Ebook Covid 19 Biomedical Perspectives Volume 50 1St Edition Charles S Pavia Editor Online PDF All Chapter

Covid-19: Biomedical Perspectives
(Volume 50) 1st Edition Charles S.

Pavia (Editor)
Visit to download the full and correct content document:
https://ebookmeta.com/product/covid-19-biomedical-perspectives-volume-50-1st-editi
on-charles-s-pavia-editor/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...
29 Single and Nigerian INCOMPLETE First Edition

Naijasinglegirl
https://ebookmeta.com/product/29-single-and-nigerian-incomplete-
first-edition-naijasinglegirl/
Journal 29 Revelation Interactive Book Game Dimitris

Chassapakis
https://ebookmeta.com/product/journal-29-revelation-interactive-
book-game-dimitris-chassapakis/
COVID-19 in International Media: Global Pandemic

Perspectives 1st Edition John C. Pollock (Editor)
https://ebookmeta.com/product/covid-19-in-international-media-
global-pandemic-perspectives-1st-edition-john-c-pollock-editor/
Dirty Little Secret (Forbidden Fantasies #29) 1st

Edition S.E. Law
https://ebookmeta.com/product/dirty-little-secret-forbidden-
fantasies-29-1st-edition-s-e-law/
Fear No Evil Alex Cross 29 1st Edition James Patterson
https://ebookmeta.com/product/fear-no-evil-alex-cross-29-1st-
edition-james-patterson/
Smolder Anita Blake Vampire Hunter 29 Laurell K

Hamilton
https://ebookmeta.com/product/smolder-anita-blake-vampire-
hunter-29-laurell-k-hamilton/
Economic Recovery After COVID-19
https://ebookmeta.com/product/economic-recovery-after-covid-19/
Fortschritte der Physik Progress of Physics Band 29

Heft 8
https://ebookmeta.com/product/fortschritte-der-physik-progress-
of-physics-band-29-heft-8/
Fortschritte der Physik Progress of Physics Band 29

Heft 4
https://ebookmeta.com/product/fortschritte-der-physik-progress-
of-physics-band-29-heft-4/
Methods in Microbiology
Volume 50
Recent titles in the series
Volume 26 Yeast Gene Analysis
AJP Brown and MF Tuite
Volume 27 Bacterial Pathogenesis
P Williams, J Ketley and GPC Salmond
Volume 28 Automation
AG Craig and JD Hoheisel
Volume 29 Genetic Methods for Diverse Prokaryotes
MCM Smith and RE Sockett
Volume 30 Marine Microbiology
JH Paul
Volume 31 Molecular Cellular Microbiology
P Sansonetti and A Zychlinsky
Volume 32 Immunology of Infection, 2nd edition
SHE Kaufmann and D Kabelitz
Volume 33 Functional Microbial Genomics
B Wren and N Dorrell
Volume 34 Microbial Imaging
T Savidge and C Pothoulakis
Volume 35 Extremophiles
FA Rainey and A Oren
Volume 36 Yeast Gene Analysis, 2nd edition
I Stansfield and MJR Stark
Volume 37 Immunology of Infection
D Kabelitz and SHE Kaufmann
Volume 38 Taxonomy of Prokaryotes
Fred Rainey and Aharon Oren
Volume 39 Systems Biology of Bacteria
Colin Harwood and Anil Wipat
Volume 40 Microbial Synthetic Biology
Colin Harwood and Anil Wipat
Volume 41 New Approaches to Prokaryotic Systematics
Michael Goodfellow, Iain Sutcliffe, and Jongsik Chun
Volume 42 Current and Emerging Technologies for the Diagnosis of Microbial Infections
Andrew Sails and Yi-Wei Tang
Volume 43 Imaging Bacterial Molecules, Structures and Cells
Colin Harwood and Grant J. Jensen
Volume 44 The Human Microbiome
Colin Harwood
Volume 45 Microbiology of Atypical Environments
Volker Gurtler and Jack T. Trevors
Volume 46 Nanotechnology
Volker Gurtler, Andrew S. Ball and Sarvesh K. Soni
Volume 47 Methods in Microbiology
Charles S. Pavia and Volker Gurtler
Volume 48 Methods in Microbiology
Volker Gurtler
Volume 49 Methods in Silkworm Microbiology
Volker Gurtler and Gangavarapu Subrahmanyam
Methods in Microbiology
Volume 50
Covid-19: Biomedical
Perspectives
Edited by
Charles S. Pavia
Department of Biomedical Sciences,
NYIT College of Osteopathic Medicine,
New York Institute of Technology, Old Westbury;
Division of Infectious Diseases,
New York Medical College, Valhalla,
NY, United States
Volker Gurtler
School of Science,
College of Science Engineering and Health,
RMIT University, Bundoora, VIC, Australia
Academic Press is an imprint of Elsevier
125 London Wall, London, EC2Y 5AS, United Kingdom
The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, United Kingdom
525 B Street, Suite 1650, San Diego, CA 92101, United States
50 Hampshire Street, 5th Floor, Cambridge, MA 02139, United States
First edition 2022
Copyright © 2022 Elsevier Ltd. All rights reserved.
No part of this publication may be reproduced or transmitted in any form or by any means, electronic or
mechanical, including photocopying, recording, or any information storage and retrieval system, without
permission in writing from the publisher. Details on how to seek permission, further information about
the Publisher’s permissions policies and our arrangements with organizations such as the Copyright
Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/
permissions.
This book and the individual contributions contained in it are protected under copyright by the Publisher
(other than as may be noted herein).
Notices
Knowledge and best practice in this field are constantly changing. As new research and experience broaden
our understanding, changes in research methods, professional practices, or medical treatment may
become necessary.
Practitioners and researchers must always rely on their own experience and knowledge in evaluating and
using any information, methods, compounds, or experiments described herein. In using such information
or methods they should be mindful of their own safety and the safety of others, including parties for whom
they have a professional responsibility.
To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any
liability for any injury and/or damage to persons or property as a matter of products liability, negligence or
otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the
material herein.
ISBN: 978-0-323-85061-2
ISSN: 0580-9517 (Series)
For information on all Academic Press publications

visit our website at https://www.elsevier.com/books-and-journals
Publisher: Zoe Kruze

Acquisitions Editor: Sam Mahfoudh
Developmental Editor: Federico Paulo Mendoza
Production Project Manager: Abdulla Sait
Cover Designer: Mark Rogers
Typeset by STRAIVE, India
This book is being dedicated to honour the world-renowned 19th century
biomedical scientist, Louis Pasteur, in memory of the 2022 bicentennial
of his birth in Dole, France, in 1822. He has often been credited as being
the founding father of modern microbiology and immunology. Much of
his work was done in the face of sometimes fierce opposition, but
he eventually succeeded in convincing his opponents that his theories
were correct. In his illustrious career, he made many ground-breaking
discoveries, which included establishing the method that became known
as pasteurization and the germ theory of disease. He also rescued the
wine, beer and silkworm industries from unwanted contaminants that
had crept into their products (more of a concern then than now).
Furthermore, and perhaps most noteworthy, are his contributions in
producing the first effective vaccines against anthrax and rabies.
Collectively, these accomplishments have laid the foundation for
subsequent improvements in hygiene, healthcare, preventive medicine
and vaccine-mediated control of serious and life-threatening diseases.
The many research and healthcare facilities, and other landmarks, that
are located in various parts of the world and bear his name, are a
testament to his long-standing legacy. If Pasteur were alive today,
he would no doubt be at the forefront of trying to develop a safe and
effective vaccine against COVID-19. As the famous physician
Sir William Osler, considered to be the founding father of modern
medicine, pointed out more than a century ago, an anonymous fitting
tribute to Pasteur states: "that he was the most perfect man who entered
the Kingdom of Science".
The Editors
This page intentionally left blank
Contents
Dedication ................................................................................................................. v
Contributors ........................................................................................................... xiii
Preface .................................................................................................................. xvii
CHAPTER 1 Sensitive methods for detection

of SARS-CoV-2 RNA........................................................1
Xi Chen and Simin Xia
1. Introduction ....................................................................................... 1
2. General approaches for the detection of SARS-CoV-2 ................... 3
3. Isothermal amplification methods for sensitive detection of
SARS-CoV-2 .................................................................................... 4
4. Sensitive detection of SARS-CoV-2 via RT-RPA ........................... 5
5. General considerations for designing an ultrasensitive
RT-RPA assay................................................................................ 11
5.1 Primer design ........................................................................... 11
5.2 Probe design............................................................................. 12
5.3 Reaction temperature ............................................................... 12
6. Comparative reviews of recently published RT-RPA assays
for SARS-CoV-2 detection ............................................................. 12
7. Methods section .............................................................................. 17
8. Before you begin............................................................................ 17
9. Key resources table ......................................................................... 17
10. Materials and equipment ................................................................ 19
11. Step-by-step method details ........................................................... 19
11.1 Detection of SARS-CoV-2 N- or S-gene using exo
probes and primers ................................................................ 19
11.2 Detection of SARS-CoV-2 N- or S-gene using nfo
probes and lateral flow strips ................................................ 21
11.3 Optional steps ........................................................................ 22
11.4 Simultaneous dual N- and S-gene detection using paired
exo probe and primers for N-gene and exo probe and
primers for S-gene ................................................................. 22
12. Summary ......................................................................................... 23
Acknowledgement ................................................................................. 24
References.............................................................................................. 24
vii
viii Contents
CHAPTER 2 The seasonal behaviour of COVID-19 and its

galectin-like culprit of the viral spike........................27
Kelsey Caetano-Anolles, Nicolas Hernandez, Fizza Mughal,
Tre Tomaszewski, and Gustavo Caetano-Anolles
1. Introduction..................................................................................... 27
2. The seasonal behaviour of viruses ................................................. 28
2.1 Seasonality of viral diseases.................................................... 28
2.2 Drivers of seasonality in trade-off performance spaces.......... 31
2.3 Finding significant correlations ............................................... 36
2.4 Distinguishing error from chaos in time series ....................... 37
3. The seasonal behaviour of COVID-19 ........................................... 40
3.1 Spatial distribution approaches ................................................ 42
3.2 Temporal distribution approaches........................................... 45
4. Viral genomic make up and seasonality ........................................ 46
4.1 Mutational change in rapidly expanding viral populations .... 49
4.2 A structuring quasispecies as paradigm of viral
mutational change .................................................................... 51
4.3 The mutational landscape of evolving SARS-CoV-2
viruses ...................................................................................... 53
4.4 Viral genomic change and seasonal behaviour ....................... 60
4.5 Genomic change levels appear unlinked to temperature or
latitude ..................................................................................... 63
4.6 Galectin homologues appear likely molecular culprits ........... 64
5. Conclusions and prospects ............................................................. 68
Acknowledgements .............................................................................. 69
Financial disclosures and conflicts of interest ..................................... 69
References ............................................................................................ 69
Further reading ..................................................................................... 79
Glossary ................................................................................................ 79
CHAPTER 3 Current molecular diagnostics assays for
SARS-CoV-2 and emerging variants............................83
Jonathan M. Banks, Kristelle Capistrano, Pari Thakkar,
Hemangi Ranade, Vaidik Soni, Manali Datta, and
Afsar R. Naqvi
1. Introduction..................................................................................... 84
2. SARS-CoV-2 variants of concern .................................................. 85
2.1 B.1.1.7 (Alpha) variant ............................................................ 88
2.2 B.1.351 (Beta) variant ............................................................. 88
2.3 P.1 (Gamma) variant ............................................................... 90
2.4 B.1.617.2 (Delta) variant ......................................................... 90
Contents ix
3. COVID-19 diagnostics ................................................................... 91

3.1 Real-time PCR diagnostics ...................................................... 92
3.2 Serology based COVID-19 diagnostics.................................. 97
3.3 CRISPR diagnostics ............................................................... 101
3.4 Biosensor diagnostics ............................................................ 103
4. Diagnostics in the era of COVID-19 vaccination ........................ 109
5. Conclusion .................................................................................... 111
References .......................................................................................... 112
Further reading ................................................................................... 120
CHAPTER 4 CRISPR use in diagnosis and therapy for COVID-19...123

Pallavi Deol, Aashwina Madhwal, Gaurav Sharma,
Rahul Kaushik, and Yashpal Singh Malik
1. Introduction ................................................................................... 124
2. Diagnostics and therapeutics for SARS-CoV-2 ........................... 125
3. CRISPR/Cas systems.................................................................... 127
3.1 Cas12 ..................................................................................... 128
4. CRISPR-based therapeutics for SARS-Cov-2 .............................. 136
4.1 Disrupting the viral RNA genome........................................ 137
4.2 Disrupting the host cell factors essential for
SARS-CoV-2 infection .......................................................... 143
5. Delivery of CRISPR/Cas components ......................................... 144
6. Limitations of CRISPR/Cas system ............................................. 144
7. Summary ....................................................................................... 145
References .......................................................................................... 146
CHAPTER 5 Recent and advanced nano-technological

strategies for COVID-19 vaccine development..........151
Chinekwu Sherridan Nwagwu, Chinenye Nnenna Ugwu,
John Dike Nwabueze Ogbonna, Adaeze Linda Onugwu,
Chinazom Precious Agbo, Adaeze Chidiebere Echezona,
Ezinwanne Nneoma Ezeibe, Samuel Uzondu,
Frankline Chimaobi Kenechukwu, Paul Achile Akpa,
Mumuni Audu Momoh, Petra Obioma Nnamani,
Clemence Tarirai, Kenneth Chibuzor Ofokansi, and
Anthony Amaechi Attama
1. Introduction ................................................................................... 151
2. The structure and infection mechanism of SARS-COV-2........... 152
3. Pathogenesis and clinical presentation of COVID-19 ................. 153
x Contents
4. Vaccine development strategies and platforms ............................ 155

4.1 Live attenuated viral vaccines ............................................... 156
4.2 Inactivated pathogen vaccines ............................................... 158
4.3 Protein subunit vaccines ........................................................ 163
4.4 Virus-like particle vaccines ................................................... 164
4.5 Vectored vaccines .................................................................. 164
4.6 Nucleic acid vaccines ............................................................ 165
5. Relevant SARS-CoV-2 antigen explored in the design of
vaccines ......................................................................................... 166
5.1 Structural, sub-structural, and non-structural proteins .......... 166
5.2 Spike (S) protein.................................................................... 166
5.3 Membrane (M) protein .......................................................... 169
5.4 Nucleocapsid (N) protein ...................................................... 169
5.5 Envelop (E) protein............................................................... 170
6. Nano-based strategies for COVID-19 vaccine development ....... 170
6.1 Nano-carriers for antigen delivery ........................................ 171
6.2 Nano-vaccine adjuvants ......................................................... 174
6.3 Delivery devices .................................................................... 175
6.4 Novel alternative routes of administration............................ 176
7. Benefits and challenges of nanotechnology in COVID-19
vaccine development .................................................................... 178
8. Conclusion and future perspectives.............................................. 179
References .......................................................................................... 180
CHAPTER 6 A review of hypersensitivity methods to detect

immune responses to SARS-CoV-2............................189
Fernando Dı́az-Espada, Victor Matheu, and Yvelise Barrios
1. Historical perspective ................................................................... 190
2. General overview, classification and description of
hypersensitivity reactions ............................................................. 193
2.1 Type I hypersensitivity-immediate/IgE mediated ................. 193
2.2 Type II hypersensitivity-IIa/IIb antibody mediated .............. 196
2.3 Type III hypersensitivity-immune complex-mediated .......... 198
2.4 Type IV hypersensitivity-IVa/IVb/IVc/IVd-T cell
mediated ................................................................................. 200
3. Skin test application of hypersensitivity reactions: In vivo
measurements of immune responses ............................................ 205
4. In vitro methods to measure immune responses after
SARS-Cov-2 infection .................................................................. 206
4.1 SARS-CoV-2 protein description .......................................... 206
Contents xi
4.2 Understanding the adaptive immune response in covid19

patients ................................................................................... 207
4.3 In vitro methods to measure SARS-CoV-2 cellular
immune responses .................................................................. 209
5. A novel application of a DTH method to measure immune
responses after SARS-CoV-2 infection ........................................ 211
6. DTH to measure immunogenicity elicited by covid vaccines ..... 213
7. Future prospects of DTH to study SARS-CoV-2
immunogenicity ............................................................................ 214
Acknowledgements ............................................................................ 214
References .......................................................................................... 214
CHAPTER 7 Hesitancy to get vaccinated against COVID-19

and how it might be overcome...................................223
Charles S. Pavia
CHAPTER 8 The emergence of SARS-CoV-2 variants of concern

in Australia by haplotype coalescence reveals a
continental link to COVID-19 seasonality..................233
Tre Tomaszewski, Volker Gurtler, Kelsey Caetano-Anolles,
and Gustavo Caetano-Anoll
es
1. Introduction ................................................................................... 233
2. Methods ........................................................................................ 235
3. VOCs in Australia ........................................................................ 236
4. Prevalence of amino acid variants in Australia ........................... 240
4.1 The emergence of first haplotypes ........................................ 240
4.2 Emergence of haplotypes associated with VOCs alpha,
delta and omicron.................................................................. 243
4.3 Amino acid variants and haplotypes shared by VOCs......... 245
4.4 Amino acid variants that are not part of established VOC
constellations ......................................................................... 246
5. A network view of haplotype diversity and VOC emergence ..... 246
5.1 Haplotype and variant reuse .................................................. 246
5.2 Haplotype size and coalescence ............................................ 249
5.3 Haplotypes and protein interactions ...................................... 249
5.4 VOC omicron haplotype variants cluster along the
S-protein sequence ................................................................. 251
5.5 Haplotypes follow the three phases of the COVID-19
pandemic................................................................................ 253
xii Contents
6. Continental links to seasonality.................................................... 254

6.1 Core haplotypes of VOCs reveal latitude-linked patterns
of seasonality......................................................................... 254
6.2 Free-standing markers also support seasonal behavior in
Australia ................................................................................. 256
7. Discussion..................................................................................... 258
7.1 Mutational landscapes of viral evolution.............................. 260
7.2 VOC emergence by haplotype coalescence .......................... 261
7.3 Haplotypes and seasonal behavior ........................................ 262
7.4 Conclusions............................................................................ 264
References .......................................................................................... 265
CHAPTER 9 COVID-19 vaccines for high risk and

immunocompromised patients...................................269
Charles S. Pavia and Maria M. Plummer
1. Introduction................................................................................... 269
2. Development of COVID-19 vaccines .......................................... 270
3. The use of COVID-19 vaccines for the high-risk patient
population with the emphasis on HIV-infected patients .............. 272
Funding .............................................................................................. 277
Author contribution ............................................................................ 277
Conflict of interest ............................................................................. 277
References .......................................................................................... 277
Contributors
Chinazom Precious Agbo
Drug Delivery & Nanomedicines Research Laboratory, Department of
Pharmaceutics, University of Nigeria, Nsukka, Enugu State, Nigeria
Paul Achile Akpa
Anthony Amaechi Attama
Jonathan M. Banks
Department of Periodontics, College of Dentistry, University of Illinois Chicago,
Chicago, IL, United States
Yvelise Barrios
Laboratorio Immunologı́a Central Lab, Planta 0, Edificio Principal, Hospital
Universitario de Canarias, Tenerife, Spain
Gustavo Caetano-Anoll es
Evolutionary Bioinformatics Laboratory, Department of Crop Sciences, University
of Illinois, Urbana, IL, United States
Kelsey Caetano-Anolles
Callout Biotech, Albuquerque, NM, United States
Kristelle Capistrano
Xi Chen
The HIT Center for Life Sciences (HCLS), Harbin Institute of Technology, Harbin,
Heilongjiang Province, People’s Republic of China
Manali Datta
Amity Institute of Biotechnology, Amity University Rajasthan, Jaipur, Rajasthan,
India
Pallavi Deol
Virology Lab, Centre for Animal Disease Research and Diagnosis, ICAR-Indian
Veterinary Research Institute, Bareilly, India
Fernando Dı́az-Espada
Department of Immunology, Clı́nica Puerta de Hierro, Madrid, Spain
Adaeze Chidiebere Echezona
xiii
xiv Contributors
Ezinwanne Nneoma Ezeibe

Department of Pharmaceutical Microbiology and Biotechnology, University of
Nigeria, Nsukka, Enugu state, Nigeria
Volker Gurtler
RMIT University, Melbourne, VIC, Australia
Nicolas Hernandez
Rahul Kaushik
Laboratory for Structural Bioinformatics, Center for Biosystems Dynamics
Research, RIKEN, Yokohama, Japan
Frankline Chimaobi Kenechukwu
Aashwina Madhwal
Division of Pathology, ICAR-Indian Veterinary Research Institute, Bareilly, India
Yashpal Singh Malik
College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal
Sciences University, Ludhiana, India
Victor Matheu
Servicio de Alergologı́a, Floor-2, Edificio de Actividades Ambulatorias, Hospital
Universitario de Canarias, Tenerife, Spain
Mumuni Audu Momoh
Fizza Mughal
Afsar R. Naqvi
Petra Obioma Nnamani
Chinekwu Sherridan Nwagwu
Kenneth Chibuzor Ofokansi
Contributors xv
John Dike Nwabueze Ogbonna

Adaeze Linda Onugwu
Charles S. Pavia
Department of Biomedical Sciences, NYIT College of Osteopathic Medicine,
New York Institute of Technology, Old Westbury; Division of Infectious Diseases,
New York Medical College, Valhalla, NY, United States
Maria M. Plummer
Department of Clinical Specialties, Division of Pathology, NYIT College of
Osteopathic Medicine, New York Institute of Technology, Old Westbury, NY,
United States
Hemangi Ranade
Amity Institute of Biotechnology, Amity University Rajasthan, Jaipur, Rajasthan,
India
Gaurav Sharma
Virology Lab, Centre for Animal Disease Research and Diagnosis, ICAR-Indian
Veterinary Research Institute, Bareilly, India
Vaidik Soni
Clemence Tarirai
Department of Pharmaceutical Sciences, Tshwane University of Technology,
Pretoria, South Africa
Pari Thakkar
Tre Tomaszewski
Chinenye Nnenna Ugwu
Department of Pharmaceutical Microbiology and Biotechnology, University of
Nigeria, Nsukka, Enugu state, Nigeria
Samuel Uzondu
Simin Xia
Preface
With a few exceptions, not since the 1918 flu pandemic has the world experienced
such a public health crisis as the one associated with COVID-19. Fortunately, several
vaccines with high levels of proven efficacy have been developed within a relatively
short time in several countries to combat this disease, although it is still unknown
how long protection will be afforded by this preventive measure. Also, since the
beginning of the pandemic in late 2019, much has been learned about the biology,
epidemiology, diagnosis, and clinical aspects of COVID-19, especially as they per-
tain to a more complete understanding on its pathogenesis and treatment regimens
for patients who develop serious illness after being infected with the causative agent,
a unique coronavirus, designated as SARS-CoV-2. As an example of the explosive
nature of this information, a search of the “PubMed” Internet publication retrieval
site revealed that, as of November 2021 and covering the previous 2 years, a total
of almost 200,00 peer-reviewed articles can be found there after entering the term
“COVID-19.”
The 9 chapters in this book try to encompass some of the key biomedical issues
associated with COVID-19 from vaccine development and challenges with its dis-
tribution and receptivity to detection methods, two chapters on seasonality (one of
these applying the methods explained in the first chapter on seasonality to the
Australian experience of isolation and strict lock downs), animal models, and cellular
immune responses. In this regard, Chapters 1 & 3 contain methods for detection of
SARS-CoV-2 RNA; Chapter 2 contains an approach for determining the seasonal
behaviour of COVID-19 and Chapter 8 applies this approach to the Australian
experience; Chapter 4 contains methods using CRISPR to diagnose an treat
COVID-19; Chapter 5 discusses recent and advanced nano-technological strategies
for COVID-19 vaccine development; Chapter 6 reviews hypersensitivity methods to
detect immune responses to SARS-CoV-2; Chapter 7 hesitancy to get vaccinated
against COVID-19; and Chapter 9 COVID-19 vaccines for high risk and immuno-
compromised patients. Collectively, this information is meant to be presented in a
clear and concise manner so that anyone interested in this topic will benefit from
it, but is intended to be especially useful to public health agencies, clinicians,
laboratory personnel, and various groups of scientific investigators.
The Editors
Charles S. Pavia
and
Volker Gurtler
xvii
CHAPTER
Sensitive methods
for detection of
SARS-CoV-2 RNA
1
Xi Chen* and Simin Xia
*Corresponding author: e-mail address: chenxihit@hit.edu.cn
1 Introduction
Since December 2019, an outbreak of COVID-19 caused by severe acute respiratory
syndrome coronavirus 2 (SARS-CoV-2) virus occurred and soon spread to the entire
world (Wang, Horby, Hayden, & Gao, 2020). The COVID-19 pandemic has led to a
dramatic loss of human life worldwide and presents an unprecedented challenge to
publish health and food systems; the global economic growth was largely slowed
down and social activities were greatly disrupted. As of July 1, 2021, COVID-19
has infected over 182 million people worldwide with over 3.9 million reported
casualties. COVID-19 is caused by an RNA virus named severe acute respiratory
syndrome coronavirus 2 (Chen et al., 2020). SARS-CoV-2 virus is a coronavirus
belonging to the beta family of coronaviruses that also includes SARS-CoV, Middle
East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43
(HCoV-OC3), and human coronavirus HKU1 (HCoV-HKU1). These beta-viruses
are enveloped, positive-sense, single-stranded RNA viruses of zoonotic origin. As
for SARS-CoV-2, this virus contains four structural proteins, namely the envelope
protein (E), spike protein (S), membrane protein (M), and the nucleocapsid
(N) protein (Fig. 1). The S, M, and E proteins form the envelope of the virus while
the N protein is associated with the single-stranded RNA genome forming nucleo-
capsid inside the envelope.
According to initial studies, this disease caused by SARS-CoV-2 showed a high
transmissibility with a basic reproduction number R0 ¼ 1.4–5.5 (WHO, 2020; Zhao
et al., 2020), likely to be below 5 and above 3 (Chen, 2020) and therefore it is highly
desired to perform early testing of SARS-CoV-2 for timely screening of infected
individuals and to stop the spread of this disease from a location to its surroundings.
Because detection sensitivity is the key to reduce false negative results, a detection
method with a high level of sensitivity can minimize non-diagnosed infected
individuals and reduce the chance of further cross transmission (Fig. 2).
Methods in Microbiology, Volume 50, ISSN 0580-9517, https://doi.org/10.1016/bs.mim.2021.06.001
Copyright © 2022 Elsevier Ltd. All rights reserved.
1
2 CHAPTER 1 Sensitive methods for detection of SARS-CoV-2 RNA
FIG. 1
Schematic illustration of the structure of coronavirus SARS-CoV-2 and its single-stranded
RNA genome. The sequence information of the single-stranded RNA genome of SARS-CoV-2
serves as the basis for the development of nucleic acid-based diagnosis.
FIG. 2
Sensitive detection methods will be highly beneficial to prevent the spread of COVID-19. High
sensitivity of diagnostic methods ensures low false negative results and therefore reduces the
latent cross transmission of non-diagnosed but actually infected individuals to their closely
contacted people.
2 General approaches for the detection of SARS-CoV-2 3
2 General approaches for the detection of SARS-CoV-2

There are several different types of diagnostic approaches used in the current
pandemic, which can be mainly classified into the following three categories:
(i) computed tomography (CT) chest scan, (ii) antigen-antibody interaction-based
serological tests, and (iii) nucleic acid (NA)-based tests (Kilic, Weissleder, &
Lee, 2020; Qin, Peng, Baravik, & Liu, 2020). The CT chest scan (Ai et al., 2020)
detects the pathological change of the respiratory system including the lung by
visualization of the transmission of the X-ray through the chest. Typically, a brighter
image that reveals a low transmission of the X-ray through the chest could potentially
indicate the infection by SARS-CoV-2. However, the specificity of CT chest scan is
low because the symptomatic features of COVID-19 CT scan are similar to those of
other types of viral pneumonia; and hence this method is generally considered as an
auxiliary method for SARS-CoV-2 diagnosis. Serological testing is based on the de-
tection of antibodies generated by the immune system which can be used to confirm
the infection of SARS-CoV-2 (Amanat et al., 2020; Udugama et al., 2020). However,
it typically takes 1–2 weeks before the body can generate detectable antibodies for
serological testing; as a result, this approach is not well suited for early-stage diag-
nosis. Other issues associated with serological tests are the high variability and some-
times low sensitivity and specificity (Tang et al., 2020). Nucleic acid-based detection
is the detection of the RNA genomic materials of the SARS-CoV-2, usually using
nucleic acid amplification approaches, which has been considered as the gold
standard for SARS-CoV-2 viral detection.
Reverse transcription-polymerase chain amplification (RT-PCR) has been
widely used for the detection of viral RNA for many years. RT-PCR requires a first
reverse transcription to produce a cDNA from the viral RNA, and then amplification
of cDNA via polymerase chain reaction. During amplification, a fluorescent probe,
either a fluorogenic dye (e.g. SYBR safe) or a rationally designed probe (e.g.
TagMan probe) is included in the PCR reaction which will respond to the ampli-
fied DNA to produce fluorescent signals. As a result, the amplification could be
detected in real-time via fluorescence using a real-time quantitative PCR machine.
A drawback of RT-PCR diagnosis is the high cost of the PCR machine and the
expertise required to design the program and to conduct the analysis. In fact,
RT-PCR is among the first reported and approved SARS-CoV-2 detection methods
(Chu et al., 2020; Corman et al., 2020). At the earliest time after the COVID-19 out-
break, Drosten et al. reported the detection of SARS-CoV-2 by real-time RT-PCR
method. The PCR primers and probes were designed for the detection of RdRp gene,
E-gene and N-gene. Although single-copy sensitivity was not achieved, this RT-PCR
assay was found to be still quite sensitive with 5.2 copies per reaction at 95% detec-
tion probability for E-gene and 3.8 copies per reaction at 95% detection probability
for RdRp gene using non-clinical samples; the sensitivity for the N-gene is less and
hence was not subjected to intensive evaluation (Corman et al., 2020). Another
RT-PCR based approach for the molecular diagnosis of SARS-CoV-2 introduced
in the very beginning of the pandemic detects the ORF1b and N-gene of SARS-
CoV-2 with a sensitivity up to 10 copies per reaction using none-RNA testing
sample (Chu et al., 2020).
3 Isothermal amplification methods for sensitive detection of

SARS-CoV-2
Isothermal nucleic acid amplification approaches are emerging as new promising
methods for detection of viral RNA (James & Alawneh, 2020; Zhao, Chen, Li,
Wang, & Fan, 2015). In isothermal nucleic acid amplification, no thermal cycles
are needed and therefore, exempted from using sophisticated thermocyclers. The re-
spective detection device is hence simpler, more portable and meet the requirement
of so-called point of care (POC) testing (Dinnes et al., 2020; Dohla et al., 2020).
Sometimes, lateral flow strips can also be used to facilitate the diagnosis so that
the testing can be applied in a POC, or even home-based fashion. Further, isothermal
amplification approaches can achieve a very high sensitivity, with up to single-copy
sensitivity per reaction. The ultrahigh sensitivity makes these approaches suitable for
early-stage diagnosis of virus infections. Therefore, isothermal nucleic acid
amplification has been considered as a promising method for the detection of virus
infection and could compensate with the currently widely used RT-PCR methods.
Indeed, as for SARS-CoV-2, isothermal amplification detection methods have
already been considered as highly promising detection tools (Shen et al., 2020). Early
development of isothermal amplification techniques include LAMP (loop-mediated
isothermal amplification) (Notomi et al., 2000; Wong, Othman, Lau, Radu, & Chee,
2018), NASBA (nucleic acid sequence-based amplification) (Compton, 1991), HDA
(helicase-dependent amplification) (Vincent, Xu, & Kong, 2004), EXPAR (expo-
nential amplification reaction of nucleic acids), and SDA (strand-displacement
amplification) (Walker et al., 1992). Among these isothermal detection methods,
LAMP coupled with reverse transcription, i.e. RT-LAMP, seems to be the most pop-
ular in SARS-CoV-2 analysis (Kashir & Yaqinuddin, 2020). In RT-LAMP, four or
six primers that target 6–8 regions in the genome are designed in combination with
the use of Bsm DNA polymerase. Along with the proceeding LAMP reaction, pairs
of primers generate a dumbbell-shaped DNA structure, which functions as the
LAMP initiator. In this method, around 109 DNA copies can be generated within
an hour and the reaction takes place at constant temperature in the range of
60–65 °C. Since magnesium pyrophosphate is generated as a byproduct during
LAMP, metal-sensitive indicators or pH-sensitive dyes can be employed for visual
detection. An advantage of the RT-LAMP approach is that regular primers are used
which do not necessitate the design of specially functionalized primers or probes;
hence this feature is helpful to reduce the cost of a RT-LAMP reaction. On the other
hand, LAMP, NASBA and HDA methods do not require thermocycle machines for
4 Sensitive detection of SARS-CoV-2 via RT-RPA 5
amplification; however, specifically designed heating devices are still needed. In

addition, LAMP requires the use of 4–6 primers, which makes primer design more
complicated than other methods. Furthermore, LAMP, NASBA or HDA typically
needs at least 60 min to complete the amplification reaction, which is longer than
RT-RPA.
Recently some more contemporary isothermal amplification methods have
been introduced, for example, NEAR, DETECR, STOP and so on. NEAR (nicking
enzyme amplification reaction) or nicking enzyme-assisted amplification (NEAA)
uses not only strand-displacement DNA polymerase (e.g. Bst polymerase), but also
nicking endonuclease enzymes to exponentially amplify short oligonucleotides
(Wang et al., 2018). Thousands of copies of DNA fragment can be produced from
only one restriction site making this approach a unique technique with rather high
amplification efficiency. On the other hand, a drawback of NEAR is the formation
of non-specific products which limits detection sensitivity. DETECTR (DNA
endonuclease-targeted CRISPR trans reporter) method (Chen et al., 2018) is associ-
ated with CRISPR-based detection approaches that involves the use of the genome
editing Cas12a enzymes. DETECTR uses a crRNA-Cas12a complex to recognize
amplified DNA targets and binding of the crRNA-Cas12a complex to target DNA
induced discrimination cleavage of non-target FQ-DNA reporters. Similar CRISPR-
based approaches include SHERLOCK detection (Gootenberg et al., 2017) in
one-pot (STOP) that uses Cas13a enzyme.
4 Sensitive detection of SARS-CoV-2 via RT-RPA

Reverse transcription recombinase polymerase amplification (RT-RPA) is a widely
recognized isothermal amplification assay for the amplification of RNA, which
combines reverse transcription that converts RNA to cDNA, and recombinase poly-
merase amplification (RPA) that amplifies cDNA under isothermal conditions. RPA
sometimes is also called ERA (enzymatic recombinase amplification) as a modified/
improved version of RPA according to the commercially supplied kit from the
company GenDx (http://gendx.cn), or RAA (recombinase aided amplification)
(Wu et al., 2020; Xue et al., 2020). RPA is a molecular technology introduced by
Piepenburg, Williams, Stemple, and Armes (2006) using proteins involved in
cellular DNA synthesis, recombination and repair (Piepenburg et al., 2006). The
RPA process starts when a recombinase protein binds to primers in the presence
of ATP and a crowding agent (e.g. a high molecular weight polyethylene glycol),
forming a recombinase-primer complex (step I). The complex then interrogates
double-stranded DNA seeking a homologous sequence and facilitates strand hybrid-
ization with the primer at the cognate site (step II & III). In the meanwhile, single-
stranded binding protein (SSB) is added in the reaction mixture to stabilize the
dissociated single-stranded DNA and prevent the ejection of the inserted primer
by branch migration, and facilitate the amplification to proceed at room temperature.
The DNA polymerase (e.g. Bsu) will bind to the 30 end of the primer to elongate the
FIG. 3
The general principle of recombinase polymerase amplification. Step I: recombinase and
primer form complexes and target homologous DNA; step II: strand exchange forms a D-loop;
herein, the brownish and blue-coloured arrows refer to the forward and reverse primers,
respectively, upon annealing with their templates; step III: polymerase initiates synthesis; step
IV: parental strands separate & synthesis continues; herein, the hollow boxed arrows refer to
the directions of the polymerization reaction; step V: two duplexes form. Abbreviation(s):
SSB, single-stranded DNA binding protein.
primer in the presence of dNTPs (step IV & V). Cyclic repetition of this process
results in the exponential amplification of a DNA (Fig. 3) (Piepenburg et al., 2006).
In order to employ RPA for the amplification of RNA, additional reverse tran-
scriptase was added in order to convert RNA to cDNA for subsequent RPA ampli-
fication. In addition, since RNA is a much less stable species compared to DNA
and is highly prone to degradation by the ubiquitously existing RNase, RNase inhib-
itor protein was added into the RT-RPA reaction. In order to facilely detect the
amplification product, a probe and a nuclease was used. Moreover, creatine kinase,
phosphocreatine and ATP were needed to generate energy for the reaction. Therefore,
a practical RT-RPA based detection reaction requires at least seven enzymes/proteins
including: (i) strand-displacing DNA polymerase, (ii) recombinase, (iii) recombination-
mediator protein (RMP), (iv) single-strand DNA binding protein, (v) RNase inhibitor,
(vi) creatine kinase, and (vii) nuclease; in addition, multiple necessary reagents are
also required like dNTPs, creatine, the crowding agent—polyethylene glycol, the
activator Mg(OAc)2, the forward and reverse primers, and a probe. For the most re-
liable test, viral RNA samples need to be purified via a standard RNA purification
process rather than using a non-purified viral sample. The list of proteins, enzymes,
reagents necessary for conducting an RT-RPA reaction with their recommended con-
centrations are summarized in Table 1 (Chen et al., 2020). The concentrations of
primers, probes, RNase inhibitor and nucleases used in our hand for exo-probe,
nfo-probe and multiplexing RT-RPA reaction have also been given (Table 1).
Table 1 List of concentrations of primers, probes, nucleases, inhibitors and

Mg(OAc)2 that need to be additionally supplied in a RT-RPA or RT-ERA reaction
kit for viral RNA detection.
Concentrations Recommended ranges by
Components used in our study other studies
Exo-probe Fw & Rw 500 nM 420 nM, can be varied in the

detection primers range of 150–600 nM
Exo probe 150 nM In the range of 50–150 nM
Exonuclease III 100 U in 50 μL –
Nfo-probe Fw & Rw 400 nM 420 nM, can be varied in
LFD primers 150–600 nM range
Nfo probe 120 nM In the range of 50–150 nM
Endonuclease 10 U in 50 μL –
IV
Duplexing Rw & Fw 100 nM Subjected to testing and
Primers optimization
Exo probes 30 nM
Exonuclease III 100 U in 50 μL
Other RNase 5 U in 50 μL –
necessary A inhibitor
reagents Mg(OAc)2 2 μL Standard 14 mM, can be varied
in the range of 12–30 mM
Note: Other components include (i) RPA enzymes (120 ngμL1 T4 UvsX recombinase, 60 ngμL1 T4
UvsY recombination-mediator protein, 600 ngμL1 T4 gp32 single-stranded binding protein,
30 ngμL1 Bsu or 8.6–12.8 μg Sau DNA strand-displacing polymerase), (ii) energy-supply system
constituents (50 mM phosphocreatine, 100 ngμL1 creatine kinase, and 3 mM ATP), (iii) 200 μM each
dNTPs, (iv) buffering constituents (typically pH 7.9 50 mM Tris/100 mM KOAc), (v) reducing agent 2 mM
DTT, (vi) crowding reagent (5% carbowax 20M), and (vii) reverse transcriptase are generally included
in the commercially available RT-RPA or RT-ERA kit with fixed concentration without the need for further
adjustment (Li, Macdonald, & von Stetten, 2020).
For the detection of viral RNA using RT-RPA, multiple detecting formats are
available. These formats include exo probe, nfo probe, fpg probe, digital (Shen
et al., 2011), nesting, microfluidics (Lutz et al., 2010), solid phase, template gener-
ation, electrochemistry, colorimetric or SNP detection, and so on (Daher, Stewart,
Boissinot, & Bergeron, 2016; Li et al., 2020). Among all these, it seems that using
exo probe for fluorescence detection (Behrmann et al., 2020; Tu et al., 2020) and
using nfo probe coupled with lateral flow strip detection (Zheng et al., 2021) are
the most popular and hence we will mainly focus on these two formats for the
detection of SARS-CoV-2 viral RNA by RT-RPA. Herein, either approach has its
own advantages. For the detection of RNA using exo probe, first forward and reverse
primers that are around 30–35 nucleotides long are designed; the melting tempera-
ture of an oligonucleotide is normally not a critical factor for the performance as a
primer. The primer pairs allow the amplification of a relatively short length DNA
amplicon ideally around 100–200 bp long that is most suited for RPA amplification.
In addition to the primer pair, an exo probe was designed for the fluorogenic
detection of the amplicon in the presence of exonuclease III (exo enzyme). The exo
probe is a modified oligonucleotide featuring an abasic nucleotide analogue—
tetrahydrofuran residue (THF, sometimes referred to as “dSpacer”) that is prone to
cleavage by exo enzyme when the nucleotide is in a double-stranded state. In addition,
the exo probe is usually around 46–52 nucleotides long, with at least 30 nucleotides
located 50 - to the THF site, and a further at least 15-bp long nucleotide located
30 - to the THF site. A blocking group, such as a phosphate, a C3-spacer, a biotin-
TEG or an amine, is situated at its 30 side so that the exo probe cannot act as a primer
and block the probe from polymerase extension. The entire exo probe is able to
specifically hybridize with one chain of the amplicon (THF needs to be counted
as one nucleotide residue). In order to allow this probe to detect the amplicon in
a fluorogenic way, exo probe features a flanking dT-fluorophore (e.g. fluorescein)
on one side of the THF residue and a flanking corresponding dT-quencher group
(typically a suitable Black Hole Quencher (BHQ)) on the other side of the THF site.
In such a way, the dT-fluorophore is temporally quenched by its FRET quencher
(e.g. BHQ1) and the probe will be in a none or weakly fluorescent state. Once RPA
reaction produces an amplicon that can hybridize with the exo probe, the exo probe
is converted from single-stranded state to double-stranded state that allows the
THF residue to be readily cleaved by the exo III enzyme. Hence the quencher
moiety is separated from the probe and the fluorescence of the dT-fluorophore
is restored (Fig. 4). Exo probe allows sensitive detection in RT-RPA based on
the enhancement of fluorescence.
In order to make the sensitive detection approach more field-deployable with
minimal instrumentation, nfo probe could be designed in combination with the
use of lateral flow strips for direct visual detection. In this regard, nfo probe can
hybridize with the amplicon to give a bifunctional amplicon, typically with a biotin
antigenic tag at one end and a FAM antigenic tag at the other end. Similar to the exo
probe, a nfo probe is around 46–52 nucleotides long, features an abasic THF residue
in between, at least 30 nucleotides 50 to the THF site, at least a further 15 nucleotides
FIG. 4
Schematic view of the working principle of a typical exo probe for RT-RPA detection of viral
RNA.
located 30 to the THF side, and a blocking group (e.g. a phosphate) at the 30 side to
block the probe from polymerization. In contrast to exo probe, the nfo probe does not
necessitate any modified dT-fluorophore nor dT-quencher, but requires an affinity
biotin or FAM antigenic tag at the 50 side of the probe. In addition, the primer with
reverse direction to the nfo probe should also be modified with a different affinity tag
(e.g. a FAM tag or a biotin tag) complementary to the nfo probe at the 50 end. Once
the nfo probe hybridizes with the amplicon generated in the RPA amplification
reaction, the nfo probe turns to a double-stranded state, rendering its internal THF
residue susceptible to cleavage by the endonuclease IV, i.e. the nfo enzyme. Then
the 15 bp oligonucleotide 50 to the THF side is released, converting the probe to
a primer and initializing polymerization in the RT-RPA reaction. In the end, a bifunc-
tional amplicon featuring a FAM moiety at one end and a biotin moiety at the other
end is generated, which allows easy visual detection using lateral flow strips (Fig. 5).
Since RT-RPA reaction is highly viscous, a further dilution of the RT-RPA reaction
solution is necessary prior to lateral flow strip analysis.
In the lateral flow (LF) test using a lateral flow strip, the bifunctional amplicon
acts as a “bridge” that connects the gold nanoparticle and the antibody immobilized
in the test line so that the test line turns into a red colour, the colour of the gold nano-
particle (Fig. 6). In brief, the lateral flow strip contains two lines. The first line
which is closer to the absorption pad side is immobilized with α-biotin antibody.
The second control line is fixed with an antibody against α-FAM antibody (i.e.
α-[α-FAM-gold] antibody). A colloidal gold particle region (the gold particle is
coated with α-FAM antibody) is located below the two lines and above the sample
pad. When the sample pad of the test strip is inserted into a diluted RT-RPA reaction
solution, the colloidal gold particle will flow along with the eluent and sequentially
FIG. 5
Schematic view of the working mechanism of a nfo probe in RT-RPA for detection of
viral RNA.
FIG. 6
Schematic view of the working mechanism of lateral flow detection (LFD) for the detection of
bifunctional amplicon, i.e. amplicon with two antigenic labels, produced in RT-RPA reaction.
5 General considerations for designing an ultrasensitive RT-RPA assay 11
cross the test and the control line. Once the double-tagged amplicon is presented in
the RT-RPA reaction, it will bridge the gold particle and the α-biotin antibody in the
test line, turning the test line to a red colour. Meanwhile the control line that contains
α-[α-FAM-gold] antibody will bind the α-FAM antibody-coated gold particle,
suggesting that the LF strip is effective (Fig. 6).
5 General considerations for designing an ultrasensitive

RT-RPA assay
RT-RPA reaction contains multiple proteins/enzymes, ingredients, primers, and a
probe. In addition, multiple factors can also affect the performance of RT-RPA re-
action. Therefore, in order to achieve an optimal performance in RT-RPA reaction
for the diagnosis of viral RNA, several points need to be taken into consideration.
Herein, we will mainly discuss the most important factors that could help the setup
of an optimal RT-RPA reaction for RNA detection. These factors include: (i) primer
design, (ii) probe design, and (iii) temperature.
5.1 Primer design

For either exo probe or nfo probe used in RT-RPA test, the optimal primer length is
30–35 nucleotides, which is usually longer than typical PCR primers. Regarding the
design of a primer pair for RPA, the melting temperature of an oligonucleotide is not
the critical factor for its performance as a primer, but rather its length. In addition, the
optimal length of a primer can also be temperature dependent as RPA reaction can
still take place above or below 37 °C. Oligonucleotides shorter than 30 bp may still
function albeit at a typically slower reaction rate. Longer oligonucleotides may also
be used as a primer to increase the RPA kinetics; yet longer primer may increase the
possibility of secondary-structure formation that could lead to the so-called primer
noise. Moreover, since RPA reaction is best suited for relatively short length DNA
amplification compared to PCR methods, it is advised that the primer pair amplify an
amplicon with a length ideally between 100 and 200 bp, not exceeding 500 bp. Am-
plification of a short length of DNA is also beneficial to achieve an increased prod-
uct/noise ratio because shorter products will be generated in a shorter period of time
and the longer an amplicon is, the more likely primer noise will outcompete target
amplification. In fact, short amplicon is an important criterion for designing ultrasen-
sitive RT-RPA assays. In order to select an appropriate primer pair annealing to an
appropriate region within a nucleic acid target, it is advised that the target region is
characterized by relatively “average” nucleotide sequence composition with a GC
content between 40% and 60%, featuring repetitive sequences, and with minimal di-
rect/inverted repeats, palindromes, etc. More importantly, when RT-RPA is used for
viral nucleic acid detection, the specificity of the primers toward the nucleic acid
target of the virus should be carefully evaluated. This can be tested, via, e.g. BLAST,
to ensure that the designed primers indeed specifically detect certain species, but not
any other species. In order to screen a best Fw and Rw primer pair, different Fw
primer and Rw primers could be paired and evaluated.
5.2 Probe design

Both exo and nfo probes should be 46–52 nucleotides long, featuring at least 30 bp
located 50 to the THF site, and at least a further 15 bp located 30 to THF residue
appended with a blocking group at the 30 group. The 30 block group should always
be added in order to prevent polymerization from the probe. Care should be taken to
avoid the occurrence of primer-probe dimers, although the primer in the same direc-
tion as the probe could partially overlap at its 50 part. In addition, secondary struc-
tures in the probe should be avoided to prevent the probe folding back on itself.
For the design of either exo probe or nfo probe, it needs to be kept in mind that
the THF site occupies one base site, meaning THF needs to replace an existing base
rather than being added as an additional base. For the design of the exo probe, the
most important factor is to identify a pair of dT residues in close proximity to each
other, typically with only 1–5 interval nucleotides. If the distance between the
dT-fluorophore and dT-quencher is too large, quenching could be poor. For the
design of a nfo probe, a 50 -antigenic label needs to be appended in order to pair with
the antigenic label on the opposing primer.
5.3 Reaction temperature

Most commercially available RPA kits are designed for being conducted at a tem-
perature range of 37–42 °C. If the temperature is higher, enzymes gradually lose
activity inhibiting amplification. When the reaction temperature is lower, the
RPA may also work excellently but at a reduced reaction rate. However, the problem
is that the consumption of the reagents in the RPA reaction still proceeds quickly
even at a reduced temperature. The result is fuel “burn-out” before RPA amplification
produces a reasonable amount of amplicon for detection.
6 Comparative reviews of recently published RT-RPA assays

for SARS-CoV-2 detection
Until now, there have been multiple reports about the detection of SARS-CoV-2 viral
RNA using RT-RPA approach following our initial report in March 2020 and May
2020 (Abd El Wahed et al., 2021; Arizti-Sanz et al., 2020; Behrmann et al., 2020;
Qian et al., 2020; Tu et al., 2020; Wang, Cai, et al., 2020; Xia & Chen, 2020a,
2020b; Xiong et al., 2020; Xue et al., 2020; Zheng et al., 2021). We introduced
an WEPEAR (whole-course encapsulated procedure for exponential amplification
from RNA) that seamlessly combines the reverse transcription (optimally at 37 °C,
in the absence of Mg(OAc)2 catalyst) and the RPA reaction (optimally at 40 °C, in
6 RT-RPA assays for SARS-CoV-2 detection 13
FIG. 7
The WEPEAR protocol seamlessly combines reverse transcription and RPA reactions in one
tube allowing both steps to be conducted under their own optimal temperatures and prevents
the Mg2+ used in the RPA reaction from interacting with the RNA sample and inhibiting
reverse transcription.
the presence of Mg(OAc)2 catalyst) at their own optimal conditions (Fig. 7) (Xia &
Chen, 2020a, 2020b). Because the optimal temperature used for performing reverse
transcription and RPA reaction is different (although a bit close), direct combination
of reverse transcription and RPA reactions in one tube would compromise the entire
amplification, although possible. In addition, the Mg2+ ion used as a catalyst in the
PRA reaction can complex with the RNA to inhibit the transcription step. Hence it is
advantageous to physically separate the reverse transcription step and the PRA am-
plification step. On the other hand, however, it is also highly desirable to perform
reverse transcription and RPA reactions in one-tube without re-opening the lid again
after introducing the detection sample. In this case, it can simplify the testing pro-
cedure and reduce possible contamination during the amplification course, such
as aerosol contamination from the air. The WEPEAR protocol readily solved this
problem by seamlessly combining the RT step and the RPA step in one-pot without
opening the lid at all during the entire detection course (Fig. 7).
In WEPEAR protocol, the RNA sample is added into the reaction solution in a
vial containing all necessary reagents for both RT and RPA reaction aside from the
magnesium activator. In the meanwhile, a small volume of the magnesium acetate
solution catalyst is loaded onto the lid of the reaction vial; due to the surface tension
force, the small volume of the magnesium solution will still sit inside of the inner lid
after gently closing the lid. The reaction vial is first warmed to 37 °C for 60 s to finish
the reverse transcription process. Afterwards, the reaction vial is subjected to brief
centrifugation, vortex, centrifugation again to mix the magnesium catalyst into the
reaction mixture and initialization of the RPA reaction. Finally, the reaction vial is
warmed to 40 °C for 4 min as the pre-reaction step, vortexed, centrifuged again, and
warmed to 40 °C for another 26 min to complete the entire RPA reaction. Herein,
vortexing and centrifuging the reaction again after 4 min is beneficial to enhance
the sensitivity because RT-RPA reaction mixture is quite viscous and the internal
vortex step could help disperse the initially amplified amplicon in the entire reaction
mixture for a more efficient amplification (Fig. 7).
In the WEPEAR-powered RT-PRA approach, two exo probes were designed for
the detection of N-gene and S-gene. Both probes show high sensitivity for the detec-
tion of SARS-CoV-2 RNA. The exo probe for N-gene can detect four copies of RNA
in a reaction while the exo probe for S-gene is able to achieve single-copy sensitivity
in the RT-RPA reaction.
As has been mentioned above, false negative results that are usually caused by
lack of sufficient sensitivity in the detection method should be avoided. False pos-
itive results also need to be minimized for a reliable diagnostic approach. Herein, if
two genes could be simultaneously detected, many false positive results will be ex-
cluded. In our recent report, the exo probe for N-gene is green-colour emissive and
the exo probe for S-gene is red-colour emissive. Hence, it makes it possible to mul-
tiplex the RT-RPA reaction for simultaneous dual-gene detection. We achieved this
simply by reducing the concentrations of both primers and probes to around one fifth
of their original concentration. Real-time dual-gene detection using green and red
channels was readily achieved using an advanced real-time PCR machine. This result
suggested that rational adjustment/reduction of the primer and probe concentrations
is an efficient way to establish a successful multiplexing RT-RPA reaction.
In addition to the exo probes, nfo probe for both N- and S-gene were also
designed for lateral flow test without the need of a real-time PCR machine, nor a blue
light imaging plate. Hence, nfo probe combined with lateral flow strips provide a
more field-deployable way for conducting SARS-CoV-2 detection. Household
detection using this LFD method is also possible simply using a daily used thermos
cup to warm up the reaction vial. Herein, ultrasensitivity has been achieved for both
nfo probes. The sensitivity tested using in vitro transcribed RNA sample reached
four-copy per reaction.
Among other RT-RPA methods for SARS-CoV-2 detection (Table 2), enhanced
RT-RPA has been introduced which is named eRPA protocol (Qian et al., 2020). In-
ternally quenched (exo-IQ) probe was designed for the detection of SARS-CoV-2
N gene (Behrmann et al., 2020). Also, all the required detection setup and reagents
could be included in a suitcase called a “Suitcase Lab” for deployable detection of
SARS-CoV-2 (Behrmann et al., 2020). Moreover, RT-RPA can be coupled with gene
editing enzymes, e.g. Cas12a or Cas13a for viral RNA detection (Arizti-Sanz et al.,
2020; Xiong et al., 2020). RT-RPA has the following advantages over RT-PCR:
(1) the amplification proceeds faster which can be accomplished within 20–30min;
(2) RT-RPA proceeds at a constant temperature without the need of thermocyclers,
and often gives higher sensitivity. For example, there are already several reports
achieving single-copy detection sensitivity for the detection of SARS-CoV-2 using
Table 2 Summarization of recently published RT-RPA methods for sensitive detection of SARS-CoV-2 (as of February 2021).
Entry Gene Type Sequence & structure Duration Sensitivity Specificity Readout References Date
1 and N Fw TTTGGTGGACCCTCAGATTCAACTGGCAGTAAC 1 min (37 °C) 4-copy/ Specific over Green Xia and March 23,
2 Rw GAATTTAAGGTCTTCCTTGCCATGTTGAGTGAG + 30 min reaction SARS-CoV emission Chen 2020
(40 °C) with (50 μL) (2020a) and
Exo-probe TATTATTGGGTAAACCTTGGGGCCGACGTTGTT/
internal vortex Xia and
i6FAMdT/T/idSp/
Chen
A/iBHQ1dT/CGCGCCCCACTG-Phosphate
(2020b)
N Fw TTTGGTGGACCCTCAGATTCAACTGGCAGTAAC 1 min (37 °C) 4-copy/ Specific over LFD May 28,
Rw Biotin-GAATTTAAGGTCTTCCTTGCCATGT + 30 min reaction MERS-CoV 2020
TGAGTGAG (40 °C) with (50 μL) but not
internal vortex SARS-CoV
Nfo-probe 6-FAM-GCGATCAAAACAACGTCGGCCCCAAGGTT
+2 min LF test
TACC/idSp/AATAATACTGCGTCT-Phosphate
S Fw GTCTCTAGTCAGTGTGTTAATCTTACAACCAGAAC 1 min (37 °C) 1-copy/ Specific over Red Xia and May 28,
Rw CATTGGAAAAGAAAGGTAAGAACAAGTCCTGAG + 30 min reaction SARS-CoV emission Chen 2020
(40 °C) with (50 μL) (2020b)
Exo-probe CCTGCATACACTAATTCTTTCACACGTGGT
internal vortex
G/iTAMdT/T/idSp/A/iBHQ2dT/
TACCCTGACAAAGTT-Phosphate
S Fw GTCTCTAGTCAGTGTGTTAATCTTACAACCAGAAC 1 min (37 °C) 4-copy/ Specific over LFD
Rw Biotin-CATTGGAAAAGAAAGGTAAGAACAAGT + 30 min reaction SARS-CoV,
CCTGAG (40 °C) with (50 μL) MERS-CoV
internal vortex
Nfo-probe 6-FAM-CCTGCATACACTAATTCTTTCACACGTGGT
+2 min LF test
G/idSp/TTATTACCCTGACAA-Phosphate
3 N Fw CCTCTTCTCGTTCCTCATCACGTAGTCGCAAC 21 min (42 °C) 10-copy/ Specific over Green Behrmann May 8,
Rw AGTGACAGTTTGGCCTTGTTGTTGTTGGCCTT + internal reaction SARS-CoV, emission et al. (2020) 2020
vortex (57 μL) MERS-CoV,
Exo- CCTGCTAGAATGGCTGGCAATGGCGGTGA/
OC43/229E/
Probe idFAMdT/idSp/C/iBMNQ535dT/
NL63
TGCTCTTGCTTTGC-C3
4 S Fw CTTCAACCTAGGACTTTTCTATTAAAATATAATG 4 min + 20 min 10-copy/ Specific over Green Xue et al. May 22,
Rw GTTGGTTGGACTCTAAAGTTAGAAGTTTGATAG (39 °C) reaction OC43/229E/ emission (2020) 2020
(50 μL) NL63/HKU1
Exo-probe CCATTACAGATGCTGTAGACTGTGCACTTG
ACCC/iFAMdT/C/idSp/C/iBHQ1dT/
CAGAAACAAAGTGTACG-Phosphate
Orf1ab Fw TACGCCAAGCTTTGTTAAAAACAGTACAATTCTG 4 min + 20 min 1-copy/ Green
Rw GGCATTAACAATGAATAATAAGAATCTACAACAGG (39 °C) reaction emission
(50 μL)
Exo-probe TTGTTGGTGTACTGACATTAGATAATCAAG
ATC/iFAMdT/C/idSp/A/iBHQ1dT/
GGTAACTGGTATGATTTCG-Phosphate
5 N Fw CAGTTCAAGAAATTCAACTCCAGGCAGCAGTAG 7 min (39 °C) 10-copy/ Specific over Green Wu et al. July 29,
Rw CAGTTTGGCCTTGTTGTTGTTGGCCTTTAC + 20 min reaction OC43/229E/ emission (2020) 2020
(39 °C) (50 μL) NL63/HKU1,
influenza A/
Exo-probe CAGACATTTTGCTCTCAAGCTGGTTCAATC
B; unknown
/iFAMdT/idSp/iBHQ1dT/CAAGCAGCAGC
for SARS-
AAAG-C3
CoV
6 S Fw TCTTGTTTTATTGCCACTAGTCTCTAGTCAGT 25 min (42 °C) 3-copy/ Specific over LFD Qian et al. November
Rw FAM-GAATGTAAAACTGAGGATCTGAAAACTTTG + 3 min (90 °C) reaction SARS-CoV, (2020) 20, 2020
+ 3 min (RT) (50 μL) MERS-CoV,
+3 min LF test SuperScript 229E/HKU1
Nfo-probe Biotin-TGCATACACTAATTCTTTCACACGTGGT
IV & RNase
H added
Continued
Table 2 Summarization of recently published RT-RPA methods for sensitive detection of SARS-CoV-2 (as of February 2021).—
cont’d
Entry Gene Type Sequence & structure Duration Sensitivity Specificity Readout References Date
7 Orf1ab Fw CCAAGGTAAACCTTTGGAATTTGGTGCCAC 50 min 10-copy/μL Specific over Green Arizti-Sanz November
input SARS-CoV emission et al. (2020) 20, 2020
Rw ACTATCATCATCTAACCAATCTTCTTCTTG or LFD
Cas13a CUCUUCUUCAGGUUGAAGAGCAGCAGAA
crRNA
FQ/FB 6-FAM-rUrUrUrUrUrUrUrUrUrUrUrUrUrU-Biotin
reporter 6-FAM-rUrUrUrUrUrUrU-IABkFQ
8 Orf1ab Fw TTGCCTGGCACGATATTACGCACAACTAATGGT 20 min (42 °C) 1-copy/ Specific over Green Xiong et al. December
Rw CAAGCTGATGTTGCAAAGTCAGTGTACTCTAT + up to reaction MERS-CoV, emission (2020) 15, 2020
120 min (37 °C) (12.5 μL) SARS-CoV, or LFD
Cas12a UAAUUUCUACUAAGUGUAGAUgugcaguug
for Cas12a OC43/HKU1
crRNA guaacaucuguuac
detection
FQ/FB FAM-TTATT-BHQ1
reporter FAM-TTATT-Biotin
N Fw CTTCCTCAAGGAACAACATTGCCAAAAGGCT 20 min (42 °C) 1–10-copy/ Specific over Green
Rw TCTAGCAGGAGAAGTTCCCCTACTGCTGCCTGG + up to reaction SARS-CoV, emission
120 min (37 °C) (12.5 μL) MERS-CoV, or LFD
Cas12a UAAUUUCUACUAAGUGUAGAUuugaacugu
for Cas12a OC43/HKU1
crRNA ugcgacuacgugau
detection
FQ/FB FAM-TTATT-BHQ1
reporter FAM-TTATT-Biotin
9 RdRp Fw TATGCCATTAGTGCAAAGAATAGAGCTCGCAC 15 min 2-copy/ NOT specific Green Abd El January
Rw CAACCACCATAGAATTTGCTTGTTCCAATTAC reaction over SARS- emission Wahed et al. 20, 2021
(50 μL) CoV (2021)
Exo-probe TCCTCTAGTGGCGGCTATTGATTTCAATAA
/iBHQ1dT/idSp/iFAMdT/
TTGATGAAACTGTCTATTG-Phosphate
E Fw GAAGAGACAGGTACGTTAATAGTTAATAGCGTA 15 min 15-copy/ NOT specific Green
Rw AAAAAGAAGGTTTTACAAGACTCACGTTAACsA reaction over SARS- emission
(50 μL) CoV
Exo-probe ATCGAAGCGCAGTAAGGATGGCTAG/iBHQ1dT/
idSp/iFAMdT/AACTAGCAAGAATAC-Phosphate
N Fw CCTCTTCTCGTTCCTCATCACGTAGTCGCAAC 15 min 15-copy/ Specific over Green
Rw AGTGACAGTTTGGCCTTGTTGTTGTTGGCCTT reaction SARS-CoV emission
(50 μL)
Exo-probe TAGAATGGCTGGCAATGGCGGTGATGCTGC
/iBHQ1dT/idSp/iFAMdT/TGCTTTGCTGCTGCTT-
Phosphate
10 N Fw CTAACAAAGACGGCATCATATGGGTT 30 min (39 °C) 10-copy/ Specific over LFD Zheng et al. February
Rw FITC-GGCCTTTACCAGACATTTTGCTCTCA + LFD reaction SARS-CoV, (2021) 1, 2021
(50 μL) OC43/
Nfo-probe Biotin-CTCTTCTCGTTCCTCATCACGTAGTCGCAA
HKU1/
C/dSp/GTTCAAGAAATTCA-Phosphate
NL63/229E,
HBV human
influenza A/
B, RSV A/B,
Abbreviations: FITC, fluorescein isothiocyanate; FAM, fluorescein; 6-FAM, 6-carboxyfluorescein; C3, C3-blocking group; idFAMdT, internal FAM modified dT nucleotide; id6FAMdT, internal 6-FAM modified dT nucleotide; idTAMdT,
internal TAMRA modified dT nucleotide; idSp, internal tetrahydrofuran (THF) spacer; idBHQ1, internal BHQ1 quencher modified dT nucleotide; idBHQ2, internal BHQ2 quencher modified dT nucleotide; iBMNQ535dT, internal
BMNQ535 quencher modified dT nucleotide; s, phosphorothioate backbone.
9 Key resources table 17
RT-RPA (Xia & Chen, 2020a, 2020b; Xue et al., 2020). A comparison of the recently
reported RT-RPA detection against SARS-CoV-2 RNA is summarized in Table 2.
7 Methods section
In the following, we will detail the methods using the WEPEAR protocol for ultra-
sensitive field-deployable detection of SARS-CoV-2 RNA.
Methods section (All Using Basic RT-ERA Kit).
8 Before you begin

Timing: few days
Design and customer synthesis of exo probes, nfo probes, and respective primers
(few days);
Reconstitution of the obtained exo probes, nfo probes and respective primers to
10 μM as stock solutions; store at 40 °C and thaw them before use;
Preparation of 5 U/μL murine RNase inhibitor in glycerol containing solution and
store at 40 °C before use;
Make exonuclease III at 200 U/μL and endonuclease IV at 10 U/μL; store at
40 °C before use;
Preparation of viral RNA sample using a qualified RNA extraction kit.
9 Key resources table
Reagent or resource Source Identifier
Bacterial and virus strains

DH5α E. coli HaiGene Cat# K10119
Recombinant proteins
Exonuclease III (exo III) Thermo Scientific Cat# EN0191
Murine RNase inhibitor Vazyme Cat# R301-01
Endonuclease IV (nfo enzyme) Vazyme Cat# R301-01
NdeI NEB Cat# R0111S
HindIII NEB Cat# R3104S
Critical commercial assays
T7 high yield transcription kit Vazyme Biotech Cat# TR101-01
Co., Ltd.
Continued
—cont’d
Basic RT-ERA reaction kit GenDx Biotech Co., Cat# KS102
Ltd.
FastPure gel DNA extraction mini kit Vazyme Biotech Cat# DC301
Co., Ltd.
Express RNA purification kit GenDx Biotech Co., Cat# NR202-50T
Ltd
Oligonucleotides
N-gene Exo Fw: LoGenBio N.A.
tttggtggaccctcagattcaactggcagt
aac
N-gene Exo Rw: LoGenBio N.A.
gaatttaaggtcttccttgccatgttgagt
gag
N-gene Exo probe: LoGenBio N.A.
tattattgggtaaaccttggggccgacgtt
gtt/i6FAMdT/t/idSp/a/iBHQ1dT/
cgcgccccactg-Phosphate
N-gene Nfo Fw: LoGenBio N.A.
aac
N-gene Nfo Rw: LoGenBio N.A.
aac
N-gene Nfo probe: 6- LoGenBio N.A.
FAM-gcgatcaaaacaacgtcggccccaaggttt
acc/idSp/aataatactgcgtct-Phosphate
S-gene Exo Fw: LoGenBio N.A.
gtctctagtcagtgtgttaatcttacaacc
agaac
S-gene Exo Rw: LoGenBio N.A.
cattggaaaagaaaggtaagaacaagtcct
gag
S-gene Exo probe: LoGenBio N.A.
cctgcatacactaattctttcacacgtggt
g/iTAMdT/t/idSp/A/iBHQ2dT/
taccctgacaaagtt-Phosphate
S-gene Nfo Fw: LoGenBio N.A.
gtctctagtcagtgtgttaatcttacaacc
agaac
S-gene Nfo Rw: Biotin- LoGenBio N.A.
cattggaaaagaaaggtaagaacaagtcct
gag
S-gene Nfo probe: LoGenBio N.A.
6-FAM-cctgcatacactaattctttcacacgtggt
g/idSp/ttattaccctgacaa-Phosphate
Recombinant DNA
SARS-CoV-2 N-gene plasmid LoGenBio N.A.
11 Step-by-step method details 19
—cont’d
SARS-CoV-2 S-gene plasmid LoGenBio N.A.
SARS-CoV N-gene plasmid LoGenBio N.A.
SARS-CoV S-gene plasmid LoGenBio N.A.
MERS-CoV N-gene plasmid LoGenBio N.A.
MERS-CoV S-gene plasmid LoGenBio N.A.
Software and algorithms
SnapGene viewer SnapGene www.snapgene.com/
snapgene-viewer
BLAST NCBI https://blast.ncbi.nlm.
nih.gov/Blast.cgi
Image J National Institutes of https://imagej.net/
Health (NIH) Downloads
Other
HybriDetect LF strips Amplification Future Cat# WLF8201
DL5000 DNA marker Vazyme Cat# MD102
100 bp DNA ladder Vazyme Cat# MD104
Agarose Biosharp Cat# BS081-100g
50 TAE buffer Alphabio Cat# A1558
SYBR safe DNA gel stain APExBio Cat# A8743
DNA sample loading buffer Alphabio Cat# A1550
10 Materials and equipment

• Mini centrifuge (DLAB, D1008)
• PCR machine (MIULAB, PR-96E)
• Real-time PCR machine (Applied Biosystem, QuantStudio 6Flex)
• Fluorescence spectrometer (Molecular Devices, SpectraMax i3x)
• Pipettes (Eppendorf, 2.5, 10, 20, 200, 1000 μL)
• Horizontal gel electrophoresis kit (LIUYI, DYCP-31C)
• Heating block (DLAB, Mini HCL100)
• Mini blue and white light imaging plate (LIUYI, WD-9403 )
11 Step-by-step method details

11.1 Detection of SARS-CoV-2 N- or S-gene using exo probes and
primers
Timing: around 31 min
1. For a 50 μL reaction system, 2.5 μL of exo forward primer (10 μM), 2.5 μL of exo
reverse primer (10 μM), 0.75 μL of exo FRET probe (10 μM), 1 μL of 5 U/μL of
murine RNase inhibitor, 1 μL of RNA sample, 20 μL of DI-H2O, and 0.5 μL of

200 U/μL exonuclease III were added into 20 μL dissolving buffer (DA solution).
2. The resultant 48 μL of reaction solution was added into the PCR tube
containing dry powder that includes all necessary enzymes and ingredients for
RT-ERA to occur, and then gently pipette to mix the reaction mixture.
3. Meanwhile, 2 μL of Mg(OAc)2 solution as the ERA activator was loaded into the
lid of the PCR tube, then close the lid gently.
4. Afterwards, the reaction vial was incubated in a 37 °C water bath for 60 s to allow
solely transcription to take place.
5. Centrifuge the tube to mix the Mg2+ activator with the RT-ERA reaction mixture,
shake and centrifuge again to collect all liquids to the bottom of the PCR tube.
6. Heat the PCR tube at 40 °C for 4 min using a heating block or PCR machine
or water inside a thermos cup to allow pre-reaction.
7. The PCR tube was shaken and spun again, and incubated at 40 °C for another
26 min to compete the RT-ERA reaction.
8. Visualize the fluorescence signal by putting the PCR tube on top of a mini
blue-light plate and capture the fluorescence image using a smartphone camera;
alternatively, the fluorescence intensity can be quantified using Molecular
Devices SpectraMax i3x with a 96-well plate.
Important notes:
(i) The area around PCR machine where RT-ERA amplification is conducted can
produce invisible aerosols in the air that contain the target amplicon. Hence
the aerosols could potentially contaminate the surrounding areas. As a result,
the area for setting up the RT-ERA reaction and the area for conducting the
RT-ERA amplification should be strictly separated in order to prevent the
contamination of the RT-ERA reaction solution by aerosols in the air.
(ii) Since RNase ubiquitously exists which is detrimental for RNA samples, the
whole working area should be carefully cleaned using DEPEC water and the
equipment used (e.g. mini-centrifuge and pipettes) should also be swiped using
DEPEC water prior to use; in addition, all consumables, e.g. tips, should be
autoclaved after spraying with DEPEC water prior to use.
(iii) Always wear appropriate personal protective equipment (PPE) including at
least a lab coat, goggles, gloves, and a mask; wearing of a mask is required in
order to prevent any foams/droplets that contain RNase and other contaminant to
be expelled from the mouth and nose contaminating the RT-ERA reaction.
(iv) Be highly cautious to avoid any part of your skin from touching the working
bench, equipment and consumables when performing the SARS-CoV-2
detection because skin surfaces have a lot of secretions (like oil) that contain
RNase and other contaminates.
(v) Due to the ultrahigh sensitivity of this RT-ERA test, both positive control and
negative control samples must be included in every test in order to exclude
possible false positive and false negative results.
11 Step-by-step method details 21
11.2 Detection of SARS-CoV-2 N- or S-gene using nfo probes

and lateral flow strips
Timing: around 31 min + around 3 min of LFD
1. For a 50 μL reaction system, 2 μL of nfo forward primer (10 μM), 2 μL of nfo
reverse primer (10 μM), 0.6 μL of nfo probe (10 μM), 1 μL of 5 U/μL of murine
RNase inhibitor, 1 μL of RNA sample, 21 μL of DI-H2O, and 1 μL of 10 U/μL
endonuclease IV (nfo enzyme) were added into 20 μL dissolving buffer
(DA solution).
2. The resultant 48 μL of reaction solution were added into a PCR tube containing
dry powder that includes all necessary enzymes and ingredients for RT-ERA to
occur, and then gently pipette to mix the reaction mixture.
3. Meanwhile, 2 μL of Mg(OAc)2 solution as the ERA activator was loaded into
the lid of the PCR tube, and then the lid was closed gently.
4. Afterwards, the reaction vial was incubated in a 37 °C water bath for 60 s to
allow solely transcription to take place.
5. Centrifuge the tube to mix the Mg2+ activator with the RT-ERA reaction
mixture, shake and centrifuge again to collect all liquids to the bottom of the
PCR tube.
6. Warm the PCR tube at 40 °C for 4 min using a heating block, a PCR machine or
water bath inside a thermos cup to allow for pre-reaction.
7. The PCR tube was shaken and centrifuge again, and incubate at 40 °C for
another 26 min to complete the RT-ERA reaction.
8. 10 μL of nfo reaction solution was diluted into 200 μL by DI-H2O in a 1.5 mL
centrifuge tube.
9. The sample pad end of the HybriDetect LF strip was dipped into the diluted
reaction solution.
10. Read the detection result after 2–3 min that if both the test line and control line
turn red, SARS-CoV-2 viral RNA is detected.
Important notes:
(i) The area around the PCR machine where RT-ERA amplification is conducted
can produce invisible aerosols in the air that contain the target amplicon. Hence
the aerosols could potentially contaminate the surrounding areas. As a result,
the area for setting up the RT-ERA reaction and the area for conducting the
RT-ERA amplification should be strictly separated in order to prevent the
contamination of the RT-ERA reaction solution by aerosols in the air.
(ii) Since RNase ubiquitously exists, which is detrimental for RNA samples, the
whole working area should be carefully cleaned using DEPEC water and the
equipment used (e.g. mini-centrifuge and pipettes) should also be swiped using
DEPEC water prior to use; in addition all consumables, e.g. tips, should
be autoclaved after spraying with DEPEC water prior to use.
(iii) Always wear appropriate PPE including at least a lab coat, goggles, gloves, and
mask; wearing of a mask is required in order to prevent any foams/droplets that
contain RNase and other contaminants to be expelled from the mouth and nose
contaminating the RT-ERA reaction.
(iv) Be highly cautious to avoid any part of your skin from touching the working
bench, equipment and consumables when performing the SARS-CoV-2
detection because skin surfaces have a lot of secretions (like oil) that contain
RNase and other contaminates.
(v) Due to the ultrahigh sensitivity of this RT-ERA test, both a positive control and
a negative control samples must be included in every test in order to exclude
possible false positive and false negative results.
(vi) After the LF strip is dipped into the diluted RT-ERA reaction, the results should
be read within the initial few minutes to get a reliable readout because the
test line may still gradually, although slowly, develop some light red colour
after an extended duration even for a blank or negative control sample.
11.3 Optional steps

Timing: <1 min
1. For single-copy sensitivity assay, more internal vortex steps are advised, such as
at 3rd, 6th and 9th min
11.4 Simultaneous dual N- and S-gene detection using paired exo

probe and primers for N-gene and exo probe and primers for S-gene
Timing: >30 min
1. For a 50 μL reaction system, 0.5 μL of exo forward primers (10 μM) for N- and
S- gene (final 100 nM), 0.5 μL of exo reverse primers (10 μM) for N- and S-genes
(final 100 nM), 0.3 μL of exo probes (each 5 μM) for N- and S-genes
(final 30 nM for each exo probe), 1 μL of 5 U/μL of murine RNase inhibitor, 1 μL
RNA sample, 23 μL of DI-H2O, and 0.5 μL of 200 U/μL exonuclease III were
added into 20 μL of DA solution.
2. The resultant 48 μL of reaction solution was added into the PCR tube containing
dry powder that includes all necessary enzymes and ingredients for RT-ERA to
occur; and then gently pipette to mix the reaction mixture.
3. Transfer the PCR mixture to a 0.2 mL 8-strip PCR tubes equipped with
transparent and flat lids.
4. Meanwhile, 2 μL of Mg(OAc)2 solution as the ERA activator was loaded into the
lid of the PCR tube strip, and then close all lids gently.
5. Afterwards, the PCR tube strip was incubated in a 37 °C water bath for 60 s to
allow solely the transcription to take place.
6. Centrifuge the PCR tube strip to mix the Mg(OAc)2 activator into the RT-ERA
reaction mixture, shake and centrifuge again.
7. Load the PCR strips into Applied Biosystem QuantStudioTM 6Flex real-time
PCR machine according to the instructions of the manufacturer.
8. Record the fluorescence increase of both fluorescein and TAMRA channels.
12 Summary 23
12 Summary
In this chapter, we have described nucleic acid-based approaches for sensitive detec-
tion of SARS-CoV-2 with a particular focus on the recombinase polymerase ampli-
fication that belongs to the isothermal amplification category. Sensitivity is the key
to avoid false negative results and would be highly beneficial to prevent the spread of
a pandemic. Some recent reports have already pointed out the necessity to avoid in-
sensitive methods, e.g. some serological tests, for practical SARS-CoV-2 diagnosis.
According to recently published papers, more than one RT-RPA-based reports have
achieved single-copy sensitivity, the highest sensitivity in diagnosis. This is gener-
ally higher than the widely used RT-PCR methods and is clearly higher than other
testing approaches. In order to achieve a high sensitivity, primers and probe should
be rationally designed in order to achieve the best performance. Specificity should
also be taken into account when designing primers and probes for sensitive viral
RNA detection. The region within an RNA genome for RT-RPA amplification also
needs to be carefully taken into account. Unlike the direct detection of DNA using
RPA, the detection of RNA using RPA requires an additional reverse transcription
step. However, the reaction condition of reverse transcription is typically not fully
consistent with the conditions used in RPA; and moreover, some reagents used in
RPA (e.g. the catalyst Mg2+) can potentially inhibit reverse transcription. In order
to make the two steps fully compatible, whole-course encapsulated procedure for
exponential amplification from RNA (WEPEAR) protocol has been introduced
for “sample-in, results-out” one tube detection of viral RNA sample (Xia & Chen,
2020a, 2020b).
RT-RPA has several distinct advantages; however, it also has some limitations.
RT-RPA is performed under a constant temperature, in the range between room tem-
perature to 42 °C without the need for thermocyclers. As a result, highly costly real-
time PCR machine is not compulsory for performing the detection. RT-RPA could be
coupled with either fluorogenic detection using a blue light imaging plate, or lateral
flow strips without any particular imaging devices. All these features make RT-RPA
highly field-deployable and would be rather suited for grassroots clinics. In fact, we
have shown that RT-PRA coupled with LF test using thermos cups as the heating
device can be conducted in a house-hold fashion (Xia & Chen, 2020a, 2020b). An-
other key advantage of RT-RPA is the fast detection rate with a typical sample-to-
readout time in the range of 20–30 min, and even within 20 min. This is clearly
shorter than the RT-LAMP method (usually >60 min) and RT-PCR methods (typi-
cally >2 h). On the other hand, the RT-RPA reaction contains multiple components,
including several enzymes, proteins, energy-supply system, crowding agents, aside
from primers and probes. This makes a standard RT-RPA reaction relatively more
expensive. However, given that no sophisticated instrumentation is required and
that diagnosis time is much shorter, the general cost for performing an RPA assay
could still be reduced to a comparative level to other nucleic acid-based detection
approaches as suggested by some previous evaluations (Londono, Harmon, &
Polston, 2016). Along with the further development of RT-RPA, such as the digital
version, microfluidic version and so on, and the fact that there are several unique
advantages of RT-RPA (e.g. ultrahigh sensitivity), we predict RT-RPA approach will
show great potential for sensitive and field-deployable viral RNA detection in the
future.
Acknowledgement
We thank the research fund from Harbin Institute of Technology, and National Natural Science
Foundation of China (grant No. 32071410 to X.C.) for the support of this work.
References
Abd El Wahed, A., Patel, P., Maier, M., Pietsch, C., Ruster, D., Bohlken-Fascher, S., et al.
(2021). Suitcase lab for rapid detection of SARS-CoV-2 based on recombinase polymerase
amplification assay. Analytical Chemistry, 93(4), 2627–2634.
Ai, T., Yang, Z., Hou, H., Zhan, C., Chen, C., Lv, W., et al. (2020). Correlation of chest CT and
RT-PCR testing for coronavirus disease 2019 (COVID-19) in China: A report of 1014
cases. Radiology, 296(2), E32–E40.
Amanat, F., Stadlbauer, D., Strohmeier, S., Nguyen, T. H. O., Chromikova, V., McMahon, M.,
et al. (2020). A serological assay to detect SARS-CoV-2 seroconversion in humans.
Nature Medicine, 26(7), 1033–1036.
Arizti-Sanz, J., Freije, C. A., Stanton, A. C., Petros, B. A., Boehm, C. K., Siddiqui, S., et al.
(2020). Streamlined inactivation, amplification, and Cas13-based detection of SARS-
CoV-2. Nature Communications, 11(1), 5921.
Behrmann, O., Bachmann, I., Spiegel, M., Schramm, M., Abd El Wahed, A., Dobler, G., et al.
(2020). Rapid detection of SARS-CoV-2 by low volume real-time single tube reverse tran-
scription recombinase polymerase amplification using an exo probe with an internally
linked quencher (Exo-IQ). Clinical Chemistry, 66(8), 1047–1054.
Chen, J. L. (2020). Pathogenicity and transmissibility of 2019-nCoV-A quick overview and
comparison with other emerging viruses. Microbes and Infection, 22(2), 69–71.
Chen, L. J., Liu, W. Y., Zhang, Q., Xu, K., Ye, G. M., Wu, W. C., et al. (2020). RNA based
mNGS approach identifies a novel human coronavirus from two individual pneumonia
cases in 2019 Wuhan outbreak. Emerging Microbes & Infections, 9(1), 313–319.
Chen, J. S., Ma, E., Harrington, L. B., Da Costa, M., Tian, X., Palefsky, J. M., et al. (2018).
CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.
Science, 360(6387), 436–439.
Chu, D. K. W., Pan, Y., Cheng, S. M. S., Hui, K. P. Y., Krishnan, P., Liu, Y. Z., et al. (2020).
Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumo-
nia. Clinical Chemistry, 66(4), 549–555.
Compton, J. (1991). Nucleic-acid sequence-based amplification. Nature, 350(6313), 91–92.
Corman, V. M., Landt, O., Kaiser, M., Molenkamp, R., Meijer, A., Chu, D. K. W., et al. (2020).
Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveil-
lance, 25(3), 23–30.
Daher, R. K., Stewart, G., Boissinot, M., & Bergeron, M. G. (2016). Recombinase polymerase
amplification for diagnostic applications. Clinical Chemistry, 62(7), 947–958.
References 25
Dinnes, J., Deeks, J. J., Adriano, A., Berhane, S., Davenport, C., Dittrich, S., et al. (2020).
Rapid, point-of-care antigen and molecular-based tests for diagnosis of SARS-CoV-2 in-
fection. Cochrane Database of Systematic Reviews, 8, 1–129. https://doi.org/
10.1002/14651858.CD14013705.
Dohla, M., Boesecke, C., Schulte, B., Diegmann, C., Sib, E., Richter, E., et al. (2020). Rapid
point-of-care testing for SARS-CoV-2 in a community screening setting shows low sen-
sitivity. Public Health, 182, 170–172.
Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., et al.
(2017). Nucleic acid detection with CRISPR-Cas13a/C2c2. Science, 356(6336), 438–442.
James, A. S., & Alawneh, J. I. (2020). COVID-19 infection diagnosis: Potential impact of iso-
thermal amplification technology to reduce community transmission of SARS-CoV-2. Di-
agnostics, 10(6), 399.
Kashir, J., & Yaqinuddin, A. (2020). Loop mediated isothermal amplification (LAMP) assays
as a rapid diagnostic for COVID-19. Medical Hypotheses, 141, 109786.
Kilic, T., Weissleder, R., & Lee, H. (2020). Molecular and immunological diagnostic tests of
COVID-19: Current status and challenges. iScience, 23(8), 101406.
Li, J., Macdonald, J., & von Stetten, F. (2020). Review: A comprehensive summary of a de-
cade development of the recombinase polymerase amplification (vol 144, pg 31, 2019).
Analyst, 145(5), 1950–1960.
Londono, M. A., Harmon, C. L., & Polston, J. E. (2016). Evaluation of recombinase polymer-
ase amplification for detection of begomoviruses by plant diagnostic clinics. Virology
Journal, 13, 48.
Lutz, S., Weber, P., Focke, M., Faltin, B., Hoffmann, J., Muller, C., et al. (2010). Microfluidic
lab-on-a-foil for nucleic acid analysis based on isothermal recombinase polymerase am-
plification (RPA). Lab on a Chip, 10(7), 887–893.
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., et al.
(2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research,
28(12), E63.
Piepenburg, O., Williams, C. H., Stemple, D. L., & Armes, N. A. (2006). DNA detection using
recombination proteins. PLoS Biology, 4(7), 1115–1121.
Qian, J., Boswell, S. A., Chidley, C., Lu, Z. X., Pettit, M. E., Gaudio, B. L., et al. (2020). An
enhanced isothermal amplification assay for viral detection. Nature Communications,
11(1), 5920.
Qin, Z., Peng, R., Baravik, I. K., & Liu, X. Y. (2020). Perspective fighting COVID-19: Inte-
grated micro- and nanosystems for viral infection diagnostics. Matter, 3(3), 628–651.
Shen, F., Davydova, E. K., Du, W. B., Kreutz, J. E., Piepenburg, O., & Ismagilov, R. F. (2011).
Digital isothermal quantification of nucleic acids via simultaneous chemical initiation of
recombinase polymerase amplification reactions on SlipChip. Analytical Chemistry,
83(9), 3533–3540.
Shen, M. Z., Zhou, Y., Ye, J. W., Al-Maskri, A. A. A., Kang, Y., Zeng, S., et al. (2020). Recent
advances and perspectives of nucleic acid detection for coronavirus. Journal of Pharma-
ceutical Analysis, 10(2), 97–101.
Tang, M. S., Hock, K. G., Logsdon, N. M., Hayes, J. E., Gronowski, A. M., Anderson, N. W.,
et al. (2020). Clinical performance of two SARS-CoV-2 serologic assays. Clinical Chem-
istry, 66(8), 1055–1062.
Tu, F., Yang, X. T., Xu, S. K., Chen, D. J., Zhou, L., Ge, X. N., et al. (2020). Development of a
fluorescent probe-based real-time reverse transcription recombinase-aided amplification
assay for the rapid detection of classical swine fever virus. Transboundary and Emerging
Diseases. https://doi.org/10.1111/tbed.13849.
Udugama, B., Kadhiresan, P., Kozlowski, H. N., Malekjahani, A., Osborne, M., Li, V. Y. C.,
et al. (2020). Diagnosing COVID-19: The disease and tools for detection. ACS Nano,
14(4), 3822–3835.
Vincent, M., Xu, Y., & Kong, H. M. (2004). Helicase-dependent isothermal DNA amplifica-
tion. EMBO Reports, 5(8), 795–800.
Walker, G. T., Fraiser, M. S., Schram, J. L., Little, M. C., Nadeau, J. G., & Malinowski, D. P.
(1992). Strand displacement amplification—An isothermal, in vitro DNA amplification
technique. Nucleic Acids Research, 20(7), 1691–1696.
Wang, J., Cai, K., He, X., Shen, X., Wang, J., Liu, J., et al. (2020). Multiple-centre clinical
evaluation of an ultrafast single-tube assay for SARS-CoV-2 RNA. Clinical Microbiology
and Infection, 26(8), 1076–1081.
Wang, C., Horby, P. W., Hayden, F. G., & Gao, G. F. (2020). A novel coronavirus outbreak of
global health concern (vol 395, pg 470, 2020). Lancet, 395(10223), 496.
Wang, L., Qian, C., Wu, H., Qian, W. J., Wang, R., & Wu, J. (2018). Technical aspects of
nicking enzyme assisted amplification. Analyst, 143(6), 1444–1453.
WHO. (2020). Statement on the first meeting of the international health regulations
(2005) Emergency committee regarding the outbreak of novel coronavirus (2019-nCoV).
Online Post.
Wong, Y. P., Othman, S., Lau, Y. L., Radu, S., & Chee, H. Y. (2018). Loop-mediated isother-
mal amplification (LAMP): A versatile technique for detection of micro-organisms. Jour-
nal of Applied Microbiology, 124(3), 626–643.
Wu, T., Ge, Y. Y., Zhao, K. C., Zhu, X. J., Chen, Y., Wu, B., et al. (2020). A reverse-
transcription recombinase-aided amplification assay for the rapid detection of N gene
of severe acute respiratory syndrome coronavirus 2(SARS-CoV-2). Virology, 549, 1–4.
Xia, S., & Chen, X. (2020a). Ultrasensitive and whole-course encapsulated field detection of
2019-nCoV gene applying exponential amplification from RNA combined with chemical
probes. ChemRixv. https://doi.org/10.26434/chemrxiv.12012789.
Xia, S., & Chen, X. (2020b). Single-copy sensitive, field-deployable, and simultaneous dual-
gene detection of SARS-CoV-2 RNA via modified RT-RPA. Cell Discovery, 6(1), 37.
Xiong, D., Dai, W. J., Gong, J. J., Li, G. D., Liu, N. S., Wu, W., et al. (2020). Rapid detection of
SARS-CoV-2 with CRISPR-Cas12a. PLoS Biology, 18(12), e3000978.
Xue, G. H., Li, S. L., Zhang, W. W., Du, B., Cui, J. H., Yan, C., et al. (2020). Reverse-
transcription recombinase-aided amplification assay for rapid detection of the 2019 novel
coronavirus (SARS-CoV-2). Analytical Chemistry, 92(14), 9699–9705.
Zhao, Y. X., Chen, F., Li, Q., Wang, L. H., & Fan, C. H. (2015). Isothermal amplification of
nucleic acids. Chemical Reviews, 115(22), 12491–12545.
Zhao, S., Lin, Q. Y., Ran, J. J., Musa, S. S., Yang, G. P., Wang, W. M., et al. (2020). Prelim-
inary estimation of the basic reproduction number of novel coronavirus (2019-nCoV) in
China, from 2019 to 2020: A data-driven analysis in the early phase of the outbreak.
International Journal of Infectious Diseases, 92, 214–217.
Zheng, Y. Z., Chen, J. T., Li, J., Wu, X. J., Wen, J. Z., Liu, X. Z., et al. (2021). Reverse tran-
scription recombinase-aided amplification assay with lateral flow dipstick assay for rapid
detection of 2019 novel coronavirus. Frontiers in Cellular and Infection Microbiology, 11,
613304.
Another random document with
no related content on Scribd:
— In tal caso spero che ci rivedremo — egli replicò. — Venga da me
un dopopranzo.... Anche mia moglie la saluterà volentieri.... Si
conoscevano una volta.... quando viveva la sua povera mamma.
Gli promisi d’andare, ma non andrò. Sua moglie è una superba che
dopo le nostre disgrazie si degnò appena di guardarci; chi sa con
che aria di protezione mi accoglierebbe! Io credo che non rivedrò più
nemmeno il buon dottore.... Fu proprio un caso ch’io l’abbia
incontrato oggi.
È curioso! Anche senza lasciar la patria, ci son tante cose e tante
persone che a poco a poco si dileguano dai nostri occhi e dalla
nostra memoria. Eppure, persino di quelle indifferenti, persino di
quelle moleste è triste il dover dire: le vedo per l’ultima volta!
Il dottore Negrotti mi mise una pulce nell’orecchio con quella sua
domanda se Odoardo sia rimasto scapolo. In vero, chi mi assicura
che mio fratello non prenderà moglie più tardi? E allora che vita mi si
preparerebbe?
Domenica, 6 giugno.
Venticinquesimo anniversario della morte di Cavour, e festa dello
Statuto! Sarà l’ultima a cui avrò assistito. Dopo qualche tempo
passato laggiù fra i barbari mi ricorderò appena chi fosse Cavour e
che cosa significhi questa che chiamiamo a ragione la festa
nazionale. O belle bandiere, belle bandiere tricolori che ho viste oggi
sventolar sulle antenne di San Marco, non dovrò vedervi più mai!
Chi sa che anche il colonnello Struzzi, se fosse nei miei panni, in
procinto di abbandonar per sempre l’Italia, non proverebbe una
commozione uguale alla mia!
Stamane, mentre il cannone tuonava da San Giorgio, il colonnello
tuonava dalla sua camera. Era pieno di stizza per lo spreco di
polvere che si faceva da un capo all’altro della penisola, s’arrabbiava
con sè stesso che aveva potuto prender sul serio simili bambocciate,
e perfino dopo essere stato messo in pensione aveva continuato per
due o tre anni a vestire in questo giorno la sua uniforme e a
sfoggiare le sue medaglie. Ma oramai egli lasciava che lo stato
maggiore della territoriale si pompeggiasse nelle sue spalline e
facesse batter sui ponti le sciabole; non voleva aver da restituire il
saluto militare a quegli ufficialetti da burla venuti su come funghi dai
negozi della Merceria e dai caffè della Piazza.
La Gegia, la solita confidente del colonnello, uscì dalla camera
intontita: — Creda a me, signorina — ella mi disse — quell’uomo
finisce matto.
Non so s’egli finirà matto; è certo che impazzirebbe chi dovesse
viver sempre con lui. Ed è certo altresì che il possedere un carattere
allegro è la più grande fortuna che ci possa esser concessa.
Oggi è venuta a farmi visita la Gemma Norini, la mia antica
condiscepola che ora è maestra comunale e che, nonostante le
innumerevoli noie della sua professione, conserva l’umore festevole
che aveva quando sedevamo sullo stesso banco della scuola.
Aveva sentito la gran novità e si lagnava, non a torto, che non gliela
avessi comunicata io. Ella però non è donna da rancori: era sicura
che non sarei partita senza prender congedo da lei. Per bacco!
Andavo a Tiflis! Un bel coraggio. Ell’era subito ricorsa ai testi e
scommetteva di saperla molto più lunga di me sul paese ove stavo
per fissare il mio domicilio.
— Fa conto — diss’io — che ne so molto poco.
— Son qua per illuminarti — ella soggiunse. — A proposito, una
nipote della mia direttrice ha il colèra. L’hanno curata
coll’ipodermoclisi, e pare che del colèra guarisca, ma muore della
cura.... Torniamo a noi. Tu sei capacissima d’ignorare che vai nella
Transcaucasia o Russia asiatica occidentale?...
— So all’ingrosso che vado al Caucaso e che il paese appartiene
alla Russia.... Ma la vostra scuola è chiusa per questo caso di
colèra?
— No, no, la nipote della direttrice non abita mica con lei.... Siamo
incaricate di vigilare sulle bimbe, sulla regolarità della loro
digestione.... mi capisci.... Ma non distrarmi.... È questa situata
(s’intende la Transcaucasia) a mezzodì del Caucaso fra il Mar Nero
e il Caspio, e forma un’altra possessione della Russia meno estesa
della prima ma più favorita dalla natura....
— Non potei a meno di mettermi a ridere: — Hai imparato la
lezione.... E la prima? Qual’è la prima?
— Che prima?
— Oh bella! Quella prima possessione che dovrebb’essere più
estesa ma meno favorita dalla natura che la Transcaucasia?
— È giusto.... Non ci avevo pensato.... Ma niente paura.... Ho meco
il suggeritore.
La Gemma cacciò la mano in una saccoccia del vestito e ne
estrasse un volumetto, il Nuovo compendio di Geografia teorico-
pratica del Comba, edizione Paravia: lo aperse alla pagina 243, e
dopo averci dato un’occhiata, si picchiò la fronte dicendo: —
Stupida! Dovevo immaginarmelo: la prima regione è la Siberia... Ma
adesso tieni pur tu il libro e guarda un po’ se non sono sicura del
fatto mio.
— Pazzerella! — esclamai. — Conservi sempre la tua memoria?
— Sempre. Sta a sentire; ripiglio dove abbiamo smesso. Essa (cioè
questa seconda regione) fu accresciuta nell’ultima guerra delle tre
provincie di Kars, Ardahan e Batum, staccate....
— Tira via.... tira via.... Questo m’importa poco.
— Preferisci che ti parli del clima? Ecco: dolce e salubre in generale;
il suolo fertilissimo dà i prodotti dell’Europa centrale.
— Veniamo a Tiflis.
— Ti servo subito: Tiflis, con 61 mila abitanti nella Georgia, è la città
principale, assai importante per il commercio di transito per l’Europa
e la Persia. In questa città, centro di un attivo commercio, risiede il
governatore.... Va bene?
— Benone.
— Aggiungerò poi una notizia che ho trovata in un altro libro. La città
è posta sul Kur, con sorgenti termali solforose da cui prende il nome,
che significa città dalle acque calde..... Nientemeno.... Tutta questa
roba nella parolina Tiflis.... Ma che ti pare della mia erudizione?
— Sei un portento....
— La geografia è stata sempre il mio forte.... Invece quella povera
Martinetti.... Te ne ricordi?
— Sì. Ebbene?
— La incontrai ieri, e avendole annunziato che vai a Tiflis, disse
pronta: In America!
— Brava! E che cosa fa la Martinetti? Non voleva tentare il teatro?
— Sì, studiava il canto al Liceo Marcello, ma non avendolo imparato,
lo insegna.
— Sei un capo ameno!... Hai un certo modo di dir le cose.... Dunque
la Martinetti dà lezioni?
— Lezioni di canto, a cinquanta centesimi l’una.
La Gemma seguitò a chiacchierare su questo tuono, rievocando gli
anni della scuola, facendomi rivivere in mezzo alle antiche
compagne, non dimenticandone una, nemmeno quelle che io avevo
dimenticate da un pezzo, nemmeno quelle ch’erano morte, o
scomparse, perdute oramai nella folla....
— Ah! — dissi, quando la mia amica fu per accommiatarsi, — se
potessi condurti meco a Tiflis, come mi parrebbe meno amaro
l’esilio! Con te non ci son malinconie....
Ella replicò con la sua aria scherzevole: — Conducimi.... pur che tuo
fratello mi sposi.... Che stampo è?
— Te lo scriverò da Tiflis.
— Eh, no — rispose la Gemma, quasi parlando a sè stessa. — Tuo
fratello non mi sposa.... È in mezzo alle Georgiane che passano per
esser tra le più belle donne del mondo.... Me non mi sposa
nessuno.... Sono uno stecco.
— Quest’è vero, ma non è una buona ragione. Non si sposano mica
solamente le donne grasse.
— Basta — concluso quello spiritello della Norini — resterò zitella....
Santa Gemma, vergine e martire.... per forza.... Ma già neanche
maritarsi come la Lucia Mazzuola per stentare il pane e far due figli
all’anno....
— Ih, che spropositi dici!... Due figli all’anno....
— Press’a poco.... Andrai a vederla....
— Senza dubbio.... Eravamo inseparabili.... Adesso si abita ai due
capi estremi di Venezia.... Prima di partire però....
— La troverai in mezzo a uno sciame di bimbi.... Oh, addio addio....
e arrivederci, s’intende....
— Sì, arrivederci.
Io dico arrivederci a tutti. E bisognerà pure che uno di questi giorni
cominci il mio giro di visite di congedo.... Non ho tempo da perdere.
· · · · · · · · · · · · · · · ·
La passeggiata di beneficenza iniziata dalla Società del Bucintoro fu

oggi una distrazione in mezzo alle tristezze dell’epidemia. I soci,
giovani tutti, erano divisi in squadre, e annunziati da squilli di tromba
percorrevano, tra un aquazzone e l’altro (poichè il tempo era
piovoso), i vari sestieri della città. Li percorrevano per terra e per
acqua nei loro agili battelli che paiono fatti apposta per insinuarsi nei
meandri de’ nostri rii. Allo squillo delle trombe la gente s’affacciava
alle finestre, usciva sulla strada, e chi dava del danaro e chi qualche
oggetto di biancheria e di vestiario; anche dalle abitazioni più povere
i bimbi e le donne portavano il loro soldo. Curiosa popolazione!
Altrettanto pronta a donare quanto a stender la mano!
Allorchè i questuanti passarono da noi, il colonnello Struzzi non era
in casa. Non era nemmeno in paese; era a Padova per non tornare
che alla sera con l’ultima corsa, a pagliacciata finita, come egli disse
alla Gegia.
Lunedì sera. 7 giugno.

Mi pare che la signora Celeste avrebbe dovuto avvisarmene. De’
suoi tre inquilini io son la sola ch’ella tiene ordinariamente a dozzina,
ma oggi c’era a desinare con noi anche il professore Verdani, e
sembra che ci sarà per tutto il tempo che dura il colèra.
La signora Celeste, che ha una tenerezza particolare pel giovine
matematico, non capiva in sè dalla gioia. — Ce n’è voluto — ella
diceva scodellando la minestra; — ce n’è voluto a persuadere il
nostro professore a cambiar per qualche settimana i suoi pranzi di
trattoria con un po’ di cucina casalinga.... E scommetto che non se
ne sarebbe fatto nulla senza le inquietudini della sua mamma.... Per
me, lo confesso, oltre che l’onore, è una grande soddisfazione....
Quell’altro di là.... — e la signora Celeste alludeva al colonnello —
quell’altro di là se vuol crepare che crepi.... Anzi, non lo vorrei alla
mia tavola per tutto l’oro del mondo.... Un accattabrighe, un
basilisco....; ma il nostro professore è una perla e lo considero uno di
famiglia....
— Grazie, signora Celeste, grazie — biascicava il professore
sforzandosi invano di porre una diga a quel torrente di parole.
La signora Celeste si appellava a me, si appellava a una sua nipote
ch’è spesso sua commensale e ch’era stata invitata da lei anche
oggi. Noi potevamo testimoniare s’ella aspettava che il professore
fosse presente per discorrere di lui in questi termini.
Io che non amo queste interpellanze a bruciapelo me la son cavata
con qualche monosillabo, ma la Giulia Sereni (ch’è la nipote) spiegò
una parlantina maravigliosa tanto per confermar le cose dette dalla
zia quanto per aggiungerne altre di suo.... Anch’ella aveva una
grande ammirazione pel professore, una così brava persona e così
modesta... Una persona di cui non si sentiva dir che del bene da
tutti.
Evidentemente Verdani era sulle spine, e pare che la signora
Celeste se ne sia accorta, perchè fece segno alla Giulia di smettere.
Allora la ragazza chinò in atto verecondo gli occhi sulla zuppiera e si
risolvette a mangiar la minestra.
La Giulia Sereni, ch’è direttrice d’un giardinetto froebeliano, deve
aver circa la mia età, piuttosto meno che più, e non è mica brutta,
tutt’altro; anche di modi, quando la si trova a tu per tu, è simpatica;
ma se c’è gente ha il vizio di voler far la ruota come il pavone. Sarà
forse un vizio comune. Noi usiamo montar sui trampoli per parere
più alti.
Secondo me, la Sereni sbaglia strada, ma non c’è dubbio ch’ella
aspira a far colpo sopra ogni nuova persona che le accade
incontrare. Studia i movimenti, le parole, i sorrisi, e non si lascia
sfuggire nessuna opportunità di mettere in mostra il suo mediocre
corredo di cognizioni. Oggi ha ripetuto a sazietà che non c’è al
mondo un gusto maggiore di quello d’istruirsi, e ha soggiunto,
guarda che combinazione! che a lei sarebbero piaciute
immensamente le matematiche.... se il coltivarlo non fosse stato
superiore alle forze di una donna.... Ma quei risultati positivi, quella
certezza assoluta....
Il professore che fino a quel momento aveva taciuto gettò dell’acqua
fredda su questa fiamma d’entusiasmo. — Eh, cara signorina, i
recenti progressi della scienza non ci permettono più nemmeno di
esser sicuri che due e due fanno quattro.
Non so se Verdani volesse scoccare un epigramma alla sua
interlocutrice o alla scienza; so che la Giulia ne rimase un po’
sconcertata e che la signora Celeste colse il destro per tirare il
discorso sopra un tema più alla portata della propria intelligenza. E
deplorò la stramba idea che m’era venuta di andar tra i selvaggi, in
un paese di cui ella non riusciva mai a rammentare il nome.
— Tiflis. Tiflis — saltò su la Sereni, beata di alludere per incidenza
alla Colchide, al Vello d’oro, agli Argonauti, a Giasone e a Medea e
di fare altre citazioni erudite per uso del professore che parve
divertirsene mediocremente. Allora la nipote della mia padrona di
casa lasciò la mitologia per la didattica e domandò l’opinione di
Verdani sul metodo Froebel.... Ma Verdani confessò che il metodo
Froebel lo conosceva appena di nome.
Se, come io mi son fitta in capo, la Sereni, d’accordo con la zia,
considera il professore quale un marito possibile e s’adopera per
conquistarlo, bisogna convenire che le prime avvisaglie non furono
fortunate. Vedremo in seguito.... Che la Giulia sia una donna
adattata pel professore, questo no e poi no. Del resto, a me la cosa
non deve importare nè punto, nè poco; anzi se la Sereni riesce a
sposarsi ne sarò contentissima per lei.... Ne ha tanta voglia!
Mercoledì, 9 giugno.
Oggi sono passata a informarmi d’una vecchia amica di mia madre,
la signora Della Riva, ch’è malatissima. Mi ricevette la figliuola,
l’Augusta, un’altra delle mie condiscepole. Povera Augusta! Son
quindici notti che non va a letto, son quindici notti che lascia appena
per pochi minuti la camera di sua madre. E non c’è speranza, pur
troppo, non si tratta che di prolungare la vita per alcuni giorni, forse
per alcune ore. Nel dirmi così, l’Augusta appoggiò la testa sulla mia
spalla, e mi ricordò il tempo in cui le nostre due mamme, sane e
robuste tutt’e due, ci conducevano insieme ai Giardini. Anche la mia
amica resterà molto sola; non ha che un fratello il quale viaggia
spessissimo per affari. È vero ch’ella crebbe al fianco di questo
fratello, è vero ch’ella lo conosce a fondo, è vero ch’ella non lascia il
proprio paese.... Il suo caso è ben diverso dal mio. All’annunzio della
mia prossima partenza pel Caucaso, ella non potè trattenere
un’esclamazione dolorosa. — Fin laggiù te ne vai! — Tu non ci
anderesti? — io chiesi. Ella rispose con enfasi: — Con un uomo a
cui volessi bene, andrei fra gli Ottentotti, ma se no.... — S’interruppe,
e temendo di essere stata troppo brusca, troppo recisa, soggiunse:
— A ogni modo, chi sa? Bisogna trovarsi nelle circostanze.... Ci
rivedremo, non è vero?
— Sì, sì.
Mi mossi di là con un’impressione singolare nell’animo. Se v’è una
figliuola buona, affettuosa, sollecita è certo l’Augusta; se v’è dolore
sincero è il suo.... Eppure, o io m’inganno, o l’acerbità di questo
dolore è temperata in lei da qualche gioia, da qualche speranza
segreta; persino il suo viso pallido e smunto mi apparve oggi
trasfigurato.... In collegio, rubiconda e fiorente, era proprio bruttina,
più brutta di me che non sono una Venere; oggi, a’ miei occhi
almeno, era bella, e giurerei che sarebbe tale anche agli occhi degli
uomini.... Dicono che l’amore soltanto opera di questi prodigi; ch’ella
ami, che sia amata?
A casa m’aspettava una gradita sorpresa. La Gegia mi consegnò un
libro francese lasciatole per me dal professore Verdani. S’intitola: Le
Caucase et la Perse, e ha un segno al principio del capitolo che
tratta di Tiflis — Ne ho già scorso alcune pagine.... La descrizione
che vi si fa del mio futuro soggiorno è meno sconfortante ch’io non
credessi; tuttavia quanto stenterò ad avvezzarmici, quante volte fra
quei Georgiani, quegli Armeni, quei Persiani e quegli Europei
semibarbari correrò col pensiero al mio popolo arguto e gentile, al
molle e melodioso dialetto delle mie lagune!
L’attenzione usatami dal professore mi fece molto piacere e ne lo
ringraziai vivamente a ora di pranzo. — Non vale la spesa di
ringraziarmi per così poco — egli disse: — se il libro non
appartenesse alla biblioteca della Scuola, la pregherei di portarselo
seco: però è libera di tenerselo fino al giorno della sua partenza.
Sarà una pura combinazione, ma è un fatto che, senza la Sereni, ce
la passammo più allegramente. Il professore aveva dimesso ogni
sussiego, e discorreva di tutto con la facilità e col garbo d’un uomo
altrettanto ricco d’istruzione quanto scevro di pedanteria. Capisco
che la sua timidezza è più apparente che reale; è la timidezza d’un
uomo non avvezzo a perdere il suo tempo nei salotti eleganti, nè a
sciupare il suo ingegno nelle giostre di spirito. Dev’essere un
insegnante modello; ha la parola chiara, sobria, precisa, di quelle
che scolpiscono l’idea....
Verso di me egli fu cortesissimo anche oggi, e nell’ipotesi assai
verosimile ch’io vada a imbarcarmi a Trieste per evitare le
quarantene, mi offerse una lettera per un parente di sua madre che
abita in quella città e potrebbe venirmi a prendere alla stazione e
accompagnarmi fino a bordo del vapore del Lloyd, e raccomandarmi
in particolare al capitano.
— Bah! — disse la signora Celeste, — io spero che la nostra Elena
resti con noi.
— O come? — esclamai.
— Giurerei che suo fratello ha mutato idea.... Vede che non le scrive
ancora.
— Cioè la lettera non può essere ancora arrivata — io soggiunsi. —
Se mutasse idea sarei in un bell’impiccio.... Dopo aver preso una
risoluzione di questa natura, il meglio è di poterla mandar presto ad
effetto.
— Ha quasi furia di piantarci.... Eppure si persuada che il suo è stato
un colpo di testa.... Una ragazza de’ suoi meriti avrebbe trovato non
uno ma mille modi di vivere onoratamente a Venezia.... Adesso, si
capisce, col colèra tutto è difficile.... ma non ha mica da durar molto
questa maledizione.
Io ero troppo commossa da replicar nulla. Davanti alla gente faccio
la disinvolta, dico che vorrei esser fuori di questo pensiero, giunta
ormai alla mia destinazione; ma poi dentro di me provo un affanno,
uno struggimento!...
Il professore fece un’osservazione giusta. Egli dichiarò che, secondo
lui, con un po’ di buon volere si può trovarsi tollerabilmente
dappertutto, giacchè noi portiamo in noi stessi il segreto della nostra
felicità o infelicità.
— Dunque — domandò la signora Celeste — lei approva il partito
preso dalla signorina?
— Non ho il diritto di approvarlo nè di disapprovarlo — rispose
Verdani; — le auguro e spero ch’ell’abbia sempre a lodarsene.
Era un’idea cortese, cortesemente espressa. Ma noi siamo
incontentabili. Avrei preferito che il professore mi biasimasse....
Perchè?... Non lo so neanch’io.
Giovedì, 10 giugno.
Grande scompiglio nelle vicinanze. C’è un caso di colèra in una calle
che sbocca nella nostra. Una donna, moglie d’un gondoliere, fu colta
iersera dai primi sintomi della malattia e oggi è in fin di vita. Non
volle lasciarsi trasportare all’ospedale; quindi la posero sotto
sequestro, isolata dal rimanente della famiglia. Il marito viene ogni
tanto dal suo traghetto a prender notizie, e forse por ingannare il
dolore è sempre ubbriaco, e urla contro il municipio, contro i signori
e contro i medici; i figliuoli son dispersi per la strada, confusi con altri
monelli della parrocchia. Noi sentiamo dalla finestra i commenti
romorosi delle donnicciuole. Come il solito, l’inferma s’è procurata lei
stessa il suo male. Ha mangiato questo, ha mangiato quello; un
piatto d’insalata verde secondo siora Beta e una granseola secondo
siora Barbara; ha camminato per la casa a piedi scalzi, ha bevuto sei
bicchieri d’acqua di fila. Dopo di lei la colpa ce l’ha il dottore ch’è
venuto tardi, che non le ha permesso di prendere il sal di canale
ch’era la sua medicina ordinaria, indicatissima pei disturbi di visceri,
che l’ha costretta a bevere alcune goccie di quel liquore denso,
nerastro che chiamano laudano, che finalmente l’ha spaventata con
quella maledetta denuncia e col sequestro.
La signora Celeste la quale finora non aveva mostrato d’esser
paurosa, oggi è in un’agitazione estrema, un’agitazione che le fece
persino andar di traverso la parrucca. Una scena comica nella sua
violenza successe fra lei e il colonnello attraverso il buco della
chiave. Ella pretendeva disinfettargli la camera e tenendo in mano
una vaschetta d’acido fenico diluito nell’acqua picchiò due volte
all’uscio del suo amabilissimo ospite.
— Chi è? — ruggì l’orso dal di dentro.
— Sono io.... Mi permette d’entrare?
— Entrare?... Perchè?... Che cosa vuole?...
— Ma.... Glielo dirò meglio se apre....
— Non apro.... Dica prima....
— Ecco.... vorrei.... spargere un po’ d’acido feni....
Il colonnello non le lasciò terminar la parola.
— Via subito.... Ah vorrebbe appestarmi la camera.... Non ha già
appestato abbastanza la casa?
— Sia ragionevole, signor colonnello — insisteva la signora Celeste.
— Lo sa che abbiamo il colèra a due passi?
— Che colèra?... Non c’è colèra.... E se c’è, tanto meglio....
— Signor colonnello.... Faccia il piacere.
E la signora Celeste tentò girare la gruccia dell’uscio.
Ma il colonnello si precipitò alla difesa, tuonando come tutta una
batteria di cannoni: — Vada via, e presto, o vengo fuori io col
revolver....
— Madonna Santa, aiuto! — gridò la signora Celeste sbigottita. — E
corse a rifugiarsi nella mia stanza, tacciando cader la vaschetta
dell’acido fenico che si sparse pel corridoio e avrà certo distrutto una
quantità immensa di microbi.
· · · · · · · · · · · · · · · ·
Quest’episodio, illustrato dalla signora Celeste con gran lusso di

gesti e suoni imitativi, fece le spese del pranzo, e tenne di buon
umore anche il professore Verdani. Però a due riprese la nostra
padrona di casa trovò che si scherzava troppo sul pericolo ch’ella
aveva corso. E il pericolo durava sempre, poichè, il colonnello era
suo inquilino, e un giorno o l’altro poteva saltargli il ghiribizzo di
compier davvero un eccidio.... D’altra parte ella non osava
licenziarlo.... Era un uomo capace di non voler andarsene con le
buone, e allora? Ah chi le aveva messo in casa il colonnello Struzzi
le aveva fatto un bel servizio!... È vero che pagava puntualmente e
pagava bene.... ma tant’era dar alloggio a Satanasso in persona!
Foss’effetto dell’emozione della giornata o d’altro, subito dopo
desinare la signora Celeste principiò a piegar la testa sul petto e a
chiudere gli occhi, e non tardò ad addormentarsi profondamente
sulla seggiola. Ell’era in questo stato quando la Gegia entrò con la
macchina da caffè.
— È peccato svegliarla — diss’io a bassa voce. — Il caffè lo farò io
stessa. Chi sa che intanto non si desti da sè.... Si fida della mia
abilità? — chiesi al professore.
— Per bacco! — egli rispose celiando; — vuole che non mi fidi?
— Già, lei non se ne intende, — soggiunsi nel medesimo tuono. —
Uno scienziato...!
— Crede proprio che gli scienziati non sappiano che le cose inutili?
— egli replicò. — S’inganna a partito... A fare il caffè con la
macchina ho una speciale attitudine.
— Davvero.... Quasi quasi le cederei il posto.... Ma no, non mi fido
io.... Invece, m’aiuti.... Scusi, dia qua i fiammiferi.
Ripensandoci su, stento a capacitarmi d’aver trattato con questa
familiarità un uomo grave e studioso, un uomo col quale pochi giorni
addietro non scambiavo che un freddo saluto; è certo però ch’egli
non mostrava di trovar nulla di strano ne’ miei modi, e mi discorreva
alla sua volta come si discorre a un vecchio camerata. La confidenza
somiglia a un fiore di campo che sboccia da sè, inavvertito, senza
cure di giardiniere.
Il professore mi parlò delle sue faccende domestiche; della sua
infanzia travagliata, del padre mortogli quand’era ancora bambino, e
della sua mamma rimasta con una magra pensione la quale doveva
bastare a lei e a due figliuoli. Uno di questi, il maggiore, le recò pochi
fastidi e cominciò a guadagnarsi il pane a dodici anni, ma il più
piccolo (ed era lui quello) avea la passione degli studi, e la fece
spendere e tribolare. Ma dalle labbra dell’angelica donna non uscì
mai una lagnanza; tutte le privazioni le parevano lievi per secondare
i ghiribizzi del suo dottore in erba.... Negarsi da sè le cose più
necessarie, vendere gli oggetti più cari.... oh in verità, anche questi
fanatici della scienza sono grandi egoisti!
— Però quando riescono — io dissi — sono egoisti che compensano
largamente i sacrifizi che hanno costato.
Verdani tentennò la testa. — Non creda.... Restano egoisti.... O se
fanno anch’essi dei sacrifizi non li fanno già per quelli che s’eran
sacrificati per loro; li fanno per la scienza, la sirena che li affascina....
E poi chi può dire d’esser riuscito?... Ah badi, badi, signorina,
spenga.
Il caffè, bollendo e gorgogliando era già salito fino all’orlo del
recipiente di cristallo: il lucignolo che avrebbe dovuto spegnersi da
sè ardeva ancora, e io non me n’ero accorta. Prima ch’io potessi
riparare alla mia dimenticanza, il tappo, spinto dalla forza del vapore,
fu slanciato in aria e una parte del caffè si rovesciò sulla tavola. Non
so come nessuno abbia riportato delle scottature. Ma la piccola
esplosione svegliò in sussulto la signora Celeste che gridò
esterrefatta; — Misericordia! Il colonnello!
Quand’ella ebbe visto di che si trattava non tardò a ricomporsi ed
esclamò in aria di persona liberata da un incubo: — Ah! non era che
la macchina.... Dunque non si prende più il caffè per questa sera?
— Ce ne sarà rimasto abbastanza da riempire una tazza — risposi,
guardando mortificata i segni del recente disastro; — una tazza da
dividersi fra lei e il professore.... Io non merito nulla.
— Neppur io — protestò Verdani. — Son io che con le mie
chiacchiere ho distratto la signorina Elena.
Ma la signora Celeste dichiarò che la maggior colpevole era lei. —
Non dovevo prender sonno.... Un giovine e una giovine quando sono
a tu per tu hanno da far di meglio che badare a una macchina da
caffè.
Questo scherzo di cattivo genere mise in impiccio il professore e me
e ci guastò la serata. Il dialogo si trascinò stentatamente per una
mezz’ora; poi ognuno se ne andò dalla sua parte.
Venerdì, 11.
Giornata triste. Non chiusi occhio in tutta la notte. Avevo caldo,
avevo freddo, avevo i nervi eccitati al massimo grado. Le parole
insignificanti della signora Celeste mi suonavano sempre
all’orecchio, come un avvertimento che la mia intimità col professore
doveva finire appena nata. È destino; nessuno crederà mai ad
un’amicizia semplice, schietta, franca tra un uomo e una donna.
Come saluto mattutino la Gegia, entrando in camera, mi disse: — La
colerosa qui vicina, è morta.
Me lo aspettavo; eppure mi fece un certo senso....
Più tardi sentii una gran scampanellata e la voce del postino che
gridava dalla strada: — Elena Givalda! — il mio nome!
Mi si rimescolò il sangue. Era senza dubbio la lettera di Odoardo.
No, non era quella.... Era un foglio listato di nero, una partecipazione
funebre, con l’indirizzo mio in una calligrafia che non m’era nuova.
La signora Emilia Dalla Riva morì ieri a mezzogiorno. Avevo visto
l’Augusta mercoledì e sapevo che una catastrofe era inevitabile, ma
non la credevo imminente. I funerali si faranno domattina alle 9
antimeridiane, in chiesa San Salvatore. Ci andrò.
È ricomparsa a pranzo la Giulia Sereni e l’avremo per commensale
fintantochè non sarà tornata sua madre che si recò a Verona a
visitare una figliuola da parto. La Giulia ha ricominciato a far la
smorfiosa e la saccente col professore. Pare uno scolaretto vicino al
maestro, ma uno scolaretto che ci tiene a farsi valere come il primo
della classe. Verdani s’annoia, è chiaro che s’annoia: tuttavia, non
volendo essere assolutamente sgarbato, bisogna bene ch’egli si
occupi un poco di chi si occupa tanto di lui.
Questa benedetta lettera d’Odoardo viene o non viene?... Quanto
pagherei d’essere già partita!
Sabato notte.
Ero così stanca, così turbata, che mi son messa a letto alle nove,
rinunziando per oggi ad aprir questo libro. Ma dopo inutili sforzi per
pigliar sonno dovetti alzarmi di nuovo, e mentre a San Marco suona
la campana di mezzanotte, io son qui al tavolino, assorta in questa
cura giornaliera, che è divenuta quasi una necessità del mio spirito;
tanto può l’abitudine!
La lettera d’Odoardo.... Ma procediamo con ordine.
Prima delle nove ero in chiesa San Salvatore per assistere ai
funerali della signora Dalla Riva. Vi assistetti incognito, come si dice
dei principi, seduta in disparte, col viso coperto da un fitto velo,
impassibile in apparenza, ma forse più commossa delle dieci o
dodici signore che, in lutto profondo, sfoggiavano il loro dolore
ufficiale nei posti riservati ai parenti e agli amici. La cerimonia,
semplicissima, durò poco, e alle dieci e un quarto ero già a casa.
La signora Celeste mi venne incontro con una lettera in mano.
— È per me? — chiesi, appoggiandomi alla ringhiera del
pianerottolo.
— Per lei.... Una lettera con tanti bolli.
— Dia qui, signora Celeste, dia qui — ripigliai ansiosa.
— Temo che sia quella ch’ella aspettava — soggiunse la mia
padrona di casa.... — Almeno suo fratello le scrivesse per mandar in
fumo quello sciagurato viaggio!
Non le badai, ma corsi a chiudermi nella mia camera con la lettera,
di cui avevo riconosciuto il carattere.
Poche righe, in stile commerciale. Lieto della mia risoluzione, mio
fratello mi consigliava d’imbarcarmi a Trieste sul vapore del Lloyd
l’ultimo o il penultimo venerdì di questo mese. Imbarcandomi a
Venezia avrei dovuto scontare la contumacia; ritardando troppo si
correva il rischio che il governo turco mettesse le quarantene anche
per le provenienze da Trieste. A ogni modo telegrafassi al momento
dell’imbarco, dirigendo il dispaccio a Costantinopoli presso il
Consolato italiano. Inchiuso nella lettera c’era un chèque di mille
franchi su un banchiere di qui, a vista.
La mia paura che Odoardo non mi rimettesse che la somma
strettamente necessaria pel viaggio era, come si vede, affatto
infondata. Cinquecento lire mi bastano ad esuberanza per andar fino
a Costantinopoli; le altre cinquecento potrò spenderle qui nel modo
che stimerò più opportuno. Non ho mai avuto tanti quattrini
disponibili.
Quanto pagherei d’esser già partita! — io scrivevo l’altro ieri su
queste pagine.... Sì, sì, desidererei d’esser partita, d’essere arrivata
a Costantinopoli, a Tiflis, in capo al mondo.... Sono, in complesso,
d’un umore adattabile, finirò col rassegnarmi al mio nuovo soggiorno
e al mio nuovo stato.... Ma questo periodo d’attesa m’è intollerabile.
Eppure non potrò imbarcarmi che il 25. Ho ancora troppe cose da
sbrigare, ho troppe persone da vedere perchè mi sia dato essere a
Trieste per venerdì prossimo.
La signora Celeste, piena di curiosità, picchiò all’uscio con un
pretesto qualunque.
Io mi ricomposi in fretta, e senz’aspettare le sue interrogazioni dissi:
— Cara signora Celeste, dunque ci lasceremo prima del 25.
Ella rimase sbalordita. — Ma siamo già al 12.
— Eh, come si fa?
Proprio la signora Celeste non sapeva darsene pace. Ero in casa
sua da poco tempo, ma le pareva di conoscermi da dieci anni
almeno, e aveva preso a volermi bene come a una figliuola.... La mia
mancanza le avrebbe lasciato un vuoto, un vuoto!... Pazienza se
avesse potuto esser tranquilla sul mio avvenire, se mi avesse vista
appoggiata a qualcheduno del cui affetto per me non fosse lecito
dubitare; ma questo fratello, che per anni e anni non s’era neanche
rammentato ch’io esistessi, le inspirava una ben scarsa fiducia....
Era un gran salto nel buio quello ch’io facevo.
— È inutile, signora Celeste — io risposi. — Sono in mano della
Provvidenza. Ormai bisogna ch’io segua il mio destino.
Ella soggiunse qualche parola sulla mia ostinazione, e se ne andò a
malincuore.
— Coraggio — diss’io fra me. — Coraggio!
E cercai di raccogliere i miei pensieri, di fare un po’ di programma
pei dieci o dodici giorni che avevo ancora da restare a Venezia, di
stabilire a quali tra lo mie amiche dovevo lasciare un ricordo, quali
tra i libri della mia piccola biblioteca dovevo portar meco, quali
oggetti indispensabili dovevo comperare prima di mettermi in
viaggio. Ma le idee più semplici mi s’ingarbugliavano nella testa, e
giravo su e giù per la stanza a guisa di smemorata, aprendo ora un
cassetto ora l’altro del mio armadio e domandandomi perchè lo
avessi aperto, accingendomi a scrivere un nome, a fare
un’annotazione, e rimanendo lì col lapis tra le dita senza poter
richiamare alla mente il nome che volevo scrivere e l’annotazione
che volevo fare.
Dopo qualche ora passata così mi risolvetti a uscir di casa e a
recarmi dall’Angusta Dalla Riva.
— Grazie d’esser venuta — ella mi disse gettandomi le braccia al
collo. Poi mi prese per mano e mi fece sedere su un canapè,
accanto a lei.... Dopo i primi baci, dopo le prime parole che si
scambiano in queste occasioni, ci fu, come accade sovente, un
breve silenzio. Ella teneva gli occhi bassi; io la guardavo, e
l’impressione provata nella mia ultima visita si rinnovava più vivace,
più intensa. Non era possibile ch’io m’ingannassi per la seconda
volta; in quel suo viso pallido che serbava le traccie delle veglie
affannose, in quel suo viso atteggiato a un dolore sincero balenava
ogni tanto come un raggio di luce, come la manifestazione timida,
inconscia d’una gioia che si vergognava ancora di sè, ma che,
invano rattenuta, saliva saliva dal fondo del cuore a raddolcire le
lacrime, a frenare i singhiozzi.
— C’eri stamattina in chiesa? — mi domandò l’Augusta con qualche
peritanza.
— Sì che c’ero.... Non ero però nei posti riservati.
— Dunque non hai visto nessuno? Nessuno ti ha parlato di me?
— Nessuno.
— Meglio così — ella soggiunse. — Meglio che tu sappia tutto dalla
mia bocca.... E prima di giudicarmi, aspetta....
— Giudicarti? Ma tu, tu che sei tanto buona, avresti una colpa sulla
coscienza?
— Non lo so.... So che ho perduta ier l’altro la mia mamma, la
migliore delle madri, so che non dovrei pensare che a questo, che
non dovrei veder sulla terra un raggio di luce.... e che invece..... oh
mi pare un’enormità....
— Invece tu ami qualcheduno? — interruppi, chinandomi verso di lei
con simpatia.
— Come hai capito?
Io sorrisi. — Eh, non ci vuol mica molto.... Ed è questo il tuo gran
delitto?
— No, forse l’amar qualcheduno non è un delitto, nemmeno in un
momento simile; gli è che da tre giorni soltanto ho la certezza
d’essere amata, e questa certezza mi rende felice.... Ecco la
profanazione.... Felice, con la mia mamma appena sepolta.... Però
— soggiunse l’Augusta, impaziente d’attenuare il proprio fallo —
però la mamma prima di morire fu messa a parte di tutto, e l’idea di
affidarmi ad un uomo onesto.... un uomo a cui non avrei creduto mai
di poter aspirare.... consolò la sua agonia.
La storia m’interessava davvero, e sollecitai l’Augusta a raccontarmi
tutto.
Come render l’accento caloroso, appassionato, sincero che mi fece
apparir così efficace, così eloquente la narrazione della mia amica?
Ella disse a un dipresso così: — Sono alla vigilia di sposare il dottor
Val Sabbia, il bravo medico che a trentacinqu’anni è già primario
dell’Ospitale e possiede una delle migliori clientele della città. Val
Sabbia era stato sopracchiamato da Ranioli, il nostro vecchio
dottore, ed essendosi Ranioli infermato subito dopo il consulto,
cedette alle nostre preghiere e rimase lui stesso alla cura.... Non si
può avere un’idea di ciò ch’egli ha fatto per la mamma. Senza
dubbio ella lo aveva ammaliato co’ suoi modi soavi, con la sua
rassegnazione angelica. Veniva di giorno, veniva di sera, veniva
spontaneamente anche nel cuor della notte. A me diceva qualche
volta che la mia mamma gli ricordava la sua mamma e che io gli
ricordavo una sorella, maritata adesso a Firenze e nata per far la
suora di carità.... Dio mio! Io non facevo più di quello che ogni
figliuola avrebbe fatto al mio posto.... Mio fratello, che aveva la
famiglia sulle spalle e non poteva trascurar gli affari, era ogni
momento fuori di casa, fuori di città; così ci trovavamo spesso soli, il
dottore ed io, soli accanto al letto dell’inferma, soli nell’aspettazione
d’una crisi, soli durante un periodo di quiete ingannevole, desolati
tutti e due, egli dell’impotenza della sua dottrina, io dell’impotenza
del mio affetto... Erano lunghi, lunghi silenzi.... Di tratto in tratto i
nostri occhi s’incontravano e io sentivo un fuoco corrermi per le
vene.... Non osavo chiedere a me stessa se l’amavo; ma stavo così

Ebook Covid 19 Biomedical Perspectives Volume 50 1St Edition Charles S Pavia Editor Online PDF All Chapter

Uploaded by

Copyright:

Available Formats

You might also like

Ebook Covid 19 Biomedical Perspectives Volume 50 1St Edition Charles S Pavia Editor Online PDF All Chapter

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ebook Covid 19 Biomedical Perspectives Volume 50 1St Edition Charles S Pavia Editor Online PDF All Chapter

Uploaded by

Copyright:

Available Formats

Covid-19: Biomedical Perspectives

(Volume 50) 1st Edition Charles S.

29 Single and Nigerian INCOMPLETE First Edition

Journal 29 Revelation Interactive Book Game Dimitris

COVID-19 in International Media: Global Pandemic

Dirty Little Secret (Forbidden Fantasies #29) 1st

Smolder Anita Blake Vampire Hunter 29 Laurell K

Economic Recovery After COVID-19

Fortschritte der Physik Progress of Physics Band 29

Fortschritte der Physik Progress of Physics Band 29

First edition 2022

Copyright © 2022 Elsevier Ltd. All rights reserved.

For information on all Academic Press publications

Publisher: Zoe Kruze

CHAPTER 1 Sensitive methods for detection

CHAPTER 2 The seasonal behaviour of COVID-19 and its

3. COVID-19 diagnostics ................................................................... 91

CHAPTER 4 CRISPR use in diagnosis and therapy for COVID-19...123

CHAPTER 5 Recent and advanced nano-technological

4. Vaccine development strategies and platforms ............................ 155

CHAPTER 6 A review of hypersensitivity methods to detect

4.2 Understanding the adaptive immune response in covid19

CHAPTER 7 Hesitancy to get vaccinated against COVID-19

CHAPTER 8 The emergence of SARS-CoV-2 variants of concern

6. Continental links to seasonality.................................................... 254

CHAPTER 9 COVID-19 vaccines for high risk and

Ezinwanne Nneoma Ezeibe

John Dike Nwabueze Ogbonna

2 General approaches for the detection of SARS-CoV-2

3 Isothermal amplification methods for sensitive detection of

amplification; however, specifically designed heating devices are still needed. In

4 Sensitive detection of SARS-CoV-2 via RT-RPA

Table 1 List of concentrations of primers, probes, nucleases, inhibitors and

Exo-probe Fw & Rw 500 nM 420 nM, can be varied in the

5 General considerations for designing an ultrasensitive

5.1 Primer design

5.2 Probe design

5.3 Reaction temperature

6 Comparative reviews of recently published RT-RPA assays

8 Before you begin

9 Key resources table

Reagent or resource Source Identifier

Bacterial and virus strains

10 Materials and equipment

11 Step-by-step method details

murine RNase inhibitor, 1 μL of RNA sample, 20 μL of DI-H2O, and 0.5 μL of

11.2 Detection of SARS-CoV-2 N- or S-gene using nfo probes

11.3 Optional steps

11.4 Simultaneous dual N- and S-gene detection using paired exo

La passeggiata di beneficenza iniziata dalla Società del Bucintoro fu

Lunedì sera. 7 giugno.

Quest’episodio, illustrato dalla signora Celeste con gran lusso di

You might also like