Ebook Mitochondrial Medicine Volume 3 Manipulating Mitochondria and Disease Specific Approaches 2Nd Edition Volkmar Weissig Online PDF All Chapter

Mitochondrial Medicine Volume 3
Manipulating Mitochondria and Disease

Specific Approaches 2nd Edition
Volkmar Weissig
Visit to download the full and correct content document:
https://ebookmeta.com/product/mitochondrial-medicine-volume-3-manipulating-mitoc
hondria-and-disease-specific-approaches-2nd-edition-volkmar-weissig/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...
Mitochondrial Medicine: Volume 2: Assessing

Mitochondria Volkmar Weissig
https://ebookmeta.com/product/mitochondrial-medicine-
volume-2-assessing-mitochondria-volkmar-weissig/
Metabolism and Medicine The Metabolic Landscape of

Health and Disease Volume 2 1st Edition Brian Fertig
https://ebookmeta.com/product/metabolism-and-medicine-the-
metabolic-landscape-of-health-and-disease-volume-2-1st-edition-
brian-fertig/
New Approaches to Disease Disability and Medicine in

Medieval Europe 1st Edition Erin Connelly Editor
Stefanie Künzel Editor
https://ebookmeta.com/product/new-approaches-to-disease-
disability-and-medicine-in-medieval-europe-1st-edition-erin-
connelly-editor-stefanie-kunzel-editor/
Principles of Gender-Specific Medicine: Sex and Gender-

Specific Biology in the Postgenomic Era 4th Edition
Marianne J. Legato
https://ebookmeta.com/product/principles-of-gender-specific-
medicine-sex-and-gender-specific-biology-in-the-postgenomic-
era-4th-edition-marianne-j-legato/
Mitochondrial Replacement Techniques Ethical Social and
Policy Considerations 1st Edition And Medicine
Engineering National Academies Of Sciences
https://ebookmeta.com/product/mitochondrial-replacement-
techniques-ethical-social-and-policy-considerations-1st-edition-
and-medicine-engineering-national-academies-of-sciences/
Modelling Congenital Heart Disease: Engineering a

Patient-specific Therapy 1st Edition Gianfranco Butera
https://ebookmeta.com/product/modelling-congenital-heart-disease-
engineering-a-patient-specific-therapy-1st-edition-gianfranco-
butera/
Cell Biology and Translational Medicine Volume 20 Organ

Function Maintenance Repair in Health and Disease 1st
Edition Kursad Turksen
https://ebookmeta.com/product/cell-biology-and-translational-
medicine-volume-20-organ-function-maintenance-repair-in-health-
and-disease-1st-edition-kursad-turksen/
Braunwald s Heart Disease a Textbook of Cardiovascular

Medicine Single Volume 11th Edition Douglas P. Zipes
https://ebookmeta.com/product/braunwald-s-heart-disease-a-
textbook-of-cardiovascular-medicine-single-volume-11th-edition-
douglas-p-zipes/
International Responses to Gendered Based Domestic

Violence Gender Specific and Socio Cultural Approaches
Dongling Zhang
https://ebookmeta.com/product/international-responses-to-
gendered-based-domestic-violence-gender-specific-and-socio-
cultural-approaches-dongling-zhang/
Methods in
Molecular Biology 2277
Volkmar Weissig
Marvin Edeas Editors
Mitochondrial
Medicine
Volume 3: Manipulating Mitochondria
and Disease- Specific Approaches
Second Edition
METHODS IN MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK
For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Mitochondrial Medicine
Volume 3: Manipulating Mitochondria

and Disease- Specific Approaches
Second Edition
Edited by
Volkmar Weissig
Department of Pharmaceutical Sciences, Midwestern University, Glendale, AZ, USA
Marvin Edeas
Cochin Hospital, Cochin Institute, INSERM U1016, PARIS, France
Editors
Volkmar Weissig Marvin Edeas
Department of Pharmaceutical Cochin Hospital
Sciences Cochin Institute, INSERM U1016
Midwestern University PARIS, France
Glendale, AZ, USA
ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-1269-9 ISBN 978-1-0716-1270-5 (eBook)
https://doi.org/10.1007/978-1-0716-1270-5
© Springer Science+Business Media, LLC, part of Springer Nature 2021

This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface
It is our distinct pleasure to present the second edition of MiMB Mitochondrial Medicine to
the ever increasing number of scientists and physicians who are as fascinated by this tiny
organelle as we are. We started working on the first edition in September 2014 and were able
to bring about one year later two volumes with a total of 70 chapters to the market. As of
today (July 2020), 195K downloads have been recorded for Volume I1 and 90K downloads
for volume II2. In light of the rapidly growing and expanding field of Mitochondrial
Medicine, we readily accepted the invitation to compile a second edition, which we started
to work on in March 2019. This second edition as offered here involves a total of 88 chapters
with 45 of them written by new contributors who were not part of our first edition. The first
and second editions combined subsequently present work from 115 mitochondrial labora-
tories from around the globe. We therefore believe these five volumes combined to be the
most comprehensive source of know-how in the wide-ranging field of Mitochondrial
Medicine.
Dividing 87 chapters equally over three volumes proved to be a bit challenging. We
chose the subtitle Targeting Mitochondria for volume I, Assessing Mitochondria for volume
II, and Manipulating Mitochondria and Disease Specific Approaches for volume III while of
course being well aware of significant overlaps between these three areas of research. For
example, it is quite obvious that mitochondria are being targeted for the purpose of either
assessing them or to manipulate them. We therefore ask all authors not to be too critical
regarding the placement of their particular chapter. The reader we believe will anyway
choose to download a chapter of his/her interest quite independently of its placement in
one of the three volumes.
All chapters in these three volumes were written for graduate students, postdoctoral
associates, independent investigators in academia and industry as well as physicians by
leading experts in their particular field. We are extremely grateful to them for having
found the time to either update their chapter from the first edition or to write a new chapter.
We will not forget that for many if not all of our contributors the worldwide COVID-19
pandemic posed additional and unexpected hurdles towards finishing their manuscript in
due time. Thank you to all!
The idea for our original book proposal leading to the first edition of MiMB Mitochon-
drial Medicine originated in our efforts to organize a series of annual conferences on
Targeting Mitochondria (www.targeting-mitochondria.com), the tenth one of which mean-
while has taken place in November 2019 in Berlin, Germany. Due to the ongoing pandemic,
our 11th conference (October 29–30, 2020) will be a virtual one but we are sure it will not
be less exciting than all the previous editions.
1
https://link.springer.com/book/10.1007/978-1-4939-2257-4.
2
https://link.springer.com/book/10.1007/978-1-4939-2288-8.
v
vi Preface
Last but not least we would like to sincerely thank John Walker, the series editor of
Methods in Molecular Biology, for having invited us to compile this second edition and for his
unlimited guidance and help throughout the entire process. We also owe sincere thanks to
Patrick Marton, the Executive Editor of the Springer Protocol Series, for always having been
available in assisting us throughout the entire project.
Glendale, AZ, USA Volkmar Weissig

Paris, France Marvin Edeas
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
1 Allotopic Expression of ATP6 in Mouse as a Transgenic Model
of Mitochondrial Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
David A. Dunn and Carl A. Pinkert
2 Mitochondrial Transplantation for Ischemia Reperfusion Injury . . . . . . . . . . . . . . 15
Ilias P. Doulamis and James D. McCully
3 Quantitatively Controlled Intercellular Mitochondrial Transfer
by Cell Fusion-Based Method Using a Microfluidic Device . . . . . . . . . . . . . . . . . . 39
Ken-Ichi Wada, Kazuo Hosokawa, Yoshihiro Ito, and Mizuo Maeda
4 Lipophilic Conjugates for Carrier-Free Delivery of RNA
Importable into Human Mitochondria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Ilya Dovydenko, Mariya Meschaninova, Anne-Marie Heckel,
Ivan Tarassov, Alya Venyaminova, and Nina Entelis
5 Drug Discovery Assay to Identify Modulators of the Mitochondrial
Ca2+ Uniporter . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
Daniela M. Arduino, Valerie Goh, Dejana Mokranjac,
and Fabiana Perocchi
6 Cytoplasmic Transfer Methods for Studying the Segregation
of Mitochondrial DNA in Mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
Thomas Kolbe, Ralf Steinborn, and Joerg P. Burgstaller
7 Electron Attachment to Isolated Molecules as a Probe
to Understand Mitochondrial Reductive Processes . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Stanislav A. Pshenichnyuk and Alberto Modelli
8 Assessment of Short- and Medium-Chain Fatty Acids
on Mitochondrial Function in Severe Inflammation . . . . . . . . . . . . . . . . . . . . . . . . . 125
Matthias Hecker, Natascha Sommer, and Konstantin Mayer
9 Assessment of the Effects of Drugs on Mitochondrial Respiration. . . . . . . . . . . . . 133
Jana Hroudová and Zdeněk Fišar
10 The NDUFS4 Knockout Mouse: A Dual Threat Model
of Childhood Mitochondrial Disease and Normative Aging . . . . . . . . . . . . . . . . . . 143
Anthony S. Grillo, Alessandro Bitto, and Matt Kaeberlein
11 Suborganellar Localization of Mitochondrial Proteins
and Transcripts in Human Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
Smirnova Anna, Richert Ludovic, Smirnov Alexandre,
Mély Yves, and Tarassov Ivan
12 In Vivo Assessment of Mitochondrial Oxygen Consumption . . . . . . . . . . . . . . . . . 175
Floor A. Harms and Egbert G. Mik
vii
viii Contents
13 Update of Mitochondrial Network Analysis by Imaging:

Proof of Technique in Schizophrenia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
Yekaterina Yatchenko and Dorit Ben-Shachar
14 Heterologous Inferential Analysis (HIA) and Other Emerging
Concepts: In Understanding Mitochondrial Variation In Pathogenesis:
There is no More Low-Hanging Fruit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203
Anto n Vila-Sanjurjo, Paul M. Smith, and Joanna L. Elson
15 Accurate Measurement of Cellular and Cell-Free Circulating
Mitochondrial DNA Content from Human Blood Samples
Using Real-Time Quantitative PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Hannah Rosa and Afshan N. Malik
16 Measurement of Mitochondrial Respiration in Platelets. . . . . . . . . . . . . . . . . . . . . . 269
Zdeněk Fišar and Jana Hroudová
17 Isolation and Electron Microscopic Analysis of Liver Cancer
Cell Mitochondria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 277
Yaschar Kabiri, Carola Eberhagen, Sabine Schmitt,
Percy A. Knolle, and Hans Zischka
18 Assessment of Mitochondrial Reactive Oxygen Species
and Redox Regulation in Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Madhavee Thumiah-Mootoo, Tina Podinic, and Mireille Khacho
19 Single-Cell Approaches for Studying the Role of Mitochondrial
DNA in Neurodegenerative Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 299
Laura J. Bailey, Joanna L. Elson, and Ilse S. Pienaar
20 A New Method for Sequencing the Mitochondrial Genome
by Using Long Read Technology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 331
Sophie Dhorne-Pollet, Nicolas Pollet, and Eric Barrey
21 Mitochondrial DNA as a Sensitive Biomarker of UV-Induced
Cellular Damage in Human Skin. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 345
Amy Bowman and Mark A. Birch-Machin
22 Isolation of Mitochondria-Associated ER Membranes (MAMs),
Synaptic MAMs, and Glycosphingolipid Enriched Microdomains
(GEMs) from Brain Tissues and Neuronal Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357
Ida Annunziata, Jason Andrew Weesner, and Alessandra d’Azzo
23 Mitochondrial Diagnostics: A Discovery-Based Biochemical
Platform for Phenotyping Human Peripheral Blood Cell Mitochondria. . . . . . . . 371
Margaret A. M. Nelson and Kelsey H. Fisher-Wellman
24 Bioenergetic Profiling of Human Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . 391
Gizem Inak, Marie-Thérèse Henke, and Alessandro Prigione
25 Integrative Methods for Studying Cardiac Energetics . . . . . . . . . . . . . . . . . . . . . . . 405
Philippe Diolez, Véronique Deschodt-Arsac, Guillaume Calmettes,
Gilles Gouspillou, Laurent Arsac, Pierre Jais, Michel Haissaguerre,
and Pierre dos Santos
Contents ix
26 Isolation of Mitochondria from Retinal Pigment Epithelial

Cell Cultures and an Application of High-Resolution Respirometric
Assay (XFe96 Seahorse Assay) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 423
Masaaki Ishii, Gyda Beeson, Craig Beeson, and B€ a rbel Rohrer
27 The Isolation and Deep Sequencing of Mitochondrial DNA . . . . . . . . . . . . . . . . . 433
Alexander G. Bury, Fiona M. Robertson, Angela Pyle,
Brendan A. I. Payne, and Gavin Hudson
28 Ultrastructure of the Mitochondria-Associated Membranes
in Human Tumor Specimens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 449
Gabriel Arismendi-Morillo
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 463
Contributors
SMIRNOV ALEXANDRE • UMR 7156 - Molecular Genetics, Genomics, Microbiology (GMGM),

University of Strasbourg/CNRS, Strasbourg, France
SMIRNOVA ANNA • UMR 7156 - Molecular Genetics, Genomics, Microbiology (GMGM),
IDA ANNUNZIATA • Department of Genetics, St. Jude Children Research Hospital, Memphis,
TN, USA
DANIELA M. ARDUINO • Institute for Diabetes and Obesity, Helmholtz Diabetes Center
(HDC), Helmholtz Zentrum München and German National Diabetes Center (DZD),
Neuherberg, Germany
GABRIEL ARISMENDI-MORILLO • Electron Microscopy Laboratory, Biological Researches
Institute, Faculty of Medicine, University of Zulia, Maracaibo, Venezuela
LAURENT ARSAC • INSERM U1045—Centre de Recherche Cardio-Thoracique de Bordeaux
& LIRYC—Institut de Rythmologie et Modélisation Cardiaque, Université de Bordeaux,
France, CHU de Bordeaux, France
LAURA J. BAILEY • Genome Damage and Stability Centre, School of Life Sciences, University of
Sussex, Falmer, UK
ERIC BARREY • Université Paris-Saclay, INRAE, AgroParisTech, Animal Genetic and
Integrative Biology, Université Paris-Saclay, Jouy-en-Josas, France
CRAIG BEESON • Department of Drug Discovery and Biomedical Sciences, Medical University
of South Carolina, Charleston, SC, USA
GYDA BEESON • Department of Drug Discovery and Biomedical Sciences, Medical University
of South Carolina, Charleston, SC, USA
DORIT BEN-SHACHAR • Laboratory of Psychobiology, Department of Neuroscience, B.
Rappaport Faculty of Medicine, Technion IIT, Haifa, Israel
MARK A. BIRCH-MACHIN • Dermatological Sciences, Translational and Clinical Research
Institute, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne, UK
ALESSANDRO BITTO • Department of Laboratory Medicine and Pathology, University of
Washington, Seattle, WA, USA
AMY BOWMAN • Dermatological Sciences, Translational and Clinical Research Institute,
Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne, UK
JOERG P. BURGSTALLER • Biotechnology in Animal Production, Department for
Agrobiotechnology, IFA Tulln, Tulln, Austria; Institute of Animal Breeding and Genetics,
University of Veterinary Medicine, Vienna, Vienna, Austria
ALEXANDER G. BURY • Wellcome Centre for Mitochondrial Research, Newcastle University,
Newcastle-upon-Tyne, UK; Biosciences Institute, Medical School, Newcastle University,
Newcastle-upon-Tyne, UK
GUILLAUME CALMETTES • Department of Medicine (Cardiology), David Geffen School of
Medicine, University of California, Los Angeles, CA, USA
ALESSANDRA D’AZZO • Department of Genetics, St. Jude Children Research Hospital,
Memphis, TN, USA
VÉRONIQUE DESCHODT-ARSAC • INSERM U1045—Centre de Recherche Cardio-Thoracique
de Bordeaux & LIRYC—Institut de Rythmologie et Modélisation Cardiaque, Université de
Bordeaux, France, CHU de Bordeaux, France
xi
xii Contributors
SOPHIE DHORNE-POLLET • Université Paris-Saclay, INRAE, AgroParisTech, Animal

Genetic and Integrative Biology, Université Paris-Saclay, Jouy-en-Josas, France
PHILIPPE DIOLEZ • INSERM U1045—Centre de Recherche Cardio-Thoracique de Bordeaux
& LIRYC—Institut de Rythmologie et Modélisation Cardiaque, Université de Bordeaux,
PIERRE DOS SANTOS • INSERM U1045—Centre de Recherche Cardio-Thoracique de
Bordeaux & LIRYC—Institut de Rythmologie et Modélisation Cardiaque, Université de
ILIAS P. DOULAMIS • Department of Cardiac Surgery, Boston Children’s Hospital, Harvard
Medical School, Boston, MA, USA
ILYA DOVYDENKO • UMR 7156 GMGM University of Strasbourg – CNRS, Strasbourg,
France; Laboratory of Synthetic Biology, Institute of Chemical Biology and Fundamental
Medicine SB RAS, Novosibirsk, Russia
DAVID A. DUNN • Department of Biological Sciences, State University of New York at Oswego,
Oswego, NY, USA
CAROLA EBERHAGEN • Institute of Molecular Toxicology and Pharmacology, Helmholtz
Center Munich, German Research Center for Environmental Health, Neuherberg,
Germany
JOANNA L. ELSON • Biosciences Institute Newcastle, Newcastle University, Newcastle upon
Tyne, UK; Human Metabolomics, North-West University, Potchefstroom, South Africa
NINA ENTELIS • UMR 7156 GMGM University of Strasbourg – CNRS, Strasbourg, France
ZDENĚK FIŠAR • First Faculty of Medicine, Charles University and General University
Hospital in Prague, Prague, Czech Republic
KELSEY H. FISHER-WELLMAN • Department of Physiology, Brody School of Medicine, East
Carolina University, Greenville, NC, USA; East Carolina Diabetes and Obesity Institute,
East Carolina University, Greenville, NC, USA
VALERIE GOH • Institute for Diabetes and Obesity, Helmholtz Diabetes Center (HDC),
Helmholtz Zentrum München and German National Diabetes Center (DZD),
Neuherberg, Germany
GILLES GOUSPILLOU • Département de Kinanthropologie, Université du Québec à Montréal,
Montréal, QC, Canada
ANTHONY S. GRILLO • Department of Laboratory Medicine and Pathology, University of
MICHEL HAISSAGUERRE • INSERM U1045—Centre de Recherche Cardio-Thoracique de
Bordeaux & LIRYC—Institut de Rythmologie et Modélisation Cardiaque, Université de
FLOOR A. HARMS • Department of Anesthesiology, Laboratory of Experimental
Anesthesiology, Erasmus MC – University Medical Center Rotterdam, Rotterdam, The
Netherlands
ANNE-MARIE HECKEL • UMR 7156 GMGM University of Strasbourg – CNRS, Strasbourg,
France
MATTHIAS HECKER • University of Giessen and Marburg Lung Center (UGMLC), Justus-
Liebig- University of Giessen, Giessen, Germany
MARIE-THÉRÈSE HENKE • Max Delbrück Center for Molecular Medicine (MDC), Berlin,
Germany
KAZUO HOSOKAWA • Bioengineering Laboratory, RIKEN Cluster for Pioneering Research,
Wako, Saitama, Japan
Contributors xiii
JANA HROUDOVÁ • First Faculty of Medicine, Charles University and General University
Hospital in Prague, Prague, Czech Republic
GAVIN HUDSON • Wellcome Centre for Mitochondrial Research, Newcastle University,
Newcastle-upon-Tyne, UK; Biosciences Institute, Medical School, Newcastle University,
Newcastle-upon-Tyne, UK
GIZEM INAK • Department of General Pediatrics, Neonatology and Pediatric Cardiology,
Heinrich Heine University, Dusseldorf, Germany; Max Delbrück Center for Molecular
Medicine (MDC), Berlin, Germany
MASAAKI ISHII • Department of Ophthalmology, Medical University of South Carolina,
Charleston, SC, USA
YOSHIHIRO ITO • Nano Medical Engineering Laboratory, RIKEN Cluster for Pioneering
Research, Wako, Saitama, Japan
TARASSOV IVAN • UMR 7156 - Molecular Genetics, Genomics, Microbiology (GMGM),
PIERRE JAIS • INSERM U1045—Centre de Recherche Cardio-Thoracique de Bordeaux &
LIRYC—Institut de Rythmologie et Modélisation Cardiaque, Université de Bordeaux,
YASCHAR KABIRI • Institute of Toxicology and Environmental Hygiene, School of Medicine,
Technical University of Munich, Munich, Germany
MATT KAEBERLEIN • Department of Laboratory Medicine and Pathology, University of
MIREILLE KHACHO • Department of Biochemistry, Microbiology and Immunology, Ottawa
Institute of Systems Biology (OISB), Center for Neuromuscular Disease, University of
Ottawa, Ottawa, ON, Canada
PERCY A. KNOLLE • Institute of Molecular Immunology and Oncology, University Hospital
rechts der Isar, Technical University of Munich, Munich, Germany
THOMAS KOLBE • Biomodels Austria, University of Veterinary Medicine Vienna, Vienna,
Austria; Biotechnology in Animal Production, Department for Agrobiotechnology, IFA
Tulln, Tulln, Austria
RICHERT LUDOVIC • UMR 7021 - Laboratory of Biophotonics and Pharmacology (LBP),
University of Strasbourg/CNRS, Illkirch, France
MIZUO MAEDA • Bioengineering Laboratory, RIKEN Cluster for Pioneering Research,
Wako, Saitama, Japan
AFSHAN N. MALIK • Department of Diabetes, Faculty of Life Sciences and Medicine, School of
Life Course Sciences, King’s College London, London, UK
KONSTANTIN MAYER • University of Giessen and Marburg Lung Center (UGMLC), Justus-
JAMES D. MCCULLY • Department of Cardiac Surgery, Boston Children’s Hospital, Harvard
Medical School, Boston, MA, USA
MARIYA MESCHANINOVA • Laboratory of RNA Chemistry, Institute of Chemical Biology and
Fundamental Medicine SB RAS, Novosibirsk, Russia
EGBERT G. MIK • Department of Anesthesiology, Laboratory of Experimental Anesthesiology,
Erasmus MC – University Medical Center Rotterdam, Rotterdam, The Netherlands
ALBERTO MODELLI • Dipartimento di Chimica “G. Ciamician”, Università di Bologna,
Bologna, Italy; Centro Interdipartimentale di Ricerca in Scienze Ambientali, Ravenna,
Italy
DEJANA MOKRANJAC • Biomedical Center Munich - Physiological Chemistry, Ludwig-
Maximilians Universit€ a t München, Martinsried, Germany
xiv Contributors
MARGARET A. M. NELSON • Department of Physiology, Brody School of Medicine, East

Carolina University, Greenville, NC, USA; East Carolina Diabetes and Obesity Institute,
East Carolina University, Greenville, NC, USA
BRENDAN A. I. PAYNE • Wellcome Centre for Mitochondrial Research, Newcastle University,
Newcastle-upon-Tyne, UK; Translational and Clinical Research Institute, Medical School,
Newcastle University, Newcastle-upon-Tyne, UK
FABIANA PEROCCHI • Institute for Diabetes and Obesity, Helmholtz Diabetes Center (HDC),
Helmholtz Zentrum München and German National Diabetes Center (DZD),
Neuherberg, Germany; Munich Cluster for Systems Neurology, Munich, Germany
ILSE S. PIENAAR • Genome Damage and Stability Centre, School of Life Sciences, University of
Sussex, Falmer, UK
CARL A. PINKERT • Department of Pathobiology, Auburn University, Auburn, AL, USA
TINA PODINIC • Department of Biochemistry, Microbiology and Immunology, Ottawa
Institute of Systems Biology (OISB), Center for Neuromuscular Disease, University of
Ottawa, Ottawa, ON, Canada
NICOLAS POLLET • Université Paris-Saclay, CNRS, IRD, Évolution, Génomes,
Comportement et Écologie, Université Paris-Saclay, Gif-sur-Yvette, France
ALESSANDRO PRIGIONE • Department of General Pediatrics, Neonatology and Pediatric
Cardiology, Heinrich Heine University, Dusseldorf, Germany; Max Delbrück Center for
Molecular Medicine (MDC), Berlin, Germany
STANISLAV A. PSHENICHNYUK • Institute of Molecule and Crystal Physics, Ufa Federal
Research Centre, Russian Academy of Sciences, Ufa, Russia
ANGELA PYLE • Wellcome Centre for Mitochondrial Research, Newcastle University,
FIONA M. ROBERTSON • Wellcome Centre for Mitochondrial Research, Newcastle University,
BA€ RBEL ROHRER • Department of Ophthalmology, Medical University of South Carolina,
Charleston, SC, USA; Ralph H. Johnson VA Medical Center, Charleston, SC, USA;
Department of Neurosciences, Medical University of South Carolina, Charleston, SC, USA
HANNAH ROSA • Department of Diabetes, Faculty of Life Sciences and Medicine, School of Life
Course Sciences, King’s College London, London, UK
SABINE SCHMITT • Institute of Toxicology and Environmental Hygiene, School of Medicine,
Technical University of Munich, Munich, Germany
PAUL M. SMITH • Department of Paediatrics, Royal Aberdeen Children’s Hospital,
Aberdeen, UK
NATASCHA SOMMER • University of Giessen and Marburg Lung Center (UGMLC), Justus-
RALF STEINBORN • Genomics Core Facility, VetCore, University of Veterinary Medicine
Vienna, Vienna, Austria
MADHAVEE THUMIAH-MOOTOO • Department of Cellular & Molecular Medicine, University
of Ottawa, Ottawa, ON, Canada
ALYA VENYAMINOVA • Laboratory of RNA Chemistry, Institute of Chemical Biology and
Fundamental Medicine SB RAS, Novosibirsk, Russia
ANTÓN VILA-SANJURJO • Departamento de Bioloxı́a, Facultade de Ciencias, Centro de
Investigacions en Ciencias Avanzadas (CICA), Universidade da Coruña, A Coruña,
Spain
Contributors xv
KEN-ICHI WADA • Bioengineering Laboratory, RIKEN Cluster for Pioneering Research,

Wako, Saitama, Japan; R&D Laboratory for Innovative Biotherapeutics, Graduate School
of Pharmaceutical Sciences, Kyushu University, Higashi, Fukuoka, Japan
JASON ANDREW WEESNER • Department of Genetics, St. Jude Children Research Hospital,
Memphis, TN, USA; Department of Anatomy and Neurobiology, College of Graduate
Health Sciences, University of Tennessee Health Science Center, Memphis, TN, USA
YEKATERINA YATCHENKO • Laboratory of Psychobiology, Department of Neuroscience, B.
Rappaport Faculty of Medicine, Technion IIT, Haifa, Israel
MÉLY YVES • UMR 7021 - Laboratory of Biophotonics and Pharmacology (LBP), University
of Strasbourg/CNRS, Illkirch, France
HANS ZISCHKA • Institute of Toxicology and Environmental Hygiene, School of Medicine,
Technical University of Munich, Munich, Germany; Institute of Molecular Toxicology and
Pharmacology, Helmholtz Center Munich, German Research Center for Environmental
Health, Neuherberg, Germany
Chapter 1
Allotopic Expression of ATP6 in Mouse as a Transgenic

Model of Mitochondrial Disease
David A. Dunn and Carl A. Pinkert
Abstract
Progress in animal modeling of polymorphisms and mutations in mitochondrial DNA (mtDNA) is not as
developed as nuclear transgenesis due to a host of cellular and physiological distinctions. mtDNA mutation
modeling is of critical importance as mutations in the mitochondrial genome give rise to a variety of
pathological conditions and play a contributing role in many others. Nuclear localization and transcription
of mtDNA genes followed by cytoplasmic translation and transport into mitochondria (allotopic expres-
sion, AE) provide an opportunity to create in vivo modeling of a targeted mutation in mitochondrial genes.
Accordingly, such technology has been suggested as a strategy for gene replacement therapy in patients
harboring mitochondrial DNA mutations. Here, we use our AE approach to transgenic mouse modeling of
the pathogenic human T8993G mutation in mtATP6 as a case study for designing AE animal models.
Key words Allotopic expression, ATP6, Transgenic mouse, mtDNA, Mitochondrial disease, Animal
modeling
1 Introduction
Throughout the course of eukaryotic evolution, genetic material

from mitochondria has translocated and taken residence within the
nuclear genome [1]. Replicating this phenomenon in the labora-
tory by expressing a mitochondrial gene in the nucleus and target-
ing the resultant protein to the mitochondrion is termed allotopic
expression (AE) (Fig. 1), first coined in the late 1980s [2]. AE has
multiple uses as a research tool in studying topics ranging from
mitochondrial genomic evolution to human disease arising from
mutations in mitochondrial DNA (mtDNA).
Creation of animal models of AE has potential value in studying
several aspects of mitochondrial physiology [3]. These include
probing human mtDNA genetic pathology, the limits of the evolu-
tionary transfer of mtDNA to the nucleus, mitochondrial protein
import, and mechanisms of aging. AE has also been proposed as a
Volkmar Weissig and Marvin Edeas (eds.), Mitochondrial Medicine: Volume 3: Manipulating Mitochondria and Disease- Specific
Approaches, Methods in Molecular Biology, vol. 2277, https://doi.org/10.1007/978-1-0716-1270-5_1,
1
2 David A. Dunn and Carl A. Pinkert
Fig. 1 Allotopic expression occurs as a gene typically encoded by the mitochon-

drial DNA is cloned and expressed as a transgene from within the nucleus–such
that it will translocate to the mitochondria upon translation
strategy for gene therapy in treating patients with diseases arising

from mutations in mtDNA and has recently been utilized as the
basis for a number of promising clinical trials testing the safety and
effectiveness of an AE-based gene therapy modality for the treat-
ment of Leber’s Hereditary Optic Neuropathy (LHON), an ocular
disease in humans stemming from mtDNA mutation in the ND4
gene [4–6]. In vivo AE models would be of enormous value in
preclinical trials of interventions targeted at mitochondrial disease.
A few animal models of AE have been developed. AE of both
wild-type and mutant ND4 expressed from adeno-associated virus
(AAV) gene therapy vectors to mouse [7] and rat [8, 9] eyes was
reported. In all experiments, AE of mutant ND4 resulted in retinal
Allotopic Expression of ATP6 in the Mouse 3
damage. Furthermore, the rat experiments illustrated a reversal of

the retinal damage when wild-type ND4 was allotopically
expressed. These AAV models are of great value in establishing
AE in viral vectors for gene therapy in ocular mitochondrial disease.
Nevertheless, a need exists for transgenic models of mtDNA muta-
tion in which the transgene is heritable, allowing creation of the
large numbers of animals required for many preclinical applications.
One such model was reported in which mutant human ND4
DNA in the mitochondrial genetic code was delivered to mitochon-
dria of mouse zygotes via microinjection of recombinant AAV
[10]. Resulting mice expressed the mutant human gene and dis-
played optic pathologies similar to human patients harboring the
same mutation. These mice displayed transmission of mutated
mtDNAs in subsequent generations. As the transferred DNA
appeared to be episomally maintained, long-term transmission
was uncertain. Mice with nuclear integrated transgenes allotopically
expressing mutant and wild-type versions of ATP6 were reported
by our group [11]. These models form the basis for the protocols in
this chapter.
Despite the potential value of these animal models, AE has
proven difficult to accomplish and remains controversial. Several
published reports show evidence of AE experiments in which allo-
topically expressed protein is not translocated into the interior of
the organelle [12–14]. Yet, some mitochondrial genes might be
more amenable to AE than others [14]. A greater aspect in deter-
mining the ability of a nuclear encoded protein to be imported into
mitochondria is in relation to its hydrophobicity. If AE proves to be
possible in expressing many proteins encoded in the mitochondrial
genome, changing the amino acid composition to reduce hydro-
phobicity in a manner sufficient to facilitate mitochondrial trans-
port will be needed.
This chapter follows the case study of making transgenic AE
mice using the human T8992G mutation in ATP6 as previously
published [11]. We cover strategies for designing an AE transgenic
mouse project, creating the expression construct, and genotyping
transgenic animals.
2 Materials
2.1 Construct Design 1. Computer with Internet connectivity and productivity

software.
2. Obtain murine coding sequence from a relevant database. Here
we obtained data from the National Center for Biotechnology
Information (NCBI) database. (NCBI Gene ID: 17705).
3. Human wild-type and mutant (see Note 1) ATP6 coding

sequences from relevant databases (NCBI Gene database and
Online Mendelian Inheritance in Man (OMIM)):
Wild-type human: NCBI Gene ID: 4508.
T8993G Mutant human: OMIM #551500.
2.2 Gene Synthesis 1. Oligonucleotides (25 nt in length) that cover the entire for-
ward and reverse sequence of the DNA to be synthesized
(Fig. 2).
2. dNTPs.
3. High Fidelity PCR polymerase; e.g., Pfu DNA Polymerase
(Promega Corporation, Madison, WI, USA).
4. Pfu DNA polymerase, 10 reaction buffer/10 PCR buffer
(Promega Corporation, Madison, WI, USA): 200 mM Tris–
HCl (pH 8.8 at 25 C), 100 mM KCl, 100 mM (NH4)2SO4,
20 mM MgSO4, 1.0% Triton® X-100, 1 mg/ml nuclease-
free BSA.
5. Phenol/chloroform/isoamyl alcohol (25:24:1).
6. 100% and 70% Ethanol.
7. Wizard® SV Gel and PCR Clean-Up System (Promega Corpo-
ration, Madison, WI, USA).
8. T7 DNA Endonuclease I (New England BioLabs, Ipswich,
MA, USA).
9. 10 NEBuffer 3 (New England BioLabs, Ipswich, MA, USA):
1 M NaCl, 500 mM Tris–HCl (pH 7.9 at 25 C),
100mM MgCl2, 10 mM DTT.
10. Tris-Acetate-EDTA agarose gels and electrophoresis apparatus.
2.3 Assembly 1. Mammalian expression vector with mitochondrial targeting

of Transgene signal (e.g., pEF/myc/mito, Thermo Fisher Scientific, Wal-
Expression Constructs tham, MA, USA).
2. Restriction endonucleases: AvaI, BssHII, EcoRI, NotI and
PvuII.
3. T4 DNA ligase.
4. DH5α competent bacterial cells (Thermo Fisher Scientific,
Waltham, MA, USA).
2.4 Animal 1. Thermocycler.

Genotyping 2. Thermostable polymerase.
3. dNTPs.
4. Transgene-specific primers: ATP6F: 50 -tggccattccactatggg-30
and ATP6R: 50 -gatggctggcaactagaagg-30 . (see Note 2).
5. Genomic DNA from potential transgenic mice.
F1 F2
5’gcggctcccagtgccgcgcgccaag-atccattcgctcgagâtgaacgaaa 3’
3’ cgcgcggttc^taggtaagcgagctc-tacttgcttt 5’
R1
F3 F4
5’atctatttgcctcat^tcattacccc-aacaatgatgggatt^cccaatcgtt 3’
3’tagataaacggagta-agtaatgggg^ttgttactaccctaa-gggttagcaa 5’
R2 R3
F5 F6
5’ gtagccatcattatg^tttccttcaa-tcctattcccatcct^caaaacgcct 3’
3’ catcggtagtaatac-aaaggaagttâggataagggtagga-gttttgcgga 5’
R4 R5
F7 F8
5’ aatcaacaaccgtct^ccattctttc-caacactggctagttâaacttatta 3’
3’ ttagttgttggcaga-ggtaagaaag^gttgtgaccgatcaa-tttgaataat 5’
R6 R7
F9 F10
5’ tcaaacaaatgatgc^taatccacac-accaaaaggacgaacâtggacccta 3’
3’ agtttgtttactacg-attaggtgtg^tggttttcctgcttg-tacctgggat 5’
R8 R9
F11 F12
5’ atgattgtttccctaâtcatgttta-ttggatcaacaaatc^tcctaggcct 3’
3’ tactaacaaagggat-tagtacaaatâacctagttgtttag-aggatccgga 5’
R10 R11
F13 F14
5’ tttaccacatacatt^tacacctact-acccaactatccatgâatctaagta 3’
3’ aaatggtgtatgtaa-atgtggatga^tgggttgataggtac-ttagattcat 5’
R12 R13
F15 F16
5’ tggccattccactat^gggctggagc-cgtaattacaggctt^ccgacacaaa 3’
3’ accggtaaggtgata-cccgacctcg^gcattaatgtccgaa-ggctgtgttt 5’
R14 R15
F17 F18
5’ ctaaaaagctcactt^gcccacttcc-ttccacaaggaactc^caatttcact 3’
3’ gatttttcgagtgaa-cgggtgaaggâaggtgttccttgag-gttaaagtga 5’
R16 R17
Fig. 2 Primer sequences and configuration for synthesis of ATP6 DNA

F19 F20
5’ aattccaatgcttat^tattattgaa-acaattagcctatttâttcaaccaa 3’
3’ ttaaggttacgaata-ataataactt^tgttaatcggataaa-taagttggtt 5’
R18 R19
F21 F22
5’ tggcattagcagtcc^ggcttacagc-taacattactgcaggâcacttatta 3’
3’ accgtaatcgtcagg-ccgaatgtcgâttgtaatgacgtcc-tgtgaataat 5’
R20 R21
F23 F24
5’ atgcacctaatcgga^ggagctactc-tagtattaatgaata^ttagcccacc 3’
3’ tacgtggattagcct-cctcgatgagâtcataattacttat-aatcgggtgg 5’
R22 R23
F25 F26
5’ aacagctaccattacâtttattatt-ttacttctactcacaâttctagaat 3’
3’ ttgtcgatggtaatg-taaataataaâatgaagatgagtgt-taagatctta 5’
R24 R25
F27 F28
5’ ttgcagtagcattaa^ttcaagccta-cgtattcaccctcctâgtaagccta 3’
3’ aacgtcatcgtaatt-aagttcggat^gcataagtgggagga-tcattcggat 5’
R26 R27
F29 F30
5’ tatctacatgataatâcagcggccg-cagaacaaaaactca^tctcagaaga 3’
3’ atagatgtactatta-tgtcgccggc^gtcttgtttttgagt-agagtcttct 5’
R28 R29
3’ cctagacttaccccg 5’
R30
- = beginning/end of primer
^ = within a primer
MutF21: tggcccgggcagtccggcttacagc
MutR20: ggactgcccgggccattggttgaat
Fig. 2 (continued)
3 Methods
3.1 Construct Design 1. Choose (or create) an appropriate expression vector. For the
ATP6 model, we chose pEF/myc/mito. pEF/myc/mito, and
other vectors like it have several necessary elements that are
required in order for AE to proceed and for experimental
visualization of the product. These include promoter (see
Note 3), mitochondrial transport signal (see Note 4), polyA
signal, and epitope tag.
2. Align wild-type and mutant human and wild-type murine
ATP6 sequences using any word processing software (e.g.,
10 20 30 40 50
Human WT atgaacgaaaatctgttcgcttcattcattgcccccacaatcctaggcct
T8992G atgaacgaaaatctgttcgcttcattcattgcccccacaatcctaggcct
Murine WT atgaacgaaaatctatttgcctcattcattaccccaacaataataggatt
A6M gcggctcccagtgccgcgcgccaagatccattcgctcgagatgaacgaaaatctatttgcctcattcattaccccaacaatgatgggatt
A6W gcggctcccagtgccgcgcgccaagatccattcgctcgagatgaacgaaaatctatttgcctcattcattaccccaacaatgatgggatt
60 70 80 90 100 110 120 130 140

Human WT acccgccgcagtactgatcattctatttccccctctattgatccccacctccaaatatctcatcaacaaccgactaatcaccacccaaca
T8993G acccgccgcagtactgatcattctatttccccctctattgatccccacctccaaatatctcatcaacaaccgactaatcaccacccaaca
Murine WT cccaatcgttgtagccatcattatatttccttcaatcctattcccatcctcaaaacgcctaatcaacaaccgtctccattctttccaaca
A6M cccaatcgttgtagccatcattatgtttccttcaatcctattcccatcctcaaaacgcctaatcaacaaccgtctccattctttccaaca
A6W cccaatcgttgtagccatcattatgtttccttcaatcctattcccatcctcaaaacgcctaatcaacaaccgtctccattctttccaaca
150 160 170 180 190 200 210 220 230

Human WT atgactaatcaaactaacctcaaaacaaatgataaccatacacaacactaaaggacgaacctgatctcttatactagtatccttaatcat
T8993G atgactaatcaaactaacctcaaaacaaatgataaccatacacaacactaaaggacgaacctgatctcttatactagtatccttaatcat
Murine WT ctgactagttaaacttattatcaaacaaataatgctaatccacacaccaaaaggacgaacatgaaccctaataattgtttccctaatcat
A6M ctggctagttaaacttattatcaaacaaatgatgctaatccacacaccaaaaggacgaacatggaccctaatgattgtttccctaatcat
A6W ctggctagttaaacttattatcaaacaaatgatgctaatccacacaccaaaaggacgaacatggaccctaatgattgtttccctaatcat
240 250 260 270 280 290 300 310 320

Human WT ttttattgccacaactaacctcctcggactcctgcctcactcatttacaccaaccacccaactatctataaacctagccatggccatccc
T8993G ttttattgccacaactaacctcctcggactcctgcctcactcatttacaccaaccacccaactatctataaacctagccatggccatccc
Murine WT atttattggatcaacaaatctcctaggccttttaccacatacatttacacctactacccaactatccataaatctaagtatagccattcc
A6M gtttattggatcaacaaatctcctaggccttttaccacatacatttacacctactacccaactatccatgaatctaagtatggccattcc
A6W gtttattggatcaacaaatctcctaggccttttaccacatacatttacacctactacccaactatccatgaatctaagtatggccattcc
330 340 350 360 370 380 390 400 410

Human WT cttatgagcgggcacagtgattataggctttcgctctaagattaaaaatgccctagcccacttcttaccacaaggcacacctacacccct
T8993G cttatgagcgggcacagtgattataggctttcgctctaagattaaaaatgccctagcccacttcttaccacaaggcacacctacacccct
Murine WT actatgagctggagccgtaattacaggcttccgacacaaactaaaaagctcacttgcccacttccttccacaaggaactccaatttcact
A6M actatgggctggagccgtaattacaggcttccgacacaaactaaaaagctcacttgcccacttccttccacaaggaactccaatttcact
A6W actatgggctggagccgtaattacaggcttccgacacaaactaaaaagctcacttgcccacttccttccacaaggaactccaatttcact
420 430 440 450 460 470 480 490 500

Human WT tatccccatactagttattatcgaaaccatcagcctactcattcaaccaatagccctggccgtacgcctaaccgctaacattactgcagg
T8993G tatccccatactagttattatcgaaaccatcagcctactcattcaaccaatagcccgggccgtacgcctaaccgctaacattactgcagg
Murine WT aattccaatacttattattattgaaacaattagcctatttattcaaccaatggcattagcagtccggcttacagctaacattactgcagg
A6M aattccaatgcttattattattgaaacaattagcctatttattcaaccaatggcccgggcagtccggcttacagctaacattactgcagg
A6W aattccaatgcttattattattgaaacaattagcctatttattcaaccaatggcattagcagtccggcttacagctaacattactgcagg
510 520 530 540 550 560 570 580 590

Human WT ccacctactcatgcacctaattggaagcgccaccctagcaatatcaaccattaaccttccctctacacttatcatcttcacaattctaat
T8993G ccacctactcatgcacctaattggaagcgccaccctagcaatatcaaccattaaccttccctctacacttatcatcttcacaattctaat
Murine WT acacttattaatacacctaatcggaggagctactctagtattaataaatattagcccaccaacagctaccattacatttattattttact
A6M acacttattaatgcacctaatcggaggagctactctagtattaatgaatattagcccaccaacagctaccattacatttattattttact
A6W acacttattaatgcacctaatcggaggagctactctagtattaatgaatattagcccaccaacagctaccattacatttattattttact
600 610 620 630 640 650 660 670 680

Human WT tctactgactatcctagaaatcgctgtcgccttaatccaagcctacgttttcacacttctagtaagcctctacctgcacgacaacacataa
T8993G tctactgactatcctagaaatcgctgtcgccttaatccaagcctacgttttcacacttctagtaagcctctacctgcacgacaacacataa
Murine WT tctactcacaattctagaatttgcagtagcattaattcaagcctacgtattcaccctcctagtaagcctatatctacatgataatacataa
A6M tctactcacaattctagaatttgcagtagcattaattcaagcctacgtattcaccctcctagtaagcctatatctacatgataatacagcg
A6W tctactcacaattctagaatttgcagtagcattaattcaagcctacgtattcaccctcctagtaagcctatatctacatgataatacagcg
A6M gccgcagaacaaaaactcatctcagaagaggatctgaatggggccgcatag
A6W gccgcagaacaaaaactcatctcagaagaggatctgaatggggccgcatag
t467g
AvaI restriction site
Fig. 3 Aligned DNA sequences of human wild-type and mutated mtATP6, wild-type mouse mtATP6, and
transgenic AE mutant (A6M) and wild-type (A6W)
MS Word) or with other bioinformatics software. Since the

allotopically expressed gene introduces a mutation not present
in the wild-type murine sequence, this visual alignment of the
human and murine orthologs assists in determining the loca-
tion where the polymorphism will be introduced (Fig. 3).
Table 1
Differences between the standard genetic code and the mitochondrial genetic code
Codon usage differences in mitochondria
Vertebrate mitochondrial genetic code Standard genetic code

AGA Stop Arginine
AGG Stop Arginine
AUA Methionine Isoleucine
UGA Tryptophan Stop
mtDNA genes expressed allotopically must be recoded to generate targeted amino acid sequences
3. Change codons to make murine nuclear expression possible or

to study the effect of these changes on AE efficiency (see Note
5). Recode sequences in which mitochondrial codons do not
match standard nuclear codons as seen in Table 1. Sequences
from non-murine sources might benefit from codon optimiza-
tion to increase expression levels [15, 16]. Addition of novel
diagnostic restriction sites might also influence codon choice
(see Note 6).
4. Assure that coding sequence to be synthesized will clone into
the chosen expression vector in-frame with existing elements
(MTS, epitope tag, etc.). Add appropriate restriction sites to
both ends of the fragment that will be introduced into the
vector.
3.2 Gene Synthesis 1. Separate primers from item 1, Subheading 2.2 into groups of
and Construct four (F1, F2, R1, R2 from Fig. 2 in the first tube, F2, F3, R2,
Assembly (See Note 7) R3 in the second tube, etc.) as described in [17]. Aliquot each
primer into a PCR tube with the outer primers at 200 nM and
the two inner primers at 40 nM.
2. Perform dual asymmetrical PCR (DA-PCR) in the tubes from
step 1. In addition to the primers, add 200 μM dNTPs and Pfu
(or other thermostable proofreading) DNA polymerase in a
50 μl total reaction volume. Perform the reaction using the
following conditions: 94 C for 20 s, 45 C for 15 s, and 72 C
for 30 s over 20 cycles.
3. Combine 5 μl aliquots of each of the reactions from step 2 into
a single new tube, extract with 150 μl phenol/chloroform/
isoamyl alcohol (25:24:1), precipitate with 100% ethyl alcohol,
and wash with 70% ethyl alcohol.
4. Resuspend precipitated products from the first PCR reaction in
86 μl ultrapure H2O. Set up the second PCR step (overlap
extension, OE-PCR) by adding 10 μl 10 PCR buffer, 2 μl
dNTPs (final concentration 200 μM), and 2 μl Pfu polymerase.
Perform the reaction using the following conditions: 94 C for

30 s, 55 C for 30 s, and 72 C for 90 s over 15 cycles.
5. Perform the third and final step of gene synthesis by combining
1 μl of the OE-PCR reaction, 5 μl 10 PCR buffer, 5 μl each of
the outermost primers from the DA-PCR steps (final concen-
tration 200 nM), 1 μl dNTPs (final concentration 200 μM),
1 μl Pfu polymerase, and ultrapure H2O to a final volume of
50 μl. Perform the reaction using the following conditions:
94 C for 20 s, 55 C for 20 s, and 72 C for 90 s over 30 cycles.
6. Isolate the products of the full-length PCR, e.g., using the
Wizard SV Gel and PCR Clean-Up System. As the final step
of the PCR clean-up, elute the PCR products in 45 μl ultrapure
H2O then add 5 μl 10 NEBuffer 3.
7. Denature at 94 C for 3 min followed by renaturation at 75 C
for 5 min. Add 1 μl T7 endonuclease I and incubate the tube at
37 C for 30 min to cleave any DNA molecules with nonho-
mologous base pairing. Separate T7 endonuclease I-treated
DNA on a 1.5% agarose Tris-acetate-EDTA (TAE) gel. Excise
the correct-sized band from the gel and purify using a Wizard
SV Gel and PCR Clean-Up System.
8. Restrict synthesized ATP6 DNAs with BssHII and NotI
restriction endonucleases in preparation for cloning into the
pEF/myc/mito plasmid.
9. Restrict plasmid DNA with BssHII and NotI restriction
endonucleases.
10. Separate restricted DNAs on agarose gel and isolate the indi-
cated bands (708 bp, synthesized ATP6; 5.5 kb, pEF/myc/
mito).
11. Perform ligation of synthesized DNA into plasmid and trans-
form into competent bacterial cells.
12. Analyze plasmids containing ATP6 inserts by AvaI RFLP
restriction analysis and DNA sequencing. One plasmid con-
taining synthesized ATP6 DNA harboring the T8993G muta-
tion was designated pEF/myc/mito/A6M, and one
containing synthesized wild-type ATP6 DNA was designated
pEF/myc/mito/A6W.
13. Treat plasmids pEF/myc/mito/A6M and pEF/myc/mito/
A6W with EcoRI and PvuII restriction endonucleases. Isolate
the 2.3 kb fragment containing the ATP6 expression fragment
for use in production of transgenic mice [11, 18].
3.3 Generation 1. Generate mouse models using traditional DNA microinjection

of Founder Animals technology (see ref. 19). A6M and A6W transgenic mice were
produced on C57BL/6 and B6(B6SJLF1) genetic back-
grounds, respectively [11]. Microinject transgene constructs
into pronuclear zygotes with surviving embryos then transfer

to pseudopregnant recipient dams for the remainder of gesta-
tion. Following birth of founder animals, obtain tail biopsies at
weaning for initial genotyping as described below (identifica-
tion of incorporation of the transgene sequence within geno-
mic DNA). Assure that all mouse procedures are approved by
appropriate Institutional Animal Care and Use Committees.
3.4 Animal 1. Isolate genomic DNA from animals to be analyzed.

Genotyping 2. Perform PCR analysis with primers from item 4, Subheading
2.4. Treat samples with an initial denaturation step of 95 C for
60 s, followed by 30 cycles of 94 C for 20 s, 61 C for 30 s, and
72 C for 30 s. Perform a final extension step of 72 C for
10 min followed by a terminal hold at 4 C. Here, forward and
reverse primers were 50 tggccattccactatggg 30 and 50 gatggctgg-
caactagaagg 30 [11].
3. Analyze amplified DNAs on a 1.5% agarose gel. A positive
result indicating a transgenic animal will yield an expected
product size of 473 base pairs.
4 Notes
1. In AE experiments studying mutated versions of mtDNAs,

both wild-type and mutated versions of the gene must be
studied.
2. PCR is commonly used to genotype potential transgenic ani-
mals [20]. Ensure PCR primers are specific to the transgene
and not endogenous mtDNA sequences. This can be accom-
plished by designing primers to recognize elements within the
transgenic construct that are outside of the mitochondrial
gene, e.g., promoter, MTS, and epitope tag. Alternatively,
primers may be designed within coding regions of allotopically
expressed sequences if they are sufficiently different from
endogenous sequence.
3. In designing an AE experiment, a number of promoter types
deserve consideration. These include a ubiquitous promoter
that supports high expression levels in a wide variety of cell
types. The EF-1α promoter, from the pEF/myc/mito expres-
sion vector used here, is an example of such a promoter
[21]. Nevertheless, a large number of inducible, conditional,
and tissue-specific promoters are available depending on spe-
cific experimental needs [22].
4. While an exhaustive study assessing the effectiveness of various
mitochondrial transport signal (MTS) sequences has not been
performed, the choice of MTS in any allotopic expression
experiment is likely to influence its effectiveness. With the

exception of the 13 proteins encoded on mitochondrial
DNA, all of the >1500 mitochondrial proteins [23] are trans-
lated in the cytoplasm and must subsequently be translocated
into mitochondria. Many nuclear-encoded mitochondrial pro-
teins are translated with an N-terminal leader peptide that is
15–40 residues in length [24] that directs their localization to
mitochondria and subsequent internal transport [25]. In sev-
eral species of algae, nuclear genes that are typically encoded in
the mtDNA of other species contain a long (>100 residues)
N-terminal mitochondrial transport signal [26]. Further
research is warranted to compare the function of different
MTS sequences across a variety of taxa. The pEF/myc/mito
vector contains coding sequence for the 29 residue MTS of
cytochrome c oxidase subunit VIII [27].
5. Hydrophobicity is hypothesized to be the greatest challenge in
large-scale allotopic expression of many genes in the
mitochondrial genome. The failure of AE in a number of
mitochondrial-encoded genes, notably including cytochrome
b, is hypothesized to be due mainly to its substantial hydro-
phobicity [12]. Sequence polymorphisms resulting in lower
protein hydrophobicity are seen in evolutionary migration of
mitochondrial genes to the nucleus and in gene duplication
events. Using some of the features of these evolutionary
approaches to nuclear gene movement might be useful in over-
coming hydrophobicity of mitochondrial genes in the allotopic
expression experiments, allowing them to be efficiently trans-
ported across the mitochondrial membranes. The ATP6 gene
of the green alga Chlamydomonas reinhardtii and other related
algae species is encoded in the nucleus. Numerous noncon-
served amino acids in putative membrane-spanning domains of
the C. reinhardtii ATP6 protein were less hydrophobic than
analogous residues from other species in which ATP6 is
encoded in the mtDNA [26]. Most legume species possess
genes for both nuclear and mitochondrial-encoded cyto-
chrome c oxidase subunit 2 (CoxII) [28]. The mitochondrial
version of the Glycine max (soy bean) CoxII protein cannot be
transported to mitochondria if expressed in the nucleus. How-
ever, if two residues in a membrane-spanning region of the
mitochondrial CoxII are changed to the corresponding (less
hydrophobic) amino acids on the nuclear version, mitochon-
drial import occurs [29]. Using this approach, changing a small
number of nonconserved hydrophobic amino acids to neutral
or hydrophilic amino acids might tip the scales in favor of
mitochondrial import for cytoplasmically translated mitochon-
drial proteins. One piece of evidence favoring the value of this
approach showed AE in the yeast COX2 gene. While the wild-
type protein did not rescue the phenotype of a cox2 mutant,

random mutagenesis that changed a tryptophan residue to
arginine allowed yeast expressing this mutant protein to
undergo aerobic respiration utilizing a nonfermentable carbon
source [30].
6. The human T8993G mutation (at position 467 of the human
and murine ATP6 sequence) results in the creation of a new
AvaI restriction site. This mutation gives rise to a RFLP that
was the basis for the discovery of the mutation [31]. This
restriction site is useful in diagnostic identification of the muta-
tion. Therefore, the allotopically expressed mutant ATP6
sequence was designed to contain an AvaI restriction site
(CCCGGG) without altering the amino acid sequence of the
resulting protein. To accomplish this, the arginine codon CGG
found in the mutated human T8993G sequence was utilized,
and the GCC alanine codon found in the human sequence was
substituted for the wild-type murine GCA alanine codon.
7. Any gene synthesis method can be used; several good protocols
are available [32–35]. Protocol outlines here represent a modi-
fication of the method of Young and Dong [17].
Acknowledgements
This work and development of outlined methods were supported

by NIH, NSF, the State University of New York at Oswego, the
Research Foundation for the State University of New York, Auburn
University, and the University of Alabama.
References
1. Timmis JN, Ayliffe MA, Huang CY et al (2004) low- and medium-dose visual results. Ophthal-
Endosymbiotic gene transfer: organelle gen- mology 124:1621–1634
omes forge eukaryotic chromosomes. Nat Rev 6. Moster ML, Sadun A, Klopstock T et al (2019)
Genet 5:123–135 rAAV2/2-ND4 for the treatment of LHON:
2. Nagley P, Devenish RJ (1989) Leading orga- 72-week data from the REVERSE phase III
nellar proteins along new pathways: the reloca- clinical trial. Neurology 92:Plen02.002
tion of mitochondrial and chloroplast genes to 7. Qi X, Sun L, Lewin AS et al (2007) The mutant
the nucleus. Trends Biochem Sci 14:31–35 human ND4 subunit of complex I induces
3. Dunn DA, Cannon MV, Irwin MH et al optic neuropathy in the mouse. Invest
(2012) Animal models of human mitochon- Ophthalmol Vis Sci 48(1):10
drial DNA mutations. Biochim Biophys Acta 8. Ellouze S, Augustin S, Bouaita A et al (2008)
1820:601–607 Optimized allotopic expression of the human
4. Wan X, Pei H, Zhao M et al (2016) Efficacy mitochondrial ND4 prevents blindness in a rat
and safety of rAAV2-ND4 treatment for model of mitochondrial dysfunction. Am J
Leber’s hereditary optic neuropathy. Sci Rep Hum Genet 83:373–387
6:21587 9. Cwerman-Thibault H, Augustin S, Lechauve C
5. Guy J, Feuer WJ, Davis JL et al (2017) Gene et al (2015) Nuclear expression of mitochon-
therapy for Leber hereditary optic neuropathy: drial ND4 leads to the protein assembling in
complex I and prevents optic atrophy and
visual loss. Mol Ther Methods Clin Dev 22. Houdebine LM (2014) Design of vectors for
2:15003 optimizing transgene expression. In: Pinkert
10. Yu H, Koilkonda RD, Tsung-Han C et al CA (ed) Transgenic animal technology: a labo-
(2015) Consequences of zygote injection and ratory handbook. Academic Press, San Diego,
germline transfer of mutant human mitochon- pp 419–458
drial DNA in mice. Proc Natl Acad Sci U S A 23. Taylor SW, Fahy E, Ghosh SS (2003) Global
112:E5689–E5698 organellar proteomics. Trends Biotechnol
11. Dunn DA, Pinkert CA (2012) Nuclear expres- 21:82–88
sion of a mitochondrial DNA gene: mitochon- 24. Stojanovski D, Johnston AJ, Streimann I et al
drial targeting of allotopically expressed (2003) Import of nuclear-encoded proteins
mutant ATP6 in transgenic mice. J Biomed into mitochondria. Exp Physiol 88:57–64
Biotechnol 2012:541245. https://doi.org/ 25. Voos W, Martin H, Krimmer T et al (1999)
10.1155/2012/541245 Mechanisms of protein translocation into mito-
12. Oca-Cossio J, Kenyon L, Hao H et al (2003) chondria. Biochim Biophys Acta
Limitations of allotopic expression of mito- 1422:235–254
chondrial genes in mammalian cells. Genetics 26. Funes S, Davidson E, Claros MG et al (2002)
165:707–720 The typically mitochondrial DNA-encoded
13. Perales-Clemente E, Fernández-Silva P, Acı́n- ATP6 subunit of the F1F0-ATPase is encoded
Pérez R et al (2011) Allotopic expression of by a nuclear gene in Chlamydomonas reinhard-
mitochondrial-encoded genes in mammals: tii. J Biol Chem 277:6051–6058
achieved goal, undemonstrated mechanism or 27. Rizzuto R, Simpson AW, Brini M et al (1992)
impossible task? Nucleic Acids Res Rapid changes of mitochondrial Ca2+ revealed
39:225–234 by specifically targeted recombinant aequorin.
14. Figueroa-Martı́nez F, Vázquez-Acevedo M, Nature 358:325–327
Cortés-Hernández P et al (2011) What limits 28. Nugent JM, Palmer JD (1991) RNA-mediated
the allotopic expression of nucleus-encoded transfer of the gene coxII from the mitochon-
mitochondrial genes? The case of the chimeric drion to the nucleus during flowering plant
Cox3 and Atp6 genes. Mitochondrion evolution. Cell 66:473–481
11:147–154 29. Daley DO, Adams KL, Clifton R et al (2002)
15. Valencik ML, McDonald JA (2001) Codon Gene transfer from mitochondrion to nucleus:
optimization markedly improves doxycycline novel mechanisms for gene activation from
regulated gene expression in the mouse heart. Cox2. Plant J 30:11–21
Transgen Res 10:269–275 30. Supekova L, Supek F, Greer JE et al (2010) A
16. Gustafsson C, Govindarajan S, Minshull J single mutation in the first transmembrane
(2004) Codon bias and heterologous protein domain of yeast COX2 enables its allotopic
expression. Trends Biotechnol 22:346–353 expression. Proc Natl Acad Sci U S A
17. Young L, Dong Q (2004) Two-step total gene 107:5047–5052
synthesis method. Nucleic Acids Res 32:e59 31. Holt IJ, Harding AE, Petty RK et al (1990) A
18. Polites HG, Johnson LW, Pinkert CA (2014) new mitochondrial disease associated with
DNA microinjection, embryo handling and mitochondrial DNA heteroplasmy. Am J Hum
germplasm preservation. In: Pinkert CA Genet 46:428–433
(ed) Transgenic animal technology: a labora- 32. Huang MC, Cheong WC, Ye H et al (2012)
tory handbook, 3rd edn. Elsevier, San Diego TopDown real-time gene synthesis. Methods
19. Pinkert CA (ed) (2014) Transgenic animal Mol Biol 852:23–34
technology: a laboratory manual, 3rd edn. San 33. Miklos AE, Hughes RA, Ellington AD (2012)
Diego, Elsevier Design and assembly of large synthetic DNA
20. Irwin MW, Pogozelski WK, Pinkert CA (2014) constructs. Curr Protoc Mol Biol 99:3.23
PCR optimization for detection of transgene 34. Zhang P, Ding Y, Liao W et al (2013) A simple,
integration. In: Pinkert CA (ed) Transgenic universal, efficient PCR-based gene synthesis
animal technology: a laboratory handbook, method: sequential OE-PCR gene synthesis.
3rd edn. Elsevier, San Diego Gene 524:347–354
21. Mizushima S, Nagata S (1990) pEF-BOS, a 35. Li G, Dong B-X, Liu Y-H et al (2013) Gene
powerful mammalian expression vector. synthesis method based on overlap extension
Nucleic Acids Res 18:5322 PCR and DNAWorks program. Methods. Mol.
Biol 1073:9–17
Chapter 2
Mitochondrial Transplantation for Ischemia Reperfusion

Injury
Abstract
Mitochondrial transplantation is a novel therapeutic intervention to treat ischemia-reperfusion-related
disorders. This approach uses replacement of native mitochondria with viable, respiration-competent
mitochondria isolated from non-ischemic tissue obtained from the patient’s own body, to overcome the
many deleterious effects of ischemia-reperfusion injury on native mitochondria. The safety and efficacy of
this methodology has been demonstrated in cell culture, animal models and has been shown to be safe and
efficacious in a phase I clinical trial in pediatric cardiac patients with ischemia-reperfusion injury. These
studies have demonstrated that mitochondrial transplantation rescues myocardial cellular viability and
significantly enhances postischemic myocardial function following ischemia-reperfusion injury. Herein,
we describe methodologies for the delivery of isolated mitochondria.
Key words Mitochondrial transplantation, Mitochondrial isolation, Ischemia-reperfusion, Intracor-

onary delivery, Direct injection
1 Introduction
Mitochondria are present in every cell in the body except for the red
blood cells. In the heart, the mitochondria represent approximately
30% of cardiomyocyte cell volume and provide the majority of
energy to allow for myocardial cellular viability and function. To
meet the energy demands of the myocardium, the mitochondria are
dependent upon a continuous supply of oxygen delivered by the
coronary arteries and extract more than 78% of the coronary artery
oxygen at rest. Thus, the heart is an obligate aerobic organ.
Decreases in oxygen delivery due either to constriction, blockade,
or disruption result in the rapid onset of ischemia and initiate a
cascade of mechanism resulting in loss of cellular viability and
decreased myocardial function [1–4].
We and others have demonstrated that ischemia damages mito-
chondrial structure, volume, calcium accumulation, complex
Volkmar Weissig and Marvin Edeas (eds.), Mitochondrial Medicine: Volume 3: Manipulating Mitochondria and Disease- Specific
Approaches, Methods in Molecular Biology, vol. 2277, https://doi.org/10.1007/978-1-0716-1270-5_2,
15
16 Ilias P. Doulamis and James D. McCully
activity, oxygen consumption, high energy synthesis, and activates

the mitochondria-mediated intrinsic apoptotic pathway, and causes
mtDNA deletion [5–19]. These events occur during ischemia and
extend into reperfusion, despite the restoration of coronary blood
flow and oxygen delivery to the ischemic area, to severely compro-
mise postischemic functional recovery and cellular viability [5, 7–
10, 13, 15–19].
Throughout the years, there have been a myriad of interven-
tions proposed to allow for the alleviation of myocardial ischemia-
reperfusion injury. For the most part, these interventions have
focused on a single function or a mechanism and have been
shown to provide only limited cardioprotection [20–24].
We rationalized that the therapeutic approach to cardioprotec-
tion should be comprehensive rather than involving a single ele-
ment or mechanistic pathway [9]. To this end, we speculated that
the replacement or augmentation of mitochondria damaged during
ischemia and reperfusion should be the target for therapeutic inter-
vention. We hypothesized that the transplantation of viable mito-
chondria isolated form the patient’s own body, from a
non-ischemic area, and then delivered into the ischemic area
would replace or augment damaged mitochondria and allow the
heart to recover from ischemia-reperfusion injury.
We have validated this hypothesis in a series of in vitro, isolated
perfused and in vivo blood perfused heart models that demonstrate
that mitochondrial transplantation rescues myocardial cellular via-
bility and significantly enhances postischemic myocardial function
following ischemia-reperfusion injury [5, 7, 9, 15].
2 Mitochondrial Transplantation Techniques
The methodology for mitochondrial isolation and quality control

and quality assurance have been previously published [6, 17, 18,
25]. In this chapter we describe the protocol we use for the delivery
of mitochondria.
Mitochondrial transplantation can be delivered by direct
epicardial injection or intracoronary delivery to the heart or by
co-incubation in cell culture. The reader is directed to our other
publications describing mitochondria delivery to lung using the
pulmonary artery or aerosol delivery [26].
All materials used for the delivery of mitochondria should be
sterile in order to avoid any contamination of the mitochondria or
infection of the patient.
Mitochondrial Transplantation 17
2.1 Direct Epicardial 1. A sterile tube or suitable container to collect and resuspended
Injection isolated mitochondria. The tube should be kept at 4 C.
2.1.1 Materials 2. A tuberculin syringe (1 mL).
3. A 28- or 32-gauge needle.
2.1.2 Method 1. The mitochondria are loaded into the syringe at the recom-
mended concentrations per 1 mL buffer (see below).
2. Injections are delivered into the area-at-risk.
3. Injection volumes are 50–100 μL each.
4. Injections can be delivered directly to the epicardial tissue in a
manner that allows for access. There is no need for the mito-
chondria to be delivered obliquely.
5. Injections in the beating heart are best made by gently placing
the needle on the epicardial surface and penetrating during the
cardiac diastolic phase.
6. We have found no flash back at these volumes and there is no
need for purse string sutures to retain mitochondria [8, 9, 15–
17, 19].
7. Epicardial echocardiography should be performed following
delivery of the mitochondria to ensure lack of intramyocardial
hematoma development.
In our studies we have delivered 0.5–10 107 mitochondria to
each of 8–10 sites within the area-at-risk [8, 9, 16, 17, 19]. Each
injection was 50–100 μL.
Direct injection of mitochondria provides localized distribu-
tion of mitochondria [16].
Mitochondrial concentrations of 2 108 are not fully sus-
pended in 1 mL of buffer and are therefore not advised for mito-
chondrial transplantation by direct injection [9].
2.1.3 Pros – Easy and fast procedure.

– Selective and precise administration of mitochondria to ischemic
region or area–at–risk.
2.1.4 Cons – Requires direct access to the organ of interest.

– Requires manipulation of the heart for injection to the medial
and posterior sides. These manipulations may result in compres-
sion of the coronary arteries and should be performed in a safe
manner.
– Does not allow for global distribution of the mitochondria
within the heart.
2.2 Intracoronary Mitochondria can also be delivered by antegrade intracoronary

Delivery delivery [5, 13, 17, 27].
2.2.1 Materials 1. A sterile tube or suitable container to collect and resuspend

isolated mitochondria. The tube should be kept at 4 C.
2. A 10 mL syringe.
3. A 5F multipurpose guide-catheter (Merit Medical Systems,
South Jordan, UT).
4. Iodinated contrast medium (Optiray 350 Ioversol 74%, Guer-
bet, Villepinte, France).
5. Sterile standard saline solution.
2.2.2 Method Intravascular delivery of mitochondria can be achieved by cannula-

tion of the radial or femoral artery, which are the usual sites of
access for coronary angiogram or percutaneous coronary
intervention.
In large animal studies, percutaneous access to the heart is
gained by right carotid artery catheterization or sterile cut down.
An angiography sheath is then introduced according to the Seldin-
ger technique. Briefly, the desired carotid artery is punctured with a
sharp hollow needle, with ultrasound guidance if necessary. A
round-tipped guidewire is then advanced through the lumen of
the needle, and the needle is withdrawn. The angiography sheath
is now passed over the guidewire into the vessel [28].
Angiographic access to the left coronary artery is established by
floating a 5F JR angiography catheter (Merit Medical Sys, UT)
through the right carotid artery (5F sheath) to the left coronary
ostium under fluoroscopy. The coronary tree is visualized by injec-
tion of 5 ml of contrast solution (74% Ioversol Optiray-350, Mal-
linckrodt Inc. MO) over 5 s followed by a 5 mL saline flush.
Intravascular delivery of mitochondria is performed by ante-
grade injection, into the left coronary ostium as a bolus of 1 109
mitochondria in 5 mL buffer followed by a 5 mL saline flush. The
mitochondria are rapidly taken up and distributed throughout the
left ventricle. The mitochondria do not go beyond the end organ
[5, 15].
2.2.3 Pros – Direct access to the organ of interest not required.

– Allows for global distribution of the mitochondria.
2.2.4 Cons – Requires arterial catheterization and the use of contrast and
radiation.
– Does not allow for administration of mitochondria on a very
specific spot.
3 Co-incubation
Mitochondrial uptake can be readily performed in cell cultures. We

and others have used direct co-incubation [11, 12, 14, 16, 29–
37]. Alternative methods for mitochondrial uptake in cell cultures
include the use of Mitoception, Mitoblade, mitochondria-specific
ligands and compounds (see techniques and protocols in [36, 38–
48]).
3.1 Materials 1. A sterile tube or suitable container to collect and resuspend

isolated mitochondria. The tube should be kept at 4 C.
2. Appropriate cell line.
3. Appropriate media and antibiotics.
4. 24-well cell culture plates (CytoOne; USA Scientific,
Ocala, FL).
5. Glass inserts for 24-well plates (Thomas Scientific,
Swedesboro, NJ).
6. A 24-well black plate with clear bottom for ATP luminescence
(Thomas Scientific, Swedesboro, NJ).
3.2 Method Note: For standardization and quantification we usually assess

mitochondrial uptake and ATP estimation in parallel using two
24-well plates. One plate has glass inserts in each well to allow for
histology analysis while the other has darkened sides to allow for
ATP luminescence [6].
3.2.1 Cell Plating 1. Grow appropriate cells to 70–80% confluence on a 100 mm

culture plate.
2. Lift cells by standard trypsin methodology and determine cell
concentration.
3. Plate 50,000 cells per well on glass inserts (for histology) or
directly in the wells in a 24-well plate.
4. Grow overnight.
5. Check cell viability and attachment prior to use for mitochon-
drial uptake.
3.2.2 Isolate The methodology for mitochondrial isolation and quality control
Mitochondria and quality assurance has been previously published [6, 18, 25].
Note: We recommend the use of our method for the isolation
of mitochondria [6]. If other methods are used, ensure no con-
taminants from foreign DNA or antibodies or isolation gradient are
present [25].
1. Isolate mitochondria.
2. Determine mitochondria number by hemocytometer or by
particle count using a Beckman Multisizer 4e Coulter counter
or a similar device (Beckman Coulter, Pasadena, CA) [6, 25].
3. Resuspend the freshly isolated mitochondria (1 109–
1 1010 in 1 mL buffer (300 mmol/L sucrose, 10 mmol/L
HEPES-KOH, 1 mmol/L EGTA-KOH, pH 7.4) in a 1.5 mL
Eppendorf tube.
Note: We use 1 tube of freshly isolated mitochondria (1 109–
1 1010 in 1 mL buffer) for mitochondrial uptake and 1 tube of
freshly isolated mitochondria (1 109–1 1010 in 1 mL buffer)
for ATP determination. All reactions are performed in parallel to
ensure replication and estimation validity.
3.2.3 For Mitochondrial 1. MitoTracker Red CMXRos is dissolved in 600 μL Dimethyl

Uptake sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO; approx
230 nM final concentration). Note: Use only fresh DMSO.
Store at 20 C.
2. Defrost MitoTracker Red CMXRos on ice.
3. Add 2 μL of MitoTracker Red CMXRos (per 500 μL of ali-
quot) to isolated mitochondria.
4. Cover with foil to prevent light quenching.
5. Incubate on ice for 10 min.
6. Centrifuge at 14,000 RPM (18,407 g) at 4 C in an Eppen-
dorf centrifuge (Centrifuge 5424R, Eppendorf, Hamburg,
Germany) for 10 min.
7. Discard the supernatant.
8. Resuspend the pellet in 1 mL buffer.
9. Recentrifuge at 4 C in an Eppendorf centrifuge for 10 min.
16. Remove supernatant and save as control.
17. Resuspend the pellet in buffer (1 103–1 107 in
100–200 μL buffer).
18. Store on ice.
19. Use immediately.
3.2.4 For ATP or Other 1. Resuspend the freshly isolated mitochondria (1 109–
1 1010 in 1 mL buffer (300 mmol/L sucrose, 10 mmol/L
HEPES-KOH, 1 mmol/L EGTA-KOH, pH 7.4) in a 1.5 mL
Eppendorf tube.
2. Centrifuge at 14,000 RPM (18,407 g) at 4 C in Eppendorf
centrifuge for 10 min.
12. Remove supernatant and save as control.
13. Resuspend the pellet in buffer (1 103–1 107 in
100–200 μL buffer).
14. Store on ice.
15. Use immediately.
3.2.5 Cells Note: Some cell lines are extremely sensitive to Subtilisin A (Prote-
ase from Bacillus licheniformis, Type VIII, lyophilized powder,
7–15 units/mg solid, Sigma-Aldrich, St. Louis, MO). Multiple
washes are recommended.
1. Have cells ready for co-incubation.
2. Remove media from each well.
3. Add 100–200 μL of media containing mitochondria at desired
concentration in each well.
4. Control cells are incubated with 100–200 μL of the saved
last wash.
Note: Mitochondria float, as evidenced by the use of dif-
ferential centrifugation techniques for isolation and thus for
co-incubation to occur the mitochondria must be in contact
with the cells.
Note: Mitochondria number for co-incubation can vary;
however, we have found that concentrations less than or equal
to 1 107/50,000 cells in a 24-well plate are optimal.
Mitochondria concentration greater than 1 107/50,000
cells in a 24-well plate is not recommended.
5. Incubate cells as usual for required time. If incubating beyond
24 h, add fresh media at 24 h as appropriate.
6. Determine uptake by Fluorescent Microscopy [9, 14, 49].

7. ATP content can be determined using the ATPlite Lumines-
cence ATP Detection Assay System (Perkin Elmer, Waltham,
MA, USA) (see reference [6] for methodology).
3.2.6 Pros – Simple procedure.

– Allows for multiple samples to be performed at one time.
– Low cost.
3.2.7 Cons – Does not replicate in vivo.
4 Discussion
4.1 Mitochondria The methodology for mitochondria isolation and quality control
Isolation and assurance have been previously published [6, 25].
The advantages of this method are:
1. It requires only a small amount of tissue (<0.01 g tissue, wet
weight).
2. The tissue is obtained from the patient thus eliminating inflam-
matory and immune reaction.
3. It uses a standardized tissue dissociation process that allows for
uniform and consistent homogenization of tissue that is not
easily achieved with manual homogenization methods.
4. The use of differential filtration eliminates time-consuming and
repetitive centrifugation steps.
5. It can be performed in less than 30 min.
6. It can be performed at the bedside.
7. It can be performed multiple times as needed during the oper-
ative procedure.
8. It can be performed within the time frame of the surgical
procedure and does not delay surgical protocols [6, 8, 19].
The isolated mitochondria are viable and maintain membrane
potential and all complex activity and are fully capable of oxygen
uptake and ATP production [15, 16, 24]. Contamination by
non-mitochondrial particles as determined by transmission elec-
tron microscopy is less than 0.001% [15, 16, 24]. Enzymatic analy-
sis of mitochondria isolates for the cytosolic and cytoplasmic
contaminant markers glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), lactate dehydrogenase (LDH), and microsome con-
taminate markers 50 nucleotidase and glucose- 6-phosphatase were
undetectable [15, 16, 24, 25]. No nuclear DNA was detectable in
isolated mitochondrial samples by qPCR [15, 16, 24, 50]. Western
Fig. 1 Intravascular delivery and direct injection of mitochondria. Schematic

illustrating mitochondrial transplantation by intravascular delivery or direct
injection
blot analysis showed no detectable contamination in agreement

with enzymatic and transmission electron microscopy analysis
[15, 16, 24, 50]. Functional analysis of isolated mitochondria
shows that the isolated mitochondria maintain complex I, II, III,
IV, and V activity and that oxygen consumption and respiratory
control index for malate-induced complex I and succinate-induced
complex II are equal to that of mitochondria isolated by other
methodologies [6, 15, 16, 24, 50–53]. Functional assessment of
the isolated mitochondria and quality assurance and quality control
have been described previously [25].
Once isolated, the mitochondria are immediately used for
transplantation. Transplantation can be performed by direct injec-
tion or by intravascular delivery (Fig. 1) [9, 13, 17, 24, 27].
4.2 Mitochondrial Mitochondria can be isolated from almost every cell type. For our
Source studies we have used skeletal muscle tissue obtained from the
patient’s own body [5–9, 11–19, 27, 50, 54, 55]. For clinical
application, the source of tissue is dependent upon the surgical
entry point and access. In adults undergoing cardiac surgery
using a minimal thoracotomy, we have found that the pectoralis
major is a good source of tissue [13, 16, 17, 24, 27]. In patients
undergoing a sternotomy, the rectus abdominus muscle is used
[8, 19]. When performing a carotid cut-down for catheter access
we have used the sternocleidomastoid muscle [13, 24, 27].
The size of the tissue samples obtained from the respective
muscle sample is small, 6 mm [6, 16]. We obtain the samples
using a #6 biopsy punch. Only two samples are needed for each
isolation, and these samples yield approximately 1 1010 mito-

chondria. It is recommended that if the tissue source cannot be
obtained directly using a biopsy punch that the tissue be dissected
using scissors. The use of electro-cauterizing blades is not recom-
mended due to heat buildup that damages the mitochondria.
4.3 Suspension Once isolated, the mitochondria are resuspended in vehicle. For
in Solution our purposes we have used buffer solution (300 mmol/L sucrose,
10 mmol/L HEPES-KOH, 1 mmol/L EGTA-KOH, pH 7.4);
however, respiration media (250 mmol/L sucrose, 2 mmol/L
KH2PO4, 10 mmol/L MgCl2, 20 mmol/L K + -HEPES buffer,
pH7.2, 0.5 mmol/L K + -EGTA, pH 8.0, 5 mmol/lL glutamate,
5 mmol/L malate, 8 mmol/l succinate and 1 mmol/L ADP) or
PBS (phosphate buffered saline, 137 Mm/L NaCl, 2.7 mM
KCl/L, 8 mM Na2HPO4/L, and 2 Mm/l KH2PO4) can also
be used.
We recommend vehicle buffer for use as respiration buffer must
be made fresh and requires multiple steps to ensure sterility, all of
which require time.
Note: All buffers must be sterilized by filtration through a
22 um filter prior to use.
Note: For direct injection, the number of mitochondria sus-
pended in vehicle cannot exceed 108. Our studies have shown
that mitochondrial concentrations exceeding 2 108 mitochon-
dria are not fully distributed in the vehicle.
4.4 Stability Our studies have demonstrated that oxygen consumption rate
of Isolated (OCR) in isolated mitochondria is stable for at least 2 h when
Mitochondria stored on ice. Mitochondrial OCR for malate (complex I) immedi-
ately following isolation was 106.6 6.0 (nM O2/min/ mg mito-
chondrial protein) [6, 16]. No significant difference in OCR was
observed at 30, 60, 90, or 120 min after isolation with storage on
ice. OCR was 94.3 9.3; 101.6 0.7.3; 91.3 9.6; and
94.6 6.6 nM O2/min/ mg mitochondrial protein, respectively.
OCR at 3 h storage was significantly decreased to 33.6 4.6 nM
O2/min/mg mitochondrial protein [6, 16] (Fig. 2).
This is in agreement with previous reports that have shown that
mitochondrial bioenergetic function is decreased to <10–15% of
normal after the mitochondria were frozen, even when preserva-
tives are used [56, 57]. Nuckala et al. have demonstrated that
despite the addition of well-characterized preservatives and cool-
ing–freezing protocols, isolated mitochondria lose functional
capacity [58].
4.5 Mitochondrial For cardiac use, we recommend 2 105–2 106 mitochondria per
Concentration gram tissue wet weight. These concentrations have been deter-
mined by studies performed using 2 105, 2 106, 2 107,
and 2 108 mitochondria per gram tissue wet weight. Our results
Complex I : Oxygen Consumption Rate

150
nM O2/min/mg mitochondrial
100
protein
50
*
0
1 30 60 90 120 180
Minutes after Isolation
Fig. 2 Oxygen consumption rate in isolated mitochondria. Barplots showing

mitochondrial oxygen consumption rate for malate (complex I) immediately
following isolation at 1, 30, 60, 90, 120, and 180 min post isolation. All
samples were stored at 4 C prior to measurement. All values are mean
SEM for n ¼ 6. *p < 0.05 vs. Baseline
have shown that there is no increase in cardioprotection achieved

using mitochondria concentrations exceeding 2 105–2 106
mitochondria per gram tissue wet weight. Our results show that
with the area-at-risk being similar between all groups (30 4%),
infarct size was 7.9 2.9%, 6.3 3.1%, 6.8 2.6%, and
6.0 2.7%, respectively for 2 105, 2 106, 2 107, and
2 108 mitochondria. No significant difference in infarct size
was determined among groups (Fig. 3). In all our studies using
direct injection, we have suspended the mitochondria in a final
volume of 1 mL and injected them at 8–10 sites within the area-
at-risk. Mitochondrial concentrations >2 108 were not entirely
suspended in 1 mL buffer; so, these concentrations were not
employed [9, 59].
These results have been confirmed in in-vivo studies where we
have demonstrated that cardioprotective effects are maximized in a
concentration dependent manner, with maximal benefit being
achieved using 1 109 mitochondria (equivalent to 2 105–
2 106 mitochondria per gram wet weight). Lower mitochondrial
injection concentrations of 1 103, 1 105, and 1 107 demon-
strated decreased efficacy. Higher dosages of 1 1011 mitochon-
dria or serial dosage of 1 109 mitochondria delivered in 10 serial
injections (1 1010) had no effect on cardioprotection as com-
pared to 1 109 mitochondria [13, 24].
26
B C
100
D E
80
1 x 109
60 1 x 1011
1 x 107
40
1 x 105
20
Dead 1 x 109
Coronary Blood Flow (mL/min)

1 x 103
50
0
100
0 5 10 20 30 40 60 80 100 120 140 160 180 200 220 240 270 300 330 360 390 410
F G
90
NS *
Time (seconds) 40
80
70 30
60
*
50
20
40 NS
30
(% Equilibrium)
20 10
10
Infarct Size/ Area-at-Risk (%)
0 0
2 x 105 2 x 106 2 x 107 2 x 108 Vehicle 2 x 105 2 x 106 2 x 107 2 x 108 Vehicle
Systolic Shortening at 120min. Reperfusion

Mitochondria per gram wet weight Mitochondria per gram wet weight
Fig. 3 Mitochondrial concentration for use in heart. (a) Continuous coronary blood flow (CBF) at the mid-left anterior descending artery upon intracoronary injection
of dead mitochondria and live mitochondria at mitochondrial concentrations of 1 103, 1 105, 1 107, 1 109, and 1 1011 (n ¼ 6). There was no difference
observed in CBF for Vehicle alone as compared to dead mitochondria. Global functional assessments of left ventricular (LV) post-intracoronary injection of
mitochondria at mitochondrial concentrations of 1 103, 1 105, 1 107, 1 109, and 1 1011. (b) maximal rate of rise of LV pressure (max % dP/dt); (c) LV
peak developed pressure (LVPDP); (d) LV end diastolic pressure (LVEDP) (n ¼ 6). (e) Regional LV contractile assessment by percent segmental shortening (%SS)
(n ¼ 6). (f) Systolic shortening at 2 105, 2 106, 2 107 and 2 108 mitochondria per gram tissue (wet weight) and (g) infarct size at 2 105, 2 106,
2 107 and 2 108 mitochondria per gram tissue (wet weight). All values are mean SEM, averaged over 60 cardiac cycles immediately post intracoronary
ä
Fig. 3 (continued) injections. *P < 0.05 vs. Vehicle. These results demonstrate that in cardiac tissue maximum benefits occur using 2 105 to 2 106mitochon-
dria per gram tissue (wet weight) equal to 1 109 mitochondria in adult heart. No adverse effects were observed at concentrations greater than 2 105 to
2 106 mitochondria per gram tissue (wet weight). (From: McCully et al. Am. J. Physiol. Heart Circ. Physiol. 2009; Shin et al. JACC Basic Transl. Sci. 2019)
Mitochondrial Transplantation
27
Coronary blood flow and maximal rate of rise of left ventricular

(LV) pressure (max % dP/dt); LV peak developed pressure,
regional LV contractile function (segmental shortening, systolic
shortening, determined by sonomicrometry and by echocardiogra-
phy), and infarct size reduction were maximally achieved using
1 109 mitochondria (equivalent to 2 105–2 106 mitochon-
dria per gram wet weight) [5, 13, 15–17, 27, 55].
These studies and those of others suggest that the number of
mitochondria required for cardioprotection is not a function of the
absolute number of mitochondria residing within the cell [3, 5, 9,
13, 15, 17, 36, 39, 42, 43]. Only a small fraction of this number
appears to be needed for cardioprotection following ischemia and
reperfusion. This would agree with Shoffner et al. [60] who have
demonstrated that only 2–6% of mtDNA needs be wild-type to alter
oxygen uptake and the devastating effects of the mitochondrial
myopathy MERRF (Myoclonic epilepsy and ragged-red fiber dis-
ease) and with Chomyn et al. who have reported that levels of only
6% wild-type mtDNA are sufficient to modulate the effects of
MELAS (Mitochondrial Encephalopathy, Lactic acidosis, and
Stroke-like episodes) [61].
4.6 Safety The transplanted mitochondria have no effect on coronary artery

patency and are not pro-arrhythmic as evidenced by serial 12-lead
electrocardiogram (ECG) analysis and optical mapping
[16, 24]. There are no ventricular tachycardia, bradycardia, fibrilla-
tion, or conduction system defects or repolarization heterogeneity
associated with mitochondrial transplantation and there are no
changes in serial ECG, QRS duration or corrected QT interval
[13, 16, 24, 27]. There is no evidence of any changes associated
with ventricular wall motion disturbances, left ventricle hypertro-
phy, valve dysfunction, fibrosis, or pericardial effusion either at the
time of injection, or at any time up to 4 weeks following transplan-
tation of autologous mitochondria [5, 7–9, 13, 15–17]. Optical
mapping studies using a 400-fold higher number of mitochondria
(8.4 107/ as compared to 2 105 mitochondria per gram tissue
wet weight) showed no detectable abnormal impulse propagation
on the myocardial surface associated with mitochondrial
transplantation [16].
The transplanted mitochondria produce no immune, autoim-
mune, or inflammatory response [8, 9, 16, 19, 50]. Enzyme-linked
immunoassays and multiplex immunology studies demonstrate that
autologous mitochondrial transplantation does not induce immune
response. There was no upregulation of immune response cytokines
(IL-1, IL-4, IL-6, IL-12, IL-18, IP-10) or macrophage inflamma-
tory protein MIP-1α and MIP-1β, which is observed in patients
with acute heart transplantation rejection. Auto-immune response
measured by anti-mitochondrial antibodies using indirect immu-
nofluorescence was undetectable [8, 16, 19, 50].
4.7 Autologous At present, we have delivered only autologous mitochondria for

and Heterologous clinical usage [8, 19]. In some situations, the use of autologous
Mitochondria mitochondria would not be useful. Such cases include but are not
limited to cases where skeletal muscle tissue damage is diffuse
making the isolation of viable mitochondria difficult or cases in
which the patient has an existing mitochondrial myopathy due to
pathogenic mutations in mtDNA [62, 63].
In such cases the isolation and transplantation of dysfunctional
mitochondria would not be beneficial.
To expand the therapeutic potential of mitochondrial trans-
plantation, we have recently investigated the use of heterologous
mitochondrial transplantation [50]. These studies were performed
in the pedigreed mouse model, in which mitochondria were deliv-
ered by intraperitoneal injection in order to maximize the immune
response [64].
Autologous and heterologous mitochondrial transplantation
were investigated using single injection at mitochondria concentra-
tions of 1 105, 1 106 and 1 107 mitochondria and serial
injections of 1 107 mitochondria. These concentrations are 10-,
20-, and 30-fold, respectively (for single injection), and 90-fold
(for serial injection) the concentration of mitochondria used in all
our studies [8, 9, 13, 15, 16, 19, 24, 26, 27, 54, 55, 65]. Immune
response measured by ELISpot, FACS, Multiplex analyses and
measurement of DAMPs (Damage-associated molecular patterns)
were performed at 10–17 days post injection to ensure maximal
immune response detection [50].
Our results demonstrate that there is no direct or indirect,
acute or chronic alloreactivity, allorecognition or DAMPs reaction
to single or serial injections of either syngeneic (autologous) or
heterologous mitochondria [50]. There was no detectable increase
as compared to control in circulating free mitochondrial DNA and
no change in tissue viability in either heart or lung tissue
[50]. These data indicate that either autologous or heterologous
mitochondria may be used for mitochondria transplantation.
The efficacy of this approach has recently been demonstrated by
us in the diabetic rat heart [55]. Long term-effects of xenogeneic
mitochondrial transplantation in the rabbit and swine heart have
also shown no detectable immune response as determined by Mul-
tiplex analysis [16, 17]. While these studies provide a basis for
eventual usage in mitochondrial myopathy patients and in patients
in which tissue sources are limited, further studies are needed to
show long-term safety and efficacy in specific models.
No difference in the cardioprotection afforded by autologous
mitochondrial transplantation was observed using either total,
interfibrillar, or subsarcolemmal mitochondria or with mitochon-
dria isolated from liver tissue [9].
4.8 Mitochondrial In previous studies, 1 108 18F-R6G-labeled or 18F-R6G and iron

Uptake oxide nanoparticle-labeled human mitochondria have been directly
and Internalization injected or delivered by intracoronary injection to regionally ische-
mic isolated rabbit and swine hearts to visualize exogenously-
derived mitochondrial tissue distribution following direct injection
or vascular delivery [15, 24].
Fluorescent, light, transmission electron microscopy, PET and
MRI have demonstrated that transplanted mitochondria are pres-
ent and viable for at least 28 days following injection into the
myocardium [9, 15–17].
The majority of injected mitochondria are found initially within
the interstitial spaces between cells. Within 2.5 min post-delivery,
the transplanted mitochondria are internalized within the cells by
endocytosis and are seen within cardiomyocytes residing near the
sarcolemma between Z-lines of the sarcomeres and in clusters
around endogenous damaged mitochondria as well as near the
nucleus. Enumeration of injected mitochondria has shown that
>80% of the injected mitochondria are attached to or found within
cardiomyocytes by 30 min [12, 14, 15, 24] (Fig. 4).
4.9 Endocytosis In 1982, Clark and Shay co-incubated mammalian cells with
isolated mitochondria from cultured cells having chloromycetin
resistance with cells having chloromycetin sensitivity. The authors
showed that the isolated mitochondria were taken up by an endo-
cytosis pathway, transferring the antibiotic resistance to the recipi-
ent cells [34]. Later, Katrangi et al., in 2007, demonstrated that
exogenous mitochondria can enter mitochondria-deficient cells
and recover cell respiratory function [35]. Kitani et al. extended
Labelled mitochondria Adjacent to the apical Undergoing endocytosis Inside iPS-CMs

cell surface
Fig. 4 Uptake and endocytic transport of extracellular mitochondria in cardiomyocytes. Induced pluripotent
stem cell-derived cardiomyocytes (iPS-CMs) were exposed to gold-labeled mitochondria isolated from human
cardiac fibroblasts for 2.5, 5, and 10 min and imaged by transmission electron microscopy. Labeled
mitochondria had electron-dense deposits and were apparent at all three study times outside cells, adjacent
to the apical cell surface, undergoing endocytosis, and inside cells (left to right and indicated by arrows).
Images are representative of four experiments at 5 min. Scale bars, 0.5 μm. (From: Cowan et al. Sci. Rep.
2017)
these findings by showing that mitochondria labeled with DsRed

and green fluorescence protein (GFP) when co-incubated with
recipient cells were rapidly taken up by the cells, as evidenced by
red and green fluorescence within the cells, after only minutes of
incubation [30, 31]. It was also shown that the recipient cell
viability and respiration ability significantly increased, and the effect
of exogenous mitochondria was maintained for approximately
25 days [16, 17].
These studies agree with our studies in vivo and in vitro
showing the rapid uptake and integration of exogenous mitochon-
dria by endocytosis [9, 12, 14–16]. We have confirmed the role of
endocytosis using cytochalasin D (caveola-dependent-clathrin
dependent endocytosis, tunneling nanotubes and macro-
pinocytosis were also examined) [12]. Only cytochalasin D signifi-
cantly decreased the internalization of mitochondria into cardio-
myocytes and decreased ATP content [12]. We have confirmed
these studies using three-dimensional super-resolution microscopy
and transmission electron microscopy to determine the intracellular
fate of exogenous mitochondria taken up by human iPS-derived
cardiomyocytes and primary human cardiac fibroblasts [14]. These
studies demonstrated that isolated mitochondria are incorporated
into cardiac cells within minutes and then transported to endo-
somes and lysosomes. The majority of exogenous mitochondria
(approximately 80%) escape from these compartments within min-
utes and fuse with the endogenous mitochondrial network, while
some of these organelles are degraded through hydrolysis [14].
These findings are confirmed by the studies of Kesner et al. [31]
who have also demonstrated that exogenous mitochondria are
transformed to recipient cells rapidly and co-localize with endoge-
nous mitochondria.
Mitochondrial transplantation, modulation by endocytosis is in
contrast to intercellular mitochondrial transfer where it has been
proposed that mitochondria are passed from one individual cell to
another via tunneling nanotubes [66–68]. Although it is possible
that intercellular mitochondrial transfer occurs following internali-
zation, this mechanism does not modulate internalization resulting
from mitochondrial transplantation [12].
The uptake of mitochondria is dependent on the integrity and
viability of the mitochondria. Kesner et al. [31] have shown that the
integrity of the mitochondrial outer membrane proteins is essential
for its transformation into cells. Disruption of the outer membrane
with digitonin significantly decreased mitochondrial uptake. This is
in agreement with our studies demonstrating that mitochondrial
viability is of prime importance in providing for uptake and inter-
nalization and final efficacy of mitochondrial transplantation [9].
The need for viable, freshly isolated mitochondria is imperative.
We have shown that nonviable mitochondria, mitochondrial pro-
teins, mitochondrial complexes, or mitochondrial RNA and DNA
Another random document with
no related content on Scribd:
Then, as she wriggled her annoyance, the laughter in the heart of him
materialized.
"My dear, I am incapable, at the moment, of taking anything seriously

except the fact that you have come back to me. Which is a matter rather for
rejoicing than for imprecations. If I seem to pass off this occurrence as
unimportant, it is only because it is so over-shadowed by the importance of
the realization that I exist again for you."
"I have never imagined you existed for anyone else," she protested
indignantly. "Another time you'll know that when it looks as if I were
thinking of someone else it's really that I am concentrating extra hard on
something connected with your happiness."
"I'll remember," Cyprian promised, slightly catching his breath.
* * * * * *
They had dismissed Digby Maur and his picture too airily. His suffering
was intense enough to cause his hatred of Cyprian to reflect again on Ferlie.
Everybody in the Club could see that he and Mrs. Clifford no longer
held sweet converse together nor walked in that House of Rimmon as
friends. Its numerous unmystical members openly rejoiced that Sterne had,
at last, put his foot down.
The iron entered into Digby Maur's soul. His was not the nature to forgo
visions of public revenge. Ferlie was involved in them because, although he
had unjustifiably presumed upon her frank comradeship to the extent of
insulting her, his desire, outweighing the elements of purer passion which
she had primarily awakened in him, was an emotion more likely to breed
wounded resentment than humble submission, on the well-deserved
withdrawal of its star.
Ferlie, though secretly confessing herself blame-worthy, realized too

thoroughly by now that dynamite, in proximity with a match-box however
innocently decorated, is not a reliable combination, and, having once
capitulated to Cyprian's judgment, could be safely trusted to abide by it.
Hence, even an armed truce was out of the question. She welcomed
with relief the news that Digby had taken casual leave and gone to
Rangoon.
"It shows he has accepted the position and means to be sensible," she
told Cyprian. "When he returns we can meet as club-acquaintances and it
will be forgotten that we ever appeared to be anything more."
"Burma does not forget," he said cloudily, and she understood that he
had learnt that lesson bitterly enough.
She might have been less sanguine of a happy ending to her own affair
if she had connected with Maur's departure a detailed announcement in the
Rangoon papers of a forthcoming Art Exhibition, on a large scale, and for
which contributions were invited in the form of original sketches, paintings,
leather-work, pottery and all the usual articles universally acknowledged,
on such occasions, a joy for ever.
Shrewdly positive that he possessed a work of Art worth exhibiting, and

a golden opportunity of advertising his hitherto unexploited talent, Digby
Maur had well-timed his leave. All individuals occupying the local seats of
the Mighty would be present; besides, at this height of the Season, many
outside visitors.
There must follow comment and inquiries as to the identity of the artist
who had produced "Imprisoned Flames."
He was right. There were visitors, and, among them, a millionaire on a

private steam-yacht and his personal physician; a young man with an
inquisitive expression, reddish hair and a loud happy voice which he
dogmatically raised upon matters which the Elderly and Unenterprising had
long elected to approach with caution.
In due course the new-comers found themselves conducted by the

residents, to the Art Show, where the chief item was already admitted to be
a unique painting which most people only remembered as the Girl and the
Gul Mohurs, though the artist had baptized it more erotically.
Said Peter to his neighbour, after a cursory glance, "Why, that's my
sister!"
Several people turned, and, amongst them, a hovering Anglo-Burman,

referred to in hushed tones as the artist.
Colonel Maddock put up his eye-glass with an astounded, "Bless my

soul! It is Ferlie. Where on earth did the little minx have it done?"
"It's damned good," said Peter. "Probably it is Cyprian's. I'd like to have
a copy. When we run them to earth we will ask them why they never told us
it was here."
The Colonel and Peter never discussed the fugitives.
Aunt B., mistrusting the frailty of human flesh, had not mentioned the
relationship under which they were masquerading. They might have already
dropped it in anticipation of the divorce to which in common sense they
must finally succumb. Better, she thought, to let Ferlie tell her own tale to
Peter. She had not foreseen that Ferlie would delay too long in replying to
Peter's letter, on the basis that least said on paper soonest mended.
So Peter and the Colonel only knew that the two were together and that
Ferlie's name was Mrs. Clifford to stave off the world's curiosity.
Digby Maur was already lionized, and, being Digby Maur, his head
already felt a little light.
He longed for Ferlie and Cyprian to hear of his triumph at first hand,
and appreciated, with a tinge of malice, that the daily papers would afford
Cyprian a resentful shock over the publicity bestowed upon the painting of
Ferlie.
He decided to find means of introducing himself to explain that the

picture was not for sale.
The opportunity occurred sooner than he expected, by way of a lady

who had once known the man reputed to be Digby Maur's father, and who
felt sorry for the quasi-European son, and glad of his success. She had met
the Colonel, and, aware of the respect in which the Banks held him, thought
to put the young artist in touch with a possible order for Burmese sketches.
Finding herself near Peter she manœuvred the two opposite one another and
was about to explain that Digby was the artist of "that red painting," when a
friend jostled against her in the crowd and engaged her in conversation.
Peter and Digby, barely introduced, were left face to face.
"I must say you have not even a family resemblance to your brother,"
hazarded Digby.
"Which is not surprising," and Peter eyed him with interest, "seeing that
I have no brother."
Maur recalled the Club conclusion of Cyprian's relationship to Ferlie.
"I should have said your half-brother, Mr. Sterne."
"Oh, you've met old Cyprian? No, he is not even my half-brother,

though people used to take him for an uncle. He is just an old family friend.
But if you have met him you may know my kiddie-sister. She is staying
with him in Burma at present."
A sudden unhealthy pallor left his companion's face putty-coloured.
"I didn't catch your name," Peter was saying when Digby recovered his
breath. "Mine's Carmichael. My sister is a Mrs. Clifford."
He slightly over-emphasized the unfamiliar title.
The eyes scrutinizing him narrowed.
"I have had the honour of painting Mrs. Clifford."
"By Jove! Then it was you——" Peter studied him afresh and stopped,
faintly uneasy. This man must know Ferlie quite well. What on earth had
made him suppose Cyprian his brother—or hers? Better not inquire, lest he
should put his foot on some unexplained situation. He drifted into
enthusiastic comment on the portrait and escaped to warn Colonel Maddock
of the artist's identity. He had been prepared for an equivocal attitude from
the narrow-minded, who might criticize Ferlie's staying with a friend of
Cyprian's calibre. Odd of Cyprian to rush her off like that to Burma. The
uncle part could be overdone. Aunt B. had said they were living in the wilds
and seeing no one, so it had appeared not to matter. He had assumed them
lost to both hemispheres till Ferlie should become stronger after her
troubles and able to make some satisfactory arrangement with Clifford.
She should have confided in her mother, or her only brother long ago.
Of course he saw that she could not be left to the care of a chap who, from
Aunt B.'s hints, was little better than a maniac on one point, however sane
he might be on all others. Like the Vane woman, he would probably end in
a Home, unless—and Peter eagerly recalled certain experiments he had
been requested to make in Ruth Levine's flat and on the efficacy of which
he was now awaiting her final verdict. He was so "keen" on insanity and if
his ideas consolidated into success there seemed no limit to his horizon.
His gaze into space grew abstracted and he dismissed Maur's inquiry
with a shrug. People always took for granted that old Cyprian was some
sort of a relation: this fellow had obviously noticed that Ferlie did not use
the prefix "Uncle," and had assumed the rest.
Rum chap, Cyprian. A queer friend for her to have stuck to all these
years. He really must hint to her, though, that she could not, in any country,
pay an indefinite visit to a man friend, however elderly, without asking for
the acidulated comments of catty women and coarse-minded men.
By the time he found the Colonel that gentleman had already been
presented to Maur; who had made hay to some purpose; having decided to
try another tack and assume Cyprian something different from a brother,
this time.
"Yes, I have had the great privilege of painting Mrs. Clifford, sir. Do
you happen to be acquainted with her husband?"
The Colonel was grateful for the lead. He thought Peter had suggested
that Ferlie was posing as a widow. Much better to have admitted separation,
since, at this distance, awkward questions could not be answered anyway.
"I have met him and have no desire to meet him again. You can take it
from me, Mr. Maur, that she was altogether wise in insisting that they
should live their lives apart. As for your picture of her I should have much
pleasure..." etc., etc.
He certainly thought he must have done Ferlie a good turn if this man
should be a talker. The chances were now people would get to know the
husband was impossible. He blandly concentrated on the picture.
"This one is not for sale," Digby assured him. "But if I can persuade
Mrs. Clifford to sit again—and I think that will be possible—I should be
happy to execute you a fresh order, though I never reproduce. I wonder if a
bank of our red lilies and the hint of a gold pagoda-roof in the middle
distance, reflected in water—you have visited the lakes?"
Maddock eventually gave the order for another portrait, subject to

Ferlie's acquiescence.
"We shall be hoping to arrange a meeting soon. Must run up to

Mandalay first."
However, after an interview with Peter, they both came to the

conclusion that Ferlie should not have left her nearest friends so much in
the dark as to her tactics.
"Aunt B. declared that she was calling herself a widow," said Peter,
"hence the 'Mrs. Clifford.' It was easier to avoid publicity and the interest of
the folk who covet their neighbour's peace of mind. The 'brother' mistake is
fishy preceding his attitude to you. We must pick our way if we don't want
to get Ferlie's name handed round with the ice-cream at every official show
going. When we see her I shall put it to her straight."
Digby Maur's leave at an end, Government House had shaken him

warmly by the hand. He had gained for himself a reputation, and the power
to shatter one.
CHAPTER XV
"Ferlie," said Cyprian, one morning, pushing back his chair from the
breakfast-table, "are you feeling all right?"
"Feeling all—what do you mean?"
"You're not, then?"
Her smile was uncertain.
"Don't be silly! Why should I be feeling wrong?"
"That's just what I have been asking myself for more than a week. The
Hot Weather is not nearly upon us yet."
"I'm quite well," she insisted listlessly.
"Then, what is the matter?"
"Nothing."
"Oh!"
"Cyprian, don't tease," and her unnerved vexation contained, he

imagined, a hint of alarm; "there is nothing the matter. Though I see you are
determined to believe that a lie."
"It is one," he replied, opening the newspaper.
She resorted to a stormy exit.
What else could she do when he was right? It seemed sometimes a great
deal too high, the price she was paying to preserve their flawless peace. At
least, it had been flawless until Digby Maur returned from Rangoon, but not
to fall easily into his niche as a casual acquaintance.
She wondered, when she sat staring at him on the river-bank below the
garden with its wild, concealing foliage, why she had never before thought
of comparing his eyes to a snake's.
He painted on, grimly speechless, but when they travelled over her,
devoid of expression, coldly alive, she could have fled in panic. And she
had got to see the thing out or everyone would learn that Cyprian had
brought her here under false colours and that, somewhere in England, dwelt
her husband, complacently aware of their flight.
The scandal would force Cyprian to resign, to whom public criticism of

his private affairs, even in simple matters, was real torture. For him, through
her, to be obliged to retire on an inadequate pension in a tempest of slander
was unthinkable.
Why had she been such a fool as to shrink from confiding, by letter, in
Peter?
It had seemed immaterial whether she did so or not, considering that, in

Rangoon, one could safely assume nobody had heard of her existence, and
he and the Colonel were not contemplating a long stay anywhere.
Peter at present, she knew, made a remorselessly logical Catholic with

no time for visions unsanctioned by the Pope. Order and discipline
everywhere, if you please, for Peter, once as thoroughly lawless as he now
showed himself law-ridden. But Peter was an extremist in everything. He
had really little use for the non-fanatic who hesitates to sacrifice, at any
rate, his neighbour's Life and Limb, for his opinions. But, while he had
made his submission to Rome in calm, wholehearted conviction, which
might or might not, in another ten years, be followed by as calm and
wholehearted a recantation, annulled in its turn by a general clear-up of his
whole life and a death-bed repentance—"for, though it may be a darned
uncomfortable religion to live in, it's the only tidy one to die in," had ever,
like Charles Stuart, maintained Peter—Ferlie had crept through the gate as a
battered ship creeps gratefully into an unexpectedly discovered harbour,
anchorless, after the storm.
She had found there warmth and healing and a kind of companionship
among the angels that only very sensitive worshippers of abstract holiness
know. The Unseen Hosts were to her lone spirit so really present at the altar
steps that she could no longer consider the most deserted church empty.
Doctrinally, she was unsound. Authority had recognized the bewildered
pulsing of a heart too bruised for searching examination, and admitted her
with far less circumspection than they accorded Peter of the minutely
inquiring habit of mind.
The Peters are well known later to deny; not so the Ferlies.
By reason of that very loyal complex in her was Ferlie passively

chained to the Force from which she had once drawn strength, since there
could be no severing of her fetters without a severance also from those who
had comforted her in affliction. How mean to accept the sweets and deny
the obligations incurred! To question only the rules which affected her
personal desires!
That Force had stood by her in her darkness: therefore she must stand
by it now that she walked in sunshine.
Yet, Cyprian was wondering whether she would outthrow superstition

when happiness set in, and she was sure that, if so, he would soon persuade
himself, for her sake, that, though divorce in itself might be an evil thing, in
their case it became a necessary good. Clifford could be trusted to make
things easy; he to whom all women were merely, Woman.
The doors would swing wide on very little pressure (... Et ne nos
inducas in tentationem).
Since, white-faced and petrified, she had undertaken to deceive

Cyprian, and steal by secret ways and unworthy evasions into Digby Maur's
garden, yielding him the triumph of another picture in return for his
promised silence, she had conversed with him only in monosyllables and,
since he earnestly desired to complete the commission which might set him
on the road to future recognition, he had borne her self-absorbed misery
without making any attempt to counteract it or effect a reconcilation. His
feelings towards her at that time were an irreconcilable mixture of angry
desire and aching remorse.
The picture completed, it was his intention to make a final effort to re-
arouse her forfeited pity. If she should throw up the sponge before he were
ready he determined to stick at nothing which should force her and that
canting Sterne to eat the dust of the same humiliation they had publicly
heaped upon him.
He was incapable of believing that they were not lovers in the term's
worst accepted sense. And what man has done man can do, and the woman
who takes one step in that direction will take another, he promised himself.
Ferlie, nervous of Cyprian's penetration in the matter, attacked Digby

one afternoon, when the work was about half finished.
"I don't think you quite understand," she said, "the strain this deception
is putting upon me. Cyprian is inventing reasons in his own mind for my
looking so ill. But I simply can't sleep."
"Tell him then."
"Do you really imagine that he would allow you to finish this, if I did?"
"In that case I should distinctly advise you not to tell him."
"Oh, you are a cad!" she burst out. "What man, worthy of the name,
would take advantage of a private confidence inadvertently yielded, to
further his own ends?"
"You forget," he said, "your Cyprian never, from the beginning, would
admit that I was worthy of the name. Do you happen to know the terms in
which he forbade me your company?"
"Whatever he said he was right."
"Why not, therefore, resign yourself to the worst where my actions are
under discussion?"
"We had an agreement before T consented to this course," she reminded
him. "I suppose you will not forget it."
"I denied any intention of employing tactics which had already failed to
make you see my side." There was a sneer in his voice. "I have,
nevertheless, abided by the word of a—no, I'll spare you. You started this
conversation, not I."
She relapsed into hopeless silence.
"Do you think I have not suffered too?" he asked, more humanely.
"Once, you would have noticed that I am hardly looking as if my own
nights were undisturbed."
Then, as she answered nothing, "You had better ask Sterne where he
intends to bring up his son that no stigma shall attach to his name in future
as he seems persuaded it does to mine."
"You could save yours if you wished," she said, in tired tones. "It is
what we are that matters, not what other people think we are."
"You may not be the hypocrite you seem. But as for your reputed
brother ..."
"I think, if I were you, I'd leave it at that," Ferlie told him, so
significantly that he paused and passed the rest of the sentence off with an
unpleasant laugh.
"I don't understand exactly what you remind me of," was his next
opening. "Have you, in England, any legends referring to the spirits of
trees? We, in Burma, people our mountains and rivers and trees with 'nats,'
which are powerfully angelic or demoniac spirits, but the tree-nats are the
most popular, I think. I might have painted you as my conception of a Gul
Mohur Nat, but, then, you would have had to stand nude among the
shadows—hardly visible, but still nude, with the dull golden reflections of
the flowers upon your pale skin."
Ferlie looked back steadily into the hard brightness of his eyes.
The attitude of purely English Club members might be, in part,
responsible for the character-development here of weak expansiveness into
bitter withdrawal, and natural animal passion to the impotent rage of
unnatural excesses which lent him a spurious sense of power.
The real power on this occasion lay in her own self-control, and she
knew it.
She spoke impersonally. "There is a story of the first Old Master to

paint from the nude. It is not a story that appeals to me, somehow. The
model and the artist regarded the occasion so sacred as to warrant their joint
attendance at Mass first. Myself, I feel that they should never have realized
the suggestion of lust, in anything so aloof as Art, enough to anticipate its
interference."
She astonished and disconcerted him where he had hoped to disconcert

her.
"You would, therefore, have raised no objection?" rather lamely.
"I should assuredly have refused—you. There is a form of Art, which

only artists of a higher evolution than you are fit to practise. My objection
would not have been founded on any idea that the human body must be
concealed to all for the sake of those who misread its allegorical beauty."
He unscrewed a fresh tube with savagely nervous fingers, and

descended to cheap reviling.
"Sterne, I gather, is one of the fortunately evolved specimens who do

not misread the allegory and are, hence, privileged without the artist's
excuse."
"Your thoughts just bore me," said Ferlie flatly. "I can see them passing
across your face and they are ugly enough to mar any work you attempt.
And, underneath all my angry disgust, I am sorry for you. If you came
across a wounded snake what would you do?"
The palette crashed to the ground as he took a pace forward, clenching
his stained hands.
"Put it out of its pain," he said.
A faint shadow of that hypnotic power, which Peter had so long

suspected and, finally, developed in himself, supported her.
"If you are, as I believe you to be, a true artist under your skin," and she
kept very still, "you will practise the restraint which should enable you to
put your picture before your—passions. I have stood long enough for to-
day."
She turned swiftly and retreated through the trees; nor did he attempt to
call her back.
* * * * * *
Towards the end of the week Cyprian, who had left Ferlie at the Club
surrounded by a new batch of English papers, and ridden out, himself, to an
inspection connected with his work at some distance, returned late in the
afternoon, to find her missing.
"Your sister, Mr. Sterne? No. She only stayed at the Club about a
quarter of an hour."
Someone had seen her walking towards the river-path.
"Then I'll go home that way, skirting the hill," said Cyprian. "The
servant met me with a telegram for her, having been to the bungalow and
found her out."
He rode slowly off, flicking at the flies with his crop. Once on the
narrow path above the bank he let the horse pick its own way. The back
compounds of one or two bungalows, set far apart, straggled to the bushy
slope above the water, but the vicinity of the river was too feverish in the
evening to be popular, and it struck Cyprian as particularly unwise of Ferlie
to choose this spot for a walk, in her present languid state of health.
He made up his mind to tackle her outright when they got home and
insist upon knowing what was worrying her. He had taken refuge in
patience, but she sometimes needed rousing by sharper methods.
There might have arrived a letter from Peter criticizing what Cyprian
felt to be none of that gentleman's business. As an only brother, and older
than Ferlie, it was possible that Peter's scruples had outweighed his
discretion. Cyprian, having overcome his own, was not prepared for re-
discussion of the situation with anybody. To have and to hold, whatever the
future brought to either of them. He would plough the furrow now to the
very end.
As he registered this resolve afresh, he heard voices ahead, but their

owners were hidden behind a natural crescent of thick undergrowth which
somebody had attempted, in the past, to train as a rude hedge. Above the
tumble of scattered bushes appeared the ragged outline of a garden, flanked
by two huge Gul Mohurs.
Cyprian recognized them as those which stood in Digby Maur's

compound, reflecting with satisfaction that the latter had remained largely
invisible since his return from leave.
The ruin of decaying vegetation on the dank path muffled the sound of
his horse's hoofs and he had passed within a few yards of the foliage
concealing the speakers when the identity of one was revealed to him.
"I told you yesterday that you make me pity you, in spite of myself,"
Ferlie was saying excitedly. "I am speaking cold sense when I repeat that it
will be impossible for me to hide much longer from Cyprian that I am not
spending my afternoons at the Club. I actually had to go there to-day to
avoid questions before he went out into the district."
"Well, it's no use," Digby Maur's huskily uneven tones replied. "You're
great on 'control' and all that, and the means you employ to get here do not
concern me. You will continue to come for as long as I need you, because
you can't help yourself; and I am not nearly finished with you yet."
Cyprian, on this statement, became entirely primitive man, and did not
wait to consider the metamorphosis. He dismounted, crashed through the
interlacing branches, and found himself standing between Ferlie and the
individual who had made this astounding claim on her time.
The air was pregnant with the labouring emotions of a drama as old as
the world.
Digby Maur recovered first from the intrusion, for, aware that he now
had his back to the wall he was, also, reliant on the sharpness of his teeth.
Sterne was the kind of man to sell his soul in avoiding a scandal should
such a drastic price be required of him.
"Good evening," he said. "These are my grounds and you will be ready
to admit that even my humble home is my castle?"
For answer, the intruder stepped forward and slashed him across the
face with the riding-crop.
The insolently poised figure reeled backwards as Cyprian spoke to

Ferlie.
"The horse is here. I am going to put you up on it and lead it home. You
don't look fit to walk."
Without a word she went with him down the slope. She would have
refused his help in mounting only that he lifted her bodily and set her
sideways on the saddle, putting the reins between her nerveless fingers.
The dull thudding progress of the horse was out of time with her
quickening pulses.... Something in the life of Cyprian and herself was over,
and of the new phase which loomed ahead she was afraid.
Arrived at the house she motioned him away and slipped unaided to the
ground. He tossed the reins to a servant and followed her up the path to his
office. She sank into a chair and sat motionless resting her chin in her
palms, dimly aware that he had passed into his dressing-room. She heard
the splutter of a syphon, and immediately he returned to push a weak
mixture towards her. "Drink it up," he ordered in matter-of-fact tones. "And
then, just when you're ready, Ferlie, you can begin."
So he had not forgotten his promise. Cyprian never made the same
mistake twice. It took a long while for her to tell him, and during the whole
recital he refrained from interruption. When she ended he drew a deep
breath and stretched out a hand through the gathering dusk to lay it over
hers in the old protective way.
"I have this to say," he told her. "We are through with any childish
arguments concerning one another's rights. You have taken no irrevocable
vows to obey me—in fact, I believe the word has lately been deleted from
the orthodox marriage service, has it not?—but our united brains must be
clear upon the point that two cannot walk together unless they are agreed,
and, as it is impossible for two human souls of widely different impulses to
agree identically upon the treatment of every problem they may be called
upon to solve, it is necessary that in final decisions one should yield
precedence to the other. In visionary matters beyond my ken I am willing to
sit at your feet. Over practical matters and the verdicts that affect our
material welfare, I claim precedence, Ferlie. You gave it to me when you
gave yourself into my keeping at Black Towers. I am responsible for you;
not you for me. Are you satisfied for this to be so?"
It was not in her power to speak, but she bowed her weary puzzled head
over his hand and rested it there. He laid his free one upon her hair and
continued speaking, while he absently smoothed the ruffled "bob."
"Yes? Well, in the circumstances, you had no shadow of right to take the
law into your own hands and act deliberately against my wishes, just
because my trust in you was too complete for me to conceive the possibility
of such a thing. If that trust between us is to remain solid, our problems, in
the future, will have to be shared. Neither must spare the other for a
mistaken sense of self-sacrifice. You would not hide your joys from me—
why, then, your sorrows? Again, I ask you: are you satisfied that I am
right?"
"You know," said Ferlie's muffled tones. "You know...."

"Do I? Then I am going to extract a promise from you, here and now,
that you will be fair with me, as I have been fair with you. Did I lie to you
after the return of Hla Byu into our joint lives? Did I leave you and
withdraw to fight my battle alone when she drowned herself? I wonder
whether the earthly years make a difference, Ferlie, after all? I wonder
whether you are capable of understanding what love means to a man who
has lived nearly half a century without it, and who suddenly finds himself
face to face with its illimitable mysteries? Surely, you will admit the fact
that, since my probation has been double yours, I have earned the inevitable
right to lead before I follow?"
Even then she did not stir under the strengthening touch of his sensitive
fingers.
"Lead on," she said....
CHAPTER XVI
Said the Most Important Lady, she always knew that there was
something queer about it. "Looks as if the whole of his ultimate objections
to Mr. Maur were rooted in the fact that he knew Maur would probably let it
out."
"But how did Maur himself find it out?"
"Probably the girl told him."
"Sounds hardly possible. Why should she?"
"My dear! He is not a young man exactly and she was obviously
attracted by Maur. Hence these stripes!"
"Have you seen his face?"

"The men are rather inclined to doubt Maur's version."
"My dear! The men! She'd have had them all in tow if she hadn't
suddenly concentrated upon Maur and disgusted everybody. Men are wax
when it comes to a red head and a white skin. Children!"
"But what does Maur exactly say?"
"Apparently Sterne saw green over the portrait-sittings and insulted

him. Maur referred him to his own little indiscretion and all parties began to
snarl about their rights. The girl appears to have played the part of passive
resister to both sides. That Type of Woman.... Well, Sterne lost his temper
and hit Maur unawares when he was quite defenceless, and then the girl
rushed between them and gave away the true relationship. From what one
gathers, she was infatuated with Maur—got him to paint her twice over for
an excuse to be with him—and, while he remained under the impression
that she was Sterne's widowed sister, he admits to having considered the
possibilities of matrimony. His discovery of what she really was—you
know they say the husband divorced her and is still alive?—startled him
into confessing that his feelings had altered in one respect.
"There was nothing for it then but for her to go home with Sterne; and
Maur can hardly be blamed for doing his duty by this credulous Station
which has also been suffering under the delusion that all was square and
above-board."
"For the sake of the natives alone, one's got to be so down upon That
Sort of Thing in this country."
"All the same," drawled the more tolerant voice of Somebody's

Husband, "I don't see how anybody has suffered particularly except the
Eternal Triangle. I've always considered Sterne a jolly decent fellow, and
Mrs. Clifford not nearly so red-haired as Maur has probably painted her."
"Well, I think the whole business is fishy. There's something horrid

about a household, in any case, which brazenly maintains that kind of
Burmese child; and John is probably the co-respondent's son of the divorce
case. The co-respondent can't be Sterne or, surely, he'd have married her.
Probably the real man bunked after marrying her, and Sterne, aware that his
own past would not bear too close a scrutiny, took pity on her and..."
"Aren't we getting on a little fast, Dolly? It makes a good story, I'll

admit, but we couldn't hold to it in the face of a summons for libel, and you
know you want to send the boys to Winchester."
In the bar one heard a good bit of low chuckling.
"And Diogenes wearing the air of a Trappist monk through the whole
joke!"
"All the same, when it comes to bringing a woman of that stamp into a
respectable God-fearing district, and introducing her to its wives and
daughters under false pretences, it's a bit thick."
"Of course he'll have to go."
"Good God, yes! He'll have to go."
"And I shouldn't be sorry to kick out Digby Maur along with him."
"Oh, Maur! His doings cut no ice. But, somehow, we have looked upon
Sterne as a creature with principles, and I, for one, am sorry for this smash-
up."
"Personally, I was dashed keen on the little lady."
"Well, none of the crowd were better than they should be. Still, I am
glad that someone has whacked Maur. I can't quite believe in his injured
innocence. If he didn't deserve a licking for this he's simply asked for it
elsewhere, for many moons. But I hate a rotten show of this sort in any
Station. I wish Sterne would hurry up and get out. But wherever they go in
Burma now, people can hardly be expected to call."
* * * * * *
Yes, most decidedly Cyprian would have to go. The children

complicated matters, particularly Thu Daw. Otherwise, things were made
easier by Peter's telegram which Cyprian had forgotten to give Ferlie until
the morning after that interview in Digby Maur's garden.
It was a long telegram explaining that Maddock had been invited to

betake himself, and party, on a visit to the Andaman Islands, where an old
friend of his was acting as Chief Commissioner.
"Bring John and come self Cyprian if possible," ended the telegram.
"It's so like Peter to prepay the reply in order to give me no time to

think," said Ferlie. "Do we go, Cyprian?"
That they should separate she did not contemplate for a moment. But he
glanced at Thu Daw before raising questioning eyes to her.
She picked up the gurgling golden-skinned atom and smiled at him over
its head.
"Why! We have no choice in the matter."
"I haven't, my dear, but you..."
"Have none either, then," said Ferlie.
He had sent in his resignation.
"And from now on," he said inconsequently, "it is to be the truth?"
"Why not?" she asked. "Can anything hurt us so long as we are

together?"
His answering smile was very wistful.
"I had great ideas of protecting and caring for the woman I loved when I
was twenty-eight," he said.
"And I had great ideas of protecting the man I loved when I was seven,"
said Ferlie.

Ebook Mitochondrial Medicine Volume 3 Manipulating Mitochondria and Disease Specific Approaches 2Nd Edition Volkmar Weissig Online PDF All Chapter

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ebook Mitochondrial Medicine Volume 3 Manipulating Mitochondria and Disease Specific Approaches 2Nd Edition Volkmar Weissig Online PDF All Chapter

Uploaded by

Copyright:

Available Formats

Mitochondrial Medicine Volume 3

Manipulating Mitochondria and Disease

Mitochondrial Medicine: Volume 2: Assessing

Metabolism and Medicine The Metabolic Landscape of

New Approaches to Disease Disability and Medicine in

Principles of Gender-Specific Medicine: Sex and Gender-

Modelling Congenital Heart Disease: Engineering a

Cell Biology and Translational Medicine Volume 20 Organ

Braunwald s Heart Disease a Textbook of Cardiovascular

International Responses to Gendered Based Domestic

For further volumes:

Volume 3: Manipulating Mitochondria

ISSN 1064-3745 ISSN 1940-6029 (electronic)

© Springer Science+Business Media, LLC, part of Springer Nature 2021

Glendale, AZ, USA Volkmar Weissig

13 Update of Mitochondrial Network Analysis by Imaging:

26 Isolation of Mitochondria from Retinal Pigment Epithelial

SMIRNOV ALEXANDRE • UMR 7156 - Molecular Genetics, Genomics, Microbiology (GMGM),

SOPHIE DHORNE-POLLET • Université Paris-Saclay, INRAE, AgroParisTech, Animal

MARGARET A. M. NELSON • Department of Physiology, Brody School of Medicine, East

KEN-ICHI WADA • Bioengineering Laboratory, RIKEN Cluster for Pioneering Research,

Allotopic Expression of ATP6 in Mouse as a Transgenic

Throughout the course of eukaryotic evolution, genetic material

Fig. 1 Allotopic expression occurs as a gene typically encoded by the mitochon-

strategy for gene therapy in treating patients with diseases arising

damage. Furthermore, the rat experiments illustrated a reversal of

2.1 Construct Design 1. Computer with Internet connectivity and productivity

3. Human wild-type and mutant (see Note 1) ATP6 coding

2.3 Assembly 1. Mammalian expression vector with mitochondrial targeting

2.4 Animal 1. Thermocycler.

Fig. 2 Primer sequences and configuration for synthesis of ATP6 DNA

60 70 80 90 100 110 120 130 140

150 160 170 180 190 200 210 220 230

240 250 260 270 280 290 300 310 320

330 340 350 360 370 380 390 400 410

420 430 440 450 460 470 480 490 500

510 520 530 540 550 560 570 580 590

600 610 620 630 640 650 660 670 680

MS Word) or with other bioinformatics software. Since the

Codon usage differences in mitochondria

Vertebrate mitochondrial genetic code Standard genetic code

3. Change codons to make murine nuclear expression possible or

Perform the reaction using the following conditions: 94 C for

3.3 Generation 1. Generate mouse models using traditional DNA microinjection

into pronuclear zygotes with surviving embryos then transfer

3.4 Animal 1. Isolate genomic DNA from animals to be analyzed.

1. In AE experiments studying mutated versions of mtDNAs,

experiment is likely to influence its effectiveness. With the

type protein did not rescue the phenotype of a cox2 mutant,

This work and development of outlined methods were supported

Mitochondrial Transplantation for Ischemia Reperfusion

Key words Mitochondrial transplantation, Mitochondrial isolation, Ischemia-reperfusion, Intracor-

activity, oxygen consumption, high energy synthesis, and activates

2 Mitochondrial Transplantation Techniques

The methodology for mitochondrial isolation and quality control

2.1.3 Pros – Easy and fast procedure.

2.1.4 Cons – Requires direct access to the organ of interest.

2.2 Intracoronary Mitochondria can also be delivered by antegrade intracoronary

2.2.1 Materials 1. A sterile tube or suitable container to collect and resuspend

2.2.2 Method Intravascular delivery of mitochondria can be achieved by cannula-

2.2.3 Pros – Direct access to the organ of interest not required.

Mitochondrial uptake can be readily performed in cell cultures. We

3.1 Materials 1. A sterile tube or suitable container to collect and resuspend