to human blood monocyte-derived macrophages.
These iPSC-derived macrophages were virtually indistinguishable from human blood
monocyte-derived macrophages based on surface marker expression (flow cytome­
try), transcriptomics (RNA sequencing), and chromatin accessibility profiling. iPSC lines
were additionally generated from non-human primate (chimpanzee) fibroblasts. When
challenged with dengue virus, human and chimpanzee iPSC-derived macrophages show
differential susceptibility to infection, thus providing a valuable resource for studying
the species-tropism of viruses. We also show that blood- and iPSC-derived macrophages
both restrict influenza virus at a late stage of the virus lifecycle. Collectively, our results
substantiate iPSC-derived macrophages as an alternative to blood monocyte-derived
macrophages for the study of virus biology.

IMPORTANCE Macrophages have complex relationships with viruses: while macro­

phages aid in the removal of pathogenic viruses from the body, macrophages are also
manipulated by some viruses to serve as vessels for viral replication, dissemination, and
long-term persistence. Here, we show that iPSC-derived macrophages are an excellent
Editor Frank Kirchhoff, Ulm University Medical
model that can be exploited in virology. Center, Ulm, Germany

Address correspondence to Cody J. Warren,

KEYWORDS iPSC-derived macrophages, induced pluripotent stem cells, macrophages, warren.802@osu.edu, or Sara L. Sawyer,
human immunodeficiency virus, influenza virus, dengue virus, RNAseq, ATACseq ssawyer@colorado.edu.

Q.Y., R.D.D., and S.L.S. are co-founders and/or

T he study of macrophage-virus interactions is essential for our understanding of

human infection and pathogenesis. Macrophages have complex relationships with
viruses; while they aid in the removal of pathogenic viruses from the body through
consultants for Darwin Biosciences.

See the funding table on p. 20.

phagocytosis, antigen presentation, and cytokine production, macrophages are also Received 5 October 2023
Accepted 8 January 2024
manipulated by some viruses to serve as vessels for viral replication, dissemination, and Published 7 February 2024
long-term persistence (1–5).
Copyright © 2024 American Society for
Microbiology. All Rights Reserved.

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 1

Full-Length Text Journal of Virology

Macrophages can be generated ex vivo by isolating monocytes from donor blood

samples and treating monocytes with growth factors and/or cytokines to simulate
their differentiation to macrophages (6, 7). Such approaches have proven their value
experimentally and have enabled the study of the biology and pathogenesis of diverse
viruses in a physiologically relevant primary cell culture system (5). Despite their
utility, there are some challenges in using blood monocyte-derived macrophages for
research purposes. Blood circulating monocytes are in low abundance (3%–8% of
blood mononuclear cells) and are non-proliferative (8, 9). While monocyte isolation and
enrichment procedures exist, they produce variable purity and yield, thereby potentially
introducing inconsistency from one experiment to the next. Additionally, acquiring these
cells requires consistent access to blood donors or the costly purchase of purified,
single-use cells from commercial vendors.
To overcome these limitations, a potential solution is to use macrophages differenti­
ated from human induced pluripotent stem cells (iPSCs) (10–13). iPSCs can be generated
in the laboratory through genetic reprogramming of somatic cells (14, 15). However, this
process is labor intensive and requires extensive characterization and validation prior to
use. Thankfully, many commercial vendors (e.g., ATCC, Coriell, and WiCell) offer diverse
collections of iPSC cell lines for purchase. Since iPSCs proliferate indefinitely, virtually
limitless numbers of cells can be obtained from a single purchased clonal cell line.
Furthermore, cell lines can be chosen based on donor ethnicity, age, and sex, introduc­
ing population-level diversity into experimental data sets. Because of their pluripotent
nature, iPSCs can also be differentiated into theoretically any cell type, including a
variety of innate immune cell types that resemble primary cells, such as monocytes
and monocyte-derived macrophages (16). Finally, iPSCs can undergo precision genome
editing with tools like CRISPR, and the introduced edits can be passed on to all differ­
entiated progeny from an engineered parental iPSC clone (17, 18), thus enabling the
creation of genetically modified immune cells that would be extremely difficult to create
if using primary cell types. Taken together, generating monocytes and monocyte-derived
macrophages from iPSCs has the potential to overcome the many difficulties associated
with studying these primary cell types from human blood while still using a physiologi­
cally relevant, non-immortalized cellular model system (10).
While other studies have compared various phenotypes between primary versus
iPSC-derived macrophages (11–13), we investigate whether iPSC-derived macrophages
are accurate models for virology. Here, following iPSC differentiation to monocytes,
harvested monocytes were differentiated into distinct macrophage subsets that were
then assessed for their ability to serve as virus infection models. To do this, we chal­
lenged these macrophage subsets with a panel of RNA viruses (HIV-1, dengue virus,
and influenza virus). We found that iPSC-derived macrophages faithfully recapitulated
viral replication kinetics and were virtually indistinguishable in terms of surface marker
expression, transcriptome, and genome-wide chromatin accessibility, when compared to
blood monocyte-derived macrophages. Thus, iPSC-derived macrophages should prove
invaluable as cellular model systems for the study of macrophage-virus interactions.

RESULTS
Blood- and iPSC-derived macrophages are phenotypically similar
Two human iPSC lines (iCTR and iC7-2) were evaluated for their ability to produce
monocyte-derived macrophages over a 4-week time course. An overview of our
macrophage generation pipeline is shown in Fig. 1A. Using the STEMdiff Monocyte
Kit (STEMCELL Technologies), we differentiated human iPSCs into hematopoietic stem
progenitor cells (HSPCs) then differentiated those HSPCs into monocytes. Monocytes
were loosely adherent to the HSPCs (HSPCs formed a confluent monolayer) and were
readily harvested by gentle washing of the cell monolayer with growth media every
4–5 days, followed by media replacement for continued growth. The total number of
monocytes harvested from four wells of a six-well dish was 4.0 × 107 cells, averaged
between both iPSC lines. After an initial burst of monocytes in the first 2 weeks (1.4 ×

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 2

Full-Length Text Journal of Virology

FIG 1 Blood- and iPSC-derived macrophages are phenotypically similar. (A) iPSCs were differentiated into monocytes using the STEMdiff monocyte kit
(STEMCELL Technologies) (top row bright­field images). As controls, blood was drawn from healthy donors and monocytes were isolated through a series of
density-gradient purifications (bottom row bright­field images; see Materials and Methods). Both blood- and iPSC-derived monocytes were differentiated into
naïve M0 macrophages via 10-ng/mL macrophage colony stimulating factor (M-CSF) treatment for 4 days. Naïve macrophages were then polarized into M1
macrophages using 50-ng/mL interferon gamma (IFN-γ) and 10-ng/mL lipopolysaccharide (LPS), or into M2 macrophages using 10-ng/mL interleukin (IL)-4, with
either treatment lasting 48 hours. Scale bars = 40 μm. (B and C) Surface protein expression levels were quantified via fluorescent antibody staining followed
by flow cytometry (one representative experiment shown from three biological replicates). Monocytes and the subsequent macrophage subtypes derived from
blood and two patient-derived iPSC lines were used. (B) Expression levels of monocyte markers CD14 and CD11b were quantified on freshly isolated monocytes.
(C) Following macrophage polarization, expression levels for CD80 (M1 macrophage marker) and CD206 (M2 macrophage marker) were quantified within the
CD14+ macrophage subset.

107 cells were collected in week 1, and 1.4 × 107 cells in week 2), we observed a gradual
decline in cell numbers over the remaining 2 weeks (7.5 × 106 cells in week 3, and 4.4
× 106 cells in week 4, Fig. S1). In contrast, single 50-mL blood harvests (Fig. 1A) yielded
2.0 × 106 monocytes total on average (n = 6 harvests, data not shown). This reveals that
monocytes can be consistently isolated from iPSCs over prolonged periods of time in
culture, thereby avoiding the need for repeated blood draws from donors.
The phenotype of iPSC-derived monocytes mirrored that of blood-derived mono­
cytes. When plated onto tissue culture-treated plastics, monocytes derived from both

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 3

Full-Length Text Journal of Virology

iPSCs and blood were adherent, large (12–21 μm in diameter), and displayed rounded
cell morphology (Fig. 1A). Flow cytometric analysis of surface marker expression in the
monocyte-producing iPSC cell population revealed a resemblance to myeloid progen­
itor cells that express the classical surface markers CD34, CD45, and CD14 (Fig. S2)
(19). Furthermore, blood- and iPSC-derived monocytes expressed canonical monocyte
surface markers CD14 and CD11b to similar levels (Fig. 1B). The purity of iPSC-derived
monocytes was lower than blood-derived cells (Fig. S3A, average CD14+ cells 75.2%,
n = 2 iPSC lines versus 93.1% from blood). However, our results are in line with the
manufacturer specifications, which indicated that a typical CD14+ purity of 60%–80%
should be expected. Overall, these data suggest that iPSCs are an alternative source to
blood for the robust production of monocytes.
We next confirmed that iPSC-derived monocytes could differentiate into macro­
phages and polarize into phenotypically distinct subtypes. Adherent monocytes were
treated with macrophage colony stimulating factor (M-CSF) for 4 days to generate naïve
(M0) macrophages. M0 macrophages were then polarized into M1 (proinflammatory) or
M2 (anti­inflammatory) subsets using interferon gamma (IFN-γ) and lipopolysaccharide
(LPS) or interleukin (IL)-4, respectively (6). iPSC-derived macrophages were similar in
morphology to blood-derived macrophages (Fig. 1A) and expressed similar levels of
CD80 (M1 subset marker) and CD206 (M2 subset marker) surface markers (Fig. 1C; Fig.
S3). Additionally, blood and iPSC-derived macrophages displayed similar phagocytic
activity when incubated with fluorescein isothiocyanate (FITC) labeled IgG opsonized
microbeads, whereas non-phagocytic epithelial cells (MA104 and BHK cells) did not
phagocytose (Fig. S4). Taken together, iPSC-derived monocytes and macrophages are
similar to their blood-derived counterparts in morphology, surface marker expression,
and functional phagocytic capacity.

Blood- and iPSC-derived macrophages are similarly susceptible to HIV-1

infection
HIV-1 primarily infects CD4+ T cells however, during the course of infection, viral
variants emerge that have the capacity to infect macrophages (20). Unpolarized (M0)
macrophages are generally susceptible to HIV-1 infection, whereas M1- or M2-polarized
macrophages are refractory (21). Macrophages might be important, long-term HIV-1
reservoirs (22). Thus, exploring HIV-1 biology in macrophages can help elucidate the role
that these cells play in HIV-1 infection in the human body.
Blood- and iPSC-derived M0 macrophages were compared for their susceptibility
to a macrophage-tropic strain of HIV-1, isolate SF162 (23, 24). Seven days after expo­
sure to HIV-1, virus production from each cell type was measured. Aliquots of the cell
supernatant were added to TZM-bl indicator cells, a CD4/CCR5 expressing cell line that
produces luciferase in response to HIV-1 gene transcription (25) (Fig. 2A). Comparable
titers of infectious virus were obtained from blood- versus iPSC-derived M0 macrophages
(Fig. 2B). We next asked whether macrophages persistently infected with HIV-1 had the
capability to seed new infections in naïve cells. To test this, 7 days post-HIV-1 infection,
the persistently infected macrophages were washed extensively, then lifted from the
dish and co-cultured with TZM-bl cells for 3 days (Fig. 2A). Co-cultured HIV-1-infected
macrophages were fully viable and capable of transmitting virus to naïve cells, as
indicated by an increase in luciferase activity over mock infected cells (Fig. 2C). Taken
together, iPSC-derived macrophages can be substituted for blood-derived cells as a
suitable model system to study HIV-1 infection.

Blood- and iPSC-derived macrophages both support high-titer dengue virus

production
Dengue virus can infect numerous cell lines in vitro, including endothelial and epithelial
cells, hepatocytes, and mononuclear cells (B and T cells) (26–29). However, the major cell
types targeted in vivo are cells of the monocyte lineage, including primary macrophages
(30–32). Importantly, dengue virus-exposed macrophages have been shown to trigger

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 4

Full-Length Text Journal of Virology

FIG 2 Blood- and iPSC-derived macrophages are similarly susceptible to HIV-1 infection. (A) Blood- and iPSC (iCTR)-derived monocytes were differentiated
into M0 macrophages using M-CSF. M0 macrophages were exposed to HIV-1 isolate SF162 (0.01 TCID50 per cell). (B) Seven days later, cell supernatant was
removed and added to TZM-bl indicator cells followed by 2 days of incubation. TZM-bl indicator cells respond to HIV-1 infection by producing luciferase, which
was quantitatively assessed by light output. (C) In parallel, adherent macrophages were lifted from the culture dish and co-cultured with TZM-bl indicator cells
for 3 days. In both graphs, error bars represent the mean ± standard deviation of technical triplicates from one (mock) or two to three biological replicates
(HIV-1-infected cells). Values above bars represent fold change relative to mock infected cells.

elevated cytokine secretion, a hallmark of patients with severe forms of dengue-induced

disease (33–36). Thus, the study of dengue virus replication in macrophages can provide
critical insights into virus-induced disease pathogenesis.
Here, we sought to test the capacity of iPSC-derived macrophages to support dengue
virus replication. We exposed blood- and iPSC-derived macrophages to dengue virus 2
(DENV2 Thailand/16681/84) at a multiplicity of infection (MOI) of 0.1. We then enumer­
ated new virions produced over a time course using plaque assays. We observed that
both blood- and iPSC-derived macrophages supported dengue virus replication with
similar endpoint titers and growth kinetics (Fig. 3A). Our results agree with a prior study
by Lang et al. (37), also supporting that iPSC-derived cells faithfully recapitulate dengue
virus replication phenotypes observed in primary blood-derived cells.
Next, we tested the effects of macrophage polarization on dengue virus replication.
M1 macrophages produce high levels of proinflammatory cytokines and are generally
more resistant to viral infections. Furthermore, pretreatment of cells with LPS and IFN-γ
(both used in M1 macrophage polarization) trigger pattern recognition receptors and
induce an anti-viral state in cells that are refractory to dengue virus infection (38–40). In
line with these studies, we observed that both blood- and iPSC-derived M1 macrophages
showed restricted virus production compared to M0 and M2 macrophage subtypes
(Fig. 3B). We speculate that such differences can be attributed to certain dengue
virus restriction factors that are induced within this highly inflammatory M1-macro­
phage subset. Collectively, dengue virus replication and innate immune restriction are
appropriately modeled in iPSC-derived macrophages, supporting the utility of these cells
for studying dengue virus biology.
We next questioned whether we could extend the use of human iPSC-derived
macrophages to non-human primate species. Each of the four human dengue virus types
is thought to have emerged after spillover from non-human primate reservoirs but, to
date, there is no evidence of spillback of these endemic human viruses into non-human
primate hosts. It is unclear whether this is due to lack of opportunity, or to species-spe­
cific restriction of the virus. It is difficult to assess the latter because (i) only a handful
of non-human primate infection models exist, and (ii) acquiring primary samples from
wild non-human primates is exceedingly difficult. For instance, the endangered status
of chimpanzees means that blood draws for research purposes are virtually impossible
to obtain. We reasoned that deriving cells from iPSCs could overcome such limitations
and enable novel studies of species tropism in relevant target cells. To achieve this goal,
we obtained commercially available chimpanzee fibroblasts and reprogrammed them

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 5

Full-Length Text Journal of Virology

FIG 3 Blood- and iPSC-derived macrophages both support high-titer dengue virus production. (A) Blood- and iPSC (iCTR)-derived M0 macrophages were
exposed to dengue virus 2 (DENV2) at an MOI of 0.1. Cell culture supernatant was harvested at the indicated time points and virus titer determined by plaque
assay. (B) Blood- and iPSC-derived macrophage subtypes, M0, M1, and M2, were exposed to DENV2 at an MOI of 0.1. After 48 hours, the supernatant was
harvested and virus titer determined by plaque assay. (C) iPSC-derived M0 macrophages from human and chimpanzee were left untreated or stimulated with
100 U/mL of interferon beta (IFN-β) for 6 hours. The cells were then exposed to DENV2 at an MOI of 1.0. After 24 hours, virus titer in the supernatent was
determined by plaque assay. Error bars represent the mean ± standard error of the mean of two to three biological replicates.

to iPSCs using non-integrating vectors (Fig. S5). The generated chimpanzee iPSCs were
successfully differentiated into monocytes and macrophages using the same methods
as we described for human iPSCs (Fig. S5). Following exposure to DENV2, chimpanzee
macrophages support infectious virus particle production to the same level as human
macrophages (white bars in Fig. 3C). This finding is in line with previous studies showing
that chimpanzees can support dengue virus infection (41–43). However, pretreatment
of cells with interferon beta prior to virus exposure resulted in greater viral restriction
in chimpanzee cells than in human cells (green bars in Fig. 3C). This latter finding may
partially account for the subclinical disease observed in chimpanzees (43), as human
dengue viruses have not experienced natural selection to subvert the interferon-driven
innate immune responses mounted by chimpanzees. Future studies with iPSC-derived
macrophages may provide valuable insights into the species tropism of dengue viruses.

Blood- and iPSC-derived macrophages both restrict influenza virus at a late

stage of the virus lifecycle
Influenza A virus primarily infects epithelial cells of the upper respiratory tract. In this
tissue environment, macrophages are among the first cell types recruited to sites of
viral replication, and they play a critical role in controlling virus-induced disease (44–47).
Influenza A virus antigen can also be detected in macrophages in vivo, suggesting that
these cell types may also support viral replication (48–50). Considering the important
role macrophages play in influenza biology, we sought to compare the replication of
influenza A virus in iPSC- and blood-derived macrophages.
We exposed blood- or iPSC-derived M0 macrophages to seasonal influenza A virus
(A/Udorn/307/1972(H3N2)) (Fig. 4A). Virus was added at an MOI of 0.1 or 1.0. After 24
hours, infectious virions produced were enumerated using plaque assays. We found that
influenza virus production was limited in both iPSC- and blood-derived macrophages
to similar extents (Fig. 4B). These findings are in line with previous reports that most
seasonal influenza virus infections in primary macrophages are abortive (2, 47, 51–54).
Next, we repeated viral growth assays in several control cell lines: (i) THP-1 and U937
are monocytic cell lines that can be differentiated into macrophages using phorbol
12-myristate-13-acetate (PMA) (55, 56), and (ii) A549 cells are common lung epithelial
cells that are susceptible to influenza virus infection (57). We observed robust virus
production in both PMA­differentiated macrophages and in A549 cells (Fig. 4B). Taken
together, our results indicate that influenza virus infection is similarly restricted in
blood- and iPSC-derived macrophages, but not in cell lines commonly used in influenza

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 6

Full-Length Text Journal of Virology

virus research. We further assessed both blood- and iPSC-derived macrophages and
A549 cells for levels of influenza virus RNA (vRNA) or viral surface protein expression
[hemagglutinin (HA)] using flow cytometry (flow cytometric gating strategy in Fig.
S6) (58). Interestingly, we observed similar levels of vRNA and HA in each cell type,
suggesting that the restriction to influenza virus is late in the virus lifecycle, after vRNA
replication and protein translation (Fig. 4C and D). Together, these results indicate that
iPSC-derived macrophages faithfully mirror the interaction between influenza virus and
blood monocyte-derived macrophages.

Blood- and iPSC-derived macrophages demonstrate similar transcriptomic

and chromatin accessibility changes during polarization
To examine whether blood- and iPSC-derived macrophages exhibit similar transcrip­
tional profiles, we carried out transcriptomic analyses of all cell types via RNA sequencing
(RNA-seq). We also included a publicly available RNA-seq data set measuring gene
expression in THP1 cell line-derived macrophages, which were polarized with similar
methodology [LPS and IFN-γ for M1, IL-4 for M2 (59)]. Through principal component
analysis of the RNA-seq data, we observed distinct transcriptomic profiles of THP1-
derived macrophages compared to iPSC- and blood-derived macrophages, as shown
in the primary principal component (Fig. 5A; PC1, 47.0% variance). In addition, the

FIG 4 Blood- and iPSC-derived macrophages both restrict influenza virus at a late stage of the virus lifecycle. (A) Schematic of experimental setup. (B) Blood- or
iPSC (iCTR)-derived macrophages, PMA­differentiated macrophages (dTHP1 and dU937 cell lines), and A549 cells were exposed to influenza virus at the indicated
MOI of 0.1 or 1.0. After 24 hours, the virus titer in the cell supernatant was determined via plaque assay on Madin-Darby canine kidney (MDCK) cells. In the
infected cells, (C) intracellular viral RNA (vRNA) and (D) surface hemagglutinin (HA) were analyzed by flow cytometry. (C and D) Mock infected cells were used to
draw gates for vRNA and HA flow analyses. All graphs display the mean ± standard error of the mean from two biological replicates.

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 7

Full-Length Text Journal of Virology

secondary principal component (PC2, 36.5%) clearly separates macrophage subtypes.

Blood- and iPSC-derived macrophage transcriptional profiles were separated by cell
subtype rather than the tissue origin, highlighting their close resemblance. In addi­
tion, via pair-wise transcriptomic comparison, we observed strong correlation of gene
expression between blood- and iPSC-derived macrophages: M0 (Pearson correlation
coefficient [PCC] = 0.95), M1 (PCC = 0.94), and M2 (PCC = 0.94) (Fig. 5B).
We next looked at the expression of specific genes in polarized cell types (M1 and M2)
relative to the naïve M0 macrophages (Fig. 5C). Compared to iPSCs, differentiated
macrophages show low or no expression of pluripotency transcription factors (NANOG,
FOXD3, SOX2, POU5F1, etc.) as expected. Furthermore, polarized macrophages showed
upregulation of genes known to correlate with the macrophage polarization process. M1
macrophages demonstrated upregulation of genes involved in inflammatory responses
(IRF1, IL15RA, IDO1, etc) as well as IFN-γ-stimulated genes (GBP5, SERPING1, STAT1, etc)
(Fig. 5C) (60–63). M2 macrophages showed upregulation of IL-4-stimulated genes
(MAOA, TGM2, and CTNNAL1) (64–66). Also consistent with our flow cytometric analysis
of cell surface marker expressions (Fig. 1C), CD80 and CD206 were differentially
expressed in M1 and M2 macrophages at the transcriptional level (Fig. 5C), respectively.
These signature gene expression changes were observed consistantly regardless of
blood or iPSC origin of the cells. However, THP1-derived macrophages failed to fully
recapitulate all of the transcriptional changes expected during polarization (e.g. SOCS1
and APOL4 in M1 macrophages; and CD206, MAOA, TGM2, etc. in M2 macrophages).
Together, this suggests that blood- and iPSC-derived macrophages have similar tran­
scriptomic profiles at each polarization stage.
Finally, to determine whether blood- and iPSC-derived macrophages exhibit similar
patterns of chromatin accessibility, we carried out the assay for transposase-accessible
chromatin sequencing (ATAC-seq) (67) on all cell types. We first identified open chroma­
tin regions for each cell type, and then compared the normalized read counts within
each open chromatin region. For example, in Fig. 6A we show chromatin accessibility
around two genes that were previously highlighted in our transcriptomic analysis: IRF1
which was upregulated in M1 macrophages, and GATA3 which was upregulated in M2
macrophages. We also see chromatin accessibility changes around these genes depend­
ing on polarization status, but that these changes are consistant regardless of blood or
iPSC origin of the cells.
By clustering open chromatin regions and looking for enriched binding motifs, we
identified active transcription factors with similar genome-wide chromatin landscapes
across cell types. From these, we summarized potentially important transcription factors
active during macrophage differentiation and polarization (Fig. 6B and C). Together with
RNA-seq analysis shown in Fig. 5C (pluripotency genes), the ATAC-seq analysis helps
confirm that, at naïve M0 macrophage stage, the iPSC-derived macrophages are free of
the residual footprints of pluripotency transcription factors (SOX2, KLF4, NANOG, etc),
which were artificially introduced during somatic-to-iPSC reprogramming (68) (Fig. 6B
and C; AC1 and AC2 for iPSC-derived M0 macrophages). The enrichment of NANOG,
SOX2, and KLF4 in both blood- and iPSC-derived M2 macrophages is likely the result of
motif co-occupancies by other transcription factors involved in anti­inflammatory
responses and wound healing, a property shared by both pluripotent stem cells and M2
macrophages (Fig 6B and C; AC2) (69). Collectively, the RNA-seq and ATAC-seq analyses
show that iPSC- and blood-derived macrophages display highly similar cell type­defining
gene expression patterns that are also revealed by chromatin accessibility profiles.

DISCUSSION
Monocytes and macrophages are essential cellular components of the innate immune
system. They are oftentimes the first population of immune cells to encounter patho­
gens, and they play a critical role in microbial clearance through phagocytosis and
activation of adaptive immunity. Despite their important role in immunity, these cells
may also serve as a double-edged-sword; monocytes and macrophages are oftentimes

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 8

Full-Length Text Journal of Virology

FIG 5 Blood- and iPSC-derived macrophages demonstrate similar gene expression profiles. (A) Principal component analysis of the expression profiles from
differentially expressed genes of blood-, iPSC (iCTR), and THP1-derived macrophages during polarization. The first two principal components are shown with the
percentages of total data variance indicated in parentheses. The specific cell types are indicated by different colors, while the origin of the cell types is indicated
by shapes (orange, M0 macrophages; maroon, M1 macrophages; blue, M2 macrophages; triangle, iPSC derived; circle, blood derived; square, THP1 derived).
(B) Scatter plots of the log10-transformed fragments per kilobase of transcript per million mapped reads (FPKM) values for all RNA transcripts from each cell
type that was either derived from blood (y-axis) or iPSC (x-axis). The red line indicates y = x, and the Pearson correlation coefficients of the linear regression
are indicated on each plot. (C) Heatmap of 5 pluripotency genes and 10 differentially expressed genes from each pair-wise comparison representing the genes
undergoing significant changes during macrophage polarizations. The library size and FPKM-normalized expression data are further scaled to row mean z-score.
Each row represents an individual gene, and each column represents a biological condition where the cell type and origin are color-coded at the top.

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 9

Full-Length Text Journal of Virology

FIG 6 Blood- and iPSC-derived macrophages demonstrate similar chromatin accessibility profiles. (A) Integrated Genome Viewer screenshots of chromatin
accessibility changes along with gene expression changes of representative genes (IRF1 and GATA3) during macrophage polarization. Each track is a bar graph
representing the counts-per-million-mapped-reads-normalized read coverage over ATAC-seq peaks or annotated genes. Each track is also representative of
two biological replicates. The track heights are group auto-scaled, and the scale for each group is indicated on the first track. (B) Heatmap of open chromatin
regions that demonstrated significant accessibility changes during macrophage polarization or through comparison to iPSC. The regions are assigned to clusters
AC1–AC5 through hierarchical clustering (shown on the left). The library size and FPKM-normalized read counts for each ATAC-seq peak is further scaled to
the row mean. Each row represents an ATAC-seq peak, and each column is the average chromatin accessibility of two biological replicates, where the cell type
and origin are color-coded at the top. (C) Transcription factor motif enrichment analysis of each open chromatin region cluster (shown in panel B, represented
here in each column) demonstrates significant accessibility changes during monocyte differentiation or macrophage polarization. The enriched transcription
factor motifs that are relevant to iPSC or macrophage lineages are represented on each row and annotated on the right. The adjusted P value from the motif
enrichment is −log10 transformed and then row mean-normalized.

exploited by viruses as vessels for viral replication and dissemination throughout the
body. Thus, studying the biology of viruses in macrophages, and how these essential
innate immune cells respond to infection, is of upmost importance.
Blood monocyte-derived macrophages are commonly employed as experimental
models to mimic in vivo macrophages in research settings. However, despite their
improved relevance over standard PMA­differentiated immortalized cell lines (e.g., THP-1
and U937 macrophages), there are some challenges that come along with working
with these primary cell types. First, monocytes circulate in low numbers in the blood
and cannot be propagated ex vivo, thus requiring large volumes of blood for routine
experimentation. Second, the reliance on blood donors means that lengthy institutional
review board (IRB) approvals must be in place prior to the study, experienced phleboto­
mists must be recruited, and donors must be procured and scheduled in advance. These
limitations could potentially be overcome by purchasing peripheral blood mononuclear
cells (PBMCs) or purified monocytes from commercial vendors, but the high upfront cost

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 10

Full-Length Text Journal of Virology

for single-use cell stocks may not be justifiable for some laboratories. Lastly, macro­
phages are difficult to genetically manipulate, making it challenging to isolate the effects
of particular genes or gene products on phenotypic outcomes. To overcome these
limitations, human iPSC-derived monocytes and macrophages have served as surrogate
experimental model systems (10–13). iPSC cell lines can be purchased commercially
and banked, avoiding the need to recruit and schedule blood donors. Genetic diversity
can be included by selecting iPSC cell lines from diverse donors. Also, the use of iPSCs
to generate monocyte-derived macrophages allows for a continual supply of cells. For
instance, we routinely isolated monocytes every 2–4 days for up to a month from
single wells of six-well dishes. However, other studies have reported that collections
can be extended for several months under different experimental conditions (70–72).
Furthermore, several recent studies have employed large-scale production of iPSC-
derived macrophages, which has broad potential for application in drug screening and
immunotherapeutic development (71–73). Thus, the use of iPSC-derived macrophages
provides many advantages over traditional blood monocyte-derived macrophages.
Historically, macrophages have been classified into several distinct groups based on
their polarization state: M0 (unpolarized), M1 (proinflammatory), and M2 (anti­inflamma­
tory). Such categories are simple (e.g., M1/M2 mirrors the Th1/Th2 T-cell polarization
concept) and useful in describing the overall opposing activities of macrophages (74,
75). Using standardized methods for cell polarization, we demonstrated that iPSC and
blood monocyte-derived macrophages phenocopied one another in terms of surface
marker expression (Fig. 1), gene expression (Fig. 5), and chromatin accessibility (Fig. 6)
following cell polarization. It is important to note, however, that many recent studies
have demonstrated that macrophages exist more on a continuum rather than fitting into
distinct M0/M1/M2 bins. For instance, M2 macrophages can be categorized into different
subtypes (M2a, M2b, M2c, and M2d) based on phenotypic differences observed in the
M2 population and the addition of different stimuli (76, 77). Additionally, while CD80 is
a canonical M1 marker, its expression is also observed on M2b cells (78). In the future,
additional studies are warranted to determine whether iPSC-derived macrophages can
also mirror the unique nature of diverse macrophage subtypes.
Tissue-resident macrophages are crucial in mediating viral pathogenesis, yet these
cell types are nearly impossible to study in vitro. The iPSC-derived macrophages
present new potential for such study, as a few recent studies have successfully gener­
ated iPSC-derived microglia, osteoclasts, Kupffer cells, and alveolar macrophages (79–
82). Future studies should also explore the relevance of iPSC-derived tissue resident
macrophages in studying viral-host interactions in vitro.
Using three clinically relevant human viruses, HIV-1, dengue virus, and influenza
A virus, we show that iPSC monocyte-derived macrophages faithfully recapitulate
relevant phenotypes observed in primary blood monocyte-derived macrophages. This
is exemplified by several key findings. First, we demonstrate that HIV-1 and dengue virus
replicate similarly in iPSC- and blood-derived macrophages. We observed similarities in
viral growth kinetics and endpoint viral titers for dengue virus and noted that HIV-1 is
similarly capable of infecting iPSC- and blood monocyte-derived macrophages. Second,
we show that dengue virus replication is restricted in iPSC and blood M1 macrophages,
recapitulating a phenotype not seen in cell lines used in this field. Finally, we show that
seasonal influenza A virus infection is similarly restricted in iPSC- and blood monocyte-
derived macrophages at a late stage of the virus replication cycle and that this blockade
was not present in immortalized monocytic or epithelial cell lines. This latter finding is
relevant because, despite the utility that PMA-induced THP-1 and U937 immortalized
macrophages provide for influenza virus research, they do not faithfully recapitulate key
viral restriction phenotypes that are observed in primary human cells. Taken together,
iPSC-derived monocytes and macrophages should be considered vital cell culture model
systems for studying virus biology and host response to infection.
We extended this work by reprogramming non-human primate (chimpanzee)
fibroblasts and then differentiating those cells into macrophages. Interestingly, we

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 11

Full-Length Text Journal of Virology

found key species­specific differences in macrophage susceptibility to virus infection.

A deeper characterization of these chimpanzee macrophages, as well as iPSC-derived
macrophages from other species, has the potential to provide important insights into
the genetic factors controlling the species tropism of viruses. It is important to note
that such studies would not have been possible with primary blood monocyte-derived
macrophages from chimpanzees, as the endangered status of these animals precludes
their access.
In conclusion, we have shown that iPSC-derived macrophages are a valuable model
system for probing questions related to virus biology and host response to infection.
In addition, we have provided comprehensive comparisons of global gene expression
and chromatin changes during iPSC and blood cell differentiation into M0, M1, and
M2 monocyte-derived macrophage subsets. We conclude that iPSC-derived cells display
nearly identical properties to blood-derived counterparts and thus would serve as a
valuable alternative to primary cells obtained from human blood donors.

MATERIALS AND METHODS

Cell lines and culture conditions
Monocytic cell lines THP-1 (ATCC, #TIB-202) and U937 (ATCC, #CRL-1593.2) were cultured
in RPMI-1640 medium (ATCC, #30-2001) with 10% FBS and 1% Pen Strep (complete
medium). TZM-bl (NIH ARP, #8129), MDCK (ATCC, #CCL-34), and BHK (ATCC, #PTA-3544)
cells were cultured in Dulbecco’s modified Eagle medium (Sigma-Aldrich, #D6429)
with 10% FBS, 2-mM L-glutamine (Corning, #25-005-CI), and 1% Pen Strep (Corning,
#MT30002CI) (complete medium). A549 cells were cultured with F-12K medium (Corning,
#10-025-CV) supplemented with 10% FBS, 2-mM L-glutamine, and 1% Pen Strep. The
iPSC cell lines iC7-2 and iCTR were obtained from the University of Colorado Anschutz
Gates Center for Regenerative Medicine and the Cedars-Sinai Medical Center iPSC Core,
respectively. Specifically, the iC7-2 line was generated from deidentified specimens
from Lonza’s publicly available biorepository (Lonza C7 fibroblasts). The reprogramming
was carried out by the Gates Center for Regenerative Medicine staff via transfection
of modified mRNAs and miRNAs using a virus-free and non-integrating method (83).
The iCTR cell line was generated from healthy donor PBMCs (CS0594iCTR), and the
reprogramming was performed via nucleofection of episomal plasmids by the core
staff as previously described (84). The iPSC lines were characterized through karyotype
analysis, mycoplasma testing, and pluripotency testing. Both iPSC lines are maintained in
mTeSR Plus medium (STEMCELL Technologies, #100-0276) using hESC­qualified Matrigel
(Corning, #CLS354277) coated plates. All cells were maintained at 37°C and 5% CO2. All
subcultures of iPSC were passaged using 0.5-M EDTA (Invitrogen, #AM9260G).

Chimpanzee iPSC derivation

Chimpanzee Induced pluripotent stem cells were generated at the Stem Cell Biobanking
and Disease Modeling Core Facility of the Gates Center for Regenerative Medicine using
episomal vector (EV) plasmids (85). Fibroblasts (6.0 × 105 cells) were electroporated with
1 µg of each EV plasmid using Lonza’s Basic Nucleofector Kit for Primary Mammalian
Fibroblasts and Nucleofector 2D device program: U-023. The cells were plated (3.0
× 105 cells) onto two wells of a six-well plate. Reprogramming medium consisted of
fibroblast culturing medium supplemented with 10-ng/µL bFGF (Peprotech, #100-18B),
5-µM Y-27632 (Tocris, #1254), 0.5-mM sodium butyrate (Sigma, #303410-5G), and 1X
antibiotic/anti-mycotic (Gibco, #15240062) (86). The medium was changed daily. On day
7 after electroporation, the cells were disassociated from the wells using Trypsin-EDTA
(ThermoFisher, #2530054) and transferred onto Matrigel (ThermoFisher, #354277) coated
six-well plates. At day 8, the medium was replaced with E8 (ThermoFisher, #A1517001)
and changed daily. Colonies were picked on day 22 and after four passages, the media
were changed to mTeSR Plus (STEMCELL Technologies, #100-0276).

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 12

Full-Length Text Journal of Virology

Characterization of chimpanzee iPSC

Immunofluorescence
Three days prior to staining, chimpanzee iPSCs were seeded onto a 24-well plate coated
with matrigel. Medium was changed daily until the resulting colonies were large enough
to be fixed. Cells were fixed with 4% (wt/vol) paraformaldehyde in DPBS (ThermoFisher,
#14190250) for 20 minutes at room temperature and subsequently washed with DPBS. A
staining solution containing 0.1% Tween (Millipore, #P1379)/0.5% Triton X-100 (Thermo­
Fisher, #J62289.AP)/0.05% sodium azide in DPBS was added to the wells. The following
conjugated antibodies were added to the staining solution at a dilution of 1:300: Oct-3/4
Alexa Fluor 546 (Santa Cruz Biotechnology, #sc-5279), Nanog Alexa Fluor 647 (Santa
Cruz Biotechnology, #sc-293121), TRA-1–60 Alex Fluor 488 (Santa Cruz Biotechnology,
#sc-21705) and incubated overnight at 4°C. The next day, the cells were washed with
DPBS and counterstained with DAPI. The cells were imaged using the Nikon Eclipse Ti
confocal microscope.

Examination of residual plasmid by PCR

Genomic DNA was extracted from cells using a Genomic DNA Extraction Kit (Zymo
Research, #D3024) following the manufacturer protocol. To determine the presence of
EV plasmid in iPSCs lines, the EBNA primers targeting the EV backbone were used (85).
The primer sequence is as follows: forward (CAGCTCCTTTCCGGGACTTT) and reverse (GA
AGGAAGGTCCGCTGGATT). PCR was performed using OneTaq HotStart Quick-Load (New
England Biolabs, #M0488S). Briefly, 9.5 µL of nuclease free water including 10 ng of DNA
and 1 µL of specified primers (5 µm of each forward and reverse primers) were added to
12.5 µL of PCR master mix. The PCRs were run in a programmable thermocycler (Bio-Rad,
#C1000), and the reaction mixture was incubated for 30 s at 94°C, followed by 20 s at
94°C, 20 s at 55°C, and 20 s at 68°C for 35 cycles; and final extension for 2 minutes at 68°C.

Cell line authentication and karyotyping

Short tandem repeat cell line authentication was performed by The Barbra Davis
Center for Childhood Diabetes Molecular Biology Core Facility. Cytogenetic analysis was
performed by WiCell using standard GTL banding (G-banding) of metaphase chromo­
somes. Twenty metaphase chromosome spreads were analyzed for each established line,
with chromosome classification following ISCN (2017) guidelines.

Differentiation of iPSC-derived monocytes using STEMdiff

Monocytes were differentiated from iPSCs using the STEMdiff Monocyte Kit (STEMCELL
Technologies, #05320), following the manufacturer recommendations. In brief, for each
iPSC cell line, approximately 120 iPSC aggregates (50–200 μm in diameter) were seeded
in four wells of hESC­qualified Matrigel coated six-well tissue culture plates. The next
day, the plates were examined under a light microscope to ensure around 60–80 iPSC
aggregates were seeded within each well of the six-well plate. By day 10 of the protocol,
monocytes were observed lifting off the basal hematopoietic progenitor cell layer and
remained in the media as suspension cells. Starting at day 16 post iPSC differentiation,
we followed a fixed schedule to harvest monocytes from the cell culture supernatant.
Upon harvest, the monocytes are seeded onto tissue culture-treated plates, and the
monocytes adhere to the bottom of the plates. Each well started with 2 mL of mono­
cyte differentiation medium [StemSpan SFEM II (STEMCELL Technologies, #09605) + 1×
STEMdiff monocyte differentiation supplement (STEMCELL Technologies, #05324)] and
incubated for 2 days. After two days incubation, the cell culture media was topped off
with 2 mL of additional monocyte differentiation medium and incubated for another 2–3
days. This method enabled greater cell numbers of monocytes to be harvested, since
they were allowed to accumulate in the culture dish for 4–5 days. This harvest schedule
was repeated seven times over the course of 4 weeks.

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 13

Full-Length Text Journal of Virology

Monocytes harvested from cell culture supernatants were collected via centrifugation
at 300xg for 5 minutes and then transitioned to culture in ImmunoCult-SF macrophage
medium (STEMCELL Technologies, #10961) over a period of several days. Specifically, a
medium ratio of 1:3 for monocyte differentiation medium : ImmunoCult-SF macrophage
medium was used to initially seed freshly isolated monocytes onto 6-well tissue culture
plates (2 × 106 cells per well plated). In the following days, a daily media change
was performed on the adherent cells following the monocyte differentiation medium :
ImmunoCult-SF macrophage medium ratio of 1:1 (1 day after harvest) and 3:1 (2 days
after harvest). These media transition steps were necessary as we found direct transi­
tion of monocytes from the monocyte differentiation media to the ImmunoCult-SF
macrophage medium led to significantly reduced cell viability. We started iPSC-derived
monocyte to macrophage differentiation 3 days after monocyte harvest by replacing
medium with 100% ImmunoCult-SF macrophage medium containing 10-ng/mL M-CSF
(R&D Systems, #216-MC-010).

Isolation of blood-derived monocytes

To obtain blood-derived monocytes, 50 mL of human blood was collected from
apparently healthy anonymous donors on the day of purification. Within 1 hour of blood
collection, 12-mL aliquots of blood were diluted 1:1 with Dulbecco’s phosphate­buffered
solution (PBS) (Caisson Labs, #PBL02-500ML) +2% FBS before being loaded onto 15 mL of
Lymphoprep (STEMCELL Technologies, #07801). The layered blood-Lymphoprep mixture
was centrifuged at 800 × g for 20 minutes at room temperature with the brake off.
After the centrifugation, the upper plasma layer was gently removed and discarded.
The buffy coat (mononuclear cell layer) was collected and washed with PBS + 2% FBS
three times with low-speed centrifugation at 180 × g for 10 minutes at room tempera­
ture. Subsequently, monocytes were purified from the PBMCs via Percoll (Sigma-Aldrich,
#P4937) gradient centrifugation as previously described (87). Briefly, freshly isolated
PBMCs were resuspended in 3 mL of RPMI-1640 +1% FBS and slowly layered on top of
a Percoll density gradient that was prepared in a 15-mL conical tube as follows: first, a
100% Percoll fraction was prepared by mixing 4.5-mL Percoll with 0.5-mL 10× PBS; then,
the 52.5% Percoll fraction was prepared by mixing 2.675-mL 100% Percoll fraction with
2.325-mL RPMI-1640 +1% FBS, and the 45% Percoll fraction was prepared by mixing
2.25-mL 100% Percoll fraction with 2.75-mL RPMI-1640 +1% FBS; finally, the density
gradient was prepared by slowly layering 4.5 mL of the 52.5% Percoll fraction followed
by 4 mL of the 45% Percoll fraction. The density gradient containing PBMCs was then
centrifuged at 610 × g for 30 minutes at room temperature with the brake off. The
monocyte layer was collected and washed with PBS via centrifugation at 250 × g for
10 minutes at room temperature three times. The purified monocytes were plated onto
six-well plates at 2 × 106 cells per well.

Monocyte to macrophage differentiation

To differentiate monocytic cell lines into macrophages, THP-1 and U937 cells were plated
at 2 × 106 cells per well of a six-well dish in RPMI-1640-complete medium supplemented
with 10-ng/mL PMA (Sigma-Aldrich, P8139) and cultured for 3 days. To differentiate
both iPSC- and blood-derived monocytes into naïve macrophages, monocytes were
plated at 1 × 106 cells per well of a six-well plate in ImmunoCult-SF macrophage
medium supplemented with 10-ng/mL M-CSF and cultured for 4 days. To polarize
the naïve macrophages into M1 subtype, the M0 macrophages were incubated in
ImmunoCult-SF macrophage medium supplemented with 50 ng/mL Interferon-gamma
(IFN-γ) (R&D Systems, #285-IF-100/CF) and 10-ng/mL LPS (Sigma-Aldrich, #L2018) for 2
days. To polarize the naïve macrophages into M2 subtype, the M0 macrophages were
incubated in ImmunoCult-SF macrophage medium supplemented with 10-ng/mL IL-4
(Sigma-Aldrich, #H7291) for 2 days.

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 14

Full-Length Text Journal of Virology

Phenotypic profiling of cell surface marker expression by flow cytometry

To carry out phenotypic profiling of cell surface marker proteins, at least 1 × 105
adherent cells were lifted off tissue cultures plate via treatment of cells with Accutase
(STEMCELL Technologies, #07922). The cells were washed once with PBS and incubated
with 25-µg/mL Fc receptor block (BD Biosciences, #564220) diluted in 50-µL FACS buffer
(PBS + 1-mM EDTA +2% FBS) for 10 minutes at room temperature. Without removing Fc
blocking solution, an additional 1 µL of fluorescently labeled cell surface antibodies was
spiked into the solution (1:50 dilution) [CD14-PE/Cy7 (BioLegend, #301813), CD11b-PE
(BioLegend, #301305), CD80-PE (BioLegend, #305207), and CD206-FITC (BioLegend,
#321113)]. The cells were then incubated in the dark at 4°C for 30 minutes to allow
antibody binding. After the incubation, the cells were washed twice using FACS buffer.
Flow cytometric analysis was carried out using the Accuri C6 Plus flow cytometer (BD
Biosciences), and the analysis was done using FlowJo analysis software v.10.8.0 (BD
Biosciences).

Phagocytosis assay
Cell capability for phagocytosis was measured using the Phagocytosis Assay Kit (Cayman,
cat. number 500290; Ann Arbor, MI) following the manufacturer instructions. Briefly,
latex beads coated with FITC-labeled rabbit IgG were added directly to cells in culture
media to a final dilution of 1:200. Cells were incubated at 37°C for 2 hours, detached,
washed, and treated with trypan blue to quench signals from cell surface-bound beads.
Single-cell fluorescence was measured by analyzing 20,000 events per sample by flow
cytometry, gating in single cells and comparing to no-bead and non-phagocytic controls.
Assay was performed in two biological replicates.

RNA-seq and ATAC-seq

ATAC-seq and RNA-seq library preparation
iPSCs, along with blood- and iPSC-derived monocytes/macrophages, were cultured in
six-well plates at 1 × 106 cells/well, each with biological duplicates. The cells were
lifted via treatment with Accutase for 20 minutes at 37°C, and 5 × 104 cells were
split for ATAC-seq library preparation following published Omni-ATAC protocol (67).
The ATAC-seq library was further size-selected using a BluePippin machine with a 2%
agarose gel cassette (Sage Science, #RBF2010) to enrich for 100- to 1,000-bp fragments.
For RNA-seq, total RNA was harvested using Zymo Quick-RNA Microprep kit (Zymo,
#R1050), and mRNA was enriched and prepared into sequencing library using KAPA
mRNA HyperPrep kits (Roche, #8098123702). Both ATAC-seq and RNA-seq libraries
were sequenced on the NovaSeq 6000 System using 2 × 151 cycles for a minimum
of 20 million pair-end reads per library. Raw sequencing reads were deposited in
the National Center for Biotechnology Information GEO database under the accession
number GSE252979.

RNA-seq data analysis

Raw sequencing reads for dTHP1 and dTHP1-derived M1 and M2 macrophages were
obtained from the National Center for Biotechnology Information GEO database, under
the accession number GSE154347. Sequencing reads were first trimmed for low-quality
reads and adapter sequences using BBDuk (BBMap v.38.05) (88). The trimmed reads were
mapped to human hg38 genome using HISAT2 v.2.1.0 (89). The number of reads were
mapped to human RefSeq exons using FeatureCount (Subread v.1.6.2) (90). The mapped
reads were normalized by size factors and analyzed for differential expression using
DESeq2 R package v.1.34.0 (91). To visualize relative expression of genes, the fragments
per kilobase of transcript per million mapped reads of size factor normalized read counts
were extracted to plot the heatmaps, and the expression level was subsequently scaled

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 15

Full-Length Text Journal of Virology

to row z-score. The gene ontology enrichment analysis was done using R package
clusterProfiler v.3.0.4 (92).

ATAC-seq data analysis

Raw sequencing reads were first trimmed for low-quality reads and adapter sequen­
ces using BBDuk (BBMap v.38.05). The trimmed reads were mapped to the human
hg38 genome using Bowtie2 v.2.2.9 (93). The resulting mapped reads were used to
identify enriched open-chromatin peaks using the software package Genrich v.0.6.1
in ATAC-seq mode (available at https://github.com/jsh58/Genrich), which automatically
removes mitochondrial reads, PCR duplicates, and corrects for read shifting caused by
Tn5 transposition. The identified narrow peaks were then merged across biological
duplicates and experimental conditions. The number of reads mapped to each peak
were counted using FeatureCount (Subread v.1.6.2). The read counts were then corrected
for library size and trimmed mean of M values using edgeR v.3.36.0 (94). We then
identified open chromatin regions that underwent significant accessibility changes
during differentiation and/or polarization and clustered their accessibility profiles using
hierarchical clustering. The motifs that are significantly enriched within each cluster
were identified using Analysis of Motif Enrichment [MEME suite v.5.4.1 (95)] against the
reference human motif database HOCOMOCO v11.

Virus production, macrophage infections, and determination of virus titers

Dengue virus
Generation of virus stocks
C6/36 mosquito cells were seeded at 1 × 105 cells/cm2 in a 150-cm diameter dish
(Celltreat, #229651) to reach 80% confluency the next day. To make the infection
medium, dengue virus stock (DENV2 Thailand/16681/84) was diluted in PBS with
calcium and magnesium (Corning, #21–030-CV) to reach an MOI of 0.001 in a total
volume of 3 mL. The cells were incubated with the virus inoculum at 28°C and 5%
CO2 for 1 hour with periodic rocking every 15 minutes. After the incubation, the
inoculum was removed, and cells were washed once with PBS. The cells were then
incubated in Eagle’s minimum essential medium (EMEM) + 25-mM HEPES (Sigma-
Aldrich H3375-250G) +2% FBS for 7 days, and then the supernatant was collected.
Cells were replenished with fresh media, and another batch of supernatant was
collected at 12 days post-infection. Cell debris were removed from the supernatant
by centrifugation at 1,000 × g for 5 minutes. The virus-containing supernatant
was then aliquoted and stored at −80°C. The titer of the dengue virus stock was
determined using plaque assay on BHK cells as described below.

Infection of macrophages
Macrophages were seeded at 1 × 106 cells/well in six-well plates on the day before
infection. Dengue virus was diluted in ImmunoCult-SF macrophage medium at the
indicated MOI and incubated with macrophages at 37°C and 5% CO2 for 1 hour. After
the incubation, the inoculum was removed, and the cells were washed with PBS three
times. Finally, 2-mL ImmunoCult-SF macrophage medium was replaced on the cells. The
supernatant was collected at the indicated time points after infection.

Infectious virus determination by plaque assays

The titer of the dengue virus stock as well as supernatant from macrophage infections
were determined by plaque assays on BHK cells. BHK cells were seeded into six well-
plates at 1 × 106 cells/well to reach near confluency the next day. The virus stock or the
infection supernatant was 10-fold serially diluted in serum-free DMEM, and 400 µL of the
dilution was overlayed on BHK cells for 1 hour at 37°C with periodic rocking every 15 min.

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 16

Full-Length Text Journal of Virology

After 1 hour, the inoculum was replaced with 2× EMEM without phenol red or L-gluta­
mine (Quality Biological, # 115–073-101) containing 1.2% Avicel (FMC Corporation, Avicel
#RC-591NF) and 10% FBS and incubated at 37°C for 5 days. After the incubation, the
overlay medium was removed, and cells were washed two times with PBS. The cells
were then fixed with 20% methanol (Research Products International, #M22055-4000.0)
containing 0.2% crystal violet (MilliporeSigma, #C3866-25G) for 15 minutes. The number
of plaques was manually counted and reported as plaque-forming units (PFU) per
milliliter.

HIV-1
Generation of virus stocks
Blood was obtained from healthy donors, and PBMCs were isolated following Lympho­
prep density-gradient centrifugation as described above. The isolated PBMCs were then
cultured in RPMI-1640 complete media supplemented with 5-μg/mL phytohemaggluti­
nin (PHA; Sigma-Aldrich, #11249738001) and 20-U/mL IL-2 (PeproTech, #200-02) for 3
days. After 3 days of PHA stimulation, the media was removed, and the cells were
expanded in RPMI-1640 complete plus IL-2 (T-cell maintenance medium). To prepare
HIV-1 stocks, 1 × 107 PBMCs were pelleted at 300 × g for 8 minutes; the media was
removed; and the cell pellet was then resuspended in 1 mL of HIV-1 SF162 cell-free virus
(NIH ARP, #276). After a 1-hour incubation with virus, the culture volume was increased
to 10 mL (T-cell maintenance medium), and the virus culture was maintained for 14 days
with the following considerations: on day 3, half of the media were replaced with fresh
media; on day 7, the culture volume was doubled by adding 1 × 107 fresh PBMCs; on day
9, half of the media were replaced with fresh media; and on day 14, the cell supernatant
was harvested and titered by TCID50 assay on TZM-bl reporter cells.

Macrophage infections
iPSC (n = 2 cell lines) and blood-derived M0 macrophages (n = 1 donor in three biological
replicates) were plated at 1 × 105 cells per well of a 48-well dish. The next day, the cells
were infected with HIV-1 SF162 virus (stock titers at 3.2 × 103 TCID50/mL) in the presence
of 5-µg/mL polybrene. The cells were spinoculated at 1,200 × g for 75 minutes at 30°C.
Following spinoculation, the cells were washed 3× with PBS and resuspended in 500 µL
of ImmunoCult-SF macrophage media. After 7 days of culture, the media were removed
and stored at −80°C for virus titering.

Infectious virus determination by TZM-bl assay

Macrophage cell supernatants were split into three equal volumes (technical replicate
samples) and were inoculated onto TZM-bl indicator cells seeded on the prior day
at 1 × 104 cells/well of a 96-well dish. TZM-bl indicator cells stably express the HIV-1
receptors CD4 and CCR5 and contain an integrated reporter gene for firefly luciferase
whose expression is activated by HIV-1 gene products. So, luciferase activity from these
cells indicates productive viral infection. The cells were spinoculated in the presence of
5-µg/mL polybrene as described above and then allowed to incubate for 48 hours at
37°C and 5% CO2. After the 48-hour incubation, the media were removed; the cells were
washed; and then virus infectivity was measured by firefly luciferase assays following the
manufacturer protocol (Promega Luciferase Assay System, #E1501). Luminescence was
determined using the Synergy LX plate reader (Biotek).

Macrophage-TZM-bl co-culture
Following 7 days of culture, infected macrophages (described above) were washed,
detached from the culture dish using Accutase cell detachment solution, split into two
equal volumes (technical replicate samples), and plated onto TZM-bl indicator cells
seeded on the prior day at 1 × 104 cells/well of a 96-well dish. The macrophages and

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 17

Full-Length Text Journal of Virology

TZM-bl cells were co-cultured for 3 days. The transmission of infectious virus from
macrophages to naïve TZM-bl cells was measured by luciferase assay as described above.

Influenza virus
Generation of viral stocks
Influenza H3N2 influenza A Udorn virus stocks (A/Udorn/307/1972(H3N2)) (96) were
grown in 10-day-old fertilized chicken eggs, and virus stock was further propagated
using human MDCK cells. Specifically, MDCK cells were plated on 15-cm dishes at 1.5 ×
107 cells to reach 100% confluency. The next day, 1.5 × 105 PFU viral stock was diluted in
5-mL serum-free DMEM medium (MOI = 0.01) and incubated on cells for 1 hour at 37°C.
Following the incubation, the infection medium was replaced with 20-mL DMEM + 0.3%
bovine serum albumin (MilliporeSigma, #A7906-50G) + 1-µg/mL N-acetylated trypsin for
72 hours. The supernatant-containing infectious viruses were collected, centrifuged at
500 × g for 10 minutes to pellet cell debris, and aliquoted and stored at −80°C. The titer
of the influenza virus stock was determined via plaque assay on MDCK cells.

Infection of macrophages and A549 cells

Macrophages were seeded at 1 × 106 cells/well in six-well plates on the day before
infection. Influenza virus was diluted in ImmunoCult-SF macrophage medium at the
indicated MOI and incubated with macrophages for 1 hour at 37°C. After the incubation,
the inoculum was replaced with 2-mL ImmunoCult-SF macrophage medium contain­
ing 0.2-µg/mL N-acetylated trypsin for 48 hours. To infect immortalized macrophages
(PMA­differentiated THP1 and U937), influenza virus was diluted in serum-free RPMI-1640
and incubated with the cells for 1 hour before and then replaced with serum-free
RPMI-1640 + 0.2-µg/mL N-acetylated trypsin + 0.3% BSA. To infect A549 cells, influenza
virus was diluted in serum-free F-12K medium and incubated with the cells for 1 hour
before being replaced with 2-mL serum-free F-12K medium + 0.2-µg/mL N-acetylated
trypsin.

Infectious virus determination via the plaque assay

The titer of the influenza virus stock as well as supernatant from macrophage and A549
infections were determined by plaque assays on MDCK cells. MDCK cells were seeded
onto six-well plates at 1 × 106 cells/well to reach near confluency the next day. The virus
stock or the infection supernatant were 10-fold serial diluted in serum free DMEM, and
850 µL of the dilution was overlayed on MDCK cells for 1 hour at 37°C. After 1 hour, the
inoculum was replaced with MEM containing 1.2% Avicel and incubated at 37°C for 48
hours. After the incubation, the overlay medium was washed off with PBS, and the cells
were fixed with 20% methanol containing 0.2% crystal violet for 15 minutes. The number
of plaques were manually counted and reported as PFU per milliliter.

HA staining and FISH flow for influenza virus infections

To carry out quantification of influenza viral protein and viral RNA via flow cytometry, at
least 1 × 106 mock or infected cells were processed. The cells were washed once with
PBS and incubated with 25-µg/mL Fc receptor block diluted in 50-µL FACS buffer for
10 minutes at room temperature. Without removing Fc blocking solution, an additional
1 µL of anti-H3N2 HA mouse monoclonal antibody was spiked into the solution (1:50
dilution; Sino Biological, #11056). The cells were then incubated in the dark at 4°C for
30 minutes to allow antibody binding. After the incubation, the cells were washed twice
with FACS buffer. We then applied secondary Alexa-647 goat anti-mouse antibodies
(Invitrogen, #A-21235) diluted 1:100 in FACS buffer and incubated in the dark at 4°C
for 30 minutes. After the incubation, the cells were washed twice with FACS buffer,
followed by fixation and permeabilization using BD Cytofix/Cytoperm kit (BD Bioscien­
ces, #BDB554714). To visualize viral RNA, cells were washed once with Wash Buffer A

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 18

Full-Length Text Journal of Virology

(Biosearch Technologies, #SMF-WA1-60) and resuspended in 50 µL of hybridization buffer

(1:100 dilution; Biosearch Technologies, #SMF-HB1-10) containing fluorescence in situ
hybridization (FISH) probes targeting H3N2 influenza virus genome segment two that
are also labeled with fluorophore ATTO-488. The cells were incubated in the dark at 37°C
for 6 hours. After incubation, cells were washed twice using Wash Buffer A, incubated at
37°C for 30 minutes, and washed once more with Wash Buffer B (Biosearch Technologies
#SMF-WB1-20). Finally, the cells were resuspended in FACS buffer for analysis. Flow
cytometric analysis was carried out using BD Accuri C6 Plus flow cytometer, and the
analysis was done using FlowJo analysis software v.10.8.0. See our detailed protocol for
using FISH­flow to detect virus-infected cells (58).

Human subjects
Potential participants were verbally screened for their ability to meet inclusion and
exclusion criteria. There were minimal inclusion criteria: subjects must be adults with the
ability to provide consent and to provide a sample. Potential subjects were excluded if
they reported a body weight of less than 110 lb. or current pregnancy. Fourteen subjects
enrolled and consented to blood draws for this study. This does not represent 14 unique
individuals as subjects were able to enroll more than once. No data were collected from
subjects to maintain anonymity and confidentiality.

ACKNOWLEDGMENTS

We thank the University of Colorado Boulder Stem Cell Research and Technology
Resource Center and the University of Colorado Anschultz Gates Center Stem Cell
Biobank and Disease Modeling Core for providing us the necessary iPSC culture training
and cell lines; Theresa Nahreini for providing valuable flow cytometry advice; and the
University of Colorado Anschutz Gates Center Genomics Core for providing sequenc­
ing services. We acknowledge the BioFrontiers Computing Center at the University of
Colorado Boulder for providing high-performance computing resources supported by
BioFrontiers IT (Matt Hynes-Grace and Bela Amade).
The flow cytometry work was performed at the BioFrontiers Institute Flow Cytometry
Core supported by National Institutes of Health (NIH) grant S10ODO21601.
This work was funded by the NIH (DP1-DO-33547, DP1-DA-046108, R01-AI-137011,
and R01-OD-034046 to S.L.S.; T32 A1007447-25, F32 GM125442, K99 Al151256, and
R00AI151256 to C.J.W.; and R01-HL-156475 to M.A.A.).

AUTHOR AFFILIATIONS
1
BioFrontiers Institute, University of Colorado Boulder, Boulder, Colorado, USA
2
Department of Molecular, Cellular, and Developmental Biology, University of Colorado
Boulder, Boulder, Colorado, USA
3
Linda Crnic Institute for Down Syndrome, University of Colorado Anschutz Medical
Campus, Aurora, Colorado, USA
4
Linda Crnic Institute for Down Syndrome Boulder Branch, BioFrontiers Institute, Boulder,
Colorado, USA
5
Department of Computer Science, University of Colorado Boulder, Boulder, Colorado,
USA
6
Department of Veterinary Biosciences, The Ohio State University, Columbus, Ohio, USA
7
Center for Retrovirus Research, The Ohio State University, Columbus, Ohio, USA
8
Center for RNA Biology, The Ohio State University, Columbus, Ohio, USA
9
Viruses and Emerging Pathogens Program, Infectious Diseases Institute, The Ohio State
University, Columbus, Ohio, USA

AUTHOR ORCIDs

Qing Yang http://orcid.org/0000-0001-9053-3158

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 19

Full-Length Text Journal of Virology

Robin D. Dowell http://orcid.org/0000-0001-7665-9985

Cody J. Warren http://orcid.org/0000-0003-4101-2705
Sara L. Sawyer http://orcid.org/0000-0002-6965-1085

FUNDING

Funder Grant(s) Author(s)

HHS | National Institutes of Health DP1-DO-33547, DP1-DA-046108, Sara L. Sawyer
(NIH) R01-AI-137011, R01-OD-034046
HHS | National Institutes of Health T32 A1007447-25, F32 GM125442, Cody J. Warren
(NIH) K99/R00 Al151256, R00-AI151256
HHS | National Institutes of Health R01-HL156475 Mary A. Allen
(NIH)

ETHICS APPROVAL

Blood samples used in this research were obtained from anonymous individuals who
consented under human study #20-0068, approved by the University of Colorado
Institutional Review Board.
The IRB approved a waiver of written consent as this was deemed a minimal risk
study, and the only record linking the subject to the research would be their name on a
consent form, leading to a possible harm if confidentiality was breached. No financial or
non­financial compensation was given to subjects for participation.

ADDITIONAL FILES

The following material is available online.

Supplemental Material

Supplemental material (JVI01563-23-s0001.docx). Figures S1 to S6.

REFERENCES
1. Shi C, Pamer EG. 2011. Monocyte recruitment during infection and
inflammation. Nat Rev Immunol 11:762–774. https://doi.org/10.1038/
nri3070
2. Cline TD, Beck D, Bianchini E. 2017. Influenza virus replication in
macrophages: balancing protection and pathogenesis. J Gen Virol
98:2401–2412. https://doi.org/10.1099/jgv.0.000922
3. Wong ME, Jaworowski A, Hearps AC. 2019. The HIV reservoir in
monocytes and macrophages. Front Immunol 10:1435. https:​//doi.org/
10.3389/fimmu.2019.01435
4. Meidaninikjeh S, Sabouni N, Marzouni HZ, Bengar S, Khalili A, Jafari R.
2021. Monocytes and macrophages in COVID-19: friends and foes. Life
Sci 269:119010. https://doi.org/10.1016/j.lfs.2020.119010
5. Nikitina E, Larionova I, Choinzonov E, Kzhyshkowska J. 2018. Monocytes
and macrophages as viral targets and reservoirs. Int J Mol Sci 19:2821.
https://doi.org/10.3390/ijms19092821
6. Murray PJ. 2017. Macrophage polarization. Annu Rev Physiol 79:541–
566. https://doi.org/10.1146/annurev-physiol-022516-034339
7. Italiani P, Boraschi D. 2014. From monocytes to M1/M2 macrophages:
phenotypical vs. functional differentiation. Front Immunol 5:514. https:​//
doi.org/10.3389/fimmu.2014.00514
8. Monie TP. 2017. Section 1 - a snapshot of the innate immune system. In
The innate immune system. Academic Press.
9. van Furth R, Raeburn JA, van Zwet TL. 1979. Characteristics of human
mononuclear phagocytes. Blood 54:485–500. https://doi.org/10.1182/
blood.V54.2.485.485
10. Lee CZW, Kozaki T, Ginhoux F. 2018. Studying tissue macrophages in
vitro: are iPSC-derived cells the answer? Nat Rev Immunol 18:716–725.
https://doi.org/10.1038/s41577-018-0054-y
11. Takata K, Kozaki T, Lee CZW, Thion MS, Otsuka M, Lim S, Utami KH, Fidan
K, Park DS, Malleret B, et al. 2017. Induced-pluripotent-stem-cell-derived
primitive macrophages provide a platform for modeling tissue-resident
macrophage differentiation and function. Immunity 47:183–198. https://
doi.org/10.1016/j.immuni.2017.06.017
12. Cao X, Yakala GK, van den Hil FE, Cochrane A, Mummery CL, Orlova VV.
2019. Differentiation and functional comparison of monocytes and
macrophages from hiPSCs with peripheral blood derivatives. Stem Cell
Rep 12:1282–1297. https://doi.org/10.1016/j.stemcr.2019.05.003
13. Cao X, van den Hil FE, Mummery CL, Orlova VV. 2020. Generation and
functional characterization of monocytes and macrophages derived
from human induced pluripotent stem cells. Curr Protoc Stem Cell Biol
52:e108. https://doi.org/10.1002/cpsc.108
14. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K,
Yamanaka S. 2007. Induction of pluripotent stem cells from adult human
fibroblasts by defined factors. Cell 131:861–872. https://doi.org/10.1016/
j.cell.2007.11.019
15. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian
S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA. 2007.
Induced pluripotent stem cell lines derived from human somatic cells.
Science 318:1917–1920. https://doi.org/10.1126/science.1151526
16. Bernareggi D, Pouyanfard S, Kaufman DS. 2019. Development of innate
immune cells from human pluripotent stem cells. Exp Hematol 71:13–23.
https://doi.org/10.1016/j.exphem.2018.12.005
17. Tian R, Gachechiladze MA, Ludwig CH, Laurie MT, Hong JY, Nathaniel D,
Prabhu AV, Fernandopulle MS, Patel R, Abshari M, Ward ME, Kampmann
M. 2019. CRISPR interference-based platform for multimodal genetic
screens in human iPSC-derived neurons. Neuron 104:239–255. https://
doi.org/10.1016/j.neuron.2019.07.014

March 2024 Volume 98 Issue 3 10.1128/jvi.01563-23 20

Full-Length Text
18. Sürün D, Schneider A, Mircetic J, Neumann K, Lansing F, Paszkowski-
Rogacz M, Hänchen V, Lee-Kirsch MA, Buchholz F. 2020. Efficient
generation and correction of mutations in human iPS cells utilizing
mRNAs of CRISPR base editors and prime editors. Genes (Basel) 11:511.
https://doi.org/10.3390/genes11050511
19. Choi K-D, Vodyanik MA, Slukvin II. 2009. Generation of mature human
myelomonocytic cells through expansion and differentiation of
pluripotent stem cell–derived lin–CD34+CD43+CD45+ progenitors. J Clin
Invest 119:2818–2829. https://doi.org/10.1172/JCI38591
20. Swanstrom R, Graham WD, Zhou S. 2017. Sequencing the biology of
entry: the retroviral env gene. Curr Top Microbiol Immunol 407:65–82.
https://doi.org/10.1007/82_2017_35
21. Cassol E, Cassetta L, Alfano M, Poli G. 2010. Macrophage polarization and
HIV‐1 infection. J Leukoc Biol 87:599–608. https://doi.org/10.1189/jlb.
1009673
22. Hendricks CM, Cordeiro T, Gomes AP, Stevenson M. 2021. The interplay
of HIV-1 and macrophages in viral persistence. Front Microbiol
12:646447. https://doi.org/10.3389/fmicb.2021.646447
23. Cheng-Mayer C, Liu R, Landau NR, Stamatatos L. 1997. Macrophage
tropism of human immunodeficiency virus type 1 and utilization of the
CC-CKR5 coreceptor. J Virol 71:1657–1661. https://doi.org/10.1128/JVI.
71.2.1657-1661.1997
24. Cheng-Mayer C, Levy JA. 1988. Distinct biological and serological
properties of human immunodeficiency viruses from the brain. Ann
Neurol 23 Suppl:S58–S61. https://doi.org/10.1002/ana.410230716
25. Kimpton J, Emerman M. 1992. Detection of replication-competent and
pseudotyped human immunodeficiency virus with a sensitive cell line
on the basis of activation of an integrated beta-galactosidase gene. J
Virol 66:2232–2239. https://doi.org/10.1128/JVI.66.4.2232-2239.1992
26. Avirutnan P, Malasit P, Seliger B, Bhakdi S, Husmann M. 1998. Dengue
virus infection of human endothelial cells leads to chemokine
production, complement activation, and apoptosis. J Immunol
161:6338–6346. https://doi.org/10.4049/jimmunol.161.11.6338
27. Lin YL, Liu CC, Lei HY, Yeh TM, Lin YS, Chen RM, Liu HS. 2000. Infection of
five human liver cell lines by dengue‐2 virus. J Med Virol 60:425–431.
https://doi.org/10.1002/(sici)1096-9071(200004)60:4<425::aid-jmv10>3.
0.co;2-a
28. Kurane I, Kontny U, Janus J, Ennis FA. 1990. Dengue-2 virus infection of
human mononuclear cell lines and establishment of persistent
infections. Arch Virol 110:91–101. https://doi.org/10.1007/BF01310705
29. Fink J, Gu F, Ling L, Tolfvenstam T, Olfat F, Chin KC, Aw P, George J,
Kuznetsov VA, Schreiber M, Vasudevan SG, Hibberd ML. 2007. Host gene
expression profiling of dengue virus infection in cell lines and patients.
PLoS Negl Trop Dis 1:e86. https://doi.org/10.1371/journal.pntd.0000086
30. Chen Y-C, Wang S-Y. 2002. Activation of terminally differentiated human
monocytes/macrophages by dengue virus: productive infection,
hierarchical production of innate cytokines and chemokines, and the
synergistic effect of lipopolysaccharide. J Virol 76:9877–9887. https://doi.
org/10.1128/jvi.76.19.9877-9887.2002
31. Halstead SB, O’Rourke EJ, Allison AC. 1977. Dengue viruses and
mononuclear phagocytes. II. Identity of blood and tissue leukocytes
supporting in vitro infection. J Exp Med 146:218–229. https://doi.org/10.
1084/jem.146.1.218
32. Pryor MJ, Carr JM, Hocking H, Davidson AD, Li P, Wright PJ. 2001.
Replication of dengue virus type 2 in human monocyte-derived
macrophages: comparisons of isolates and recombinant viruses with
substitutions at amino acid 390 in the envelope glycoprotein. Am J Trop
Med Hyg 65:427–434. https://doi.org/10.4269/ajtmh.2001.65.427
33. Hober D, Shen L, Benyoucef S, De Groote D, Deubel V, Wattré P. 1996.
Enhanced TNFα production by monocytic-like cells exposed to dengue
virus antigens. Immunol Lett 53:115–120. https://doi.org/10.1016/s0165-
2478(96)02620-x
34. Green S, Vaughn DW, Kalayanarooj S, Nimmannitya S, Suntayakorn S,
Nisalak A, Lew R, Innis BL, Kurane I, Rothman AL, Ennis FA. 1999. Early
immune activation in acute dengue illness is related to development of
plasma leakage and disease severity. J Infect Dis 179:755–762. https://
doi.org/10.1086/314680
35. Hober D, Poli L, Roblin B, Gestas P, Chungue E, Granic G, Imbert P,
Pecarere JL, Vergez-Pascal R, Wattre P. 1993. Serum levels of tumor
necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1 β (IL-1 β)
March 2024 Volume 98 Issue 3
Journal of Virology
in dengue-infected patients. Am J Trop Med Hyg 48:324–331. https://
doi.org/10.4269/ajtmh.1993.48.324
36. Kittigul L, Temprom W, Sujirarat D, Kittigul C. 2000. Determination of
tumor necrosis factor-alpha levels in dengue virus infected patients by
sensitive biotin-streptavidin enzyme-linked immunosorbent assay. J
Virol Methods 90:51–57. https://doi.org/10.1016/s0166-0934(00)00215-9
37. Lang J, Cheng Y, Rolfe A, Hammack C, Vera D, Kyle K, Wang J, Meissner
TB, Ren Y, Cowan C, Tang H. 2018. An hPSC-derived tissue-resident
macrophage model reveals differential responses of macrophages to
ZIKV and DENV infection. Stem Cell Rep 11:348–362. https://doi.org/10.
1016/j.stemcr.2018.06.006
38. Chen YC, Wang SY, King CC. 1999. Bacterial lipopolysaccharide inhibits
dengue virus infection of primary human monocytes/macrophages by
blockade of virus entry via a CD14-dependent mechanism. J Virol
73:2650–2657. https://doi.org/10.1128/JVI.73.4.2650-2657.1999
39. Ho L-J, Hung L-F, Weng C-Y, Wu W-L, Chou P, Lin Y-L, Chang D-M, Tai T-Y,
Lai J-H. 2005. Dengue virus type 2 antagonizes IFN-α but not IFN-γ
antiviral effect via down-regulating Tyk2-STAT signaling in the human
dendritic cell. J Immunol 174:8163–8172. https://doi.org/10.4049/
jimmunol.174.12.8163
40. Prestwood TR, Morar MM, Zellweger RM, Miller R, May MM, Yauch LE,
Lada SM, Shresta S. 2012. Gamma interferon (IFN-γ) receptor restricts
systemic dengue virus replication and prevents paralysis in IFN-α/β
receptor­deficient mice. J Virol 86:12561–12570. https://doi.org/10.1128/
JVI.06743-11
41. Men R, Yamashiro T, Goncalvez AP, Wernly C, Schofield DJ, Emerson SU,
Purcell RH, Lai C-J. 2004. Identification of chimpanzee Fab fragments by
repertoire cloning and production of a full-length humanized
immunoglobulin G1 antibody that is highly efficient for neutralization of
dengue type 4 virus. J Virol 78:4665–4674. https://doi.org/10.1128/JVI.
78.9.4665-4674.2004
42. Harrison VR, Eckels KH, Sagartz JW, Russell PK. 1977. Virulence and
immunogenicity of a temperature-sensitive dengue-2 virus in lower
primates. Infect Immun 18:151–156. https://doi.org/10.1128/iai.18.1.151-
156.1977
43. Rosen L, Russell PK, Scherer WF, Dickerman RW, Casals J. 1978.
Experimental infection of chimpanzees with dengue viruses. Am J Trop
Med Hyg 27:590–599. https://doi.org/10.4269/ajtmh.1978.27.590
44. Kim HM, Lee Y-W, Lee K-J, Kim HS, Cho SW, van Rooijen N, Guan Y, Seo
SH. 2008. Alveolar macrophages are indispensable for controlling
influenza viruses in lungs of pigs. J Virol 82:4265–4274. https://doi.org/
10.1128/JVI.02602-07
45. Purnama C, Ng SL, Tetlak P, Setiagani YA, Kandasamy M, Baalasubrama­
nian S, Karjalainen K, Ruedl C. 2014. Transient ablation of alveolar
macrophages leads to massive pathology of influenza infection without
affecting cellular adaptive immunity. Eur J Immunol 44:2003–2012.
https://doi.org/10.1002/eji.201344359
46. Schneider C, Nobs SP, Heer AK, Kurrer M, Klinke G, van Rooijen N, Vogel
J, Kopf M. 2014. Alveolar macrophages are essential for protection from
respiratory failure and associated morbidity following influenza virus
infection. PLoS Pathog 10:e1004053. https://doi.org/10.1371/journal.
ppat.1004053
47. Tate MD, Pickett DL, van Rooijen N, Brooks AG, Reading PC. 2010. Critical
role of airway macrophages in modulating disease severity during
influenza virus infection of mice. J Virol 84:7569–7580. https://doi.org/
10.1128/JVI.00291-10
48. Manicassamy B, Manicassamy S, Belicha-Villanueva A, Pisanelli G,
Pulendran B, García-Sastre A. 2010. Analysis of in vivo dynamics of
influenza virus infection in mice using a GFP reporter virus. Proc Natl
Acad Sci U S A 107:11531–11536. https://doi.org/10.1073/pnas.
0914994107
49. Ogiwara H, Yasui F, Munekata K, Takagi-Kamiya A, Munakata T, Nomura
N, Shibasaki F, Kuwahara K, Sakaguchi N, Sakoda Y, Kida H, Kohara M.
2014. Histopathological evaluation of the diversity of cells susceptible to
H5N1 virulent avian influenza virus. Am J Pathol 184:171–183. https://
doi.org/10.1016/j.ajpath.2013.10.004
50. Wonderlich ER, Swan ZD, Bissel SJ, Hartman AL, Carney JP, O’Malley KJ,
Obadan AO, Santos J, Walker R, Sturgeon TJ, Frye LJ Jr, Maiello P, Scanga
CA, Bowling JD, Bouwer AL, Duangkhae PA, Wiley CA, Flynn JL, Wang J,
Cole KS, Perez DR, Reed DS, Barratt-Boyes SM. 2017. Widespread virus
replication in alveoli drives acute respiratory distress syndrome in
10.1128/jvi.01563-23 21
Full-Length Text
aerosolized H5N1 influenza infection of macaques. J Immunol 198:1616–
1626. https://doi.org/10.4049/jimmunol.1601770
51. Londrigan SL, Short KR, Ma J, Gillespie L, Rockman SP, Brooks AG,
Reading PC. 2015. Infection of mouse macrophages by seasonal
influenza viruses can be restricted at the level of virus entry and at a late
stage in the virus life cycle. J Virol 89:12319–12329. https://doi.org/10.
1128/JVI.01455-15
52. Yu WCL, Chan RWY, Wang J, Travanty EA, Nicholls JM, Peiris JSM, Mason
RJ, Chan MCW. 2011. Viral replication and innate host responses in
primary human alveolar epithelial cells and alveolar macrophages
infected with influenza H5N1 and H1N1 viruses. J Virol 85:6844–6855.
https://doi.org/10.1128/JVI.02200-10
53. Rodgers BC, Mims CA. 1982. Influenza virus replication in human
alveolar macrophages. J Med Virol 9:177–184. https://doi.org/10.1002/
jmv.1890090304
54. Wang J, Nikrad MP, Travanty EA, Zhou B, Phang T, Gao B, Alford T, Ito Y,
Nahreini P, Hartshorn K, Wentworth D, Dinarello CA, Mason RJ,
Jeyaseelan S. 2012. Innate immune response of human alveolar
macrophages during influenza A infection. PLoS One 7:e29879. https://
doi.org/10.1371/journal.pone.0029879
55. Chanput W, Mes JJ, Wichers HJ. 2014. THP-1 cell line: an in vitro cell
model for immune modulation approach. Int Immunopharmacol 23:37–
45. https://doi.org/10.1016/j.intimp.2014.08.002
56. García A, Serrano A, Abril E, Jimenez P, Real LM, Cantón J, Garrido F, Ruiz-
Cabello F. 1999. Differential effect on U937 cell differentiation by
targeting transcriptional factors implicated in tissue- or stage­specific
induced integrin expression. Exp Hematol 27:353–364. https://doi.org/
10.1016/s0301-472x(98)00038-1
57. Geiss GK, Salvatore M, Tumpey TM, Carter VS, Wang X, Basler CF,
Taubenberger JK, Bumgarner RE, Palese P, Katze MG, García-Sastre A.
2002. Cellular transcriptional profiling in influenza A virus-infected lung
epithelial cells: the role of the nonstructural NS1 protein in the evasion
of the host innate defense and its potential contribution to pandemic
influenza. Proc Natl Acad Sci U S A 99:10736–10741. https://doi.org/10.
1073/pnas.112338099
58. Warren CJ, Barbachano-Guerrero A, Huey D, Yang Q, Worden-Sapper ER,
Kuhn JH, Sawyer SL. 2023. Quantification of virus-infected cells using
RNA FISH-Flow. STAR Protoc 4:102291. https://doi.org/10.1016/j.xpro.
2023.102291
59. He L, Jhong J-H, Chen Q, Huang K-Y, Strittmatter K, Kreuzer J, DeRan M,
Wu X, Lee T-Y, Slavov N, Haas W, Marneros AG. 2021. Global characteriza­
tion of macrophage polarization mechanisms and identification of M2-
type polarization inhibitors. Cell Rep 37:109955.
https://doi.org/10.1016/j.celrep.2021.109955
60. Orecchioni M, Ghosheh Y, Pramod AB, Ley K. 2019. Macrophage
polarization: different gene signatures in M1(LPS+) vs. classically and
M2(LPS–) vs. alternatively activated macrophages. Front Immunol
10:1084. https:​//doi.org/10.3389/fimmu.2019.01084
61. Viola A, Munari F, Sánchez-Rodríguez R, Scolaro T, Castegna A. 2019. The
metabolic signature of macrophage responses. Front Immunol 10:1462.
https:​//doi.org/10.3389/fimmu.2019.01462
62. Tretina K, Park E-S, Maminska A, MacMicking JD. 2019. Interferon-
induced guanylate-binding proteins: guardians of host defense in health
and disease. J Exp Med 216:482–500. https://doi.org/10.1084/jem.
20182031
63. Schneider WM, Chevillotte MD, Rice CM. 2014. Interferon-stimulated
genes: a complex web of host defenses. Annu Rev Immunol 32:513–545.
https://doi.org/10.1146/annurev-immunol-032713-120231
64. Binder F, Hayakawa M, Choo M-K, Sano Y, Park JM. 2013. Interleukin-4-
induced β-catenin regulates the conversion of macrophages to
multinucleated giant cells. Mol Immunol 54:157–163. https://doi.org/10.
1016/j.molimm.2012.12.004
65. Bhattacharjee A, Shukla M, Yakubenko VP, Mulya A, Kundu S, Cathcart
MK. 2013. IL-4 and IL-13 employ discrete signaling pathways for target
gene expression in alternatively activated monocytes/macrophages.
Free Radic Biol Med 54:1–16. https://doi.org/10.1016/j.freeradbiomed.
2012.10.553
66. Martinez FO, Helming L, Milde R, Varin A, Melgert BN, Draijer C, Thomas
B, Fabbri M, Crawshaw A, Ho LP, Ten Hacken NH, Cobos Jiménez V,
Kootstra NA, Hamann J, Greaves DR, Locati M, Mantovani A, Gordon S.
2013. Genetic programs expressed in resting and IL-4 alternatively
March 2024 Volume 98 Issue 3
Journal of Virology
activated mouse and human macrophages: similarities and differences.
Blood 121:e57–e69. https://doi.org/10.1182/blood-2012-06-436212
67. Corces MR, Trevino AE, Hamilton EG, Greenside PG, Sinnott-Armstrong
NA, Vesuna S, Satpathy AT, Rubin AJ, Montine KS, Wu B, Kathiria A, Cho
SW, Mumbach MR, Carter AC, Kasowski M, Orloff LA, Risca VI, Kundaje A,
Khavari PA, Montine TJ, Greenleaf WJ, Chang HY. 2017. An improved
ATAC-seq protocol reduces background and enables interrogation of
frozen tissues. Nat Methods 14:959–962. https://doi.org/10.1038/nmeth.
4396
68. Plath K, Lowry WE. 2011. Progress in understanding reprogramming to
the induced pluripotent state. Nat Rev Genet 12:253–265. https://doi.
org/10.1038/nrg2955
69. Manole E, Niculite C, Lambrescu IM, Gaina G, Ioghen O, Ceafalan LC,
Hinescu ME. 2021. Macrophages and stem cells—two to tango for tissue
repair? Biomolecules 11:697. https://doi.org/10.3390/biom11050697
70. Ackermann M, Rafiei Hashtchin A, Manstein F, Carvalho Oliveira M,
Kempf H, Zweigerdt R, Lachmann N. 2022. Continuous human iPSC-
macrophage mass production by suspension culture in stirred tank
bioreactors. Nat Protoc 17:513–539. https://doi.org/10.1038/s41596-021-
00654-7
71. Gutbier S, Wanke F, Dahm N, Rümmelin A, Zimmermann S, Christensen
K, Köchl F, Rautanen A, Hatje K, Geering B, Zhang JD, Britschgi M, Cowley
SA, Patsch C. 2020. Large-scale production of human iPSC-derived
macrophages for drug screening. Int J Mol Sci 21:4808. https://doi.org/
10.3390/ijms21134808
72. Ackermann M, Kempf H, Hetzel M, Hesse C, Hashtchin AR, Brinkert K,
Schott JW, Haake K, Kühnel MP, Glage S, Figueiredo C, Jonigk D, Sewald
K, Schambach A, Wronski S, Moritz T, Martin U, Zweigerdt R, Munder A,
Lachmann N. 2018. Bioreactor-based mass production of human iPSC-
derived macrophages enables immunotherapies against bacterial
airway infections. Nat Commun 9:5088. https://doi.org/10.1038/s41467-
018-07570-7
73. Lachmann N, Ackermann M, Frenzel E, Liebhaber S, Brennig S, Happle C,
Hoffmann D, Klimenkova O, Lüttge D, Buchegger T, Kühnel MP,
Schambach A, Janciauskiene S, Figueiredo C, Hansen G, Skokowa J,
Moritz T. 2015. Large-scale hematopoietic differentiation of human
induced pluripotent stem cells provides granulocytes or macrophages
for cell replacement therapies. Stem Cell Rep 4:282–296. https://doi.org/
10.1016/j.stemcr.2015.01.005
74. Mills C. 2012. M1 and M2 macrophages: oracles of health and disease.
Crit Rev Immunol 32:463–488. https://doi.org/10.1615/CritRevImmunol.
v32.i6.10
75. Mills CD, Kincaid K, Alt JM, Heilman MJ, Hill AM. 2000. M-1/M-2
macrophages and the Th1/Th2 paradigm. J Immunol 164:6166–6173.
https://doi.org/10.4049/jimmunol.164.12.6166
76. Atri C, Guerfali FZ, Laouini D. 2018. Role of human macrophage
polarization in inflammation during infectious diseases. Int J Mol Sci
19:1801. https://doi.org/10.3390/ijms19061801
77. Huang X, Li Y, Fu M, Xin H-B. 2018. Polarizing macrophages in vitro.
Methods Mol Biol 1784:119–126. https://doi.org/10.1007/978-1-4939-
7837-3_12
78. Wang L-X, Zhang S-X, Wu H-J, Rong X-L, Guo J. 2019. M2b macrophage
polarization and its roles in diseases. J Leukoc Biol 106:345–358. https://
doi.org/10.1002/JLB.3RU1018-378RR
79. Abud EM, Ramirez RN, Martinez ES, Healy LM, Nguyen CHH, Newman SA,
Yeromin AV, Scarfone VM, Marsh SE, Fimbres C, Caraway CA, Fote GM,
Madany AM, Agrawal A, Kayed R, Gylys KH, Cahalan MD, Cummings BJ,
Antel JP, Mortazavi A, Carson MJ, Poon WW, Blurton-Jones M. 2017.
iPSC-derived human microglia-like cells to study neurological diseases.
Neuron 94:278–293. https://doi.org/10.1016/j.neuron.2017.03.042
80. Chen I-P. 2020. Differentiation of human induced pluripotent stem cells
(hiPSCs) into osteoclasts. Bio Protoc 10:e3854. https://doi.org/10.21769/
BioProtoc.3854
81. Tasnim F, Xing J, Huang X, Mo S, Wei X, Tan M-H, Yu H. 2019. Generation
of mature Kupffer cells from human induced pluripotent stem cells.
Biomaterials 192:377–391. https://doi.org/10.1016/j.biomaterials.2018.
11.016
82. Happle C, Lachmann N, Ackermann M, Mirenska A, Göhring G, Thomay
K, Mucci A, Hetzel M, Glomb T, Suzuki T, Chalk C, Glage S, Dittrich-
Breiholz O, Trapnell B, Moritz T, Hansen G. 2018. Pulmonary transplanta­
tion of human induced pluripotent stem cell–derived macrophages
10.1128/jvi.01563-23 22
Full-Length Text
ameliorates pulmonary alveolar proteinosis. Am J Respir Crit Care Med
198:350–360. https://doi.org/10.1164/rccm.201708-1562OC
83. Kogut I, McCarthy SM, Pavlova M, Astling DP, Chen X, Jakimenko A,
Jones KL, Getahun A, Cambier JC, Pasmooij AMG, Jonkman MF, Roop DR,
Bilousova G. 2018. High­efficiency RNA-based reprogramming of human
primary fibroblasts. Nat Commun 9:745. https://doi.org/10.1038/s41467-
018-03190-3
84. Toombs J, Panther L, Ornelas L, Liu C, Gomez E, Martín-Ibáñez R, Cox SR,
Ritchie SJ, Harris SE, Taylor A, Redmond P, Russ TC, Murphy L, Cooper JD,
Burr K, Selvaraj BT, Browne C, Svendsen CN, Cowley SA, Deary IJ,
Chandran S, Spires-Jones TL, Sareen D. 2020. Generation of twenty four
induced pluripotent stem cell lines from twenty four members of the
Lothian Birth Cohort 1936. Stem Cell Res 46:101851. https://doi.org/10.
1016/j.scr.2020.101851
85. Wen W, Zhang J-P, Xu J, Su RJ, Neises A, Ji G-Z, Yuan W, Cheng T, Zhang
X-B. 2016. Enhanced generation of integration-free iPSCs from human
adult peripheral blood mononuclear cells with an optimal combination
of episomal vectors. Stem Cell Rep 6:873–884. https://doi.org/10.1016/j.
stemcr.2016.04.005
86. Stauske M, Rodriguez Polo I, Haas W, Knorr DY, Borchert T, Streckfuss-
Bömeke K, Dressel R, Bartels I, Tiburcy M, Zimmermann W-H, Behr R.
2020. Non-human primate iPSC generation, cultivation, and cardiac
differentiation under chemically defined conditions. Cells 9:1349. https:/
/doi.org/10.3390/cells9061349
87. Mosher BS, Fulkerson HL, Yurochko AD. 2021. Collection and isolation of
CD14+ primary human monocytes via dual density gradient centrifuga­
tion as a model system to study human cytomegalovirus infection and
pathogenesis. Methods Mol Biol 2244:103–113. https://doi.org/10.1007/
978-1-0716-1111-1_6
March 2024 Volume 98 Issue 3
Journal of Virology
88. Bushnell B, Rood J, Singer E. 2017. BBMerge – accurate paired shotgun
read merging via overlap. PLoS One 12:e0185056. https://doi.org/10.
1371/journal.pone.0185056
89. Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. 2019. Graph-based
genome alignment and genotyping with HISAT2 and HISAT-genotype.
Nat Biotechnol 37:907–915. https://doi.org/10.1038/s41587-019-0201-4
90. Liao Y, Smyth GK, Shi W. 2013. The Subread aligner: fast, accurate and
scalable read mapping by seed-and-vote. Nucleic Acids Res 41:e108–
e108. https://doi.org/10.1093/nar/gkt214
91. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change
and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550.
https://doi.org/10.1186/s13059-014-0550-8
92. Yu G, Wang L-G, Han Y, He Q-Y. 2012. clusterProfiler:​ an R package for
comparing biological themes among gene clusters. OMICS 16:284–287.
https://doi.org/10.1089/omi.2011.0118
93. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with
Bowtie 2. Nat Methods 9:357–359. https://doi.org/10.1038/nmeth.1923
94. Robinson MD, McCarthy DJ, Smyth GK. 2010. edgeR: a bioconductor
package for differential expression analysis of digital gene expression
data. Bioinformatics 26:139–140. https://doi.org/10.1093/bioinformat­
ics/btp616
95. Bailey TL, Johnson J, Grant CE, Noble WS. 2015. The MEME suite. Nucleic
Acids Res 43:W39–W49. https://doi.org/10.1093/nar/gkv416
96. Chen BJ, Leser GP, Morita E, Lamb RA. 2007. Influenza virus hemaggluti­
nin and neuraminidase, but not the matrix protein, are required for
assembly and budding of plasmid-derived virus-like particles. J Virol
81:7111–7123. https://doi.org/10.1128/JVI.00361-07
10.1128/jvi.01563-23 23