See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/345098693

Genetic relationship between local rice varieties based on MatK and rbcL genes

Conference Paper in AIP Conference Proceedings · September 2020

DOI: 10.1063/5.0015756

CITATIONS READS
0 87

6 authors, including:

Annisa Sholikhah Elhah Nailul Khasna

Universitas Gadjah Mada Leibniz Universität Hannover
9 PUBLICATIONS 3 CITATIONS 19 PUBLICATIONS 3 CITATIONS

SEE PROFILE SEE PROFILE

Riri Retnaningtyas Suharti Suharti

University of Arkansas Kimia Farma
17 PUBLICATIONS 6 CITATIONS 13 PUBLICATIONS 3 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Exploration of Mentigi Gunung (Vaccinium varingiaefolium (Blume) Miq.) View project

Fe3O4/TiO2 Nanocomposite from Local Iron-Silica Sand and it Application as Antibacterial Agent and Therapeutical Based Nanoparticle Combating Cancer View project

All content following this page was uploaded by Dwi Listyorini on 25 January 2021.

The user has requested enhancement of the downloaded file.

Genetic relationship between local rice
varieties based on MatK and rbcL genes
Cite as: AIP Conference Proceedings 2260, 020020 (2020); https://doi.org/10.1063/5.0015756
Published Online: 16 September 2020

Nina Bunga Anggraini, Annisa Sholihah, Elhah Nailul Khasna, Riri Wiyanti Retnaningtyas, Suharti, and
Dwi Listyorini

AIP Conference Proceedings 2260, 020020 (2020); https://doi.org/10.1063/5.0015756 2260, 020020

© 2020 Author(s).
Genetic Relationship Between Local Rice Varieties Based on
MatK and rbcL Genes
Nina Bunga Anggraini1, 5, Annisa Sholihah3, Elhah Nailul Khasna5, Riri Wiyanti
Retnaningtyas4, Suharti2, 6 and Dwi Listyorini1, 5, a)
1
Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Malang, Jl Semarang,
Malang 65145, Indonesia.
2
Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Negeri Malang, Jl Semarang,
Malang 65145, Indonesia.
3
Faculty of Biology, Universitas Gadjah Mada, Bulaksumur, Yogyakarta 55281, Indonesia.
4
Cell and Molecular Biology Program, Department of Biological Sciences, University of Arkansas, Fayetteville, AR
72701, United States.
5
Biotechnology Division, Central Laboratory of Mineral and advanced Material,Faculty of Mathematics and
Natural Sciences, Universitas Negeri Malang Jl Semarang, Malang 65145, Indonesia.
6
PUIPT Disruptive Learning Innovation, Universitas Negeri Malang, Jl Semarang, Malang 65145, Indonesia.
a)
Corresponding author: listyorini.aljabari@um.ac.id

Abstract. Indonesia home of abundant indigenous and hybrid rice varieties. The phenomenon of phenotipic-plasticity
allows varieties or even the same species to exhibit different phenotypic characteristics when planted in different
locations. Thus, the identification based on phenotypic characters is needed to be supported by genetic data. The aim of
this research was to unveil the relationship between local rice varieties provided from East Java, Banten, and Samarinda
based on matK and rbcL genes. Total DNA from leaves were used as template for amplification of both genes.
Phylogenetic trees were reconstructed using Neighbour-Joining (NJ) models in Kimura-2 parameters with 1000
bootstraps. The phylogenetic analysis using matK proved that rice varieties from East Java were closely related to rice
varieties from Banten rather than to rice varieties from Samarinda. Meanwhile the same study using the rbcL gave
inconsistent results

INTRODUCTION
Rice was domesticated thousands of years BC and many humans cultivated it to be a staple food source. The part
of rice that is usually consumed by humans is endosperm or commonly called rice. Nearly half the world's
population makes rice a staple food and 90% of consumers are in Asia [1].
Two domestic rice species are O. sativa (Asia) and O. glaberrima (Africa) which have been bred globally.
Distinctive features of domestic and wild rice are changes in pericarp color, dormancy, shattering, panicle
architecture, number of stalks, mating type, and seed size [2]. The Oryza genus is divided into 4 complex species
namely O. sativa, O. offialis, O. ridelyi and O.granulata [3]. The Oryza sativa has two domesticated sub-species
namely japonica and indica [2].
Indonesia has a wealth of indigenus rice germplasm that is abundant and some of it is endemic varieties. So far
there are around 38 local rice accessions which are distinguished anatomically and morphologically. Of all these
accessions can be divided into rice with white, red and black rice. The anatomical and morphological studies are
able to distinguish rice varieties quite thoroughly, but the phenomenon of genetic - plasticity allows the same
varieties or even species to give different anatomical and morphological characteristics when planted or grown in
locations with different microclimate. Based on this, genetic identification needs to be done.

The 6th International Conference on Biological Science ICBS 2019

AIP Conf. Proc. 2260, 020020-1–020020-7; https://doi.org/10.1063/5.0015756
Published by AIP Publishing. 978-0-7354-2020-5/$30.00

020020-1
 Nowadays DNA barcoding becomes very important in the effort of genetic inventory and to maintain genetic
information sources of plant germplasm so that it can later cope if genetic erosion occurs, genetic manipulation for
breeding, and bad environmental effects [4]. Genetic information is also needed to make new varieties, as well as the
basis of information for biotechnology. Genetic diversity also determines anatomical and morphological and
physiological structures which can help organisms cope with varied environmental conditions and helps organisms
survive in uncertain environments [5].
Rice relationship analysis can be done by reconstructing phylogenetic trees of rice using data sequence of rice
chloroplast genes through DNA barcoding. The Consortium for the Barcode of Life (CBOL) recommends a
combination of the 2-locus ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit (rbcL) and maturase K
(matK) genes as a barcode standard for plants [6]. Phylogenetic studies using matK produce phylogenetic trees that
are stronger than other genes [7]. The matK gene has a base length of around 900 bp. While the rbcL gene has a base
length of around 700 bp. The rbcL gene encodes the ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO)
unit [8], located at the plastid locus and can determine evolutionary relationships to the genus level [9]. A
comprehensive study using various barcode genes is carried out to close gaps in genetic data from other barcode
genes that have not been studied or reported to the gene reference center (GenBank). The purpose of this study was
to determine the diversity and relationship of various local rice varieties originating from East Java, Banten, and
Samarinda based on their genetic sequences.

MATERIALS AND METHODS

The materials of this study is based on sequence data from GenBank and new sequence of local rice. The local
rice samples used came from three regions namely East Java, Samarinda and Banten. East Java local rice samples
were obtained from PT. Sirtanio with 6 varieties including SOJA3, Blambangan, Berlian, Hitam Melik, Jawa and
wild type. Banten local rice was obtained from Sultan Ageng Tirtayasa University with 6 varieties including Sereh,
Pare Jaketra, Bulu Putih, Waren, Tambleg, and Pare Caok. In addition, four Samarinda's local rice varieties were
obtained from Mulawarman University including Amas, Kambang, Roti and Pandan Ungu varieties.
Total DNA was isolated using Qiamp from Qiagen DNA extraction kit. Total DNA was extracted from local rice
and the result of DNA isolation were further tested with nanodrop to determine the purity of DNA (the range of
value of 1.8-2.0) showed pure DNA while below 1.8 indicates protein contamination and above 2.0 indicates RNA
contamination. The PCR reaction used Intron PCR mix and the primers used in the matK are forward primer
5’TAAT TTACGATCAATTCATT 3’and reverse primer 5’ACAAGAAAG TCGAAG TAT 3’[10]. Besides, the
primers used in the rbcL were forward primer 5'TAGCTGCTGCTTGTGAGGTATGG3’reverse primer
5’AAATACTAGG CCCACTAAAGG 3’ [11][12][13]. The PCR reaction was 35 cycles for matK gene consisted
predenaturation at 94˚C for 3 min, denaturation at 94˚C for 30 s, annealing at 48˚C 42 s, then the extention at 72˚C
for 1 min, final extention at 72˚C for 10 min. Next, the reaction for rbcL gene was predenaturation at 95˚C for 1
min, denaturation at 95˚C for 30 s, annealing at 48˚C for 30 s, extention at 68˚C for 1 min, then final extention at
68˚C for 5 min. Then, DNA bands from PCR were electrophoresed using 1% agarose gel and visualized using UV-
transiluminator. PCR product were subsequently sequenced at First Base Laboratories Sdn Bhd, Malaysia. DNA
sequencing result were analyzed using DNA baser software, Bioedit, FinchTV and MEGA6. Phylogenetic trees
were reconstructed using Neighbour-Joining (NJ) models in Kimura-2 parameters with 1000 bootstrap using
MEGA6 and the phylogenetic tree reconstruction results above are supported by the results of intraspecific genetic
distance analysis using within group mean distance, and interspecific using between group mean distance.

RESULT
Total DNA isolation yields a sufficiently good amount of DNA, so that the amplification of target genes for the
purpose of diversity and relationship analysis also gives good results as shown in Figure 1 below. Amplification of
the matK gene from each rice variety studied yielded DNA fragments of about 900 bp in length while the rbcL gene
was around 700bp (Figure 1).
Local varieties of rice genetically have differences with other Asian rice (Figure 2). Based on the phylogenetic
tree reconstruction using rbcL gene, it is also known that SOJA3 varieties are located in the outermost clade (I)
which is separated from the monophyletic group (II) consisting of Blambangan (A) varieties and clusters consisting
of other local varieties (B). The Blambangan (A) variety occupies a clade outside the Asian rice cluster and other
local varieties (B). Cluster B consists of two clades namely clade 1 and clade 2. Clade 1 consists of Oryza sativa

020020-2
indica and japonica and Oryza sativa vr. Pare Caok. Based on the reconstruction, it is known that Pare Caok is the
most closely related variety to the Asian rice clusters (Oryza sativa japonica and Oryza sativa indica). Clade 2 has
members Indonesian local rice which forms a monophyletic branch against clade 1.
In clade 2, Berlian, Java, and Amas are closely related to Oryza sativa wildtype they are in one clade with 33
bootsrap value. Bulu Putih varieties are closely related to the Kambang variety with 65 bootsrap value. Hitam Melik
varieties are closely related to Pandan Ungu, Pare Jaketra, Sereh, Tambleg and Waren with 18 bootsrap value.

FIGURE 1. Visualization the results of the amplification of target genes. M : Marker DNA 1kb; Lane 1-9: using matK gene for
varieties 1) Amas, 2) Pandan Ungu, 3) Bulu Putih, 4) Pare Caok, 5) Pare Jaketra, 6) Kambang, 7) Sereh, 8) Tambleg, 9) Waren;
Lane 10-21: gen rbcL for varieties. 10) Amas, 11) Pandan Ungu, 12) Bulu Putih, 13) pare Caok, 14) Pare Jaketra, 15) Kambang,
16) Sereh, 17) Tambleg, 18) Waren, 19) Wild Type, 20) Merah Harum, 21) Hitam Melik.

The phylogenetic tree reconstruction based on the matK gene was carried out using the NJ method (Figure 3).
Depth phylogenetic analysis was carried out to find out in detail the differences between Indonesian local rice
varieties and Asian rice (Oryza sativa indica and japonica). The results of the phylogenetic NJ tree reconstruction
between local varieties of rice with Oryza sativa japonica and Oryza sativa indica show results that are consistent
with the interspecific NJ tree reconstruction in the Poaceae family. In the NJ tree reconstruction between local rice
varieties and Asian rice, local varieties formed a separate cluster with insignificant genetic divergences compared to
Oryza sativa indica and Oryza sativa japonica.
The Cyepraceae family is used as an outgroup to obtain polarized phylogenetic tree reconstruction (Figure 4).
The phylogenetic tree reconstructions of the family of Poaceae show that the Oryzoideae subfamily represented by
the Oryza genus forms monophyletic branches separate from the Subfamily Panicoideae, Bambusoideae, and
Pooideae. Oryza genus in subfamily Oryzoideae forms two clades namely Oryza australiensis and one clade which
form complex species. This species complex consists of Oryza glaberrima, Oryza barthii, Oryza nivara, Oryza
rufipogon, and Oryza sativa; in it there is a separation between Indonesian local rice varieties and other Afro-Asian
rice. This shows that Indonesia's local rice is unique compared to rice from mainland Asia and Africa caused by
breeding throughout agricultural history.

020020-3
FIGURE 2. Phylogenetic tree reconstruction based on the rbcL gene with genetic distance accuracy of 0.0050 using the
Neighbor Joining method.

FIGURE 3. Reconstruction of intraspecies phylogenetic trees Asian rice and local variety rice based on the MatK gene
using the NJ method.

020020-4
 FIGURE 4. Reconstruction of interspecies phylogenetic tree; Poaceae family with Cyperaceae Outgroup based on matK gene
using NJ method.

The phylogenetic tree reconstruction results are supported by intraspecific genetic distance analysis using within
group mean distance, and interspecific using between group mean distance. Based on within group mean distance
analysis, there is no genetic variation at Banten local varieties and at the East Java local rice varieties, whereas in the
local variety of Samarinda there is a genetic variation indicated by a genetic distance of 0.0015 (Table 1).

TABLE 1. Within Group Mean Distance Indonesian local rice from Banten, Samarinda, and East Java
based on matK gene.
Group Distance Std. Error
East Asia 0 0
South Asia 0 0
Banten 0 0
Outgroup 0 0
Samarinda 0,0015 0,0011
East Java 0 0

Meanwhile, the results of the between group mean distance of rice grouped based on geographical distribution
using the matK gene showed that rice originating from East Java did not differ from rice originating from Banten as
indicated by genetic distance of 0.00000, while Samarinda rice was genetically different from Banten and East Java
rice with a genetic distance of 0,00074 (Table 2).

020020-5
 TABLE 2. Between Group Mean Distance local rice Banten, Samarinda, and East Java based on matK gene.

East Asia South Asia Banten Outgroup Samarinda East Java

East Asia 0,00000 0,00000 0,02217 0,00053 0,00000

South Asia 0,00000 0,00000 0,02217 0,00053 0,00000

Banten 0,00000 0,00000 0,02217 0,00053 0,00000

Outgroup 0,29900 0,29900 0,29900 0,02212 0,02217

Samarinda 0,00074 0,00074 0,00074 0,29900 0,00053

East Java 0,00000 0,00000 0,00000 0,29900 0,00074

The results of this analysis support the results of phylogenetic tree reconstruction using the matK and rbcL genes.
Genetic distance within groups as well as between groups proves the genetic differences of the varieties studied
follow their geographical distribution. Local rice varieties grown on the island of Kalimantan have considerable
genetic variation compared to varieties grown on the island of Java, while local rice varieties from Banten and East
Java have no genetic variation with adjacent branches in phylogenetic trees.

DISCUSSION
DNA barcoding is a method of species identification using short DNA sequences [9][14]. Agricultural
identification and biotechnology is carried out using chloroplast genes [15] that have been standardized [9]. These
genes are known to be able to show the similarities or differences accurately and reliably in plant species [17].
The genes from chloroplasts are used for plant identification [16]. Analysis using the chloroplast genes matK,
RpoC2, rpl33, and ndhF showed that O. sativa var. indicaand O. sativa var. japonica in one clade but exhibited
different clade with O. australiensis and O. meridionalis [15].
The result from analysis using the matK and rbcL genes from this study gives inconsistent results. Rice varieties
originating from Banten, Samarinda and East Java are genetically unique so that they are separated from other Asian
rice and African rice. Asian and African rice in general are closely related because they have a history of
overlapping breeding to produce offspring that are still genetically close, as seen in the phylogenetic tree topology
based on the matK gene. In the phylogenetic tree matK gene, Asian rice (Oryza sativa indica and japonica), both in
intraspecific and interspecific trees, are in one clade and do not have significant genetic distances to be said as
different taxa; despite forming different clusters of Indonesian local rice varieties. This is due, in the perspective of
subspecies, local rice varieties are basically also descendants of indica and japonica. In the Samarinda variety group,
the geographical boundary in the form of the ocean plays a big role in producing a considerable difference from the
Banten and East Java rice groups; thus reducing the possibility of cross-breeding between Samarinda's local
varieties and those on Java.
Breeding that occurred independently at the same time in the history of domestication of rice led to genetic
differences in the indica and japonica subspecies produce varieties that are unique to these areas. The genetic
uniqueness of local varieties is still too small to be said as a difference from its ancestors in mainland Asia.
However, further research is needed on the origin of local varieties of rice using molecular markers that are more
specific than the matK and rbcL genes. In this study, there is still ambiguity in the placement of each taxon in the
phylogeny clade, due to the limitations of the molecular markers used.
The rbcL and matK genes are specific genes used to identify plants that are accurately limited to the family level.
This is evidenced by several confusions of species position in the Oryzoideae species complex in the interspecific
matK tree and confusion in the position of Oryza sativa japonica and Oryza sativa indica in the intraspecific matK
tree. In addition, the rbcL and matK gene sequences of local varieties obtained in this study are partial genes; it
means that there are several variable areas in these genes which are not covered because of the limitation of the
amplification by the primers of each gene, while the variable area is the area that distinguishes one taxon from
another taxon. Therefore, to ensure the position of local varieties on the phylogeny of domesticated rice, further

020020-6
 research is needed using specific markers to the level of subspecies; which is supported by morphological and
ecological studies of local variety populations.

CONCLUSIONS
Based on Analysis using the matK and rbcL genes from this study gives inconsistent results. Rice varieties
originating from Banten, Samarinda and East Java are genetically unique so that they are separated from other Asian
rice and African rice. The East Java rice varieties are more closely related to the rice varieties from Banten and
further with the rice varieties from Samarinda.

ACKNOWLEDGEMENTS
We thanks to PT. Sirtanio, Sultan Ageng Tirtayasa University and Mulawarman University for providing rice
seeds samples. We are also thankful to IsDB for funding the research.

REFERENCES

1. S. Mohanty, Trends in Global Rice Consumption. (online) (irri.org). Accessed at 03 August 2019.
2. M. Sweeney & S. McCouch, Review Annals of Botany 100, 951-957 (2007).
3. D. A. Vaughan, H. Morishima, & Kadowaki, Current Opinion in Plant Molecular Biology 6, 139–146
(2003).
4. M. Govindaraj, M. Vetriventhan, & M. Srinivasan, Genetics Research International, 14 (2015).
5. V. S. P. Kloet, J. L. Baltzer, J. H. Appleby, R. Evans, & D. Stewart, Taxon, 53(1): 91-98 (2004).
6. CBOL. Proc. Nat. Acad .Sci, 106: 12794-12797 (2009).
7. K. W. Hiliet, T. Borsch, K. Muller, D. E. Soltis, P. S. Soltis, V. Savolainen, M. W. Chase, M. P. Powell, L.
A. Alice, R. Evans, H. Sauquet, C. Neinhuis, T. A. B. Slotta, J. G. Rohwer, C. S. Campbell, & L. W. Am.
Chatrou, J. Bot. 90(12): 1758-1776 (2003).
8. M. Backlund, B. Oxelman, & B. Bremer, American Journal of Botany 87(7): 1029–1043(1998).
9. W. J. Kress, K. J. Wurdack, E. A. Zimmer, L. E. Weight, & D. H. Janzen, PNAS, 102(23): 8369–8374
(2005).
10. S. C. Roy, Plant Gene and Trait 2015 6(5): 1-10 (2015).
11. W. Dong, J. Liu, J. Yu, L. Wang, and S. Zhou, PLoS ONE, 7: e35071 (2020).
12. M. L. Hollingsworth, C. A. Andra, L. L. Forrest, J. Richardson, R. Pennington, D. G. Long, R. Cowan, M.
W. Chase, M. Gaudeul, and P. M. Hollingsworth, Molecular Ecol. Res., 9: 439-457 (2009).
13. S. Jyoti, P. K. Datta, R. W. Mayur, R. Rishiraj, K. Miranda, B. V. Satish, and B. Shubha, Int. J. Curr.
Microbiol. App. Sci. 6(5): 2746-2756 (2017).
14. S. O. Baafeel, I. A. Arif, M. A. Barkir, H. A. Khan, A. H. Farhan, A. A. Homaidan, A. Ahamed, & J.
Thomas, Plant Omics Journal, 4(4):195-198 (2011).
15. H. Daniel, S. Kumar, & N. Dufourmantel, Trends Biotechnol., 23: 238–245 (2005).
16. C. J. Nock, D. L. E. Waters, M. A. Edwards, S. J. Bowen, N. Rice, G. M. Cordeiro, & R. J. Henry, Plant
Biotechnology Journal 9: 328–333 (2011).
17. M. Moller and Q. C. B. Cronk, Journal Systematic and Geography of Plants, 71(2): 545-555 (2001).

020020-7
View publication stats