1 An atypical case of Babesia bigemina parasitising a dog from a rural area of eastern

2 Mexico

4 José L. Bravo-Ramos*a, Sokani Sánchez-Montesb, c, Gerardo G. Ballados-González d, Dora

5 Romero-Salasa, d, Jannete Gamboa-Prieto d, Angélica Olivares-Muñoz a

a
7 Laboratorio de Parasitología, Posta Zootécnica Torreón del Molino, Facultad de Medicina

8 Veterinaria y Zootecnia, Universidad Veracruzana, Circunvalación y Yáñez s/n, 91710

9 Veracruz, México

10

b
11 Facultad de Ciencias Biológicas y Agropecuarias región Tuxpan, Universidad

12 Veracruzana, Carretera Tuxpan Tampico Kilómetro 7.5 Universitaria 92870 Tuxpan de

13 Rodríguez Cano, Veracruz, México

14

c
15 Centro de Medicina Tropical, Unidad de Investigación en Medicina Experimental,

16 Facultad de Medicina, Universidad Nacional Autónoma de México, Dr. Balmis 148, Col.

17 Doctores, 06726 México City, México

18
d
19 Laboratorio de Enfermedades Infecciosas, Facultad de Medicina Veterinaria y Zootecnia,

20 Universidad Veracruzana, Circunvalación y Yáñez s/n, 91710 Veracruz, México

21
22 *Corresponding author: José L. Bravo-Ramos: jbravo@uv.mx. Facultad de Medicina

23 Veterinaria y Zootecnia, Universidad Veracruzana, Circunvalación y Yáñez s/n, C.P.

24 91710, Veracruz, México.

25
26 Abstract

27 One dog that shared habitat with domestic animals in a cattle farm and that was exposed to

28 wildlife was taken to a private practitioner for clinical examination. The analyses conducted

29 on the patient revealed a babesiosis due to Babesia bigemina by a molecular test. Clinical

30 signs of the infection were observed in the patient. The animal was treated with imidocarb

31 dipropionate (two doses each 0.5 ml/10 kg b.w. at an interval of 14 days). On treatment day

32 7, the clinical signs were mostly reduced. On day 30, PCR was carried out to assess the

33 efficacy of the treatment, with a negative result. This case represents the first report of

34 babesiosis due to B. bigemina in a dog living on a cattle farm in Mexico. It indicates the

35 lower host specify of these pathogens and that dogs can play a role as sentinels of vector-

36 borne parasites in livestock animals.

37
38 Keywords: Piroplasms; Tick-borne disease; Phylogenetic analysis; Canine babesiosis
39

40
41 Canine babesiosis is one of the most widespread tick-borne diseases which affects dog

42 populations worldwide. The disease may cause a multi-organ dysfunction syndrome, which

43 can compromise the life of the host. It is caused by several species of the protozoan genus

44 Babesia. Based on the size of the intraerythrocytic stages of the parasite, two main groups

45 have been recognised: the large group (Babesia canis, Babesia rossi and Babesia vogeli)

46 and the small group (Babesia gibsoni, Babesia conradae, Babesia microti-like, Theileria

47 annae or Babesia vulpes) [1,2]. Among them, B. vogeli is most widely distributed in canids

48 throughout the tropical and subtropical regions [3]. It has been postulated that the species of

49 the genus Babesia has been considered as highly specific for a given host species or group.

50 However, the specificity of these piroplasms is probably lower than expected [4]. Since the

51 implementation of molecular methods, which has increased the sensitivity for the detection

52 of infectious agents, unusual parasite-host associations have started to be described more

53 frequently in dogs. Such is the case of piroplasms from livestock and wild artiodactyls

54 (Theileria annulata, Theileria equi, Theileria sinensis, Theileria velifera and

55 uncharacterized Theileria), which have been reported in dogs from different countries of

56 the Afrotropical and Oriental regions [5]. On the other hand, on cattle farms, canids may

57 share ectoparasites (that act as vectors of several pathogens) with livestock and wildlife.

58 However, the role of dogs as sentinels of tick-borne parasites in livestock is not fully

59 understood. Thus, considering the high prevalence of several tick’s species in canine

60 populations throughout Mexico, it is not surprising to find these shared pathogens among

61 species of hosts that are infested by the same tick species [6]. This report is the first record

62 of the livestock piroplasm Babesia bigemina in a dog and describes the clinical features of

63 the infection.
64 A 4-year-old male mixed-breed dog that shared habitat with livestock and was exposed to

65 wildlife was taken to a private practice in the municipality of Jesus Carranza (southern

66 Veracruz, Mexico) with a 1-week history of anorexia, pigmented faeces, haematuria, fever,

67 and lethargy. The dog had not travelled outside of the state of Veracruz and had never

68 received a blood transfusion. After the first physical examination, the dog was evaluated

69 via a baseline assessment consisting of a complete blood count, serum biochemistry and

70 screening for vector-borne diseases, using a immunochromatographic test SNAP 4Dx

71 followed by a blood smear stained with Giemsa and observed at100x. Additionally, ticks on

72 the dog´s body were removed using forceps, and each one was kept in a small flask with

73 70% ethanol. Ticks were identified according to the morphologic characteristics as

74 described elsewhere [7,8]. According to taxonomic keys, we identified the tick species

75 Amblyomma mixtum on the dog (Fig. 1a). Blood and serum analyses revealed anaemia;

76 thrombocytopenia, leucocytosis, eosinophilia, blood urea nitrogen and creatinine levels

77 were increased (Table 1). The SNAP 4Dx test was negative. However, light microscopy of

78 the blood smear revealed the presence of pyriform structures inside erythrocytes (Fig. 1b).

79 To confirm the identification of piroplasms, a fragment of the 571-bp region of the 18S

80 ribosomal gene (18S-rDNA) was amplified with the primers BAB01

81 (5′CCGTGCTAATTGTAGGGCTAATACA3′) and BAB02 (5′

82 GCTTGAAACACTCTARTTTTCTCAAAG 3′) as described previously [9, 10]. Genomic

83 DNA was extracted from 100 μL of whole blood using the QIAampDNA Minikit (Qiagen,

84 Germany). Amplification product were submitted for purification and sequencing at

85 Macrogen Inc., Korea, and the obtained sequence were deposited in GenBank under

86 accession number: OM530520. Subsequently, the sequence was compared with those

87 available in GenBank using the Basic Local Alignment Search Tool (BLASTn tool). The
 88 BLAST analysis revealed the highest nucleotide identity (i.e.,100% and 99.2%) with

89 reference sequences of Babesia bigemina deposited in GenBank (OK605299, MH050387)

90 reported in cattle and tick Rhipicephalus microplus from China and India. Additionally,

91 sequence generated in this study and those of other Babesia species deposited in GenBank

92 were aligned using the algorithm Muscle in MEGA 11. Subsequently, a phylogenetic

93 reconstruction using the Maximum likelihood method was performed, also in MEGA 11

94 [11]. Branch support was estimated using 1,000 non-parametric bootstraps. The

95 phylogenetic analysis supported the finding of B. bigemina. The sequence generated in this

96 work were grouped with those of B. bigemina in a monophyletic group with support values

97 that varied from 95–100 (Fig. 2).

98 The dog was treated with imidocarb dipropionate (two doses each 0.5 ml/10 kg b.w. at an

99 interval of 14 days, intramuscularly) and fluid therapy. Additionally, a single dose of a

100 chewable tablet that contained afoxolaner (2.5–5 mg/kg) and milbemycin oxime (0.5–1

101 mg/kg) NexGard Spectra ® was given orally. On day 7 of treatment, clinical signs in this

102 patient were mostly reduced, with a rapid resolution. On day 20, the dog underwent a

103 physical exam, and blood and serum analysis showed normal values. In day 30, a PCR was

104 carried out again to assess the efficacy of the treatment, and Babesia DNA was no longer

105 detectable. The treatment showed good tolerance and safety, with scarce adverse events

106 observed. The case resolved favorably, and the patient was discharged

107 In this report, we describe the first record and characterisation of B. bigemina in a dog with

108 clinical and haematological abnormalities consistent with babesiosis in Mexico. Previous

109 records in Mexico have shown that dogs in rural areas can be infested by several hard tick

110 species such as Amblyomma mixtum, Amblyomma ovale, Amblyomma near parvum, Ixodes

111 near affinis, Rhipicephalus microplus, Rhipicephalus sanguineus s.l. and Amblyomma near
112 oblongoguttatum. The tick A. mixtum, detected in this case, is the same as that previously

113 reported attacked to dogs in rural communities in Yucatan [6]. Additionally, A. mixtum

114 parasitises a wide range of hosts and can take advantage of the nutritional resources present

115 in the area [7]. For this reason, it is likely that this tick is a potential transmitter of Babesia

116 species and exchanges several pathogens between domestic animals and wildlife.

117 The main clinical sign observed in canine babesiosis is anaemia. Some reports state that

118 oxidative stress and lipid peroxidation play a role in the pathogenesis of anaemia in some

119 protozoan diseases. In biological membranes, these mechanisms induce disturbances of the

120 structural integrity, leading to the rupture of the membrane and the release of red blood cell

121 contents, which causes lysis [12]. Other clinical signs of canine babesiosis include fever,

122 anorexia, depression and lethargy [13], which coincide with our case. The abnormalities in

123 the elevation of white blood cells could be related to the Babesia infection, with the likely

124 exception of the peripheral eosinophilia. However, absolute eosinophilia cannot be

125 considered a marker of babesiosis, considering that it is not a specific alteration of the

126 infection in dogs but a common finding secondary to several helminths parasitic or allergic

127 diseases [14]. Low platelet count is well described in canine babesiosis as well as in other

128 diseases caused by protozoa, such as malaria and trypanosomiasis. However, the

129 mechanism of thrombocytopenia seen in babesiosis is not clear. The severity and rapid

130 recovery of the platelet counts has led to the suggestion that immune-mediated mechanisms

131 are involved [15]. Higher serum urea levels are not uncommon in dogs with babesiosis, and

132 this elevation is often disproportionate to the rise in creatinine levels. This is probably due

133 to increased protein catabolism and urea production resulting from gastrointestinal

134 haemorrhage or protein catabolism due to the febrile inflammatory illness [16]. Regarding

135 treatment, imidocarb is the only agent licensed for treating babesiosis in the United States
136 and has direct action against the parasite DNA, causing unwinding and denaturation.

137 However, a few drugs and drug combinations are used in the treatment of canine

138 babesiosis, often without complete parasite elimination, and the dogs usually become

139 chronic carriers or present with recurrent episodes of acute infection [17]. In this new

140 scenario, veterinarians should be aware of unexpected Babesia species in dogs that, as

141 known for this species, may be even worse than in livestock, considering the rapid

142 manifestation of the clinical signs. In conclusion, the spectrum of Babesia pathogens that

143 infect dogs is gradually being elucidated with the aid of new molecular techniques and

144 meticulous clinical investigation. Additionally, chemoprophylaxis should also be adopted

145 for dogs living in an endemic area, with the primary means of prevention being tick control.

146

147 Acknowledgements

148 All authors would like to thank MVZ. Diego Delgado of Clivet for providing the data for

149 case.

150

151 Declarations

152

153 Funding

154 The authors declare that no funds, grants, or other support were received during the

155 preparation of this manuscript

156

157 Conflict of interest

158 On behalf of all authors, the corresponding author states that there is no conflict of interest

159
160 Competing Interests

161 The authors have no relevant financial or non-financial interests to disclose.

162

163 Code or data availability

164 The data that support the findings of this study are available in GenBank under accession

165 number: OM530520

166

167 Author Contributions

168 All authors contributed to the study conception and design. SSM: Writing – original draft,

169 Formal analysis, Investigation. GGBG: Project administration, Resources. DRS:

170 Investigation, Validation. AOM: Investigation, Validation, JGP: Visualization, Data

171 curation. JLBR: Project administration, Conceptualization, Writing – review & editing.

172

173 Ethical approval

174 All applicable international, national, and/or institutional guidelines for the care and use of

175 animals were followed. No approval was required. Anesthesia, euthanasia, or any other

176 kind of animal sacrifice was not a part of the study.

177

178 Consent to participate

179 Not applicable

180

181 Consent for publication

182 Not applicable

183
184 References

185 [1] Baneth, G, Florin-Christensen, M, Cardoso. L, Schnittger. L. Reclassification of

186 Theileria annae as Babesia vulpes sp. nov. Parasit. Vectors. 8 (2015) 207 https://doi.org/

187 10.1186/s13071-015-0830-5.

188

189 [2] Bawm, S, Myaing, T.T, Thu, M.J, Akter, S, Htun, L.L., Win, M.M, Katakura, K. PCR

190 detection and genetic characterization of piroplasms from dogs in Myanmar, and a possible

191 role of dogs as reservoirs for Theileria parasites infecting cattle, water buffaloes, and goats.

192 Ticks Tick. Dis. 12 (2021) 101729

193

194 [3] Penzhorn, B.L. Don’t let sleeping dogs lie: unravelling the identity and taxonomy of

195 Babesia canis, Babesia rossi and Babesia vogeli. Parasit. Vectors 13 (2020) 1-9

196

197 [4] Uilenberg, G. Babesia – a historical overview. Vet. Parasitol. 138 (2006) 3–10

198

199 [5] Nayyar-Ghauri, H., Ijaz, M., Farooqi, S.H., Ali, A., Ghaffar, A., Saleem, S., Iqbal,

200 M.K., Aziz, M.U., Ghani, U., Ullah, M.R., Ahmad, H.M. A comprehensive review on past,

201 present and future aspects of canine theileriosis. Microb. Pathog. 126 (2019) 116–122.

202 https://doi.org/10.1016/j.micpath.2018.10.033

203

204 [6] Ojeda‐Chi, M.M., Rodriguez‐Vivas, R.I, Esteve‐Gasent, M.D, Pérez de León, A.A..,

205 Modarelli, J.J., Villegas‐Perez, S.L. Ticks infesting dogs in rural communities of Yucatan,

206 Mexico and molecular diagnosis of rickettsial infection. Transbound Emerg Dis 66 (2019)

207 102-110
208

209 [7] Guzmán-Cornejo C., Robbins R.G., Guglielmone A.A., Montiel-Parra G., Pérez T.M.

210 The Amblyomma (Acari: Ixodida: Ixodidae) of Mexico: identification keys, distribution

211 and hosts. Zootaxa. 2998 (2011) 16–38.

212

213 [8] Nava S., Beati L., Labruna M.B., Cáceres A.G., Mangold A.J., Guglielmone A.A.

214 Reassessment of the taxonomic status of Amblyomma cajennense with the description of

215 three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and

216 Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum, and Amblyomma

217 sculptum (Ixodida: Ixodidae) Tick Tick-Borne Dis. 5 (2014) 252–276.

218

219 [9] Almeida, A.P., Marcili, A, Leite R.C, Nieri-Bastos, F.A, Domingues, L.N, Martins, J.R,

220 Labruna, M.B. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: argasidae).

221 Ticks Tick. Dis 3 (2012) 203–206

222

223 [|0] Sarma, K., Nachum-Biala, Y., Kumar, M., Baneth, G. Molecular investigation of

224 vector-borne parasiticinfections in dogs in Northeast India. Parasit. Vectors 12 (2019) 122

225

226 [11] Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K. MEGA X: molecular

227 evolutionary genetics

228 163 analysis across computing platforms. Mol. Biol. Evol 35 (2018) 1547–1549

229 https://doi.org/10.1093/molbev/msy096

230
231 [12] Holovakha, V.I., Piddubnуak, О.V., Bakhur, T.I., Vovkotrub, N.V., Antipov, A.A.,

232 Anfiorova, M.V., Macynovich, A.O. Changes in erythrocytopoesis indices in dogs with

233 babesiosis Regul mech Biosyst 9 (2018) 379-383

234

235 [13] Crnogaj, M., Petlevski, R., Mrljak, V., Kis, I., Torti, M., Kucer, N., Stokovic, I.

236 Malondialdehyde levels in serum of dogs infected with Babesia canis. Vet Med (Praha) 55

237 (2010) 163-171

238

239 [14] Chidumayo, N.N. Epidemiology of canine gastrointestinal helminths in sub-Saharan

240 Africa Parasit. Vectors 11 (2018) 1-7

241

242 [15] Rautenbach, Y., Schoeman, J., Goddard, A. Prevalence of canine Babesia and

243 Ehrlichia co-infection and the predictive value of haematology. Onderstepoort J. Vet. Res

244 85 (2018) 1-5

245

246 [16] Ullal, T., Birkenheuer, A., Vaden, S. Azotemia and proteinuria in dogs infected with

247 Babesia gibsoni. J Am Anim Hosp Assoc 54 (2018) 156-160

248

249 [17] Baneth, G. Antiprotozoal treatment of canine babesiosis. Vet Parasitol. 254 (2018) 58

250

251
252 Figure legends

253 Figure 1. a) Dorsal view of the female Amblyomma mixtum b) Photomicrograph of the

254 paired intra-erythrocytic pyriform identified on Giemsa-stained thin blood smear suggested

255 to Babesia sp. in this case

256

257 Figure 2. Maximum-likelihood (ML) phylogenetic reconstruction generated with Tamura-

258 Nei model (TN93). Constructed phylogenetic tree based on 571 pb of the 18S rDNA gene

259 of genus Babesia. Sequences recovered in this study are marked with solid figures (red)

260 The numbers at the nodes correspond to bootstrap values higher than 50% obtained with

261 1000 replicates. Theileria equi was used as outgroup.

262

263