Catherine Cupples Connon (Editor) - Forensic DNA Analysis - Methods and Protocols (Methods in Molecula

Volume 2685
Methods in Molecular Biology
Series Editor
John M. Walker
School of Life and Medical Sciences, University of Hertfordshire, Hatfield,
Hertfordshire, UK
For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the
research protocols and methodologies in the critically acclaimed
Methods in Molecular Biology series. The series was the first to
introduce the step-by-step protocols approach that has become the
standard in all biomedical protocol publishing. Each protocol is
provided in readily-reproducible step-by-step fashion, opening with an
introductory overview, a list of the materials and reagents needed to
complete the experiment, and followed by a detailed procedure that is
supported with a helpful notes section offering tips and tricks of the
trade as well as troubleshooting advice. These hallmark features were
introduced by series editor Dr. John Walker and constitute the key
ingredient in each and every volume of the Methods in Molecular
Biology series. Tested and trusted, comprehensive and reliable, all
protocols from the series are indexed in PubMed.
Editor
Catherine Cupples Connon
Forensic DNA Analysis

Methods and Protocols
Editor
Department of Forensic Science, Virginia Commonwealth University,
Richmond, VA, USA
ISSN 1064-3745 e-ISSN 1940-6029

Methods in Molecular Biology
ISBN 978-1-0716-3294-9 e-ISBN 978-1-0716-3295-6
https://doi.org/10.1007/978-1-0716-3295-6
© The Editor(s) (if applicable) and The Author(s), under exclusive

license to Springer Science+Business Media, LLC, part of Springer
Nature 2023
This work is subject to copyright. All rights are solely and exclusively
licensed by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in
any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or
dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks,

service marks, etc. in this publication does not imply, even in the
absence of a specific statement, that such names are exempt from the
relevant protective laws and regulations and therefore free for general
use.
The publisher, the authors, and the editors are safe to assume that the
advice and information in this book are believed to be true and accurate
at the date of publication. Neither the publisher nor the authors or the
editors give a warranty, expressed or implied, with respect to the
material contained herein or for any errors or omissions that may have
been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
This Humana imprint is published by the registered company Springer

Science+Business Media, LLC, part of Springer Nature.
The registered company address is: 1 New York Plaza, New York, NY
10004, U.S.A.
Preface
This volume of the well-known Methods in Molecular Biology series
will focus exclusively on methods specific to forensic DNA analysis.
Included in this series is a comprehensive collection of extraction,
quantification, STR amplification, and detection methods for routine
forensic samples, including a variety of manual, semi-automated, and
automated procedures using both home-brew and commercial
products. Also included are protocols for a probabilistic modeling
software and specialized start-to-finish procedures for mitochondrial
DNA analysis, archived latent fingerprints, latent DNA, rapid DNA
profiling, and next-generation sequencing. This is truly a one-of-a-kind
compilation of forensic DNA analysis procedures that will be the
definitive laboratory protocol resource for all forensic DNA
laboratories.
Richmond, VA, USA
Contents
Part I Introduction
1 Forensic DNA Analysis:An Overview of the Laboratory Process
Part II DNA Extraction and Purification
2 Organic Extraction of Nucleic Acids Using Ethanol Precipitation
or Microcon® Centrifugal Filter Purification Methods
Carolyn A. Lewis
3 Manual Silica-Based DNA Extractions
4 Applied Biosystems™ PrepFiler™ Forensic DNA Extraction Kit
(Manual and Semi-automated via AutoMate Express™)
Megan M. Foley
5 Robotic DNA Extraction Utilizing Qiagen BioSprint® 96
Workstation
Brittany Ziencik
6 DNA Extraction of Bone Through Demineralization
Brandi L. Iorio and Ashley M. Cooley
7 Differential Extraction with Purification via Organic/Microcon®
and Promega DNA IQ™ Methods
Jonathan Forsberg and Caitlin Ayoub
8 DNA Purification from Bloodstains and Buccal Cells/Saliva on
FTA® Cards
Brittany C. Hudson and Catherine Cupples Connon
Part III DNA Quantification
9 Yield Gel via Quantitative Gel Electrophoresis
Victoria R. Parks and Dayanara A. Torres
10 Quantitative PCR of Alu Repeats Using PowerUp™ SYBR® Green
Master Mix
Sierra L. Laveroni and Victoria R. Parks
11 Quantitation of DNA Using the Applied Biosystems Quantifiler®
Trio DNA Quantification Kit
Kelly L. Knight, Angelina Mauriello and Georgia Williams
12 QIAGEN’s Investigator® Quantiplex® Pro Kit
Michelle D. Bonnette
Part IV STR Amplification
13 DNA Amplification Using Promega’s PowerPlex® Fusion
Systems (5C and 6C)
Caitlin McCaughan and Kristy A. Lenz
14 Amplification of Extracted DNA and Direct Amplification with
the PowerPlex® Y23 System
Jonelle M. Thompson
15 Applied Biosystems’ GlobalFiler™ PCR Amplification Kit
Georgia Williams, Megan M. Foley and Kelly L. Knight
16 QIAGEN’s Investigator® 24plex QS and GO! PCR Amplification
17 Low Volume STR Amplification Options:Coupling with
Standard or Fast PCR, Traditional or Normalized DNA Extraction,
and/or Traditional or Alternative Capillary Electrophoresis
Part V STR Profile Detection and Interpretation
18 Capillary Electrophoresis with Applied Biosystems’ 3500
Genetic Analyzer
Kara Kovach
19 Likelihood Ratio Calculation Using LRmix Studio
Megan M. Foley
Part VI Specialized Samples
20 Mitochondrial DNA Analysis
Ashley M. Cooley
21 An Optimized Forensic DNA Analysis Workflow for Obtaining
STR Results from Archived Latent Fingerprints
April D. Solomon
22 Detection of Latent DNA Using a DNA Binding Dye
Adrian Linacre and Piyamas Petcharoen
23 Rapid DNA Profile Development with Applied Biosystems
RapidHIT™ ID System
Megan M. Foley
24 Next-Generation Sequencing:ForenSeq™ DNA Signature Prep
Kit with the Illumina MiSeq FGx
Megan M. Foley
Index
Contributors
Caitlin Ayoub
Virginia Department of Forensic Science, Richmond, VA, USA
InVita Healthcare Technologies, Jacksonville Beach, FL, USA

Richmond, VA, USA
Ashley M. Cooley
Megan M. Foley
Department of Forensic Sciences, The George Washington University,
Washington, DC, USA
Jonathan Forsberg
Brittany C. Hudson
Richmond, VA, USA
Integrative Life Sciences, Virginia Commonwealth University,
Richmond, VA, USA
Brandi L. Iorio
Kelly L. Knight
Forensic Science Program, George Mason University, Fairfax, VA, USA
Kara Kovach
Erie County Central Police Services Forensic Laboratory, Buffalo, NY,
USA
Sierra L. Laveroni
Richmond, VA, USA
Kristy A. Lenz
Promega Corporation, Madison, WI, USA
Carolyn A. Lewis
Richmond, VA, USA
Integrative Life Sciences, Virginia Commonwealth University,
Richmond, VA, USA
Adrian Linacre
Forensic DNA Technology, College of Science and Engineering, Flinders
University, Adelaide, SA, Australia
Angelina Mauriello
Caitlin McCaughan
Bexar County Criminal Investigation Lab, San Antonio, TX, USA
Victoria R. Parks
Richmond, VA, USA
Piyamas Petcharoen
Forensic Technology and Innovation Module, School of Biology,
Institute of Science, Suranaree University of Technology, Nakhon
Ratchasima, Thailand
April D. Solomon
Jefferson Parish Sheriff’s Office Regional DNA Laboratory, Harvey, LA,
USA
Jonelle M. Thompson
Promega Corporation, Madison, WI, USA
Dayanara A. Torres
Richmond, VA, USA
Georgia Williams
Brittany Ziencik
Part I
Introduction
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of
Springer Nature 2023
C. Cupples Connon (ed.), Forensic DNA Analysis, Methods in Molecular Biology 2685
https://doi.org/10.1007/978-1-0716-3295-6_1
1. Forensic DNA Analysis: An Overview

of the Laboratory Process
Catherine Cupples Connon1
(1) Department of Forensic Science, Virginia Commonwealth
University, Richmond, VA, USA

Email: cmconnon@vcu.edu
Abstract
Developing a suitable DNA profile from forensic evidence has long been
a lengthy, multi-step laboratory process. Over the last couple of
decades, the “process” has exploded into a plethora of numerous
options for each of the individual steps, including different
manufacturers and commercial kits, as well as options for manual,
semi-automated, and automated processing. Despite these options, the
heart of the big picture process remains fairly consistent with its early
2000s counterpart and is deeply embedded with a wide variety of
precautions to help prevent contamination and ensure integrous
results. This includes habitual cleaning, wearing personal protective
equipment (PPE), using sterile products and reagents, processing
controls, and employing strategic laboratory practices. This chapter
serves to briefly introduce new audiences to the forensic DNA process,
particularly from a laboratory perspective. Invaluable information
regarding routine precautions is included here, and it is highly
recommended that this chapter be read first, as much of the
information applies to nearly all the chapters of this text.
Key words Forensic DNA – Quality assurance – Quality control –
Personal protective equipment – Precautions – Controls –
Contamination
1 Introduction
The typical, modern laboratory process used to develop a DNA profile
for human identification purposes from forensic evidence takes about a
day or two—a vast improvement from decades earlier. Following an
initial screening process, items that are deemed likely to yield a
probative DNA profile are continued on to DNA extraction and
purification, quantification, amplification of short tandem repeat (STR)
loci, and profile detection via capillary electrophoresis. The resulting
DNA—or more specifically, STR—profiles are then analyzed for
accuracy, followed by comparison to profiles of other evidentiary items
to form conclusions about the origins of DNA located on such items.
Given that items of this nature tend to be highly compromised (e.g.,
little and/or low-quality DNA) and we are dealing with an alleged
criminal act, it is of the utmost importance for the forensic scientist to
do everything possible to ensure the integrity of the evidence. This
includes handling it with care so as not to waste, lose, contaminate,
degrade, or otherwise further compromise the precious DNA. Many of
these precautions are common laboratory practices for similar fields
(e.g., a clinical setting), and their importance is made extremely clear by
the fact that the forensic DNA community has strict, thorough quality
assurance standards [1–3].
Furthermore, as technology has advanced, a variety of procedural
options have come to the forefront, and laboratories have the benefit of
piecing together the extraction, quantitation, amplification, detection,
and even analysis software methods of their choosing. This includes not
only a variety of manual, semi-automated, and automated procedures,
but also the selection of commercial products and instruments from a
variety of well-established manufacturers, such as Applied Biosystems,
Promega, and Qiagen.
2 Universal Precautions Against
Contamination and Compromise
Technological advancements have made the DNA profiling process
extremely sensitive, furthering the need to take extreme precautions
against contamination. General “universal precautions” are taken such
that the analyst should assume that they will (inadvertently)
contaminate the evidence item if they are not immensely careful and
that the evidence itself is highly infectious with a life-threatening agent.
Yes, all very extreme scenarios; however, they are intended to make the
analyst recognize not only how important these precautions are but
also to strictly adhere to them.
There is a laundry list of precautions that we always adhere to as
forensic DNA analysts: restrict access to work areas to authorized
personnel only; physically partition work areas based on tasks
performed (e.g., pre-amplification and post-amplification); wear PPE;
clean our workspace, equipment, and instrumentation before and after
use; use sterile plastics, reagents, etc.; handle one sample at a time; and
utilize controls. It is the laboratory’s responsibility to not only precisely
define how these precautions will be employed but also ensure that
analysts are trained and monitored appropriately.
Laboratory space needs to be secure and restricted to laboratory
staff and other authorized users. The more human traffic there is in
such spaces, the more likely someone will leave their DNA behind (see
Note 1). Physical separation of work areas may also be necessary—or
at least beneficial—depending on what procedures are being
performed. Forensic standards require physical separation (i.e.,
different rooms) of routine DNA casework from DNA databasing, as
well as separation of rapid DNA profiling from both of these other
testing laboratory spaces [1, 2]. Additionally, pre-amplification
procedures (e.g., sample accessioning, screening, extraction,
polymerase chain reaction (PCR) setup, etc.) must be conducted at
different times or in separate spaces from one another, while the
generation and further processing of PCR amplified product must
reside in a completely separate room(s) from pre-amplification
activities [1, 2]. These are routinely referred to as “pre-amplification”
and “post-amplification” laboratory spaces. Utilizing separate
laboratories for different profiling techniques—such as STR,
mitochondrial DNA, and next-generation sequencing (NGS)—is also
highly recommended.
When in the laboratory, individuals should always wear PPE,
including but not limited to lab coat and gloves. No one should ever
touch anything in the laboratory without gloves, as they can leave trace
amounts of their genetic material behind, which could later be
transferred to someone else’s gloves if they happen to come in contact
with the same surface. Once genetic material is on their gloves, there is
a risk that it could then be transferred to an item of evidence, a reagent,
etc., and contaminate the resulting DNA profile. Even when wearing
gloves, analysts are not completely safe-guarded and need to be
mindful of what they touch. They should not touch their face, hair,
clothing/shoes, etc. They should be careful about not touching
doorknobs, telephones, personal items, chair backs, etc. For any of
these “touching” events, their gloves must be changed immediately.
Additionally, hair must be secured, and, in some settings (e.g.,
mitochondrial DNA analysis), hair nets must be worn. Legs and feet
must be appropriately covered by pants and shoes (e.g., closed-toe
shoes that also cover the top of the foot, no shorts, etc.). Many
laboratories will find it advantageous to require face coverings/masks,
as talking over and/or near evidence without a face covering can result
in inadvertent transfer of DNA from small droplets/aerosols of saliva.
On a related note, excessive talking in the laboratory can be distracting
and result in an analyst(s) making some kind of procedural error.
Additionally, sleeve guards and/or shoe coverings may need to be worn.
The latter two items are not as often encountered in a typical forensic
DNA laboratory but may be necessary depending on the laboratory
itself. Safety glasses are also a common form of PPE, but when
employed in a forensic DNA setting, they are usually worn to protect the
wearer from harmful chemicals, infectious agents, etc., rather than to
protect the evidence from contamination.
DNA laboratories should also have a clear policy regarding a
cleaning/decontamination routine. These can be broken up into
different types of cleaning associated with performing a procedure
versus periodic cleaning (e.g., daily, weekly, monthly, quarterly, etc.)
that is scheduled regardless of whether a laboratory procedure is going
to be/was performed on a given day. If a procedure is to be performed,
the surfaces, equipment (including pipettes, tip boxes,
forceps/tweezers, scissors, etc.), and instruments (e.g., doors,
keypads/user interface screens/touchpads, etc.) should be
decontaminated by thoroughly wiping down with 10% bleach, followed
by 70% ethanol, using a fresh laboratory paper towel for each. Bench
pads (also known as lab soak, lab diapers, etc.) should be used as a
disposable workspace for the procedure, rather than working directly
on the bench itself. These should be changed on an as-needed basis
during the procedure. At the end of the procedure, the bench pad
should be discarded, and the bench top, equipment, and instruments
disinfected again with bleach and ethanol. Equipment (e.g., pipettes,
forceps, and scissors) can be exposed to ultraviolet (UV) light as an
additional decontamination measure; autoclaving is also a
decontamination option for some items (e.g., forceps and scissors).
Plastics, reagents, and other consumables used for forensic DNA
laboratory testing must be sterile—or more precisely, free of
DNA/genetic material—before beginning any procedure. Just because
pipette tips, microcentrifuge tubes, etc., come in a secured container
from the vendor, they are not necessarily free of extraneous DNA. They
may have been inappropriately handled at any one (or more) of
numerous stages prior to use in the forensic laboratory. The most
responsible action is to autoclave these plastics prior to use and limit
handling after that. Never handle these items without gloves, and never
reach into a container of autoclaved tubes, even when wearing gloves;
instead, gently pour out the number of tubes needed onto a clean lab
wipe, cap them, and arrange them in your tube rack. Never handle a
pipette tip directly; insert the end of the pipette shaft into the opening
of the tip while it is still racked in the tip box and tap down to secure it
on to the end of the pipette. Use of aerosol-barrier pipette tips are also
recommended because they protect against small particles (like dust
and aerosols) from falling into the tips and ending up in your
reagent/sample, as well as to protect the end of the pipette shaft itself
from coming into contact with a reagent/sample due to accidental over-
pipetting, bubbles, etc. You should likewise be confident that the
reagents you are using are sterile. These can be purchased sterile from
the vendor or autoclaved after recipient/in-house preparation (if
acceptable for that reagent/container; see Subheading 4.1). Prior to the
use of a critical reagent (see Note 2) with a lot number that has not
been used before, it must be tested to ensure it is not contaminated and
yields the expected results; this is part of the quality control process
[1–3]. It is best practice to make a small aliquot of a reagent (e.g., ~1–
50 mL) for your own personal use rather than pipetting from the larger
stock reagent. This reduces the risk of contaminating the larger stock
reagent; if your small aliquot becomes contaminated, the
contamination is isolated to that small container and your samples
alone. It is good practice to discard personal aliquots after about a
month, or sooner, if needed. Other consumables, such as cotton swabs
for sample collection, should be sterilized prior to use; it is best to
purchase these sterile, rather than attempting to sterilize them in-
house. The bottom line with respect to these consumables is that if you
are ever in doubt, throw it out! It is not worth compromising one or
more of your samples if you suspect you many have contaminated a tip,
tube, reagent, etc.
While working with samples, handle only one sample at a time. If
working with the actual item of evidence, the gloves, scissors, forceps,
bench pad, etc., should be changed/decontaminated between each item,
and the item should be securely returned to its packaging before
proceeding to another item. As cuttings of these samples are
transferred to individual microcentrifuge tubes for DNA testing, those
tubes should be labeled appropriately so that they can be identified at
any given time. Laboratory-approved worksheets should be prepared
for these samples prior to starting a multi-sample procedure to help
guide you along the way and make sure all samples are processed;
these worksheets also help document in what order samples are
processed, as well as where they are located in a multi-sample plate
(e.g., a 96-well plate) or on an instrument. Individual sample tubes
should be checked as you progress through the procedure to ensure
you are always working with the correct sample. It is a helpful habit to
physically move a sample tube to a different column/row/location of
the tube rack after you have completed a step so that you can keep
track of where you are in the process at any given time. All of these
measures help prevent sample switches.
Handle and pipette into/out of the sample tubes with care. This
includes opening each tube slowly and carefully to prevent small
droplets of liquids (aerosols) from spraying out into the air or onto
your gloves. If this occurs, immediately decontaminate the affected
surface(s) and/or change your gloves. Only one tube should be open at
a time; when opening/closing it, be careful not to touch the inside of
the cap with your glove. If that happens, change your glove(s)
immediately. While the tube is open, be careful not to spill its contents
(immediately clean up, change bench pad, etc., if this happens) or allow
unintended particles to enter the tube. Working in a chemical fume
hood or biosafety cabinet can help prevent the latter. Never reach over
an open tube, uncovered/exposed sample plate, open box of tips, etc., as
particles from your lab coat could fall into any of these containers or
you could knock the container over and spill its contents. When
pipetting to/from a tube (again, with only one tube open at a time),
pipette slow and steady; be mindful of the first and second stops of the
pipette plunger. Prior to pipetting, it is common practice to allow the
sample/reagent you are pipetting from to come to room temperature (if
previously stored at −20 °C, 4 °C, etc.), followed by vortexing and a
quick spin. After aspirating (drawing up liquid into the tip) from that
tube, check the volume of the liquid in the pipette tip to make sure it
looks about right for the intended volume, that there are no air bubbles
present, etc. After dispensing the reagent/sample to its intended
location, check the pipette tip again to make sure all was dispensed;
pipette just past the first stop if needed, but be careful not to introduce
bubbles. At this point, it is often appropriate to vortex and quick spin
the tube in which sample/reagent was added (but follow the protocol,
as sometimes this is not the case). Change pipette tips between each
sample/reagent (to help prevent sample-to-sample contamination),
and always keep the tip box closed when not getting a tip (to help
prevent contamination of the tips). If your pipette tip ever accidently
touches something it shouldn’t (e.g., the bench pad, counter, another
tube, your lab coat/glove/hand, etc.), change it immediately.
The final general precaution that we utilize in forensic DNA testing
is the use of controls. Controls are of known origin and serve two basic
purposes: to ensure that no reagent, other consumable, piece of
equipment, etc., used in the procedure is contaminated and that the
procedure worked as expected. The former are generally categorized as
negative controls, while the latter are categorized as positive controls.
Specific controls are introduced at each step of the DNA analysis
process, and many, but not all, are carried through to the final step.
3 Routine Guidance for DNA Processing

3.1 Separation of Question and Reference Samples
Forensic DNA samples can be placed into two broad categories:
question/unknown and reference/known. As the names imply, some
items are of unknown, or questioned, origin, like a red/brownish stain
suspected to be blood that was collected from a knife or article of
clothing, or a yellowish stain suspected to be a mixture of semen and
vaginal fluid that was collected from the underwear of a sexual assault
victim. On the other hand, some items are of known origin, as they are
collected as reference samples from a person (hopefully of known
identity) either to be used for comparison purposes in a specific case or
to be entered into a DNA database; these are typically buccal swabs
collected from the cheek area of the inside of the individual’s mouth or
as venous blood collected from their arm. In forensic DNA casework,
the DNA profiles obtained from the question samples are compared to
those obtained from the reference samples in an attempt to determine
the origin of the genetic material from the question samples. For
forensic DNA databasing, the profiles will be stored in a restricted-
access database for subsequent comparisons.
Given the nature of these ultimate goals, it is customary that
question samples are processed prior to and separate from reference
samples. Additionally, question samples tend to be more compromised
compared to the generally high-quality and high-quantity reference
samples, the latter of which tend to yield high-quality DNA profiles
without as much effort as compared to the lower-quality question
samples. Thus, laboratory procedures for question samples tend to be
designed and optimized for a particular sample type, whereas the
procedures used for reference samples tend to work for most reference
samples (see Note 3).
3.2 DNA Extraction and Purification

Following screening (see Note 4) and the selection of
suitable/promising DNA samples, samples should be grouped together
by sample type (question separate from reference), and further sub-
grouped by the extraction process to be utilized. This grouping is often
referred to as a “batch” or a “run” and must contain its own set of
extraction controls [1, 2]. The positive control is of known origin, and
the negative control is a reagent blank; both are processed as if they
were any other sample, except no DNA/substrate is added to the
reagent blank. The positive control is not required by the forensic DNA
quality assurance standards, but many laboratories still choose to
process one (see Note 5), while the reagent blank must be carried
through the entire process to capillary electrophoresis detection [1, 2].
A variety of manual and semi-automated extraction methods are
available. Batch sizes are generally limited by the subsequent DNA
quantification step (typically performed on a 96-well format),
equipment (e.g., centrifuge space), and/or semi-automated instrument
space (usually 6–16 samples for low-throughout options and 96
samples for high-throughput options).
All of the routine laboratory techniques and universal precautions
should be followed (see Subheading 2), especially having only one tube
open at a time. The initial step of nearly all of the extraction procedures
is a cell lysis step that is dependent on numerous reagents. Rather than
adding each reagent one at a time to each tube, an extraction buffer
master mix/cocktail of all of the reagents can be made. If utilizing this
strategy, be sure to make enough for all samples in the batch (including
controls and accounting for a small amount of extra volume needed due
to pipetting errors) and mix/vortex thoroughly prior to dispensing to
each sample. Moreover, this is a fairly high-risk part of the overall
process with regards to contamination and sample switches. The lysis
process utilizes a detergent, which tends to be bubbly and can make a
mess when pipetting—potentially resulting in reagent coming out of
the tube when it is capped—if not careful. There are many vortexing
steps, so it is important to ensure that tubes are securely closed. Many
of the extraction or purification protocols call for tube transfers, so it is
imperative that samples are not only labeled correctly but also
transferred correctly.
3.3 DNA Quantification
Following extraction and purification, the amount of human DNA must
be determined for question samples prior to continuing on to profile
development [1]. Reference samples can also be quantified with a
human-specific method, bypassing this process entirely, or use a non-
human quantitation method (see Note 6); whichever option a
laboratory chooses, they must validate it [1, 2]. At this stage, the
controls initiated at the extraction process must also be processed, as
well as DNA standards (or a calibrator, if using a virtual standard curve)
[1, 2]. Laboratories can choose to initiate additional controls at this
point, such as a calibrator (positive control) and/or no template control
(NTC; negative control), which should be processed concurrently with
the associated batch samples. A calibrator is of known origin and DNA
concentration. An NTC is another type of reagent blank that consists of
all of the reagents for the quantitation method but lacks DNA template;
no water or buffer is added in its place. If either of these controls are
employed at this step, they stop here; they are not processed beyond
quantitation.
A variety of commercial products are available for quantification of
human DNA. Nearly all of these utilize real-time quantitative PCR
(qPCR) with a 96-well format thermal cycler enhanced with an optical
filter to detect fluorescence; this is often simply referred to as a real-
time PCR instrument. These “quant” plates tend to be as close to 96
samples/controls as possible, if not entirely full, and can be setup
manually or via a liquid handler instrument to pipette the reagents.
This is often the result of combining smaller extraction batches
together for a single “quant run.” As a cost-savings measure, half
reactions are often used in place of full reactions.
should be followed (see Subheading 2), especially avoiding reaching
over an open/exposed 96-well plate. Given the extremely sensitive
nature of PCR, this process should be setup in the protection of a
biological safety cabinet or hood. Additionally, since these batches tend
to fill or nearly fill a 96-well plate, a PCR master mix is made that
consists of all of the necessary components, except for the DNA
template (extract). It is imperative that all reagents are brought to room
temperature, vortexed, and quick-spun prior to making the master mix
(see Note 7). The master mix should be enough for all samples/controls
in the batch and have enough extra for pipetting error. Similar to the
master mix reagents, the DNA extracts should have time to come to
room temperature and should be vortexed and quick-spun prior to
addition to the reaction plate. Sealing the plate securely with an
adhesive film is essential to prevent evaporation. The plate should be
spun in a plate spinner/centrifuge prior to being loaded on the real-
time instrument to remove bubbles that may have formed during setup.
These last two precautions help to ensure that each well of the 96-well
plate undergoes an efficient PCR reaction.
3.4 STR Amplification

Following quantitation, samples are normalized to a concentration that
allows a specific nanogram amount (~0.25–1.0) of DNA to be PCR
amplified in order to develop an STR profile that aids in human
identification. Similar to the quantitation step, the reagent blank from
the extraction step must be amplified under the same conditions as the
DNA extracts (see Note 8), and a new set of controls are initiated at this
point, which must be amplified at the same time as the associated batch
samples [1, 2]. The positive amplification control is of known origin and
DNA concentration. The negative amplification control is another type
of reagent blank that consists of all of the reagents for the amplification
method but lacks a DNA template; whatever is used to normalize/dilute
the DNA extracts for this step (e.g., Type I water or TE−4) is added in
place of DNA to the amplification negative control. Like the reagent
blank from the extraction control, both of these amplification controls
are carried through the entire process.
Similar to extraction and quantitation, there are numerous
commercial kits available for STR amplification. Most of the autosomal
STR amplification kits that are currently available target all 20 of the
CODIS loci, plus more. Like qPCR, these amplification batches are
limited by the number of wells in the thermal cycler in which they will
be amplified—typically 96 or 384 wells. As a cost-savings measure, half
reactions are often used in place of full reactions for question and/or
reference samples. Due to the high-quality nature of reference samples,
reaction volumes as low as 3 μL have been successfully implemented
(~1/8th reaction) [4, 5]. Less than half reactions are generally not
suitable for question samples due to their compromised nature and
potential to contain DNA from more than one contributor (i.e., a
mixture); both of these lead to peak height imbalances, which are
further exacerbated by low volume reactions, making them unreliable
for such samples.
over open tubes or an exposed 96-well plate. Many of the additional
precautions specific to qPCR also apply here (see Subheading 3.3):
setting up the reactions in a biological safety cabinet or hood;
strategically preparing a master mix for all samples/controls; securely
sealing the amplification plate or individual tubes; and spinning down
the plate/tubes prior to loading on the thermal cycler.
3.5 STR Profile Detection

Following STR amplification, the amplification (“amp”) product needs
to be separated based on sized and detected so that the resulting STR
profile can be further reviewed; this takes place via capillary
electrophoresis. At this point, the extraction and amplification controls
are processed along with the samples (see Note 9). The positive and
negative amplification controls typically serve as the detection controls
as well.
The other specialized reagents for separation and detection are
linked directly to the STR amplification method that was used; these
are typically provided as part of the purchased amplification STR kit,
including an allelic ladder and internal size standard, though
sometimes the size standard is purchased separately. The most current
amplification kits for human identification typically rely on the use of a
5- or 6-dye system.
over an open/exposed 96-well plate. Many of the additional
precautions specific to amplification also apply here (see Subheadings
3.3 and 3.4): preparing the amplification product for detection in a
biological safety cabinet or hood; strategically preparing a master mix
for all samples/controls; securely sealing the detection plate with a
plate septa; and spinning down the plate prior to loading on the
capillary electrophoresis instrument.
4 Additional Guidance
4.1 Water
Water is necessary for a variety of laboratory procedures, including
reagent preparation, sample storage and dilution, etc. Despite its
apparent simplicity, it is imperative that the appropriate water is used
for forensic DNA testing.
Reagent water is classified based on its purity with respect to
properties such as resistivity, conductivity, total organic carbon (TOC),
and bacteria count [6]. The American Society for Testing and Materials
(ASTM) takes most of these properties into consideration when
classifying water as Type I, Type II, Type III, and Type IV, but classifies
based on bacteria count separately using Type A, Type B, and Type C
(see Table 1). Each type of water can be used for various laboratory
applications; classifications of A, B, and C are only assessed on an as-
needed basis. For forensic DNA analysis, Type A is always needed for
any application in which the water is used in conjunction with sample
collection or subsequent testing that leads to a genetic profile. The
primary focus here will be in the discussion of Types I–IV. Of these four
types of water, Type I is the most pure—virtually pure, in fact—with a
resistivity of 18–18.3 MΩ-cm at 25 °C, conductivity of <0.055 μS/cm,
and total organic carbons (TOC) <10 parts per billion (ppb) [6, 7]. This
type of water is often denoted as ultrapure, analytical grade, molecular
biology grade, amplification grade, etc., and is reserved for use as a
critical reagent in advanced analytical and molecular biology
applications, including PCR amplification and sequencing [7–9]. Thus, it
is the type of water that should be used for any forensic DNA
assay/protocol in which water is considered a critical reagent (e.g.,
sample collection, dilutions, and any extraction, quantification,
amplification, detection, or similar assay that requires the addition of
water to the sample substrate, extract, amplification product, etc.).
Type I water is achieved by a complex combination of purification
techniques, such as carbon filtration, ion exchange, microfiltration,
ultrafiltration, and/or ultraviolet (UV) irradiation [6, 10].
Table 1 ASTM classifications of reagent water
Reagent Resistivity (MΩ- Conductivity Total organic Heterotrophic

water cm at 25 °C) (μS/cm) carbons (ppb) bacterial count
Type I 18–18.3 <0.056 <50 –
Type II 1–15 <1.0 <50 –
Type III >4 <0.25 <200 –
Type IV >0.2 <5.0 No limit –
Type A – – – <10/1000 mL
Type B – – – <10/100 mL
Type C – – – <100/10 mL
A partial summary of the properties used to classify water by the

American Society for Testing and Materials is displayed, including those
most relative to forensic DNA analysis. It should be noted that bacteria
count has a separate classification from the majority of the other
properties and is assessed on an as-needed basis. Type I water is the
purest reagent water and is reserved for advanced analytical and
molecular applications. Type II water is highly pure but reserved for
general laboratory use. Type III and Type IV water can be used for non-
critical laboratory applications
Type II water is highly pure—but not as pure as Type I (see Table 1)

—and is often denoted as general laboratory grade water [6–9]. In
general, it can be utilized for use as a non-critical reagent (e.g., buffers,
pH solutions, culture media, etc.) or as feedwater that is further
purified to produce Type I water. It should not be used for forensic DNA
assays/protocols when water is added directly to a sample substrate,
extract, amplification product, etc. Type II water is typically produced
through a combination of two forms of purification (e.g., distilled-
distilled, reverse osmosis-deionization, etc.) [6, 11].
Type III water is often denoted as primary grade water and is
suitable for basic, non-critical laboratory applications, such as
rinsing/washing glassware, water baths, autoclaves, or as feedwater for
Type I/II [7–9]. Type III water is typically achieved after one form of
purification, such as reverse osmosis, deionization, or distillation.
Type IV water is the least pure of the reagent water classifications,
and it is typically used only as feedwater to yield a purer form of water
[7–9]. Similar to Type III water, Type IV is often achieved after one form
of purification, such as reverse osmosis, deionization, or distillation.
There are a variety of common names by which water goes by in a
laboratory setting; these are typically tied to the water purification
process used (see Fig. 1). These methods are often used in combination
with one another to achieve higher levels of purity. Common
purification methods include sterilization, distillation, reverse osmosis,
and deionization. Sterile water, as the name implies, can be achieved via
sterilization processes like boiling, autoclaving, ozonation, chlorination,
and/or UV irradiation, which result in killing living microorganisms
(viruses, bacteria, fungi, spores, etc.), denaturing proteins, and
degrading DNA to small fragments [10, 12, 13]. Note that sterilization
does not remove these particles but rather makes them non-viable. If
water is only sterilized, it likely would not even classify as Type IV (but
depends on the feedwater source) and is highly susceptible to
contamination because bacteria can easily thrive on the content in the
water and reproduce. Though “sterile” water is often listed for use in
forensic DNA assays/protocols, this typically isn’t the only form of
purification the water was subjected to. When referred to in such
protocols, it’s likely asking for a Type I water that has also been
subsequently autoclaved (i.e., sterilized) to safeguard against
microorganism contamination that could have been introduced during
the bottling process.
Fig. 1 Overview of common names for laboratory water. There are many common names for
laboratory water, which can be confusing when trying to align them with standardized
classifications. This figure attempts to summarize common names used for laboratory water,
the methods used to achieve them, and how they are classified based on the ASTM
Distilled water (aka dH2O) is produced via distillation, which is the

process of boiling water into vapor and then condensing it back into a
liquid form in a separate container [6, 14]. This form of purification
leaves water free of most organic and inorganic contaminants, but
volatile impurities remain (e.g., CO2, ammonia, silicon dioxide, some
organics, etc.). Similar to sterile water, it is at high risk for bacterial
contamination, as bacteria can easily reproduce given the impurities
that remain. This water is also conductive. Though it is more pure than
sterile water, it is not a great long-term, pure water source. The
distillation process usually yields Type III or IV water, which is a good
feedwater source for additional purification measures to achieve higher
levels of purity. In fact, double-distilled (aka distilled-distilled,
distillation-distillation, or ddH2O) water undergoes a second round of
distillation to yield water that has very low levels of organic/inorganic
contaminants, microorganisms, soluble gases, and volatile impurities. It
is more pure than sterile, distilled, and reverse osmosis water and is
classified as Type II water.
Reverse osmosis (RO) water is produced via a process that relies on
the principles of osmosis through a fine membrane with pore sizes of
~10–100 Å [6, 14]. This purification process removes 90–99% of
organic and inorganic impurities. Though it is more pure than distilled
water, it typically results in Type III or even Type IV water. RO water is a
typical feedwater source for Type I and II water and is often suitable for
non-critical laboratory applications.
Deionized water that is available from a “DI” tap in a laboratory has
actually undergone more than just a deionization process so that it can
achieve Type II purity and be suitable for a variety of laboratory
applications that do not require Type I purity. Also known as DI water
or diH2O, the process begins with a relatively pure feedwater source
(e.g., RO water) and subjects that to an ion exchange purification
process [6, 11, 14]. Though there are a variety of ion exchange
processes, they all work under the same basic principles to attract,
remove, and replace ions with H+ and OH−, which ultimately combine to
form more water molecules. This leaves the water free of nearly all
organic and inorganic contaminants. It should be noted that the
deionization process alone does not generate DI water as we know it (a
Type II water), but rather it is achieved through the deionization of an
already purified feedwater source.
Another common misconception about DI water is that it can be
collected from the DI tap and autoclaved to make Type I-sterile water
with the intent of using it as a critical reagent for forensic DNA assays
like PCR amplification. This is incorrect, as the act of autoclaving DI
water will not make its purity increase from Type II to Type I, as
defined by the ASTM. Instead, it would remain Type II and, therefore,
would not be suitable for advanced molecular applications such as PCR
amplification due to the presence of inorganic impurities. This should
not discourage laboratories from autoclaving DI water that is bottled
for use from the DI tap. This is indeed a good practice to ensure that
microorganisms and other organic contaminants that were introduced
during the bottling process were in turn rendered non-viable. However,
the purity of the water will remain as Type II.
This leads us to ultrapure water, the highly sought after, purest form
of water that we can use with our precious DNA samples. However,
there is not one pathway to ultrapure water. Ultrapure water can be
achieved through a variety of ways, but the commonality between all of
these possibilities is that they all utilize a complex combination of
several forms of water purification, such as carbon filtration, ion
exchange, microfiltration, ultrafiltration, and/or UV irradiation [6–10].
This pathway to ultra-purity often begins with RO water as the
feedwater source and, in the end, can be classified as both Type I and
Type A water, as defined by the ASTM. Similar to autoclaving DI water
after bottling it out of the DI tap, it is good laboratory practice to
autoclave ultrapure water after it has been collected from the filtration
system to safeguard against contaminants that may have been
introduced during the bottling process.
Achieving water that is pure for our laboratory standards is a
lengthy and complex task, especially when we seek Type I, ultrapure
water. In addition to autoclaving after the bottling process, best
practices include using small aliquots of the purified water to help
reduce the risk of contamination to the stock bottle that is in use for the
laboratory. Each user should have their own aliquot, which should be
discarded after about a month.
4.2 Tris-EDTA (TE) Buffer Versus Water

Tris-EDTA (TE) buffer is a common buffer used in molecular biology
applications, including forensic DNA assays. It is a stable buffer and
offers DNA as good or better protection during storage compared to
(Type I) water. There are two common preparations of TE buffer: TE
(aka TE−1), which is 10 mM Tris-HCl and 1 mM EDTA; and low TE (aka
low EDTA TE, TE low EDTA, TE−4, etc.), which is 10 mM Tris-HCl and
0.1 mM EDTA. The main difference is that the amount of EDTA is tenfold
higher in TE compared to low TE. It can be confusing when referring to
the buffer as TE−1 or TE−4, as the tenfold difference in EDTA is not
readily apparent with these notations. The “–1” in the former indicates
that the concentration of EDTA is tenfold less than Tris-HCl in that
preparation, whereas the “–4” in the latter indicates the final
concentration of EDTA relative to the entire buffer.
Sometimes these preparations can be interchanged without much
harm, but other times not. EDTA is a chelating agent; depending on the
assay, sometimes more or less EDTA is needed, and the appropriate
buffer needs to be used. EDTA’s chelating properties are often helpful,
like when it chelates Mg++ and prevents the activation of many
enzymes, including general nucleases, DNases, and RNases that
degrade DNA/RNA. On the other hand, sometimes EDTA’s chelating
properties work against the assay—e.g., when Mg++ is needed to
activate other enzymes, like polymerases that are necessary for PCR
amplification. In this situation, less EDTA is better so that Mg++ is free
to interact with the polymerases. In situations like the former, use of TE
is more appropriate, whereas situations like the latter, use of low TE (or
just water!) is better suited. In fact, use of TE instead of low TE in
assays such as PCR amplification can lead to PCR inhibition due to
insufficient polymerase activation.
For assays that could be sensitive to the presence of EDTA in a
TE/low TE buffer, some laboratories have chosen to use water instead
to eliminate the potential impacts of EDTA. However, if the stability of
the DNA is in question, this may not be the best choice. DNA is often
more stable in a TE/low TE buffer compared to water, but time and
temperature also play an important role in stability. DNA can be stable
in water for short periods of time at 2–8 °C or even room temperature,
as well as long periods of time at −20 °C to −80 °C. Its stability is
generally as good or better if stored in TE/low TE in all of these
conditions, but it is difficult to ascertain how much better, if at all.
It is common practice to elute DNA in TE during the final steps of a
DNA extraction to offer stability to the DNA while it is being stored (−20
or 2–8 °C) and awaiting further testing. Laboratories have also
demonstrated that high-quality DNA (e.g., single-source reference
samples) can be eluted in water at the end of the extraction process if
the extracts will be processed very quickly (less than a week, with
storage at 2–8 °C when not in use) and discarded after use. It is also
common practice to utilize low TE or Type I water for assays involving
PCR amplification (e.g., diluting samples and/or as part of the
amplification master mix); TE should not be used with amplification
assays. If in doubt, inquire whether TE, low TE, or Type I water should
be used for a particular assay.
5 Summary
In summary, the forensic DNA analysis process has become more
advanced and complex over the decades, leading to an increased need
to safeguard against further compromising DNA samples, as well as
selecting methods (and reagents) that work in concert with one
another. It is vital for a laboratory to have appropriate quality
assurance and quality control measures in place to ensure the
production of integrous results. If a laboratory desires to make a change
to any part of their overall process, the entire process must be
examined to confirm that there are no negative impacts.
6 Notes
1.
In the event that unauthorized individuals enter the laboratory
space, or individuals enter without appropriate PPE, a thorough
decontamination must be performed before casework can be
processed again. This includes cleaning all surfaces, door/drawer
pulls, etc., with 10% bleach, followed by 70% ethanol. The same
decontamination practice can be employed for any equipment or
instrumentation that may have been touched. Ideally, the
laboratory will be equipped with overhead ultraviolet (UV) lighting,
and the entire room can be UV sterilized for 15–60 min, depending
on the strength of the lighting. After the decontamination has taken
place, the room should be spot-checked for trace amounts of DNA
by randomly sampling a variety of surfaces, handles, etc., and
attempting to develop a DNA profile from them. Assuming that all
of these come back clean, casework can resume. If not all clean,
repeat the decontamination process and check for genetic material
again.
2.
A critical reagent is defined as “those whose performance is vital to
the success of the DNA testing and require testing on known
samples before use” on forensic casework or database samples [1,
2].
3. Different protocols for reference samples tend to arise based on the
collection substrate (swab versus lytic/non-lytic punch) rather
than due to the quality of the sample. However, blood introduces
some other minor challenges, such as the PCR-inhibitor heme, but
some other minor challenges, such as the PCR inhibitor heme, but
this is easy to remedy.
4.
Screening is a term used in the forensic biology/DNA process that
is associated with examining question/unknown evidentiary items
to assess whether body fluids are (potentially) present and
whether they are good candidates for DNA testing. Screening can
also be more precisely described as “serological” screening since
there is a heavy emphasis on body fluid detection/identification.
5.
The FBI quality assurance standards do not require that a positive
extraction control be processed at the extraction stage. A
laboratory can still decide to include this as part of their standard
operating procedure (SOP). If using a positive extraction control,
the relevant SOPs must clearly define through which processes the
control is carried through. Some laboratories have chosen to only
carry this control through to the DNA quantification step to confirm
that DNA was recovered during the extraction, while other
laboratories process this control all the way through profile
detection via capillary electrophoresis.
6.
Reference samples (from casework or databasing) do not
necessarily need to undergo a human-specific (or any, for that
matter) DNA quantitation method if the laboratory has a validated
process that skips over this step; this does not apply to
question/unknown evidentiary items. This would include, but is
not limited to, direct amplification workflows or those that utilize
samples deposited on FTA® Cards.
7.
These PCR reagents are light and temperature sensitive. Handle
with care and do not expose to light or room temperature for too
long. Exposure to these conditions for about an hour is okay, which
is plenty of time to manually setup a full 96-well plate.
8. The reagent blank does not have to be amplified at the same time
as the DNA extracts it is associated with, although it is ideal to do
so; it must be amplified using the same amplification chemistry
(kit), PCR parameters, etc., and detected using the same detection
parameters as the evidence samples it corresponds to. If utilized,
the positive control from the extraction step can be amplified (if the
the positive control from the extraction step can be amplified (if the
laboratory decides that is their policy), but it is not required by the
FBI quality assurance standards [1, 2].
9.
This includes the reagent blank, positive amplification control, and
negative amplification control [1, 2]. If a laboratory employs a
positive extraction control and chooses to amplify it per their
standard process, then it should be carried through detection as
well so that the STR profile can be reviewed.
References
1. Federal Bureau of Investigation (2020) Quality Assurance Standards for Forensic DNA
Testing Laboratories. Available via the Federal Bureau of Investigation. https://www.fbi.
gov/file-repository/quality-assurance-standards-for-forensic-dna-testing-laboratories.
pdf/view. Accessed 19 July 2022
Databasing Laboratories. Available via the Federal Bureau of Investigation. https://www.
fbi.gov/file-repository/quality-assurance-standards-for-dna-databasing-laboratories.pdf.
Accessed 19 July 2022
3. Federal Bureau of Investigation (2020) Standards for the Operation of Rapid DNA Booking
Systems by Law Enforcement Booking Agencies. Available via the Federal Bureau of
Investigation. https://www.fbi.gov/file-repository/standards-for-operation-of-rapid-dna-
booking-systems-by-law-enforcement-booking-agencies-eff-090120.pdf. Accessed 19 July
2022
4. Connon CC, LeFebvre AK, Benjamin RC (2016) Validation of low volume, fast PCR
amplification of STR loci for DNA reference samples. J Forensic Legal Investig Sci. https://
doi.org/10.24966/FLIS-733X/100008
5. Connon CC, LeFebvre AK, Benjamin RC (2016) Development of a normalized extraction to

further aid in fast, high-throughput processing of forensic DNA reference samples. Forensic
Sci Int Genet 25:112–124. https://doi.org/10.1016/j.fsigen.2016.07.019
[Crossref][PubMed]
6. American Society for Testing and Materials (2017) Standard specification for reagent
water. Available via ASTM International. https://www.astm.org/d1193-99e01.html.
7. Burdg J (2015) Infographic: What water type should I use? Available via LabConco. https://
www.labconco.com/articles/water-type-difference. Accessed 21 July 2022
8. Red T (2017) Ultra pure vs feed water, comparing the 4 types of laboratory water. Available
via Technology Networks. https://www.technologynetworks.com/immunology/lists/4-
types-of-laboratory-water-made-simple-293547. Accessed 21 July 2022
9.
ELGA LabWater (2021) Different types of pure water for the lab: what you need to know.
Available via ELGA LabWater. https://www.elgalabwater.com/blog/different-types-pure-
water-lab-what-you-need-know. Accessed 21 July 2022
10. SMACgig Technologies (2022) Methods for making Type1 (Ultrapure) water. Available via
SMACgig Technologies. https://www.smacgigworld.com/blog/methods-for-making-
ultrapure-type1-water.php. Accessed 21 July 2022
11. PureTec Industrial Water (2022) What is Deionized Water? Available via PureTec Industrial
Water. https://puretecwater.com/deionized-water/what-is-deionized-water#:~:text=
Demineralization%20therefore%20requires%20using%20at,is%20always%20first%20
in%20line. Accessed 21 July 2022
12. Grainger (2020) How Does Autoclave Sterilization Work? Available via Grainger. https://
www.grainger.com/know-how/equipment-information/kh-how-does-autoclave-
sterilization-work. Accessed 21 July 2022
13. Environmental Protection Agency (1999) Wastewater Technology Fact Sheet: Ozone
Disinfection. Available via Environmental Protection Agency. https://www3.epa.gov/
npdes/pubs/ozon.pdf. Accessed 21 July 2022
14. Wikipedia (2022) Purified water. Available via Wikipedia. https://en.wikipedia.org/wiki/

Purified_water. Accessed 21 July 2022
Part II
DNA Extraction and Purification
https://doi.org/10.1007/978-1-0716-3295-6_2
2. Organic Extraction of Nucleic Acids

Using Ethanol Precipitation or
Microcon® Centrifugal Filter
Purification Methods
Carolyn A. Lewis1, 2
(2) Integrative Life Sciences, Virginia Commonwealth University,
Richmond, VA, USA
Carolyn A. Lewis
Email: lewisca4@alumni.vcu.edu
Abstract
The use of organic solvents to separate nucleic acids from other cell
components is a common practice among many scientific fields,
including molecular biology and biochemistry. The advantage of
performing organic extractions in forensic DNA analysis is the ability to
purify DNA from heavily degraded or inhibitory sample types, such as
skeletal remains. These sample types require special care to ensure that
the DNA is contaminant-free since they often contain PCR inhibitors
that negatively impact downstream DNA analysis, resulting in
unobtainable or uninterpretable short tandem repeat (STR) profiles.
Purification of DNA after an organic isolation procedure is essential for
improving the likelihood of obtaining valid STR profile from a
challenging evidence sample. This chapter describes the methodology
for extracting and purifying DNA from various types of challenging
samples that are often encountered in forensic casework.
Key words Forensic science – DNA extraction – Organic extraction –

Ethanol precipitation – Microcon® centrifugal filter purification –
Differential extraction
1 Introduction
Organic solvents have long been used to isolate nucleic acids from other
cell components for downstream analyses. In general, the method
involves the use of heat, detergents, chelating agents, and proteolytic
enzymes followed by phenol:chloroform and aqueous phase separation
[1, 2]. Cell components are separated into layers based on solubility,
and thus, the organic layer contains lipids and proteins while nucleic
acids (RNA and DNA) remain in the aqueous layer [3]. However, the
aqueous layer may also contain water-soluble PCR inhibitors; therefore,
additional purification is often performed to ensure downstream
analyses are feasible. Ethanol precipitation of DNA is a traditional
purification method used to remove salts or other possible
contaminants; however, size-based centrifugal filtration has become
increasingly popular in the forensic community due to its ease of use in
high-throughput workflows.
In forensic DNA analysis, organic extraction methods are most
commonly used for challenging samples that contain trace amounts of
DNA or that likely contain PCR inhibitors, such as skeletal remains
(bones and teeth) [4]. It is also common practice to perform a
“differential” organic extraction on evidence samples that are thought
to contain a mixture of epithelial and sperm cells, often observed in
sexual assault cases. While the main purpose of using organic solvents
for challenging samples is to remove impurities, an additional goal of a
differential extraction procedure is a manual attempt to separate sperm
cells from non-sperm cells, which can ease the downstream
interpretation of DNA profiles of multiple contributors [5].
It is important to keep in mind that this protocol was written for
general use in the forensic molecular biology community and that each
forensic laboratory has specific quality assurance, quality control, and
methodology protocols that have been internally validated for
processing evidentiary samples.
2 Materials
Some materials are only required for certain sample types (bones and
teeth). Prior to starting the procedure, review the protocol for sample
type being extracted to determine which materials are needed and
carefully read all precautions that should be taken during this
procedure (see Notes 1–5). All plastic consumables should be
autoclaved prior to use to sterilize. All reagents should be prepared
with sterile, Type I water.
2.1 Equipment
1.
Microcentrifuge: Needs a rotor compatible with 2.0 mL tubes and a
maximum centrifugal force of ≥17,000 × g. Temperature control
(4 °C) is needed for the ethanol precipitation procedure only.
2.
Biosafety cabinet/hood.
3.
Chemical fume hood.
4.
Hammer and rotary tool with flexible shaft and heavy cut-off wheel
(for teeth only).
5.
High-speed electric drill with drill bits (for bone only).
2.2 Consumables
1.
Spin baskets.
2.
Microcon® 100 kDa centrifugal filters.
2.3 Reagents
1. 95–100% ethanol: Ice cold, for ethanol precipitation only. Store
between 2 °C and 8 °C.
2.
Stain extraction buffer: Prepare 10 mM Tris-HCl, 10 mM EDTA,
0.1 M NaCl, and 2% SDS. Mix until dissolved, and adjust to pH 8.0
with NaOH. Store at room temperature for up to 1 year.
3.
TNE buffer, pH 8.0: Store at room temperature for up to 1 year.
4.
20% Sarkosyl: Store at room temperature for up to 5 years.
5.
Sterile water: Autoclaved Type I water. Store at room temperature.
6.
20 mg/mL Proteinase K: Store in freezer between −5 °C and
−30 °C.
7.
PCR digestion buffer: Prepare 10 mM Tris-HCl, 10 mM EDTA,
50 mM NaCl, and 1% SDS. Mix until dissolved, and adjust to pH 7.5
with dilute HCl. Store at room temperature for up to 1 year.
8.
25:24:1 Phenol:Chloroform:Isoamyl Alcohol: Store between 2 °C
and 8 °C for up to 5 years.
9.
24:1 Chloroform:Isoamyl Alcohol: Store at room temperature for
up to 5 years.
10.
0.39 M Dithiothreitol (DTT): Store at −20 °C.
11.
TE buffer: 10 mM Tris-HCl and 1 mM EDTA, pH 7.5–8.0. Store at
room temperature for up to 1 year.
12.
3 M sodium acetate, pH 5.2: For ethanol precipitation procedure
only. Store at room temperature for up to 3 years.
3 Methods
Subheadings 3.1, 3.2, 3.3, 3.4, and 3.5 describe sample preparation and
lysis for various sample types. The organic extraction procedure begins
in Subheading 3.6.
3.1 Sample Preparation and Lysis: Swabs and Stains
1.
Use sterile forceps and scissors to cut a small section the stained
material or swab into a 2.0 mL tube (see Note 6).
2.
To each sample, add 400 μL stain extraction buffer and 15 μL
Proteinase K (see Note 7).
3.
Mix by inverting or light vortex mixing and pulse spin so that the
sample is fully immersed into the liquid.
4.
Incubate at 56 °C in a heat block or incubator for a minimum of 2 h
up to 12 h. Mix by inverting or vortex mixing periodically when
possible.
5.
Vortex thoroughly for 10–15 s, pulse spin, and transfer the cutting
into a spin basket using sterile forceps. Place the spin basket back
into the same tube with the liquid and centrifuge for 5 min at
≥9000 × g to collect any residual liquid from the cutting. Remove
and discard the spin basket with the cutting or swab (see Note 8).
6.
Proceed to Organic Isolation of DNA (see Subheading 3.6, step 1).
3.2 Sample Preparation and Lysis: Tissue Samples

1.
Use sterile forceps and scissors to cut a small piece of tissue (~10–
50 mm3) into a 2.0 mL tube.
2.
To each sample, add 400 μL stain extraction buffer and 15 μL
3.
Mix by inverting or light vortex mixing and pulse spin so that the
tissue sample is fully immersed into the liquid.
4.
Incubate at 56 °C in a heat block or incubator for 2 h. If the tissue
sample has been preserved in formaldehyde or formalin, add an
additional 10 μL of Proteinase K after 2 h and return to incubation
at 56 °C for an additional 2 h.
5. Centrifuge at approximately 14,000 × g for 5 min to pellet any
undigested material.
6.
3.3 Sample Preparation and Lysis: Bones

1.
Clean an electric drill and 3/32″ drill bit with 10% bleach,
followed by 95% ethanol.
2.
Prepare the cleaning solution by mixing 1.2 mL TNE, 7.5 μL 20%
Sarkosyl, and 225 μL sterile water in a 2.0 mL tube.
3.
Place the cleaning solution in a heat block or incubator set to
56 °C.
4.
Remove the cleaning solution from heat and add 15 μL of
Proteinase K. Mix by inverting or vortex mixing.
5.
Fold several Kimwipes into a pad thick enough to absorb the
entire volume of cleaning solution. Add the cleaning solution to
the padded Kimwipes and wrap them around the outer surface of
the bone.
6.
Place the wrapped bone in a plastic Ziploc bag large enough to fit
the entire bone sample, and place it in an incubator pre-set to
56 °C for 30 min.
7.
Remove the bone from the plastic bag, and unwrap the Kimwipes.
Discard the bag and Kimwipes.
8.
Apply 95% ethanol to a new Kimwipe, and clean the area of the
bone that the cleaning solution was exposed to (see Note 9).
9.
Allow the bone to briefly dry in a hood until any residual ethanol
has evaporated.
10. In the hood, drill a 1–2 mm deep section out of the cleaned bone
using the cleaned electric drill and bit (see Subheading 3.3, step
us g t e c ea ed e ect c d a d b t (see Sub ead g 3 3, step
1).
11.
Tap the bone gently onto a Kimwipe or Wypall to collect any
dislodged bone powder from the bone surface. Wrap the Kimwipe
or Wypall around the loose powder and discard (see Note 10).
12.
Place a new Kimwipe or Wypall under the bone, and clean the
drill bit with 10% bleach, followed by 95% ethanol.
13.
Drill into the same hole about 3–5 mm deeper, and collect the
bone powder into a weigh boat.
14.
Using a sterile spatula, transfer a pea-sized amount of the powder
into a 1.5 mL tube (see Note 11).
15.
3.4 Sample Preparation and Lysis: Teeth

1.
Clean the outer surface of the tooth with 10% bleach, followed by
70% ethanol (see Note 12).
2.
Clean the rotary tool and heavy-duty cut-off wheel with 10%
bleach, and remove any bleach residue using 70% ethanol.
3.
In a clean biosafety cabinet, cut away the upper crown area of the
tooth until the pulp chamber becomes visible. Small knicks can be
made in the side of the tooth to assist in breaking down the lower
portion of the tooth in subsequent steps.
4.
Once the crown has been removed, insert the tooth into a small,
sterile plastic Ziploc bag. Place the bag with the tooth into a second
Ziploc bag and then into a third bag. While removing as much air as
possible, securely seal all of the bags.
5. Insert a clean hammer head into several plastic Ziploc bags. On a
hard and durable surface, carefully use the hammer to crush the
tooth into powder. Take caution not to puncture the plastic bag
with the pulverized tooth sample.
6.
While holding the seal upward, shake the tooth powder to a corner
of the Ziploc bag. Cut the same corner with sterile scissors, and
transfer the pulverized sample into a 1.5 mL or 2.0 mL
microcentrifuge tube (see Note 13).
7.
3.5 Sample Preparation and Lysis: Differential Procedure

for Mixed Body Fluid Stains
1.
To each stain or swab cutting, add 400 μL TNE, 25 μL 20%
Sarkosyl, 75 μL sterile water, and 5 μL Proteinase K (see Notes 6
and 7).
2.
Mix by inverting or light vortex mixing, and pulse spin so that the
cutting is fully immersed in the liquid.
3.
Incubate at 37 °C using a heat block or incubator for 2 h (see Note
14).
4.
Vortex thoroughly for 10–15 s, pulse spin, and transfer cutting
into a spin basket using sterile forceps. Place the spin basket back
into the same tube with the liquid, and centrifuge for 5 min at
≥9000 × g to collect any residual liquid from the cutting. Remove
and discard the spin basket with the cutting or swab (see Note 8).
5.
Without disturbing the sperm pellet, carefully transfer all but
approximately 50 μL of supernatant (“non-sperm fraction”) into a
new 1.5 or 2.0 mL tube (see Note 15).
6.
Set aside the non-sperm fraction while washing and lysing the
sperm fraction (see Subheading 3.5, steps 7–11; Note 16).
7. Gently wash the pellet by adding 500 μL of PCR digestion buffer,
and resuspend it by slowly pipetting up and down several times
or briefly vortex mixing on a low speed (see Note 17). Centrifuge
for 5 min at ≥9000 × g and remove/discard all but approximately
for 5 min at ≥9000 × g and remove/discard all but approximately
50 μL of supernatant.
8.
Repeat the wash (see Subheading 3.5, step 7) at least two more
times. This can be performed up to five times (see Note 18). After
the final wash, resuspend the pellet in the remaining 50 μL of
supernatant by slowly pipetting up and down. This is now the
“sperm fraction” (see Note 19).
9.
To each sperm fraction, add 150 μL TNE, 50 μL 20% Sarkosyl,
40 μL 0.39 M DTT, 150 μL sterile water, and 10 μL Proteinase K.
10.
Mix by inverting or light vortex mixing, and incubate at 56 °C for
2 h (see Note 20).
11.
Pulse spin so that any condensation is forced to the bottom of the
tube.
12.
Perform Organic Isolation of DNA (see Subheading 3.6, step 1) on
both non-sperm and sperm fractions.
3.6 Organic Isolation of DNA

This procedure should be performed in a chemical fume hood due to
the use of hazardous chemical reagents.
1.
Add an equal volume (~500 μL) of Phenol:Chloroform:Isoamyl
Alcohol (25:24:1) to the sample lysate (see Subheadings 3.1, 3.2,
3.3, 3.4, or 3.5). Briefly mix by inverting or lightly vortex mixing at a
low speed until a milky emulsion is obtained. Centrifuge at full
speed (~17,000 × g) for 5 min to separate phases.
2.
Carefully remove the aqueous (top) layer containing the DNA, and
transfer it to a new 1.5 mL tube (see Notes 21 and 22).
3.
Add an equal volume (~500 μL) of Cholorform:Isoamyl Alcohol
(24:1) to each sample, and vortex briefly to mix phases. Centrifuge
at full speed (~17,000 × g) for 5 min to separate phases.
4. Carefully remove the aqueous layer, and transfer it to a new 2.0 mL
tube (see Notes 22 and 23).
5.
Proceed to the preferred DNA purification method (see Subheading
3.7, step 1 or Subheading 3.8, step 1).
3.7 Microcon Purification

1.
Assemble and label a Microcon 100 kDa centrifugal filter unit for
each sample, and add 100 μL of TE to the top of each filter device.
2.
Transfer the aqueous layer from the end of the organic isolation
protocol (see Subheading 3.6, step 4) to the top of the filter device
(see Note 24).
3.
Centrifuge at 500 × g for 10–15 min (see Notes 25 and 26).
4.
Discard liquid flowthrough by carefully removing the filter device
from the assembly and pouring it into a waste container. Return the
filter device to the filtrate tube.
5.
Add 200 μL of TE to the top of the filter device, and centrifuge at
500 × g for 10–15 min, ensuring that all the liquid has spun
through the filter.
6.
Add 20–200 μL of TE to the filter device, depending on the
anticipated size and quality of the DNA sample (see Note 27). Let it
stand at room temperature for 5 min.
7.
Remove the filter device and invert into a new, labeled filtrate tube.
Discard the used filtrate tube.
8.
Centrifuge the assembly for 5 min at 1000 × g.
9.
Discard the filter device unit and store purified DNA in a new
1.5 mL tube at 4 °C short-term or −20 °C long-term.
3.8 Ethanol Precipitation Purification

1. Estimate the volume of DNA extract.
2.
Add 1/10th volume of 3 M sodium acetate (pH 5.2) and two
volumes of ice cold 95–100% ethanol.
3.
Mix well and store on ice or at −20 °C for at least 1 h to
precipitating DNA (see Note 28).
4.
Recover precipitated DNA by centrifuging at maximum speed for
10 min at 4 °C.
5.
Carefully remove the ethanol supernatant without disturbing the
DNA pellet (see Note 29).
6.
Wash the DNA pellet with 500–700 μL of room-temperature 70%
ethanol, and centrifuge at 4 °C for 2 min at maximum speed (see
Note 30).
7.
Repeat the wash twice (see Subheading 3.8, steps 5–6) to wash the
pellet a total of three times.
8.
Allow the pellet to air-dry at room temperature with the tube lid
open for 15 min or until all residual ethanol has evaporated (see
Note 31).
9.
Resuspend the DNA pellet in an appropriate volume (20–200 μL) of
TE buffer, and store purified DNA at 4 °C short term or −20 °C long
term.
4 Notes
1. Biological samples may contain infectious agents, such as HIV or
hepatitis-causing virus; therefore, proper personal protective
equipment (PPE) must be worn at all times during the procedure.
This includes eye/nose/mouth protection, lab coat, and
disposable latex or nitrile gloves (double glove, if necessary).
Gloves should be changed frequently to avoid sample-to-sample
DNA contamination. A clean Kimwipe can be used to open
microcentrifuge tubes to minimize DNA transfer onto gloves. If it
is suspected that any DNA has come into contact with a glove, it
should be changed immediately prior to handling subsequent
samples.
2.
Biohazardous waste is to be disposed of according to laboratory-
specific biohazard waste management protocols. Biohazardous
waste should never be placed in a non-biohazardous waste
container.
3.
All work surfaces and applicable equipment are to be cleaned
thoroughly with a 10% bleach solution, followed by 70% ethanol
to degrade DNA and remove chemical residue, respectively.
4.
At least one reagent blank (and substrate control, where
applicable) must be processed alongside every batch of samples
to ensure there is no reagent contamination at the extraction step
of the DNA workflow. Differential procedures include at least two
reagent blanks that are processed alongside each fraction.
5.
To reduce the risk of sample and/or reagent contamination, all
liquid is to be centrifuged to the bottom prior to opening a tube.
Reagents should be aliquoted into smaller working volumes, and
different lot numbers of the same reagent should never be
combined. All reagent lot numbers used to process a batch of
casework samples should be the same as the corresponding
reagent blank. If there is a small volume of reagent remaining and
a different lot number is needed to process casework samples, a
separate reagent blank must be included.
6.
Cut the tip of the swab or approximately 1 cm × 1 cm of stained
material.
7.
These volumes may be altered in proportionate amounts to
accommodate sample size. The sample should be fully—but not
overly—saturated.
8. Refer to specific laboratory guidelines for discarding evidentiary
material.
9.
Wipe the surface of the bone with 95% ethanol 1–2 times to
ensure that all active residual Proteinase K is removed.
10.
DNA should NOT be obtained from the outer surface of the bone
as it has been exposed to environmental conditions and likely to
be more degraded or contaminated than the inner surface of the
bone.
11.
In the event that low DNA yield is observed during DNA
quantification, multiple 1.5 mL tubes can be prepared from the
same bone powder. The powder can be combined later if re-
extraction is required.
12.
If available, molars and/or premolars are the best tooth choice for
DNA extraction.
13.
Depending on the amount of powder, the pulverized tooth can be
placed into a weigh boat and subsequently transferred into a
microcentrifuge tube using a sterile spatula.
14.
This incubation step is lysing epithelial cells while sperm cells
remain intact at this lower temperature.
15.
The new tube containing the supernatant should be labeled with
the sample ID and “NSF” for non-sperm fraction, as this will be
subsequently processed as its own evidentiary sample. The pellet
contains the sperm cells and will later become the “sperm
fraction.”
16.
Once separated, the sperm and non-sperm fractions should be
processed in different batches with their own reagent blanks. A
common practice is to continue processing the non-sperm
fraction during the 2-h incubation (see Subheading 3.5, step 10).
17.
It is important to perform this step very gently in order to keep
the sperm heads intact, as the microscopic identification of sperm
cells is based on the cell morphology.
Th li t i i ll th f
18. The goal is to remove any remaining non-sperm cells; therefore,
more washes are recommended if it is anticipated that there are
high levels of non-sperm fraction. For example, a vaginal/cervical
swab from a sexual assault case likely contains high non-sperm
fraction cell counts and lower sperm cell counts; therefore, more
than two washes should be performed.
19.
If desired, pipette 3–5 μL of sperm fraction onto a glass
microscope slide for microscopic examination of sperm cells.
20.
The addition of DTT and a higher incubation temperature causes
the sperm cell heads to lyse and release DNA into the sperm
fraction lysis buffer. DTT is a detergent that reduces disulfide
bonds in the acrosomal caps of sperm cells.
21.
Additional organic extractions (see Subheading 3.6, steps 1–2)
may be performed prior to the addition of Chloroform:Isoamyl
Alcohol (see Subheading 3.6, step 3) if layer separation is still
observed. The aqueous layer should appear clear and
homogenous.
22.
It is important to not transfer any of the organic layer and/or the
white interphase. The organic layer contains inhibitory solvents
and lipids, while the white interphase contains inhibitory
proteins.
23.
The aqueous layer may be directly transferred to the pre-
moistened Microcon® membrane (see Subheading 3.7, step 1) to
minimize tube transfers and potential loss of DNA.
24.
Ensure that only the aqueous layer is added since organic solvents
can damage the filter membrane, resulting in holes through which
DNA can pass through and is lost.
25.
Centrifugal force greater than 3000 × g may damage the
concentrator.
26. Ensure that all liquid has spun through the filter. If necessary,
repeat centrifugation until the filter is moist but not completely
dry.
dry.
27.
For low quality samples, approximately 20 μL is recommended.
For reference or high molecular weight samples, approximately
200 μL is recommended.
28.
DNA in ethanol solutions can be stored indefinitely at −20 °C.
29.
The DNA pellet may not be visible; therefore, the supernatant may
be retained and stored at 4 °C short term or −20 °C long term until
DNA recovery has been verified, particularly for nearly consumed
evidence samples.
30.
Since the DNA is not always visible, a good tip is to dispense the
70% ethanol down the sides of the tube to ensure that any DNA
stuck against the tube wall is washed.
31.
If necessary, the open tube can be incubated at 45 °C for 2–3 min
to fully evaporate any ethanol that may inhibit downstream
analyses.
References
1. Green MR, Sambrook J (2016) Precipitation of DNA with ethanol. Cold Spring Harb Protoc
12:1116–1120. https://doi.org/10.1101/pdb.prot093377
[Crossref]
2. Zeugin JA, Hartley JL (1985) Ethanol precipitation of DNA. BRL-focus 7:1–2
3. Kurosaki K, Matsushita IT, Ueda S (1993) Individual DNA identification from ancient human
remains. Am J Hum Genet 53(3):638–643
[PubMed][PubMedCentral]
4. Kö chl S, Niederstä tter H, Parson W (2005) DNA extraction and quantitation of forensic
samples using the phenol-chloroform method and real-time PCR. In: Carracedo A (ed)
Forensic DNA typing protocols, Methods in molecular biology, vol 297. Humana Press,
Clifton, pp 13–29
[Crossref]
5. Gill P, Jeffreys AJ, Werrett DJ (1985) Forensic application of DNA fingerprints. Nature
318:577–579. https://doi.org/10.1038/318577a0
[Crossref][PubMed]
https://doi.org/10.1007/978-1-0716-3295-6_3
3. Manual Silica-Based DNA Extractions


Abstract
There are several silica-based extraction methods that utilize silica-
packed columns or silica-coated paramagnetic resin and are suitable for
the needs of forensic DNA analysis and/or human identification. These
rely on the use of chaotropic salts to alter the affinity of DNA such that
it binds strongly to silica. A variety of samples can be successfully
processed with these procedures, including buccal swabs, dried or
liquid blood, saliva, semen, and other typical forensic-type samples.
This chapter will describe the manual extraction process for Promega’s
DNA™ IQ System, as well as Qiagen’s QIAamp® DNA Blood Mini Kit,
QIAamp® DNA Mini Kit, and QIAamp® DNA Investigator Kit.
Key words DNA extraction – DNA IQ System – QIAamp DNA Blood

Mini Kit – QIAamp DNA Mini Kit – QIAamp DNA Investigator Kit – Silica
– Paramagnetic resin
1 Introduction
1.1 Background
DNA extraction is an important beginning step of the overall forensic
DNA analysis process. The key goals are typically to isolate and purify
DNA so that it is of suitable quality and quantity for downstream
methods—like PCR amplification and capillary electrophoresis—with
the end goal being the development of a high-quality STR profile.
Silica-based extraction methods have proven to be the method of
choice by the forensic DNA community for well over a decade, with
some laboratories consistently employing them since the early 2000s
[1, 2]. These methods initially won over the community by offering an
alternative to the long-standing, health-hazardous organic extraction
that had been the primary go-to method for decades. In addition, they
offered improved DNA yields and the ability to remove PCR inhibitors
that had shown to be problematic with older methods, such as Chelex
[1, 3]. These methods also proved to be easily adapted to the
differential extraction procedure for mixed stains containing sperm and
non-sperm cells [4].
Initially on the market as a silica column-based extraction (i.e., silica
packed into a flow-through column), these procedures also offered
some decrease in processing time compared to organic extractions,
coupled with a process that eliminated tube-to-tube transfers, which
effectively prevented sample switches due to erroneously transferring
the retenant from one tube to that of another (which is a routine step
when transferring the aqueous phase in organic extractions). The
method was quickly improved thereafter when the silica was coupled
with a paramagnetic resin, which—compared to its silica column-based
counterparts—made the process (1) quicker, (2) even less susceptible
to contamination/sample switches, and (3) more amenable to semi-
automated/automated extraction, all of which were accomplished by
eliminating centrifugation and reducing tube-to-tube transfers to a
single transfer. The latter were accomplished through the novel idea of
securing the DNA-bound, silica-wrapped paramagnetic resin (aka
beads) to the back of the microcentrifuge tube via a magnetic
separation stand, effectively pulling the DNA aside to remove and
discard liquid waste. This action was translated to automated
instruments/liquid handlers by retaining the beads inside the
instrument pipette tips (rather than the sample tubes/wells) and
moving/washing the beads from/with one location/reagent to another.
In fact, most of the current DNA extraction instruments utilize silica-
coated paramagnetic resin; silica column-based extractions have also
been automated, but doing so requires the instrument to house a
centrifuge (see Table 1) [5–17]. Automation itself—including semi-
automated instruments—has offered added benefits, like reduced
hands-on time and labor, as well as increased reproducibility of DNA
yields [1, 2, 4, 18].
Table 1 Common silica-based extraction chemistries
Kit Manual Automated

Column Resin Instrument Column Resin
BioSprint® DNA Blood Kit – – BioSprint® 96 – ✓

KingFisher Flex – ✓
ChargeSwitch® Forensic DNA – – iPrep™ Purification – ✓

Purification Kit Instrument
DNA IQ™ System – ✓ Maxwell® 16 – ✓
EZ1 & 2® DNA Investigator Kit – – EZ1® series – ✓

instruments – ✓
EZ2® Connect Fx
PrepFiler® Forensic DNA – – AutoMate Express™ – ✓

Extraction Kit
QIAamp® DNA Blood Mini Kit ✓ – QIAcube® ✓ –
QIAamp® DNA Mini Kit ✓ – QIAcube® ✓ –
QIAamp® DNA Investigator Kit ✓ – QIAcube® ✓ –

✓ –
QIAcube® Connect
Numerous silica-based extraction chemistries have been commercially

available dating back to the early 2000s. This table includes some of the
options that have been utilized for forensic casework and/or human
identification. Most of the paramagnetic resin options were quickly
adapted for automation on a variety of instruments. Additionally, the
resin/bead-based options were also easily amenable for use with
several high-throughput liquid handling instruments (not shown here)
The first criticism of the silica bead-based extraction methods was

that they had an upper limit for the DNA yield. Promega’s DNA IQ™
System specifically advertised a maximum DNA yield of 100 ng [19].
Though initially viewed as a disadvantage compared to organic and
silica column-based methods, this was quickly squashed, as routine
forensic samples often have nowhere near 100 ng of DNA, and if they
did, 100 ng of DNA is more than enough for any combination of
downstream forensic analyses. Additionally, the method becomes more
efficient as sample quantity decreases—and is most efficient with
samples containing less than 100 ng of DNA [19]. If for some reason
more DNA is needed, the yield can be increased by increasing the
volume of paramagnetic beads used [20].
A legitimate concern arose when it was discovered that bead
carryover in the DNA extract led to PCR inhibition. This was more of a
problem with the early qPCR quantification kits (e.g., Applied
Biosystem’s Quantifiler® Human DNA Quantification Kit) and made it
difficult to obtain an accurate DNA estimation. The STR amplification
kits at the time (e.g., AmpFlSTR® Identifiler® PCR Amplification Kit)
were often able to overcome the level of PCR inhibition imposed by the
beads. Current qPCR and STR amplification kits have seen vast
improvements and typically are not subjected to inhibition if beads are
present in the extract, though it is still strongly recommended to
prevent bead carryover into the DNA extract.
1.2 Silica DNA Extraction Chemistry

Regardless of the commercial kit, all silica-based extractions utilize a
chaotropic salt (e.g., guanidinium or some form of it) and an alcohol
(e.g., ethanol and/or isopropanol) to change the affinity of DNA such
that it will strongly bind to silica; this is also referred to as silica
adsorption. At the end of the process, the chemistry is reversed such
that DNA is released from the silica in a purified form.
To begin, the sample is incubated with a proprietary lysis buffer
containing a chaotropic salt and typically some type of protease—
proteinase K is very common, but DNA IQ utilizes dithiothreitol (DTT)
—for ≤2 h to lyse cells. During this time, the chaotropic salt disrupts the
hydrogen bonding of water and denatures proteins (including
nucleases), the latter of which is aided by the protease (or DTT, if
using). In addition to having a high salt concentration, a low pH also
helps to prepare for the upcoming DNA-silica binding. After the lysis
incubation, the sample substrate is removed and the lysate is either
added to a silica column or paramagnetic resin is added to the lysate,
depending on which extraction method is used. Either way, the DNA is
exposed to silica and will bind to it under these conditions. The binding
affinity is improved with the addition of an alcohol. Next, as DNA is
securely bound to the silica (either in the silica-packed column or the
free-floating silica-coated beads), impurities are removed through a
series of wash steps. These wash steps are slightly different depending
on the commercial kit used, but in general, they begin with high salt
and alcohol concentrations to keep the DNA tightly bound to the silica.
As the washes progress, the concentration of salt and/or alcohol
decreases. At the final elution step, an elution buffer free of salt and
alcohol (e.g., low EDTA TE buffer) changes the binding affinity such that
DNA is released from the silica and is retained in a highly pure form as
the sample extract.
Qiagen (Hilden, Germany) offers a variety of silica-based extraction
chemistries that are suitable for forensic DNA analysis, including:
QIAamp® DNA Blood Mini Kit (Blood Mini kit), QIAamp® DNA Mini Kit
(DNA Mini kit), and QIAamp® DNA Investigator Kit (Investigator kit)
[12, 13]. When processing these extraction methods manually, all
utilize silica columns. The Blood Mini and DNA Mini kits are more
suitable for high-quality reference samples rather than evidentiary
samples and also use the same silica columns when processed with the
QIAcube® instrument [14]. Comparatively, the Investigator kit is better
equipped to handle forensic evidentiary samples and is available as a
silica column-based extraction when used with the QIAcube® or
QIAcube® Connect instruments, as well as a silica bead-based
extraction when used with the EZ1® series or EZ2® Connect Fx
instruments [11, 14, 15]. All of these are semi-automated instruments
from Qiagen. The QIAcube series are more automated than the
EZ1/EZ2 instruments, given that the lysis step is performed on the
instrument for the former (but still requires the user to remove the
sample substrate following lysis); lysis is performed off-instrument for
the EZ1/EZ2 instruments, after which the lysate is transferred to the
instrument for further processing.
Promega (Madison, WI) offers the DNA IQ™ System, a silica bead-
based extraction that can be performed manually, via a semi-automated
platform, or on a variety of liquid handling instruments [1, 9, 10, 18].
This method yields a combination of single-stranded and double-
stranded DNA (ssDNA and dsDNA, respectively). The ratio of ssDNA to
dsDNA is controlled by the incubation temperature of the lysis step:
70 °C for a higher ratio of ssDNA and 56 °C for a higher ratio of dsDNA
[21].
There are various other silica bead-based DNA extractions that have
been used/targeted for forensic/human identity samples, including the
PrepFiler® Forensic DNA Extraction Kit (Applied Biosystems, Waltham,
MA) and ChargeSwitch® Forensic DNA Purification Kit (Invitrogen,
Waltham, MA), which can be semi-automated with the AutoMate
Express™ Forensic DNA Extraction System (Applied Biosystems) and
iPrep™ Purification Instrument (Invitrogen), respectively.
Given the vast number of combinations of kits and manual/semi-
automated/automated procedures available, this chapter’s focus is on
manual extraction using the DNA IQ System, as well as three QIAamp
DNA kits (Blood Mini, DNA Mini, and Investigator).
2 Materials
All methods should utilize molecular grade reagents and materials.
Plastic consumables (i.e., tips, tubes, and spin baskets) must be
autoclaved for sterilization; aerosol-barrier pipette tips are highly
recommended.
2.1 DNA Extraction via QIAamp® DNA Blood Mini Kit or

QIAamp® DNA Mini Kit
1. QIAamp DNA Blood Mini Kit: Contains QIAamp Mini Spin Columns,
Collection Tubes (2 mL), Buffer AL, Buffer AW1, Buffer AW2, Buffer
AE, QIAGEN® Protease, and Protease solvent (see Note 1). Upon
receipt, all components can be stored at room temperature for up
to 1 year (see Note 2). When ready for use, reconstitute the
Protease in the provided solvent, and add the specified volume of
95–100% ethanol to Buffer AW1 and Buffer AW2 (see Notes 3 and
4). Prevent Buffer AL and Buffer AW1 from coming into contact
with bleach, including dilute forms (see Note 5).
2.
QIAamp DNA Mini Kit: Contains QIAamp Mini Spin Columns,
Collection Tubes (2 mL), Buffer AL, Buffer AW1, Buffer AW2, Buffer
AE, and Proteinase K (see Note 1). Upon receipt, all components
can be stored at room temperature for up to 1 year (see Note 2).
When ready for use, add the specified volume of 95–100% ethanol
to Buffer AW1 and Buffer AW2 (see Note 4). Prevent Buffer AL and
Buffer AW1 from coming into contact with bleach, including dilute
forms (see Note 5).
3.
95–100% ethanol.
4.
Phosphate-buffered saline (PBS).
5.
Heat block: A thermomixer is beneficial but not required.
2.2 DNA Extraction via QIAamp® DNA Investigator Kit

1.
QIAamp DNA Investigator Kit: Contains QIAamp MinElute®
Columns, Collection Tubes (2 mL), Buffer ATL, Buffer AL, Buffer
AW1, Buffer AW2, Buffer ATE, Carrier RNA (cRNA), and Proteinase
K. Upon receipt, QIAamp MinElute Columns should be stored at 2–
8 °C (room temperature is okay if they will be used within
4 weeks); all other components can be stored at room temperature
for up to 1 year (see Note 2). When ready for use, add the specified
volume of 95–100% ethanol to Buffer AW1 and Buffer AW2, and
add 310 μL Buffer ATE to a single tube of cRNA to obtain a
concentration of 1 μg/μL (see Notes 4 and 6). Prevent Buffer AL
and Buffer AW1 from coming into contact with bleach, including
dilute forms (see Note 5).
2.
95–100% ethanol.
3.
Spin baskets: Needs to be compatible with 1.5 mL tubes.
4.
2.3 DNA Extraction via DNA IQ System
1.
DNA IQ System: Contains Resin, Lysis Buffer, 2X Wash Buffer, and
Elution Buffer. Upon receipt, all components can be stored at room
temperature (see Note 2). When ready for use, add the specified
volume of 95–100% ethanol and isopropyl alcohol to 2X Wash
Buffer to prepare the working stock Wash Buffer (see Note 4).
Prevent Lysis Buffer from coming into contact with bleach,
including dilute forms (see Note 5).
2.
1 M Dithiothreitol (DTT): Aliquot and store at −20 °C. Limit to one
freeze/thaw event.
3.
Spin baskets: Needs to be compatible with 1.5 mL tubes.
4.
5.
Magnetic separation stand: Must hold 1.5 mL tubes.
3 Methods
Universal precautions should be followed at all times to prevent the
contamination of evidence and to the safeguard the analyst from
chemical and biological hazards. This includes the use of personal
protective equipment (PPE; gloves, lab coat, etc.) and disinfecting
workspaces and tools (e.g., scissors, forceps, etc.) before and after use
with 10% bleach followed by 70% ethanol. Appropriate positive and
negative controls should be processed with each extraction batch, as
defined by your laboratory (see Note 7). The methods included here are
for manual extraction of routine forensic samples such as blood, buccal,
saliva, or touch DNA samples, the latter of which is best processed with
the QIAamp® DNA Investigator Kit or DNA IQ™ System (see Notes 8–
10). Prior to starting the extraction, check the lysis buffer for
precipitate (see Note 11).
3.1 Extraction of Reference Blood or Buccal Samples Using

QIAamp DNA Blood Mini Kit or QIAamp DNA Mini Kit
1.
Using a set of sterile scissors (and sterile forceps to assist, if
needed), cut an appropriate-sized portion of a sample swab or
other substrate and place it into a 1.5 or 2 mL tube (see Note 12).
Prepare extraction controls as well (see Note 7).
2.
To each sample, add: 400 μL Buffer AL, 20 μL Protease/Proteinase
K, and 400 μL PBS (see Notes 13 and 14; Table 2). Vortex
thoroughly for 10–15 s and quick spin.
3.
Incubate at 56 °C for 10 min (see Note 15). Centrifuge tubes
briefly to remove condensation.
4.
Add 400 μL ethanol to each sample. Vortex thoroughly for 10–15 s
and quick spin.
5.
Obtain one QIAamp Mini Spin Column (provided in a 2 mL
collection tube) per sample (see Note 16). Add 700 μL of the
lysate/ethanol mixture to the corresponding column and securely
close the column (see Note 17). Do not transfer the substrate.
Save the remaining lysate.
6.
Centrifuge the column assembly at 6000 × g for 1 min (see Note
18). Discard the filtrate and the collection tube. Place the column
into a new, clean 2 mL collection tube.
7.
Add the remaining lysate (see Subheading 3.1, step 5) to the
corresponding column (see Note 17). Use the pipette to remove as
much liquid from the substrate as possible, but do not transfer the
substrate itself to the column. Discard the tube containing the
substrate.
8.
9.
Carefully open each column and add 500 μL Buffer AW1. Securely
close the column (see Note 17).
10. Centrifuge the column assembly at 6000 × g for 1 min (see Note
11.
12.
Centrifuge the column assembly at 10,000 × g for 3 min (see Note
into a new, clean 1.5 mL tube (see Note 19).
13.
Carefully open each column and add 150 μL Buffer AE. Securely
close the column (see Note 17), but do not try to close the 1.5 mL
tube. Incubate at room temperature for 5 min (see Note 20).
14.
Centrifuge the column assembly at 15,000–20,000 × g for 1 min to
complete the elution step. Confirm that each tube contains sample
extract, then discard the collection tube and securely close the
extract tube.
15.
Samples may proceed immediately to DNA quantitation, may be
stored at 2–8 °C for a few days, or may be stored at −20 °C if they
will not be used again within roughly a week.
Table 2 Composition of lysis mix
QIAamp DNA Blood QIAamp DNA Mini QIAamp DNA DNA IQ System
Mini Kit Kit Investigator Kit
400 μL Buffer AL 400 μL Buffer AL 400 μL Buffer ATL 300 μL Lysis
Buffer
20 μL Protease 20 μL Proteinase K 20 μL Proteinase K 3 μL 1 M DTT
400 μL PBS 400 μL PBS – –
Each silica-based extraction begins with an incubation to facilitate lysis.

The lysis mix is similar per method, containing a proprietary lysis
buffer with a chaotropic salt and some type of protease or DTT. All
components are supplied in the commercial kits, except for the PBS and
1 M DTT required for the QIAamp DNA Kits and DNA IQ System,
respectively. It is important for the sample substrate to be fully
saturated and immersed in the reagents during the lysis step. Volumes
of at least 300–400 μL are usually sufficient to provide adequate
immersion of up to one cotton swab or 1 cm2 of other material
substrate
3.2 Extraction of Blood, Buccal, Saliva, or Touch DNA

Samples Using QIAamp DNA Investigator Kit
1.
other substrate and place it into a 1.5 or 2 mL tube (see Note 12).
2.
To each sample, add: 400 μL Buffer ATL and 20 μL Proteinase K
(see Notes 13 and 14; Table 2). Vortex thoroughly for 10–15 s and
quick spin.
3.
Incubate at 56 °C for 1–2 h (see Notes 15 and 21). Centrifuge
tubes briefly to remove condensation.
4.
To each sample, add 400 μL Buffer AL and 1 μL cRNA (see Note
22). Vortex thoroughly for 10–15 s and quick spin.
5.
Incubate at 70 °C for 10 min (see Note 15). Centrifuge tubes
briefly to remove condensation.
6.
For samples with anticipated low DNA yields, use sterile forceps
to transfer the substrate to a spin basket and new 1.5 mL tube;
retain the lysate in the original 1.5/2 mL tube. Centrifuge the spin
basket assembly at 10,000 × g for 3 min. Remove and discard the
spin basket containing the substrate, then transfer the lysate back
to its original 1.5/2 mL lysate tube (see Note 23).
7.
Add 200 μL ethanol to each sample. Vortex thoroughly for 10–15 s
and quick spin.
8. Obtain one QIAamp MinElute Column (provided in a 2 mL
collection tube) per sample (see Note 16). Transfer the entire
lysate/ethanol mixture to the corresponding column and securely
close the column (see Note 17). If the substrate was not
i l d( S bh di 3 2 t 6) d tt f
previously removed (see Subheading 3.2, step 6), do not transfer
it to the column. Discard the empty 1.5/2 mL lysate tube and any
remaining substrate.
9.
10.
11.
12.
13.
Centrifuge the column assembly at 6000 × g for 1 min (see Notes
18 and 24). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
14.
Carefully open each column and add 700 μL ethanol. Securely
15.
Centrifuge the column assembly at 6000 × g for 1 min (see Notes
18 and 24). Discard the filtrate and the collection tube. Place the
column into a new, clean 2 mL collection tube.
16.
Centrifuge the column assembly at 10,000 × g for 3 min (see Note
into a new, clean 1.5 mL tube (see Note 19).
17.
Carefully open each column and incubate in a secure location at
room temperature for 10 min or at 56 °C for 3 min to allow for
complete evaporation of ethanol (see Notes 25 and 26).
18. Add 20–150 μL Buffer ATE to each column. Securely close the
column (see Note 17), but do not try to close the 1.5 mL tube.
Incubate at room temperature for 5 min (see Note 27)
Incubate at room temperature for 5 min (see Note 27).
19.
Centrifuge the column assembly at 15,000–20,000 × g for 1 min to
complete the elution step. Confirm that each tube contains sample
extract, discard the collection tube, and securely close the extract
tube.
20.
3.3 Extraction of Blood, Buccal, Saliva, or Touch DNA

Samples Using DNA IQ™ System
1.
other substrate and place it into a 1.5 mL tube (see Note 12).
2.
Prepare a lysis mix consisting of 500 μL Lysis Buffer and 5 μL 1 M
DTT per sample, plus an additional 10–15% for pipetting error
(see Note 28). Vortex thoroughly and quick spin.
3.
Add 300 μL lysis mix to each sample (see Note 14; Table 2); retain
the remainder mix for after the incubation (see Subheading 3.3,
steps 6 and 10). Vortex each sample thoroughly for 10–15 s and
quick spin.
4.
Incubate at 56 °C for 1–2 h (see Notes 15, 21, and 29). Centrifuge
tubes briefly to remove condensation.
5.
For samples with anticipated low DNA yields, use sterile forceps
to transfer the substrate to a spin basket and place it back into its
corresponding 1.5 mL tube with the lysate. Centrifuge the spin
basket assembly at 10,000 × g for 3 min. Remove and discard the
spin basket containing the substrate (see Note 30). For samples
not processed with a spin basket (i.e., reference samples), squeeze
out as much of the lysate from the substrate as possible as it is
being removed from the tube and discard.
6. Add 100 μL of the retained lysis mix (see Subheading 3.3, step 3)
to each sample. Vortex thoroughly for 10–15 s and quick spin.
7.
Vortex the Resin bottle thoroughly for 10 s. Add 8 μL Resin to each
sample. Vortex thoroughly for 10–15 s and let stand at room
temperature for 5 min (see Note 31).
8.
Briefly vortex each sample and place on the magnetic separation
stand. The resin will be pulled to the back of the tube, at the point
closest to the magnet (see Note 32).
9.
Carefully open each tube, and remove and discard the lysis mix.
Do not disturb the resin (see Note 33).
10.
Add an additional 100 μL of the retained lysis mix (see
Subheading 3.3, step 3) to each sample. Briefly vortex each
sample and place on the magnetic separation stand (see Note 32).
11.
Carefully open each tube and remove and discard the lysis mix. Do
not disturb the resin (see Note 33).
12.
Wash the DNA-bound resin by adding 100 μL of Wash Buffer to
each sample. Briefly vortex each sample and place on the
magnetic separation stand (see Note 32).
13.
Carefully open each tube and remove and discard the Wash Buffer.
Do not disturb the resin (see Note 33).
14.
Repeat the wash two times (see Subheading 3.3, steps 12 and 13)
for a total of three washes. Make sure all of the liquid is removed
following the last wash.
15.
While still on the magnetic separation stand and with the lids
open, allow the tubes to air-dry in a secure location for 5 min (see
Notes 26 and 34).
16.
Add 20–150 μL Elution Buffer to each sample. Securely close the
tube, vortex briefly, and incubate at 65 °C for 5 min (see Note 35).
17. Briefly vortex each sample and place on the magnetic separation
( ) f
stand (see Notes 32 and 36). Transfer the eluted DNA to a new 1.5
mL tube (see Notes 19 and 37).
18.
4 Notes
1.
The kits contain many of the same components; differences are
noted here [12]. The Blood Mini kit does not contain Buffer ATL,
whereas the DNA Mini kit does. However, Buffer ATL is not
utilized in the protocols provided in this chapter. Additionally, the
Blood Mini kit contains QIAGEN® Protease (and the
accompanying solvent), whereas the DNA Mini kit contains
Proteinase K. The Protease is a lyophilized (dry) powder that is
temperature-sensitive after reconstitution, compared to
Proteinase K, which is in solution and stable at room temperature
[12, 13, 22]. As an added note, the Protease is not compatible with
Buffer ATL, but Proteinase K is compatible with that buffer (not
relevant here because Buffer ATL is not utilized in the protocols in
this chapter).
2.
Room temperature is considered 15–25 °C per Qiagen and 15–
30 °C per Promega; temperatures on the low end of this range
may cause precipitate to form in the lysis buffers (QIAamp Buffer
AL/ATL and DNA IQ Lysis Buffer) (see Note 11). If the Protease
(Blood Mini kit) is to be stored for longer than 1 year prior to
being reconstituted in the provided solvent, then it should be
stored dry at 2–8 °C. The life of the Proteinase K (DNA Mini and
Investigator kits) is prolonged to beyond 1 year if stored at 2–8 °C
[9, 12, 13].
3.
Store the reconstituted Protease at 2–8 °C for up to 12 months.
Avoid exposing Protease to room temperature for prolonged
periods of time. To prolong its life, aliquot into smaller volumes
and store at −20 °C [12]. Limit to two freeze/thaw events.
Th l f l h l( ) dd d d d h i i ki
4. The volume of alcohol(s) added depends on the size extraction kit
purchased. (For ethanol specifically, Qiagen specifies the use of
96–100% ethanol, whereas Promega specifies 95–100%; the

latter is fine for any of the kits used in this chapter.) See
instructions provided with the kit. After alcohol(s) has been
added, these buffers are stable for 1 year at room temperature [9,
12, 13]. Be sure to close the lids tightly to avoid evaporation.
5.
Buffer AL (Qiagen), Buffer AW1 (Qiagen), and Lysis Buffer
(Promega) contain a chaotropic salt (guanidine hydrochloride for
the Qiagen buffers and guanidium thiocyanate for Promega’s),
which is not compatible with bleach or any product containing
bleach. Exposure to bleach can result in the formation of a toxic
gas [9, 12, 13, 23].
6.
Dissolve the contents of the cRNA tube thoroughly. Reconstituted
cRNA should be aliquoted and stored at −20 °C. Limit to three
freeze/thaw events [13].
7.
The FBI Quality Assurance Standards (QAS) require the use of a
reagent blank as a negative control during extraction. Positive
controls for the extraction procedure are not required per the
QAS, but laboratories can choose to implement them as part of
their standard operating procedure if they deem fit [24].
8.
The protocols for extraction of blood or buccal samples with the
QIAamp DNA Blood Mini Kit and QIAamp DNA Mini Kit are
basically the same, except for the use of QIAGEN® Protease versus
Proteinase K, respectively (see Note 1) [12, 13].
9. More challenging sample types—such as hair, teeth, bone, and
urine, as well as those contaminated with fingerprint powder
and/or collected from a firearm (including swabs of the weapon,
shells/casings, or bullets)—are likely better suited for a modified
extraction and/or a different procedure altogether. Samples
suspected of containing sperm must be subjected to DTT, whereas
those suspected of containing sperm and non-sperm cells must be
subjected to a differential extraction. Such protocols are not
included in this chapter [9 12 13]
included in this chapter [9, 12, 13].
10.
Automated and/or semi-automated extraction procedures are
available for these kits in combination with instruments/liquid
handlers from various manufacturers, but such protocols are not
included in this chapter [1, 2, 4, 9–15, 18].
11.
If precipitate has formed in the lysis buffer (e.g., Buffer AL, Buffer
ATL, or Lysis Buffer), the buffer can be warmed to 37–70 °C for
~5–10 min to force the precipitate back into solution [9, 12, 13]. If
this becomes a habitual problem, the ambient temperature of the
room may be too cold (≤20 °C).
12.
Approximately 0.25–0.5 swab is recommended for a buccal
(reference) swab and 0.5–1 swab for non-reference samples; for
low copy number samples, up to two swabs can be used,
but reagent volumes may need to be adjusted (see Note 14). If
possible, use the exterior portion of the swab and leave the
interior portion behind (if unstained) to prevent overloading the
tube with material. For other substrates (e.g., clothing, linens,
etc.), cut approximately 0.5–1 cm2 of the material, depending on
its thickness. Denim and other heavily dyed materials can be
inhibitory during PCR if the dyes are not removed adequately
during extraction/purification, so taking smaller cuttings—or
swabbing the stain rather than cutting the material—tends to
work better. Cut the substrate into 2–4 smaller pieces before
adding them to the sample tube. Sterilize the scissors and forceps
in between sample cuttings.
13. It is recommended to use a repeater pipette to add these
components individually to each sample tube. Make sure all tubes
are spaced far apart (they will all be open at the same time, which
is generally frowned upon due to the risk of contamination) and
be careful to prevent splashing/aerosol formation. Alternatively, a
lysis master mix can be made in a conical tube that contains
enough of all of the reagents for all of the samples, plus extra
(~10–15%) for pipetting error. Make sure the lysis mix is
thoroughly vortexed to reach homogeneity, then spin it down. Due
thoroughly vortexed to reach homogeneity, then spin it down. Due
to the nature of the lysis buffer and the detergents present, the
lysis mix will have bubbles that will be hard to remove, even when
spun down.
14.
Ensure that the sample substrate is saturated and fully immersed.
Additional buffer may be added, if needed. Additional
Protease/Proteinase K is not needed for the QIAamp kits but
additional 1 M DTT is necessary in proportion to any additional
Lysis Buffer for the DNA IQ System [9, 12, 13].
15.
Use of a thermomixer set to 900 rpm during the initial incubation

will aid lysis. It is recommended but not required. Alternatively,
samples can be intermittently vortexed during the incubation
period (e.g., every 3 min for a 10-min incubation, every 10 min for
a 1-h incubation, etc.) [13].
16.
These are the silica columns. Only the top of the column needs to
be labeled. They are designed to be transferred from one
collection tube to another during this protocol. (The sample itself
is not transferred via pipetting from one tube to another, hence
the “elimination of tube-to-tube transfers.”) Do not wet the rim of
the collection tube as the column is transferred, as this can be a
source of contamination. If your glove gets contaminated with
lysate, change it immediately before touching something else.
17.
Only one sample should be open at a time. When opening, be
careful not to generate aerosols. When adding to the column, do
not wet the rim of the column and avoid touching the pipette tip
to the packed silica at the bottom of the column. Close the column
carefully, yet securely, to avoid aerosol formation during
centrifugation [12, 13].
18.
If the lysate has not completely passed through the column after
centrifugation, centrifuge again at a higher speed until the column
is empty [12, 13].
19. This will be the final elution tube and should be labeled
appropriately.
20.
This incubation is helping to release the DNA from the silica.
Reduced incubation times could result in lower DNA yields. Final
elution volumes can be adjusted, if desired, in anticipation of the
sample’s DNA concentration. Using lower volumes will increase
concentration but often reduces overall yield, especially if less
than 100 μL is applied. Some volume will be lost to the column
[12].
21.
For reference samples, incubation time may be reduced to 10 min
for QIAamp DNA Investigator or 30 min for DNA IQ [9, 13].
22.
A white precipitate may form when Buffer AL is added to Buffer
ATL. The precipitate does not interfere with the procedure and
will dissolve during incubation (see Subheading 3.2, step 5) [13].
23.
This step is highly susceptible to introducing contamination;
proceed carefully and cautiously, so as to not add the lysate from
the spin basket’s 1.5 mL tube to the wrong 1.5/2 mL lysate tube
and/or introduce contamination from gloves coming into contact
with lysate. Only have one tube open at a time and change gloves
whenever necessary to minimize these risks. If the risks are
deemed too high, this step can be eliminated. This step is not
needed for reference samples, as they tend to contain higher
quantities of DNA.
24.
Be cautious when working with this increased volume to avoid
contact between the column and the flow-through in the
collection tube. Some centrifuge rotors may vibrate upon
deceleration, resulting in the flow-through, which contains
ethanol, coming into contact with the column. Take care when
removing the column and collection tube from the rotor, so that
flow-through does not come into contact with the column. If this
occurs, centrifuge the column assembly again [13].
25.
This step is necessary to prevent ethanol carryover, which is a
potential problem for downstream applications [13].
This step is high risk for potential contamination as all tubes are
This step is high risk for potential contamination, as all tubes are
26.
open at one time for several minutes. This incubation should be
performed in a safe, secure location, like a biosafety cabinet or
hood.
27.
Reduced incubation times could result in lower DNA yields. Final
elution volumes can be adjusted, if desired, in anticipation of the
sample’s DNA concentration. Using lower volumes will increase
concentration but often reduces overall yield. Up to 5 μL will be
lost to the column [13].
28.
Since the volume of DTT added per sample is relatively small, it is
recommended to make a master mix for the lysis step. If
components were added individually, there is a greater risk that
an insufficient amount of DTT (or none at all) would be dispensed
into the sample tube, which would have disastrous effects on the
extraction process.
29.
This extraction yields a combination of ssDNA and dsDNA, which
is primarily influenced at this incubation step. Incubating at 56 °C
will result in predominantly dsDNA in the final extract. If
predominantly ssDNA is desired, increase the incubation to 70 °C
[21].
30.
This step is highly susceptible to introducing contamination;
proceed carefully and cautiously, so as to not add the spin basket
containing sample substrate to the wrong tube and/or introduce
contamination from gloves coming into contact with lysate. Only
have one tube open at a time and change gloves whenever
necessary to minimize these risks. If the risks are deemed too
high, this step can be eliminated. This step is not needed for
reference samples, as they tend to contain higher quantities of
DNA.
31. The step is facilitating the binding of DNA to the silica beads.
Quick spinning samples at this time may interfere with the
process [9]. If needed, individual tubes can be tapped down on the
f f
benchtop to help remove liquid from the top and/or side of the
tube.
32.
If a distinct pellet does not form on the back of the tube, vortex
the tube and quickly place it back in the stand [9].
33.
If the resin is disturbed or accidentally removed, dispense the
removed liquid/resin back to the tube. Vortex the sample and
return it to the magnetic separation stand to induce separation
again. Carefully remove and discard the lysis mix without
disrupting the resin.
34.
Do not exceed 20 min for drying. Doing so can reduce the ability
of the DNA to be eluted from the beads, resulting in lower DNA
yields [9].
35.
Reduced incubation times could result in lower DNA yields [9].
Final elution volumes can be adjusted, if desired, in anticipation of
the sample’s DNA concentration. Using lower volumes will
increase concentration but often reduce overall yield [12, 13].
36.
DNA yield will decrease if the tube cools prior to being placed on
the magnetic separation stand [9].
37.
Do not disturb or remove the resin. Check the transferred extract
to ensure that no beads were carried over. If they were, vortex,
quick spin, and immediately return the final elution tube to the
magnet stand. Transfer the extract to a new 1.5 mL tube, ensuring
not to carryover any resin.
References
1. Greenspoon SA, Ban JD, Sykes K et al (2004) Application of the BioMek 2000 Laboratory
Automation Workstation and the DNA IQ System to the extraction of forensic casework
samples. J Forensic Sci 49(1):29–39. https://doi.org/10.1520/JFS2003179
[Crossref][PubMed]
2.
Frégeau CJ, De Moors A (2012) Competition for DNA binding sites using Promega DNA IQ™
paramagnetic beads. Forensic Sci Int Genet 6(5):511–522. https://doi.org/10.1016/j.
fsigen.2011.12.003
[Crossref][PubMed]
3. Ip SCY, Lin S, Lai K (2015) An evaluation of the performance of five extraction methods:
Chelex® 100, QIAamp® DNA Blood Mini Kit, QIAamp® DNA Investigator Kit,
QIAsymphony® DNA Investigator® Kit and DNA IQ™. Sci Justice 55(3):200–208. https://
doi.org/10.1016/j.scijus.2015.01.005
[Crossref][PubMed]
4. Goldstein MC, Cox JO, Seman LB et al (2020) Improved resolution of mixed STR profiles
using a fully automated differential cell lysis/DNA extraction method. Forensic Sci Res
5(2):106–112. https://doi.org/10.1080/20961790.2019.1646479
[Crossref][PubMed]
5. QIAGEN (2012) BioSprint® 96 DNA handbook. Available via Qiagen. https://

wwwqiagencom/us/resources/resourcedetail?id=64902c5d-9c3c-4fe3-a3f7-
668c4704d9eb&lang=en, 6 Aug 2022
6. Thermo Scientific (2010) Thermo Scientific KingFisher Flex User Manual, Revision 1.2.
Available via Themo Fisher Scientific. https://static.thermoscientific.c om/images/
D01475~.pdf. Accessed 6 Aug 2022
7. Invitrogen Corporation (2005) ChargeSwitch® Forensic DNA Purification Kits Instruction

Manual, Version A. Available via Thermo Fisher Scientific. https://www.thermofisher.com/
document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2Fchargeswitch_forensicdna_man.pdf. Accessed 6 Aug 2022
8. Invitrogen Corporation (2007) iPrep™ Purification Instrument user manual, Version B,

Carlsbad
9. Promega Corporation (2021) DNA IQ™ System—small sample casework protocol. Available
via Promega. https://www.promega.com/-/media/files/resources/protocols/technical-
bulletins/101/dna-iq-system-small-sample-casework-protocol.pdf. Accessed 6 Aug 2022
10. Promega Corporation (2016) DNA IQ™ Casework Pro Kit for Maxwell® 16. Available via
Promega. https://www.promega.com/-/media/files/resources/protocols/technical-
manuals/101/dna-iq-casework-pro-kit-for-maxwell-16-protocol.pdf?rev=
70c3fc19ed8f4921ac2f5614cbd4cdcf&sc_lang=en. Accessed 6 Aug 2022
11. QIAGEN (2022) EZ1 & 2® DNA Investigator® Kit Handbook. Available via Qiagen. https://
www.qiagen.com/us/resources/resourcedetail?id=46064856-1b88-4b27-a825-
d3f616e06c08&lang=en. Accessed 6 Aug 2022
12. QIAGEN (2016) QIAamp® DNA Mini and Blood Mini Handbook, 5th edn. Available via
Qiagen. https://www.qiagen.com/us/resources/resourcedetail?id=62a200d6-faf4-469b-
b50f-2b59cf738962&lang=en. Accessed 6 Aug 2022
13.
QIAGEN (2020) QIAamp® DNA Investigator Handbook. Available via Qiagen. https://www.
qiagen.com/us/resources/download.aspx?id=26ef8f2c-7c2a-49e6-b2d2-39d4e130b3cc&
lang=en. Accessed 6 Aug 2022
14. QIAGEN (2018) QIAcube® User Manual, Version 1.3. Available via Qiagen. https://www.
qiagen.com/us/resources/resourcedetail?id=f 7d77c6e-0479-4b2b-a2e0-5ca747114e34&
15. QIAGEN (2022) QIAcube® Connect User Manual. Available via Qiagen. https://www.
qiagen.com/us/resources/download.aspx?id=40c8ffa5-8662-434d-ba70-5a098d1294c4&
16. Applied Biosystems (2017) PrepFiler® and PrepFiler® BTA Forensic DNA Extraction Kits
Quick Reference, Revision B. Available via Thermo Fisher Scientific. https://www.
thermofisher.com/document-connect/document-connect.html?url=https://assets.
thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2Fcms_099065.pdf. Accessed 6 Aug
2022
17. Applied Biosystems (2019) Automate Express™ Instrument User Guide, Revision G.
Available via Thermo Fisher Scientific. https://www.thermofisher.com/document-
connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2F4441982_AutoMateExp_UG.pdf. Accessed 6 Aug 2022
18. Frégeau CJ, Lett M, Fourney RM (2010) Validation of a DNA IQ-based extraction method for
TECAN robotic liquid handling workstations for processing casework. Forensic Sci Int
Genet 4(5):292–304. https://doi.org/10.1016/j.fsigen.2009.11.001
[Crossref][PubMed]
19. Huston K (2002) Technical tips: DNA IQ System “Frequently Asked Questions”. Available via
Promega Corporation. https://www.promega.com/products/forensic-dna-analysis-ce/
dna-isolation/dna-iq-system/. Accessed 21 Mar 2022
20. Connon CC, LeFebvre AK, Benjamin RC (2016) Development of a normalized extraction to
further aid in fast, high-throughput processing of forensic DNA reference samples. Forensic
Sci Int Genet 25:112–124. https://doi.org/10.1016/j.fsigen.2016.07.019
[Crossref][PubMed]
21. Truman A, Wieczorek D (2013) Quantifying dsDNA and ssDNA Isolated by Manual and
Automated Methods Using a Fluorescent Nucleic Acid Dye. Available via Promega
Corporation. https://www.promega.com/resources/pubhub/quantifying-dsdna-and-
ssdna-isolated-by-manual-and-automated-methods-using-a-fluorescent-dye/. Accessed 21
Mar 2022
22. QIAGEN (2022) QIAGEN Protease and Proteinase K: For protease digestion during DNA and
RNA preparation. Available via Qiagen. https://www.qiagen.com/us/products/discovery-
and-translational-research/lab-essentials/enzymes/qiagen-protease-and-proteinase-k/.
Accessed 6 Aug 2022
23.
Promega Corporation (2020) Safety Data Sheet: Lysis Buffer. Available via Promega
Corporation. https://www.promega.com/resources/msds/msdss/a8000/a8261/.
Accessed 7 Aug 2022
24. Federal Bureau of Investigation (2020) Quality Assurance Standards for forensic DNA
testing laboratories. Available via the Federal Bureau of Investigation. https://www.fbi.
gov/file-repository/quality-assurance-standards-for-forensic-dna-testing-laboratories.pdf.
Accessed 21 Mar 2022
https://doi.org/10.1007/978-1-0716-3295-6_4
4. Applied Biosystems™ PrepFiler™

Forensic DNA Extraction Kit (Manual
and Semi-automated via AutoMate
Express™)
Megan M. Foley1
(1) Department of Forensic Sciences, The George Washington
University, Washington, DC, USA
Megan M. Foley
Email: mmfoley@gwu.edu
Abstract
The PrepFiler™ Forensic DNA Extraction Kits allow for optimal genomic
DNA isolation and purification from forensic samples through a bind-
wash-elute-based technique that can be performed manually or
robotically using the Applied Biosystems AutoMate Express™ Forensic
DNA Extraction System. The extraction kits come in two formats: the
standard kit used for common case type samples, like bodily fluid
swabs or stains, and a BTA kit for more challenging evidence sample
types that can be submitted for analysis, like bones, teeth, and
adhesive-type samples. Both forms of extraction, manual and semi-
automated, require an initial manual incubation step using a lysis buffer
to release the DNA into solution. If following the semi-automated
protocol, the lysate can be purified and eluted on the AutoMate
Express™. After lysis, the DNA binds to magnetic beads in the presence
of a chaotropic salt and is washed multiple times with an ethanol-based
wash buffer to purify the sample and remove potential PCR inhibitors.
After removing the wash liquid, elution buffer is added to the tube
containing the DNA-bound magnetic beads and heated, which disrupts
the bonding between the DNA and beads. The DNA is then concentrated
in the final tube and can be moved forward through the DNA analysis
workflow. This chapter describes a manual DNA isolation method and
the extraction procedures following both manual and robotic methods
using the PrepFiler™ chemistries in conjunction with the AutoMate
Express™ Forensic DNA Extraction System.
Key words DNA Extraction – PrepFiler™ – PrepFiler™ BTA – PrepFiler

Express™ – PrepFiler Express™ BTA – AutoMate Express™ – Forensic
Genetics – Forensic Biology – DNA analysis
1 Introduction
1.1 Background
The protocols for PrepFiler™ Forensic DNA Extraction Kit (e.g.,
PrepFiler™, PrepFiler™ BTA, PrepFiler Express™, and PrepFiler Express™
BTA) made by Applied Biosystems™ utilize similar technologies and
reagents to perform genomic DNA extraction, which includes a lysis
step, a purification step, and a concentration/elution step. Both the
manual and automated PrepFiler™ methods can be used for commonly
encountered forensic samples, including buccal swabs, bodily fluid
swabs, small tissue samples, hair roots, touch swabs, or other biological
stains found on substrates. The PrepFiler™ BTA kits have enhanced
steps to extract more challenging sample types, including bones (B),
teeth (T), and adhesives (A), as well as tape lifts, cigarette butts, and
chewing gum [1–3].
1.2 Sample Lysis

Regardless of whether the manual or semi-automated procedures are
followed, the basic techniques and methodologies are the same. After
sample collection, all samples and controls are subjected to a lysis step.
Cell lysis is performed by using the PrepFiler™ Lysis Buffer(s) mixed
with dithiothreitol (DTT) [1, 3]. The proprietary buffer contains
reagents like guanidine thiocyanate (GTC), a chaotropic salt that acts as
a denaturant to disrupt both cell and nuclear membranes in order to
release the DNA into solution [4, 5]. It is believed that chaotropic salts
have this effect because they disrupt the hydrogen bonds of water
found in the lysis buffer, making the nucleic acids more stable
throughout the procedure [6]. GTC also has reductant properties, which
break disulfide bonds in proteins, thus inactivating nucleases present in
the sample [7, 8]. Samples that are considered challenging (e.g.,
paraffin-embedded tissue and BTA samples) are subjected to additional
reagents like Proteinase K and Sodium Dodecyl Sulfate (SDS) [1, 3]. The
addition of these two reagents further helps the breakdown of the
cellular membrane and proteins present in the sample [5]. The samples
and controls are subjected to heat and agitation during the first
incubation, often at 70 °C, to further encourage membrane lysis. More
difficult sample types, like aged bones and teeth, require longer
incubation times due to the challenging nature of the sample types [1–
3].
After incubation, the sample is centrifuged in a spin basket to
remove any lysate that may be within the substrate into the bottom of
the tube. The PrepFiler™ LySep Column provided in the semi-
automated method allows for a more streamlined version of this
process by eliminating multiple transfer steps that could lead to
contamination and other errors [9, 10]. The column also allows for an
increase in lysate recovery since the sample stays in one tube
throughout the entire incubation and spin-down processes [11]. The
column contains a membrane and a frit layer, a porous layer that allows
passage of liquid, that remains intact during incubation, allowing the
substrate to be submerged in the lysis master mix throughout the
duration of the incubation. After this lysis incubation, the assembly is
centrifuged. Through high-speed centrifugation, the membrane housed
in the column bursts, allowing the supernatant to flow through the frit
to the bottom of the tube. Since the frit only allows the passage of the
liquid containing cellular material, the substrate remains on top of the
filter and can be removed prior to processing [1, 10]. If performing the
semi-automated method with the AutoMate Express™, lysis is the only
manual step. The remaining steps of the extraction are performed on
the instrument [1].
1.3 DNA Isolation and Purification

The first step of the DNA isolation and purification in the PrepFiler™
methods is to separate the DNA from the cellular and substrate material
remaining in the lysate. Before any isolation occurs, BTA samples have
additional buffer added to ensure proper salt concentration for DNA
binding [3]. The PrepFiler™ technology can be described as a solid-
phase extraction [5]. Magnetic silica beads are introduced to the lysate
and bind to the DNA, allowing the separation of DNA from unwanted
material present in the sample, like polymerase chain reaction (PCR)
inhibitors. Adsorption of DNA onto the magnetic beads is enhanced
through the presence of the chaotropic salts, like GTC, in the lysis buffer
[5, 8, 12, 13]. The liquid lysate is mixed with the silica magnetic beads
and isopropanol, then incubated again to allow enough time for the
DNA to reversibly bind [1, 3]. The beads used in PrepFiler™ have a high
surface area available to bind to a definable amount of DNA due to the
smaller sized beads, which allows for a higher yield [5].
After sufficient time is allowed for proper binding, a magnet is
introduced to the DNA-bound beads, either through the outside of the
tube (if following the manual method) or through the sample pipette
tip (if following the automated method). This allows the DNA to be
separated from the lysis supernatant, which is then removed and
discarded. Under the appropriate conditions, the beads remain on one
side of the plastic through the attraction with the magnet. Both
methods then follow a multi-step washing procedure. The PrepFiler™
Wash Buffers A and B (includes ethanol) are dispensed into the
tube/pipette, and the magnet is removed to allow the DNA-bound
particles to mix in order to remove any leftover unwanted material or
contaminants [1, 3]. Inhibitors are common in forensic samples, either
present due to the substrate material or through exposure to other
known inhibitors, like humic acid in soil or hematin in blood. It is
crucial that the extraction method removes all inhibitors to decrease
the chance of inefficient amplification and poor STR profile generation
[11, 14].
After mixing with the wash buffer, the magnet is applied again to the
sample (the DNA-bound beads) and the supernatant is removed and
discarded. This procedure occurs for a total of three washes following
the standard procedures and is recommended a fourth time for dirtier
samples that contain a large amount of protein. Wash Buffer B is added
during the third wash step in order to decrease the chance of carrying
over any wash buffer into the eluant, which is an inhibitor itself [1, 3].
The developmental validation for both systems and additional studies
conclude that the reagents do not add inhibitors to the extract and
successfully remove inhibitors present in the sample through the
evaluation of quantitation and genotyping results of extraction blanks
and samples. The PrepFiler™ developmental validation tested
compromised samples that included an inhibitor mixture (a mixture of
indigo, hematin, humic acid, and urban dust), blood on denim, and
blood on cloth exposed to the outdoors for 10 min. The PrepFiler
Express™ developmental validation extracted prepared compromised
samples containing denim, a prepared inhibitor mixture (a mixture of
indigo, hematin, humic acid, and urban dust), and a pulverized tooth
and bones [1, 9, 10, 15].
1.4 DNA Concentration and Elution

Once the DNA-bound silica beads have been thoroughly washed and the
last supernatant discarded, the sample is left to dry for around 10 min
to evaporate any wash buffer that is still present in the tube/tip. This is
necessary as leftover buffer can further dilute out the sample and lead
to less-than-optimal STR results. Lastly, the elution buffer is added to
the sample to remove the DNA—with the assistance of heat—from the
magnetic beads, allowing for concentration of the DNA sample [1, 3].
The binding of the DNA to the magnetic beads is reversible under the
appropriate conditions. Elution with the PrepFiler™ kits occurs through
the heating of the beads under alkaline conditions and the removal of
any salts that were present [5, 8, 15]. Elution volumes between 20 μL
and 250 μL are available using the AutoMate Express™ workflow. It
should be noted that the 20 μL elution volume showed less recovery
than larger volumes when evaluated using blood samples in a study
performed by Applied Biosystems™ [1].
1.5 The AutoMate Express™ Forensic DNA Extraction

System
As mentioned above, the methods and techniques for extraction using
the AutoMate Express™ System are identical to the manual extraction.
The enhancement of the semi-automated procedure is that the
purification and concentration/elution steps are automated by using
the AutoMate Express™ Forensic DNA Extraction System (see Fig. 1),
also manufactured by Applied Biosystems™ [10]. The robotic system is
able to process a total of 13 samples and decreases the
purification/elution time to 30 min. A protocol card is inserted within
the instrument that is preprogrammed specifically to the extraction kit
utilized. After the lysate tubes have been inserted into the instrument
and the run started, steps performed in the manual process are
automated by the robot. This includes mixing of lysate with the various
reagents, including the magnetic beads and isopropanol, separation of
the magnetic particles bound to the DNA, washing of the DNA-bound
magnetic beads, the removal of the ethanol wash buffer, and finally, the
elution of the purified DNA. The system contains a magnet unit that
uses Magtration™ technology that pulls magnetic beads present in a
sample towards the magnetic strip housed in the instrument while
remaining in the pipette tip, instead of mixing within the tube, like in
the manual method [1, 2].
Fig. 1 The AutoMate Express™ Forensic DNA Extraction System and the PrepFiler Express™
Extraction Kit. (Reproduced from ref. [16]. Figure owned by Life Technologies Corporation, a
part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific
Inc. Used under permission)
The wash buffer is aspirated and dispensed while the DNA-bound

beads are held to the side of the pipette tip, which helps increase the
yield of DNA. This also decreases the chance that magnetic beads are
eluted with the DNA in the final elution step. Additionally, the chance
for contamination is decreased using this system as the tubes, reagents,
and tips for each sample stay within the same axis line within the
instrument. All purification and elution reagents are prepackaged into a
single sample reagent cartridge. Each cartridge contains additional lysis
buffer for BTA extractions, a suspension of the magnetic particles,
isopropanol to promote proper binding, three separate wells for wash
buffer, and the elution buffer. See Fig. 2 for a visual representation of the
reagent cartridge. The lysate tubes, a set of pipette tips and tip holders,
and the elution tube are lined up for each sample to a reagent cartridge.
One tip/tip holder and one cartridge are used per sample [1, 2, 10].
Fig. 2 Visual representation of the single-sample reagent cartridge used for the AutoMate
Express™ semi-automated workflow. The cartridge contains 12 wells: 10 are sealed with
extraction reagents/empty and 2 are left open for heating. Tubes labeled 1 and 0 represent the
sample tube which contains the lysate and the empty elution tube. Slots 8–10 will be empty.
(Reproduced from ref. [17]. Figure owned by Life Technologies Corporation, a part of Thermo
Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used
under permission)
2 Materials
Reusable instruments, like forceps, scissors, etc., should be sterilized
prior to use and decontaminated in between use. Plastics (pipette tips
and tubes) should be DNase- and RNase-free. Aerosol-resistant/barrier
pipette tips are highly recommended for extraction procedures. All
reagents should be prepared with molecular biology grade DNA-free
water.
2.1 Manual PrepFiler™ Extractions

1.
Isopropanol.
2.
1X Phosphate-Buffered Saline (PBS) (see Note 1).
3.
20 mg/mL Proteinase K: Store at the manufacturer indicated
temperature. If the preparation requires freezing, store as aliquots
at −20 °C and limit freeze/thaw events. This is for use with the
PrepFiler™ Forensic DNA Extraction Kit only, when required (see
Note 2). Samples processed with the PrepFiler™ BTA Forensic DNA
Extraction Kit will utilize Proteinase K supplied with the kit.
4.
Low-TE Buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0; aka TE −4
(see Note 2).
5.
10% Sodium Dodecyl Sulfate (SDS) (see Note 3).
6. PrepFiler™ Forensic DNA Extraction Kit: Contains PrepFiler™ Lysis
Buffer (see Note 4); PrepFiler™ Magnetic Particles; PrepFiler™
Wash Buffer A Concentrate (×2 bottles); PrepFiler™ Wash Buffer B
Concentrate (×2 bottles); PrepFiler™ Elution Buffer; PrepFiler™
Filter Columns; PrepFiler™ Spin Tubes; 1.5 mL non-stick RNase-
free microcentrifuge tubes; and 2.0 mL microcentrifuge tubes with
screw caps. Store all components at room temperature upon
receipt, except the magnetic particles. These should be stored at 4–
8 °C until first use, then at room temperature. To prepare a working
stock of the concentrated wash buffers, add 93 mL of 95% ethanol
to one of the Wash Buffer A concentrate bottles and 19.5 mL of
95% ethanol to one of the Wash Buffer B concentrate bottles.
Diluted wash buffers expire 6 months after preparation when
stored at room temperature (see Note 5).
7.
PrepFiler™ BTA Forensic DNA Extraction Kit: Contains PrepFiler™
Lysis Buffer (see Note 4); PrepFiler™ BTA Lysis Buffer (see Note 4);
PrepFiler™ Magnetic Particles; PrepFiler™ Wash Buffer A
Concentrate (×2 bottles); PrepFiler™ Wash Buffer B Concentrate
(×2 bottles); PrepFiler™ Elution Buffer; PrepFiler™ Filter Columns;
PrepFiler™ Spin Tubes; 20 mg/mL Proteinase K; 1.5 mL non-stick
RNase-free microcentrifuge tubes; 2.0 mL microcentrifuge tubes
with screw caps. Store all components at room temperature upon
receipt, except the magnetic particles. These should be stored at 4–
8 °C until first use, then at room temperature. Prepare a working
stock of the concentrated wash buffers as described for the
standard PrepFiler™ kit (see Subheading 2.1, item 9).
8.
Oven for heating buffer containers.
9.
Magnetic stand(s): Recommend those that hold 16 microcentrifuge
tubes.
2.2 Semi-automated PrepFiler™ Extractions Using the

AutoMate Express™
1.
PrepFiler Express™ Forensic DNA Extraction Kit: Contains
PrepFiler™ LySep Columns; Hingeless 1.5 mL PrepFiler™ Sample
Tubes (no caps); PrepFiler™ Elution Tubes; PrepFiler™ Lysis Buffer
(see Note 4); PrepFiler Express™ Cartridges; and Automate
Express™ Tips and Tip Holders. Store all components at room
temperature.
2. PrepFiler Express BTA™ Forensic DNA Extraction Kit: Contains
PrepFiler ™ LySep Columns; Hingeless 1.5 mL PrepFiler™ Sample
Tubes (no caps); PrepFiler™ Elution Tubes; PrepFiler™ BTA Lysis
Buffer (see Note 4); PrepFiler Express™ Cartridges; AutoMate
Express™ Tips and Tip Holders; PrepFiler™ Bone and Tooth Lysate
Tubes; PrepFiler™ Bone and Tooth Lysate Tube Caps; and
20 mg/mL Proteinase K. Store all components at room
temperature.
3.
AutoMate Express™ Forensic DNA Extraction System: Contains
PrepFiler Express™ and/or PrepFiler Express™ BTA Protocol Card;
AutoMate Express™ Tip and Tube Rack; AutoMate Express™
Cartridge Rack; and D-ring Exchange Tools, Silicone Greats, and D-
rings.
2.3 Shared Materials for Manual and Robotic Extractions

1.
Thermomixer (see Note 6) or heat block for microcentrifuge tubes
(see Note 7).
2.
PCR hood.
3.
Sterile forceps.
4.
1.0 M solution DL-Dithiothreitol (DTT): Molecular weight is
154 g/mol. Store as aliquots at −20 °C and limit freeze/thaw events
(see Note 8).
3 Methods
Before beginning extraction, ensure that all reagents are within
expiration and that all necessary equipment and consumables are
stocked. Prepare all documentation worksheets with appropriate
information (e.g., sample names, elution volumes, etc. (see Note 9)). A
reagent blank should be included in each extraction batch, and, if
desired, a positive extraction control containing DNA from a known
source. Hair nets, a face mask, and gloves must be worn throughout this
procedure, changing gloves often and when necessary, like before
touching any sample tubes, or when a sample may have contaminated
the glove.
3.1 Preparation for Manual Extraction

1. To prepare the magnetic beads, set a thermomixer or heat bath to
37 °C. Once up to temperature, incubate the bead tube for 10 min
(see Note 10). Allow the DTT and Proteinase K (if frozen and if
processing paraffin-embedded tissue) to come to room
temperature.
2.
If precipitate is visible in the lysis buffer, preheat an oven or heat
bath to 37 °C and incubate the bottle for 15 min. Vortex for at least
5 s.
3.
For the standard PrepFiler™ kit, preheat the thermomixer to 70 °C.
If extracting DNA from nail clippings, preheat one thermomixer to
37 °C and a second to 50 °C (see Note 11). For PrepFiler™ BTA kit
and paraffin-embedded samples, preheat the thermomixer to 56 °C.
4.
For bone, tooth, or tape samples using the BTA kit, label a 2.0 mL
screw-cap tube with the appropriate sample information. For all
other BTA samples and the standard kit, label a 1.5 mL
microcentrifuge tube or a PrepFiler™ Spin Tube. Carefully transfer
the sample into the appropriately labeled tube, utilizing sterile
forceps if necessary (see Note 12). For recommended sample input
size based on sample type, see Table 1.
Table 1 PrepFiler™/BTA manual extraction sample types and recommended sample input
Protocol Sample type Recommended sample

type input
Standard Liquid samples ≤40 μL
Standard Blood on a substrate (e.g., FTA card) Punch or 5 × 5 mm cutting
Standard Saliva or semen on substrate (e.g., fabric) Punch or 5 × 5 mm cutting
Standard Bodily fluid swabs One swab or less
Standard Tissue fragment One swab or less
Modified Blood/soil mixture ≤50 mg
Modified Differentially separated samples—epithelial and Epithelial fraction ≤150 μL
sperm fractionsa Sperm fraction ≤200 μL
Modified Hair root 3 mm cutting from root
Modified Nail ≤5 mm clipping
Protocol Sample type Recommended sample
type input
Modified Paraffin-embedded tissue 3 × 3 mm of tissue or 5 × 5
tissue slide
BTA Bone—powdered ≤50 mg
BTA Tooth—powdered ≤50 mg
BTA Cutting of envelope flaps 1 × 1.5 cm
BTA Chewing gum ≤50 mg (or 3 × 5 × 5 mm)
BTA Tissue fragment One swab or less
BTA Cigarette butt filter paper 5 × 5 mm cutting
BTA Tape lift—saliva or blood 5 cm2 cutting
Recommended sample inputs are ideal sample amounts. Based on state

laws for sample preservation, consumption of the full amount of sample
may not be allowed. Additional factors should be considered and the
above table used as a guide (e.g., degraded/aged samples, presence of
inhibitors, or the nature of the substrate). Samples labeled as protocol
type “Standard” can be extracted following the common sample
PrepFiler™ protocol. Samples labeled as “Modified” are extracted
following steps that deviate from the standard PrepFiler™ protocol.
Samples labeled as protocol type “BTA” should follow any procedural
steps specific to the BTA kit
aFor differential samples, follow validated procedures for differential
separation of epithelial and sperm cells. The large volume sample

protocol can be followed for any common sample type that isn’t fully
covered by 300 μL of master mix. An example sample type that may
require the large volume protocol is a touch DNA swab that requires
three swabs for sample collection due to the large surface area
collected
3.2 Sample Lysis for Manual Extraction

1. Blood/soil mixture samples and paraffin-embedded tissue samples
must go through an additional preparation step (see Subheading
3.2, steps 2 and 3–5, respectively). Epithelial and sperm fractions
from differential extractions do not need this step and can
proceed to manual DNA isolation and purification (see
Subheading 3.3, step 1). For all other samples, prepare the
specified extraction master mix (see Subheading 3.2, step 6).
2.
For blood/soil mixture samples, aliquot 100 μL of 1X phosphate-
buffered saline to each sample/control tube and close the cap.
Vortex for 10 s and centrifuge for 30 s. Do not exceed 30 s (see
Note 13). Transfer the supernatant to a newly labeled 1.5 mL
microcentrifuge tube, carefully avoiding any of the sediment at
the bottom of the tube. Proceed to Subheading 3.2, step 7.
3.
For paraffin-embedded tissue sample, prepare a minimum of 1 mL
of Proteinase K lysis master mix in an appropriately sized tube
(e.g., 5 mL, 15 mL conical tubes, etc.) composed of 980 μL of low-
TE Buffer, 5 μL of 10% SDS, and 15 μL of Proteinase K (see Note
14).
4.
Aliquot 100 μL of the master mix to each tube. Incubate for
60 min at 56 °C at 900 RPM (see Notes 15 and 16). During this
time, preheat a second thermomixer to 95 °C. After the first
incubation is finished, transfer the tubes to the second
thermomixer and incubate for another 15 min at 95 °C at 900
RPM.
5.
Remove the tubes from the thermomixer and cool for at least 5
min. Centrifuge for 30 s at 16,000 × g. Proceed to Subheading 3.2,
step 7.
6.
For all other samples, prepare an extraction master mix in an
appropriately sized tube (e.g., 5 mL, 15 mL conical tubes, etc.). See
Table 2 for reagent volume specifications for the different sample
types (see Note 17). Proceed to Subheading 3.2, step 7.
7.
Add the master mix (or indicated reagent) to each sample (see
Note 15 and Table 2). Vortex each sample/control for 5 s and
pulse spin to remove any liquid from the cap.
8. Perform the first incubation (see Notes 16 and 18). Place each
tube into the pre-heated thermomixer. See Table 3 for incubation
parameters specific for each sample type. For nail clippings,
preheat a second thermomixer for 70 °C After the first incubation
preheat a second thermomixer for 70 C. After the first incubation
is complete, centrifuge the nail clippings at 16,000 × g for 5 s and
transfer the supernatant to a new labeled 1.5 mL microcentrifuge
tube (leave the nail clipping in the initial tube). Cap and incubate
the transferred supernatant for an additional 20 min at 70 °C at

900 RPM.
9.
While the samples are incubating, prepare for the next incubation
(see Note 19). For the standard kit, prepare an assembly for each
sample/control tube by placing a PrepFiler™ Filter Column into a
labeled PrepFiler™ Spin Tube and close the cap. For the BTA kit,
prepare a new set of labeled 1.5 mL microcentrifuge tubes for all
sample types. For non-bone and tooth samples with the BTA kit,
also prepare an assembly for each sample/control tube by placing
a PrepFiler™ Filter Column into a labeled PrepFiler™ Spin Tube
and close the cap.
10.
Once the first incubation is complete, set the thermomixer to
room temperature (see Note 19) and briefly centrifuge or pulse
spin all tubes to remove any condensation from the top and sides.
Transfer the lysate into the corresponding filter column assembly
using a 1000 μL pipette. Next, transfer the substrate (if present)
into the filter using sterile forceps, and cap the assembly.
11.
Centrifuge according to sample type (see Note 20). For the
standard kit and extraction of all common samples (standard or
large), hair samples, nail clippings, or paraffin-embedded tissue
samples, centrifuge for 2 min at 14,000 × g or 5 min at 4000 × g.
For the standard kit and extraction of blood/soil mixture samples,
centrifuge for 5 min at maximum speed, ideally 16,000 × g. For the
BTA kit and extraction of bone, tooth, or chewing gum samples,
centrifuge for 90 s at 10,000 × g. For any remaining BTA sample
types, centrifuge for 90 s at 8000 × g.
12. After centrifugation, ensure that each lysate is at a total volume of
at least 180 μL. Any samples less than 180 μL should be
centrifuged again for 5 min. If the sample is still below 180 μL,
bring it up to a volume of 300 μL with PrepFiler™/BTA Lysis
Buffer. Retain or dispose of the cutting/substrate based on
laboratory procedures. Standard samples must be between 180
μL and 300 μL for proper extraction.
13.
For blood/soil mixtures, paraffin-embedded tissue samples, and all
BTA samples, transfer the supernatant to a new labeled 1.5 mL
microcentrifuge tube without transferring any sediment (see Note
21).
14.
Let the samples/controls come to room temperature after
incubation. This step takes around 5 min (see Note 22).
15.
For all BTA samples, add 300 μL of PrepFiler™ Lysis Buffer (not
BTA Lysis Buffer) to each sample/control, cap, vortex, and pulse
spin.
16.
Proceed to manual DNA isolation and purification (see
Subheading 3.3, step 2; Note 23).
Table 2 PrepFiler™/BTA manual extraction master mix specifications
Sample type PrepFiler™/BTA DTT Proteinase Master mix

Lysis Buffer K dispensed per
sample
Common samples (non-semen) 300 μL 3 μL Not used 300 μL
or nail clippings
Semen (non-differential) 300 μL 5 μL Not used 300 μL
Hair 100 μL 3 μL Not used 103 μL
Blood/soil mixtures Pipette 500 μL of PrepFiler™ Lysis Buffer into each tube
Paraffin-embedded tissue Pipette 500 μL of PrepFiler™ Lysis Buffer into each tube
Large volume samples (non- 500 μL 5 μL Not used 500 μL
semen)
Large volume semen samples 500 μL 8 μL Not used 503 μL
BTA samples 220 μL 3 μL 7 μL 230 μL
This table displays the volumes of reagents per sample in the

preparation of the master mix per sample type. For BTA samples, use
the kit supplied PrepFiler™ BTA Lysis Buffer and Proteinase K. For all
other sample types, use the standard PrepFiler™ Lysis Buffer. The final
volume of the master mix that will be aliquoted into each
sample/control tube is designated in the final column
Table 3 PrepFiler™/BTA manual extraction lysis incubation specifications
Sample type Temperature Mix Duration

(°C) settings (min)
(RPM)
Liquid bodily fluid (standard or large) and paraffin- 70 900 20
embedded tissue samples
Dried stain (standard or large) and hair samples 70 900 40
Non-differential semen samples (standard or large) 70 900 90
Blood/soil mixture samples 70 900 30
Nail clippings (first incubation) 37 900 20
Nail clippings (next incubation) 70 900 20
BTA bone and teeth samples 37 1100 120
Other BTA samples 37 900 40
The incubation parameters and time based on sample type
3.3 DNA Isolation and Purification for Manual Extraction

1.
For epithelial and sperm fractions processed via a differential
extraction procedure (not processed through Subheading 3.2),
add 300 μL or 500 μL of PrepFiler™ Lysis Buffer, respectively. If
following the input sizes in Table 1, add an additional 150 μL or
100 μL of buffer, respectively.
2.
Vortex the PrepFiler™ Magnetic Particles and invert the tube
multiple times to mix the beads into the solution. Do not
centrifuge; flick the tube downwards if liquid remains on the cap.
During storage, the beads settle at the bottom of the tube (see
Note 24).
3.
Add the appropriate volume of beads to each sample/control
based on sample type (see Table 4) and close the lid.
4. Vortex each tube for 10 s at a low speed (500–1200 RPM) and
pulse spin (see Note 25) Add isopropanol based on the sample
pulse spin (see Note 25). Add isopropanol based on the sample
types listed in Table 4 below.
5.
Vortex the samples at low speed and place them on the
thermomixer. Incubate the samples on the thermomixer for
10 min at room temperature at 1000 RPM.
6.
After the second incubation, vortex each sample at maximum
speed for 10 s and pulse spin (see Note 26). Set the thermomixer
to 70 °C for the next incubation step.
7.
Place each tube in a slot of the magnetic stand. For the standard
kit, wait 1–2 min for a pellet to form towards the magnet of the
stand. For the BTA kit, wait 10 min for a pellet to form (see Note
27 and Fig. 3).
8.
Remove the supernatant and discard using a 100 μL pipette. Do
not remove any of the magnetic particles (see Note 28).
9.
Wash the DNA-bound magnetic particles by adding 600 μL of the
diluted PrepFiler™ Wash Buffer A to each tube (see Notes 29–31).
Vortex each tube and pulse spin. Place each tube back into a slot in
the magnetic stand. Wait 60 s for a pellet to form towards the
magnet of the stand (see Note 32). Remove and discard the
supernatant using a 100 μL pipette, again ensuring that the pellet
is not disturbed. Repeat this wash procedure using 300 μL of the
diluted PrepFiler™ Wash Buffer A, followed by 300 μL of the
diluted PrepFiler™ Wash Buffer B, for a total of three washes.
10.
After the third wash, centrifuge all samples for 30 s at a low speed
to pull any residual wash buffer to the bottom of the tube. Place
back on the magnetic stand and remove any leftover supernatant.
11.
Proceed to manual DNA concentration and elution (see
Subheading 3.4, step 1).
Table 4 PrepFiler™/BTA manual extraction magnetic reagent incubation volume specifications
Sample type Volume of magnetic beads Volume of isopropanol

Sample type Volume of magnetic beads Volume of isopropanol
Standard common samples 15 μL 180 μL
Differential epithelial fraction 15 μL 180 μL
Differential sperm fraction 15 μL 300 μL
Hair samples 15 μL 100 μL
Paraffin-embedded tissue samples 15 μL 300 μL
Nail clippings 15 μL 180 μL
Large volume samples 15 μL 300 μL
Blood/soil mixture samples 20 μL 300 μL
BTA samples 15 μL 300 μL
The magnetic bead and isopropanol volumes based on sample type
Fig. 3 Formation of pellet. A visualization of the tube placement within the magnetic stand
with the bead pellet forming towards the magnet. The magnet in the top picture will be behind
the tube and in the bottom picture will be on the left side. (Reproduced from ref. [3]. Figure
owned by Life Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.
thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under permission)
3.4 DNA Concentration and Elution for Manual Extraction

1. Once the third wash supernatant has been removed, open the
tube(s), and air-dry the particles for 7–10 min. To decrease the
chance of contamination, ensure that the rack is placed in a sterile
space like a PCR hood and closed off during this time so that
nothing is passed over the open tubes (see Note 33).
2.
Add 50 μL of the PrepFiler™ Elution Buffer to each sample/control
(see Note 34). Vortex for 5 s and pulse spin. Ensure that the
magnetic beads have been resuspended in the buffer (see Note 35).
Then immediately place each tube in the preheated thermomixer
(see Note 36). For the standard kit, incubate for 5 min at 70 °C at
900 RPM. For the BTA kit, incubate for 10 min at 70 °C at 900 RPM.
During the incubation, label a set of 1.5 mL elution tubes.
3.
After incubation, vortex samples for 2 s and pulse spin.
Immediately place the tubes in the magnetic stand. Wait 1–5 min
for a pellet to form towards the magnet of the stand.
4.
Remove the supernatant (contains the DNA) carefully to avoid
disturbing the pellet and place it into the appropriately labeled
1.5 mL elution tube (see Note 37). If the eluant is cloudy, centrifuge
the sample for 5 min at 10,000 × g, return the tube to the magnet
stand, and transfer the supernatant into a labeled 1.5 mL
microcentrifuge tube (see Note 38).
5.
Purified extracts may proceed immediately to DNA quantitation or
should be stored at −20 °C for long-term storage or 4 °C for short-
term storage (up to 1 week).
3.5 Preparation for the Semi-automated PrepFiler

Express™ Standard and BTA Extraction Using the AutoMate
Express™
1.
Preheat the thermomixer. For standard samples, heat the
thermomixer to 70 °C. For BTA samples, heat the thermomixer to
56 °C.
2.
Check the PrepFiler™ (or BTA) Lysis Buffer for crystals. If
precipitate is visible, heat the bottle to 37 °C in an oven. Vortex the
bottle to ensure all crystals have resolubilized.
3. Insert a PrepFiler™ LySep Column into a hingeless PrepFiler™
f
Sample Tube. Close the cap to decrease the chance of
contamination (see Note 39). This assembly should be prepared for

each sample/control to be extracted. Label the top of the column
and side of the tube with the appropriate sample information (see
Note 40). If extracting bone and/or teeth, utilize the supplied
PrepFiler™ Bone and Tooth Lysate tubes and caps. No column is
utilized for this sample type.
4.
Carefully transfer the sample into the appropriately labeled tube,
utilizing sterile forceps if necessary (see Note 41).
5.
For recommended sample input based on sample type, see Table 5.
6.
Label the top and sides of a PrepFiler™ Elution Tube for each
sample/control for later use.
7.
Proceed to sample lysis using the AutoMate Express™ (see
Table 5 PrepFiler/BTA Express™ semi-automatic extraction sample types and recommended
sample input
Protocol/Kit type Sample type Recommended sample input

PrepFiler Express™ Liquid samples ≤40 μL
PrepFiler Express™ Blood on a substrate (e.g., FTA Punch or 5 × 5 mm cutting
card)
PrepFiler Express™ Saliva or semen on substrate Punch or 5 × 5 mm cutting
(e.g., fabric)
PrepFiler Express™ Bodily fluid swabs One swab or less
PrepFiler Express™ Hair root 5 mm cutting from root
PrepFiler Express Bone—powdered ≤50 mg
BTA™
PrepFiler Express Tooth—powdered ≤50 mg
BTA™
PrepFiler Express Chewing gum ≤50 mg or a 3 × 3 × 5 mm section (see
BTA™ Note 41)
PrepFiler Express Cigarette butt filter paper 5 × 5 mm cutting split into 2–3 pieces
BTA™
Protocol/Kit type Sample type Recommended sample input
PrepFiler Express Tape lifts 2 × 2 cm cutting (see Note 42)
BTA™
Recommended sample inputs are ideal sample amounts. Based on state

laws for sample preservation, the full amount may not be allowed.
Additional factors should be considered and the above table used as a
guide (e.g., degraded/aged samples, presence of inhibitors, or the
nature of the substrate). The Protocol/Kit column informs what type of
kit and protocol card should be used for the specific sample types
3.6 Sample Lysis for Semi-automated PrepFiler Express™

Standard and BTA Extraction Using the AutoMate Express™
1.
Allow the DTT to come to room temperature.
2.
Prepare an extraction master mix in an appropriately sized tube
(e.g., 5 mL, 15 mL conical tubes, etc.) (see Note 17). For standard
samples, combine 500 μL of PrepFiler™ Lysis Buffer and 5 μL of
DTT per sample. For BTA samples, combine 220 μL of PrepFiler™
Lysis Buffer, 3 μL of DTT, and 7 μL of Proteinase K per sample.
3.
For standard samples, add 500 μL of master mix to each
sample/control assembly and close the lid. For BTA samples, add
230 μL of master mix to each sample/control assembly and close
the tube by screwing on the supplied cap. Vortex and pulse spin
for 5 s (see Notes 15, 17, and 42–44).
4.
For standard samples, place each assembly into the pre-heated
thermomixer (70 °C). Incubate for 40 min at 750 RPM (see Note
45); the master mix and sample/control sit in the upper part of
the LySep column for the incubation. For bone and teeth samples,
place each tube into the pre-heated thermomixer (56 °C).
Incubate for 2–18 h at 1100 RPM. For adhesive samples, place each
assembly into the pre-heated thermomixer (56 °C). Incubate for
40 min at 750 RPM (see Note 45).
5. Prepare the sample and reagent racks during incubation. Open the
instrument by sliding the front door upwards. Remove the two
instrument by sliding the front door upwards. Remove the two
racks from within. The AutoMate Express™ Cartridge Rack is
located towards the back of the instrument, and the AutoMate
Express™ Tip and Tube Rack is located nearest the door (see Fig.
6). Lift each rack straight up and remove it from the instrument
(see Note 46).
6.
Load the Reagent Cartridge Rack. Remove a reagent cartridge
from the plastic container. Before loading a reagent cartridge,
ensure that all reagents and appropriate volumes are visible. Do
not remove the foils. If any precipitation is observed, incubate the
cartridge for around 30 min at 37 °C the day of the run until no
crystals are observed. Load the cartridge by sliding along the
groove in the direction of the arrow etched into the rack. Once the
cartridge is in all of the way, it should click into place. Each
cartridge contains a notch that should directly line up with the
notches on the Reagent Cartridge Rack (see Fig. 4). A maximum of
13 samples/controls can be processed at a time (see Note 47).
7.
Load the Tip and Tube Rack (see Fig. 5) as described.
8.
Row S (last row towards the back of the instrument): capless
labeled lysate PrepFiler™ sample tubes only, no columns—insert
during Subheading 3.6, step 14.
9.
Row T2: One pair of AutoMate Express™ tips and tip holders per
sample.
10.
Row T1: Empty, used for other applications.
11.
Row E (first row closest to the window of the instrument): labeled
PrepFiler™ 1.5 mL elution tubes. Caps can remain closed during
this step to decrease the chance of contamination. They can be
removed before inserting the tray into instrument.
12. Centrifugation of incubated samples. For common and adhesive
samples, remove all samples/controls from the thermomixer and
centrifuge the assemblies for 2 min at 10,000 × g. For bone and
tooth samples, remove all samples/controls from the thermomixer
and centrifuge the assemblies for 90 s at 10 000 × g
and centrifuge the assemblies for 90 s at 10,000 × g.
13.
If there is any liquid lysate in the column section after
centrifugation, re-centrifuge for 5 min or pipette into the sample
tube. For standard samples, an optimal volume of at least 300 μL
should be extracted. If the volume is still below 300 μL, bring it to
volume with additional PrepFiler™ Lysis Buffer. For BTA samples,
a minimum of 200 μL should be extracted. Bring it to volume with
additional PrepFiler™ BTA Lysis Buffer. Less than the optimal
volume can cause issues with the DNA binding to the magnetic
beads, air bubbles, or improper mixing (see Note 48).
14.
Transfer the assembly into the appropriate column of the Tip and
Tube Rack in row “S.” Remove the columns/caps one at a time (see
Note 49). Retain the cutting or dispose based on laboratory’s
procedures.
15.
Before loading into the instrument, verify that all samples line up
with the appropriately labeled elution tube and each sample has a
corresponding tip, tip holder, and reagent cartridge.
16.
Immediately proceed to DNA extraction with the AutoMate
Express™ (see Subheading 3.7, step 1).
Fig. 4 Proper insertion of reagent cartridge into the reagent rack. A visualization of the lineup
of the notches of the reagent cartridge and the cartridge rack. If a reagent cartridge is not
properly inserted, this can result in an instrument error. For example, because the instrument
follows an exact axis alignment, if the reagent cartridge is not lined up correctly, the tip may hit
the plastic instead of entering into the reagent. This can lead to severe issues and instrument
down-time. (Reproduced from ref. [17]. Figure owned by Life Technologies Corporation, a part
of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc.
Used under permission)
Fig. 5 Tip and tube holder rack. A visualization of the placement of consumables into the tip
and tip holder rack. Row 1—sample lysate tubes; this is towards the back of the instrument.
Row 2—tips and tip holders. Row 3—empty. Row 4—elution tubes; this is the closest to the
door of the instrument. (Reproduced from ref. [2]. Figure owned by Life Technologies
Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo
Fisher Scientific Inc. Used under permission)
3.7 DNA Extraction on the AutoMate Express™ Robot

1.
Prepare the AutoMate Express™. Confirm that the appropriate
card is loaded into the instrument. The power switch should be
turned to OFF (see Notes 50 and 51).
2. On the front of the instrument in the lower left quadrant is a black
protocol card slot. To remove the installed card, lift the cover and
push the black button. This pushes the card out. If the card is not
h i l di h i d
the appropriate protocol, remove and insert the appropriate card.
3.
Press the appropriate protocol card into the slot. The arrow
should be pointing towards the instrument. The label side should
be facing to the left side. Once the card is inserted, the door to the
card slot can be closed.
4.
Power the instrument to the ON position (see Note 52). The
instrument begins reading the protocol card and should display
protocol information. Once the protocol has been loaded, the
“Main Menu” is visible.
5.
Open the AutoMate Express ™ door. First, insert the loaded
Reagent Cartridge Rack (see Note 53).
6.
Check each reservoir that contains the magnetic beads to ensure
that they are resuspended (see Note 54).
7.
Next, insert the loaded Tip and Tube Rack into the front position
of the instrument. Row “E” should be closest to the door (see Fig.
6). At this time, open each elution tube and settle the cap into the
open slot at the front of the tray (see Note 55). Slide the
instrument door closed.
8.
Start the extraction run. From the “Main Menu” on the digital
display, press “START.”
9.
Next, a series of prompts are available to help verify the kit type
and position of the different consumables. Step through each of
these prompts by pressing the Enter key (icon of a down and left
arrow at the bottom right corner of the keypad) and double check
that each of the commands is correct.
10.
The next display asks which script is being used. Press the
appropriate option: “1” for PF Express, “2” for PF Express BTA.
11. The next display asks for elution volume settings. Press the
appropriate option: “1” for 20 μL, “2” for 30 μL, “3” for 40 μL, “4”
for 50 μL, “5” for 100 μL, “6” for 200 μL, or “7” for 250 μL (see
Note 56).
12.
The last display repeats the options chosen. Verify that each is
correct. If any information is incorrect, press “ESC” until the
parameter screen appears and choose the correction option. To
cancel the run, press “STOP” twice to return to the main menu.
13.
Press “START” to begin the extraction. During the extraction
process, a timer provides an estimated time until the run is
complete and a short description is displayed of the step being
performed by the instrument.
14.
Once the run has finished, there is a beep and the display switches
to “Finished Protocol.” Press “Enter” to return to the main menu.
15.
Open the instrument door and close each of the elution tubes.
Remove the Tip and Tube Rack. Replace the elution caps
and move elution tubes to an appropriate location and discard
remaining contents into the appropriate biohazard location.
Remove the Reagent Cartridge Rack and discard used reagent
cartridges into the appropriate biohazard location.
16.
If the eluant is cloudy, centrifuge the sample for 5 min at
10,000 × g, return the tube to the magnet stand, and transfer the
supernatant into a labeled 1.5 mL microcentrifuge tube (see Note
38).
17.
Before turning the instrument off, make sure the proper
maintenance is performed (see Subheading 3.8, steps 2–6).
18.
Purified extracts may proceed immediately to DNA quantitation
or should be stored at −20 °C for long-term storage or 4 °C for
short-term storage (up to 1 week).
Fig. 6 Loading of the AutoMate Express™. A visualization of the placement of the Reagent
Cartridge Rack and the Tip and Tube Rack for extraction inside of the AutoMate Express™.
(Reproduced from ref. [2]. Figure owned by Life Technologies Corporation, a part of Thermo
under permission)
3.8 Post-Run Instrument Maintenance

1.
The following procedures should be performed after every run.
2.
Clean the inside of the instrument, including the syringe unit, using
deionized water on a disposable laboratory wipe, followed by 70%
ethanol on another laboratory wipe. Do not utilize acidic or basic
reagents, like bleach, to clean the instrument. PrepFiler™ reagents
utilize guanidine thiocyanate, which when mixed with these
reagents, may create toxic gases.
3. At the bottom of the inside of the robot is a removable metal tray
that sits underneath the racks. Remove the tray and wipe its
surface clean with a disposable laboratory wipe moistened with
deionized water, followed by another wipe moistened with 70%
ethanol. This should only be performed when the instrument is off.
Reinsert the tray properly.
4.
The clear door panel can be wiped with a disposable laboratory

wipe moistened with deionized water.
5.
The Reagent Cartridge Rack, the Tip and Tube Rack, and the
magnets within the instrument should be wiped with a disposable
laboratory wipe moistened with deionized water, followed by
another wipe moistened with 70% ethanol.
6.
The piercing units should be cleaned in the same manner as above.
To access the piercing units, turn the instrument on. From the main
menu, press “1” to display the “Man” screen. From here, press “3”
for “Clean,” and then “1” to lower the piercing unit. Wipe the tips
(see Note 57). Once finished, press “ESC” to return the piercing unit
to the running position.
3.9 Bi-weekly Instrument Maintenance

1.
On a bi-weekly basis, perform maintenance on the D-rings (see
Note 58). With gloves, apply vacuum-type silicon grease to the tip
of a finger. Apply the grease on the surface of the D-rings on each
nozzle of the syringe unit (see Note 59). Wipe off excess grease that
can be seen on the edge of the nozzles utilizing either a disposable
laboratory wipe or dust-free cloth.
3.10 Monthly Instrument Maintenance

1.
The following procedures should be performed monthly.
2. Perform the Axis test (see Note 60): before beginning, load empty
reagent cartridges into the Reagent Cartridge Rack. Load the Tip
and Tube Rack with empty tips/tip holders and tubes into each
position (see Note 61). Although the extraction run only requires
one row of tips and tip holders, fill Row T1 and T2 for the axis test.
Place the racks back into their positions. Press “3” on the main
menu to pull up the “Tests” screen. Press “1:Axis” to choose the axis
test. Press “Start.” The estimated run time is 3 min. If no problem is
detected, the screen displays “All OK.” If a problem is detected, an
error code is displayed. Contact Thermo Fisher with the error code.
Once finished, press “ESC” to return.
3.
Perform the temperature test (see Note 62): Press “3” on the main
menu to pull up the “Tests” screen. Press “2:Temp” to choose the
temperature test. Press the up-arrow button to increase the
temperature to 60 °C; the default is 25 °C when first turned on.
Press “Start.” The temperature slowly rises within the heating
block, displayed as “Now Temp.” When the temperature reaches the
“Set Temp” of 60 °C, the “Alarm Value” turns to “00.” The estimated
heating time is about 5 min. Verify that this has occurred. Contact
Thermo Fisher if any errors occurred. Once finished, press “ESC” to
return.
3.11 Yearly Instrument Maintenance

1.
The following procedures should be performed yearly or every 200
extractions (see Note 63).
2.
Replace the D-rings: remove each D-ring from the nozzle of the
syringe unit by pulling the ring out using sterile forceps or pliers,
and then slide it from under the nozzle. Grease each nozzle by
applying a small dab of silicon grease to a gloved finger and gently
apply. Next, take a new D-Ring and slide back onto a greased nozzle
(see Fig. 7). Verify that the D-ring is correctly inserted. Using a lint-
free laboratory wipe, wipe off excess grease that is on each nozzle.
Fig. 7 D-ring maintenance. A visualization of the addition of a new D-ring to the nozzle using
the tool supplied in the installation package. (Reproduced from ref. [2]. Figure owned by Life
Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). ©
2023 Thermo Fisher Scientific Inc. Used under permission)
4 Notes
1.
Only needed if processing blood/soil mixture samples.
2.
Only needed if processing paraffin-embedded tissue samples.
Additionally, low-TE may be used as an elution matrix in place of
the kit-supplied elution buffer.
3.
Only needed if processing paraffin-embedded tissue samples.
4.
Author recommends having a separate biohazard container for kit
contents and consumables for materials containing the
PrepFiler™/BTA Lysis Buffer. Components of the buffer (e.g.,
guanidine thiocyanate) can react with bleach/acid to create a
toxic gas. Handle with appropriate safety protective equipment.
Only prepare one wash bottle at a time to lengthen the expiration
yp p g p
5. of the unopened bottle. Mark the bottle with “diluted,” initials, and
date prepared to avoid future confusion.
6.
The manufacturer recommends a thermomixer, as the procedure
was not fully evaluated using a heat block, and DNA recovery may
be decreased without agitation. Author recommends having at
least two thermomixers for this procedure as there are multiple
incubation steps at a range of temperatures. Only having one
requires additional time between steps in order to cool or heat up
to the next required temperature.
7.
Because of the additional height of the column, the assembly may
not fit in all standard microcentrifuges. Before performing the
first extraction, make sure that the lab has an appropriately sized
microcentrifuge.
8.
If a large batch is made, smaller aliquots can be prepared of
100 μL or greater and stored in individual 0.5 mL microcentrifuge
tubes in the freezer (around −20 °C). Once a tube has been thawed
for use, the tube should be thrown away even if liquid is left.
Aliquoting into smaller tubes allows for more efficient usage. DTT
begins to degrade after 6 months; therefore, a new fresh batch
should be prepared and aliquoted.
9.
Samples should be batched based on the sample type. Some
samples require additional sample preparation. Reagent volumes
and incubation times vary depending on the sample type.
10.
Never leave the magnetic bead tubes open. This leads to
evaporation of the buffer, which leads to an improper ratio of the
magnetic beads to buffer. Additionally, the reagent will run out
before the intended sample number.
11.
Laboratories should conduct internal validation studies if they
wish to adjust the temperature. The manufacturer recommends a
range of 50–80 °C and emphasizes that temperatures should not
exceed this range.
To save a step, the author recommends collecting the sample in a
p g p
12. 1.5 mL microcentrifuge tube or the kit’s Spin Tube during sample
collection for storage until extraction. The extraction master mix
can be directly added to this tube.
13.
This causes the sediment to clump at the bottom of the tube and
doesn’t allow for thorough mixing to extract DNA.
14.
Even though 100 μL of the Proteinase K lysis master mix is added

to each paraffin-embedded tissue sample, a minimum of 1 mL of
the mix should be prepared to avoid pipetting low volumes of SDS
and proteinase K. If more than nine samples/controls are being
processed, prepare an appropriate overall volume to maintain the
reagent ratios and include extra for pipetting overages. Be sure to
use an external proteinase K source (see Subheading 2.1, item 3),
as this reagent is not supplied with the PrepFiler™ kit. After
combing the necessary reagents, vortex the master mix and flick
the tube downward to get any liquid off of the cap.
15.
Make sure that a new pipette tip is used for each sample and that
the entire substrate is covered in liquid. Close the lid tightly to
ensure that no liquid leaks out during incubation.
16.
If using a heat block, the same temperature and times should be
followed. Vortex and pulse spin the tubes every 5 min during the
incubation for optimal extraction.
17. When preparing the designated master mix, multiply these
reagent volumes by the total number of samples and controls
being processed, plus two additional. An additional two samples
have been added to the calculations for overage to account for
pipetting error for this example, but the analyst/laboratory can
modify based on their discretion. Be sure to use the appropriate
proteinase K source: for samples extracted with the standard
PrepFiler™ kit, use an external source (see Subheading 2.1, item
3); for samples extracted with the PrepFiler™ BTA kit, use the
proteinase K supplied with the kit. After combining the necessary
reagents, vortex the master mix and flick the tube downward to
li id ff f h
get any liquid off of the cap.
18.
Discard residual master mix after incubation has begun. Do not
reuse leftover master mix or DTT. Master mix should be made
fresh every batch for the most efficient extraction.
19.
The author recommends having more than one thermomixer for
this procedure, since it takes some time for the thermomixer to
reach room temperature after being heated. This leads to samples
sitting until the temperature is reached. If two thermomixers are
available, set the other to room temperature during the initial
incubation (see Subheading 3.2, step 8). Once the first incubation
is complete, that thermomixer can remain at an elevated
temperature, given that later in the procedure, the samples are
incubated again at 70 °C. Otherwise, if only one thermomixer is
accessible, its temperature will need to be lowered to room
temperature after the first incubation is complete.
20.
Speeds and times are dependent on the maximum setting of the
centrifuge.
21.
If at this point, the caps of tubes are not staying closed, transfer to
a new labeled 1.5 mL centrifuge tube using a pipette to avoid
possible contamination events.
22.
Ensure that the samples/controls come to room temperature
prior to DNA isolation and purification (see Subheading 3.3). If
quantitation volumes are lower than expected, it may be that
efficient binding did not occur because this step was not
completed.
23.
For extraction of any sample using the standard kit, proceed
directly to DNA isolation and purification (see Subheading 3.3,
step 2). For BTA samples, the extraction can be paused and
samples may be left at room temperature for up to 24 h. Do not
chill. By storing the unextracted lysates in cold temperatures,
precipitation occurs.
24. Depending on the number of samples within the batch, the
ti ti l dt b t di d t
magnetic particles may need to be re-vortexed in order to ensure
homogeneity, about every 5 min. Author recommends vortexing
after every five samples.
25.
If quantitation values are lower than expected for the sample type
being analyzed, it may be that efficient binding did not occur
because this step was not performed.
26.
If magnetic beads are seen on the sides of the tube above the
meniscus of the lysis buffer, invert several times. All particles
should be within the solution before the next step.
27.
Samples with a large abundance of proteins can cause the beads
to move slower. Sample types that contain a higher amount of
proteins include vaginal or oral sexual assault swabs. A pellet may
be formed after centrifugation. Wait an additional 2 min if
necessary.
28.
Using a 100 μL pipette tip decreases the chance that the magnetic
particles are removed because the tip has a smaller bore size. The
best way to not disturb the particle pellet is to depress the
plunger of the pipette, then insert the pipette tip to the opposite
side of the pellet without disturbing it, and slowly aspirate the
liquid all the way to the bottom of the tube. Do not press down on
the pipette plunger while the tip is submerged in the liquid, as
this could create bubbles and/or disturb the pellet.
29.
The tubes remain in the magnetic stand during any aspiration or
dispensing into the tube.
30.
Only one tube should be opened and closed at a time to decrease
the chance of contamination. Additionally, use a new pipette tip
for each sample/wash.
31.
After vortexing, the pellet should have dispersed back into the
solution. Small aggregates are acceptable.
32.
This pellet should form faster than in the binding step.
For room temperatures greater than 25 °C incubate only for
For room temperatures greater than 25 C, incubate only for
33. 5 min. Do not exceed a 10-min incubation for any temperature.
This can cause inefficient elution of the DNA and decrease yield. If
samples yield unexpectedly low quantitation values, check this
step.
34.
Low-TE (TE −4) Buffer can be used instead of the kit-supplied
elution buffer if validated by the laboratory. The manufacturer
warns against using water as an elution matrix.
35.
If the pellet has not completely resuspended, the sample may have
dried for too long. Vortex vigorously for an additional 15 s, and if
needed, flush the liquid with a pipette or tap the tube externally. If
the beads are still clumped, proceed to the next step with
intermittent vortexing. Make a note of this occurrence in case the
quantitation results are lower than expected.
36.
If using a heat block, the same temperature and times should be
followed. Vortex and pulse spin the tubes every 2–3 min during
the incubation for optimal extraction.
37.
If any of the pellet is aspirated, pipette the sample back into the
tube and let it sit for an additional minute on the magnetic stand.
Check that no beads have stuck to the side of the tip. If beads are
visualized when the sample is removed for quantitation, place it
on the magnetic stand and move the supernatant to a new tube
before quantifying; ensure that no beads are transferred to the
new tube.
38.
The author has found that samples that are initially “dirty” and
result in a colored eluant often benefit from an additional wash
step to help further purify the sample. Make note of these sample
types and apply an additional wash step with 300 μL of Wash
Buffer B for future extractions.
39.
Do not press the column all the way down into the tube. If pressed
too far, this causes the seal between the two plastics to break, and
leakage of the sample during incubation may occur.
Preprinted labels can be utilized except for on the tops of the tube
p p p
40. caps of the assemblies, which can cause leakage. Use marker only
for the tops.
41.
To save a step, the author recommends using a column/tube
assembly during sample collection and placing the sample directly
into the assembly for storage until extraction.
42.
For optimal sample collection, gum can be flattened onto a small
sterile surface and frozen for 2 h (ideally −80 °C).
43.
When transferring to the column, do not let the tape stick to the
column, as this can result in less-than-optimal DNA recovery.
44.
Do not pulse spin beyond 5 s. Additional spinning can cause a
pellet to form, which can cause issues further on in the process.
45.
Incubation over 40 min can lead to precipitation of the reagent
salts. This can be seen before and after the centrifugation step
after incubation. Salt can cause instrumental problems, including
tip clogging, tip filter wetting, and/or an instrument crash. If
precipitate is observed, flush the lysate with a pipette or vortex to
mix.
46.
Close the door to AutoMate Express™ until ready to run. This helps
protect the internal parts from too much exposure to the outside
environment.
47.
Thirteen samples are not required to perform an extraction. If the
whole rack is not being used, ensure that each cartridge lines up
with a sample tube in the Tip and Tube Rack.
48.
If a physical pellet is visible, transfer the lysate into a new labeled
PrepFiler™ Sample Tube. Sediment may cause instrumental
problems like liquid handling errors. If precipitate is seen, heat
the sample back to 37 °C to avoid instrument errors.
49. Remove the columns/caps in a manner that avoids reaching over

an open tube. For example, place the tray at an angle and remove
the first sample with your right arm working across the tray from
the first sample with your right arm, working across the tray from
left to right.
50.
Do not remove protocol cards from the instrument when it is on.
It stops any current runs and may lead to data file losses.
51.
All protocol cards should be stored out of the light. Additionally,
do not apply any reagents or decontamination methods to the
card.
52.
Make sure that the protocol card is fully inserted, and the
instrument door is completely closed before turning on. The
instrument beeps if the door is open while it is trying to read the
protocol; the door must be closed before it continues.
53.
The reagents must be inverted and mixed before being placed into
the instrument. To do this, pick up the rack with two hands, one
hand on each side, and invert the rack five times. Make sure that
inversion of the rack occurs with the back tilting downwards. If it
is tilted with the front side down, the cartridges can fall out.
54.
The beads should be in suspension and not settled at the bottom
of the well. Repeat inversion if necessary or tap the top of the
reagent cartridge that is not mixed. Tap the tray at the end to pull
any liquid from the top of the cartridges. Insert the rack
containing the mixed cartridges into the back position of the
instrument.
55.
If the hinge is causing the cap to drift upwards, take the tube out
of the tray and bend the hinge back slightly. Replace the tube into
the correct slot.
56.
40 μL is recommended for low quantity samples, like touch DNA.
However, if there is permission to consume the sample, choose a
lower volume option to concentrate the sample further. 100 μL is
recommended for blood samples. 200 μL is recommended for
reference samples. 250 μL is recommended for epithelial fraction
of differential samples.
57. These tips are sharp on the end and can cut through a glove. Use
ti h l i f b th f t d t i ti
caution when cleaning for both safety and contamination
purposes.
58.
Proper D-ring care ensures the attachment of the tips remains
secure and prevents leakage.
59.
Make sure grease is not applied into the nozzles. If grease is
suspected in the nozzle, wipe the area with a disposable
laboratory wipe or dust-free cloth. Excess grease can interfere
with the operation and lead to instrument errors.
60.
The axis test verifies all of the axis movements by checking each
well position by moving tips up and down into the positions.
61.
Empty cartridge and tips/tip holders are included within the
instrument install kit. Sample tubes should be gathered from the
kits.
62.
The temperature test verifies the functionality of the heat block.
63.
This step is performed yearly to ensure proper seal of tips to
nozzles and that no leakage occurs during extraction.
References
1. Thermo Fisher Scientific (2017) PrepFiler Express™ and PrepFiler Express BTA™ Forensic
DNA Extraction Kits User Guide, Revision D. Available via Thermo Fisher Scientific. https://
tools.thermofisher.com/content/sfs/manuals/cms_081933.pdf. Accessed 14 April 2022
2. Thermo Fisher Scientific (2019) AutoMate Express Instrument User Guide, Revision G.
Available via Thermo Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/LSG/
manuals/4441982_AutoMateExp_UG.pdf. Accessed 14 April 2022
3. Thermo Fisher Scientific (2012) PrepFiler® and PrepFiler® BTA Forensic DNA Extraction
Kits User Guide, Revision C. Available via Thermo Fisher Scientific. https://www.
thermofisher.com/order/catalog/product/4463352. Accessed 14 April 2022
4. Thermo Fisher Scientific (2019) Safety Data Sheet—PrepFiler Lysis Buffer. Available via
Thermo Fisher Scientific. https://www.thermofisher.com/document-connect/document-
connect.html?url=https%3A%2F%2Fassets.thermofisher.com%2FTFS-
Assets%2FLSG%2FSDS%2F4441405_MTR-NALT_EN.pdf. Accessed 14 April 2022
5.
Butler JM (2012) DNA extraction. In: Advanced topics in forensic DNA typing: methodology.
Elsevier, Waltham, pp 29–47
6. Tereba AM, Bitner RM, Koller SC et al (2004) Simultaneous isolation and quantitation of
DNA. US Patent 6673631, 6 Jan 2004
7. Chirgiwin J, Przbyla A, MacDonald R et al (1979) Isolation of biologically active ribonucleic

acid from sources enriched in ribonuclease. Biochemistry 18:5294–5299. https://doi.org/
10.1021/bi00591a005
[Crossref]
8. Boom R, Sol J, Salimans M et al (1990) Rapid and simple method for purification of nucleic
acids. J Clin Microbiol 28:495–503. https://doi.org/10.1128/jcm.28.3.495-503.1990
[Crossref][PubMed][PubMedCentral]
9. Davis C, King J, Budowle B et al (2012) Extraction platform evaluations: A comparison of

Automate ExpressTM, EZ1® Advanced XL, and Maxwell® 16 Bench-top DNA extraction
systems. Legal Med 14:36–39. https://doi.org/10.1016/j.legalmed.2011.09.005
10. Liu J, Zhong C, Holt A et al (2012) AutoMate ExpressTM Forensic DNA Extraction System for
the extraction of genomic DNA from biological samples. J Forensic Sci 57:1022–1030.
https://doi.org/10.1111/j.1556-4029.2012.02084.x
[Crossref][PubMed]
11. Stangegaard M, Hjort B, Hansen T et al (2013) Automated extraction of DNA from biological
stains on fabric from crime cases. A comparison of a manual and three automated methods.
Forensic Sci Int Genet 7:384–388. https://doi.org/10.1016/j.fsigen.2012.12.009
12. Vogelstein B, Gillespiet D (1979) Preparative and analytical purification of DNA from
agarose. Proc Natl Acad Sci U S A 76:615–619. https://doi.org/10.1073/pnas.76.2.615
13. Marko M, Chipperfield R, Birnboim H (1982) A procedure for the large-scale isolation of
highly purified plasmid DNA using alkaline extraction and binding to glass powder. Anal
Biochem 121:382–387. https://doi.org/10.1016/0003-2697(82)90497-3
[Crossref][PubMed]
14. Alaeddini R (2012) Forensic implications of PCR inhibition—a review. Forensic Sci Int
Genet 6:297–305. https://doi.org/10.1016/j.fsigen.2011.08.006
[Crossref][PubMed]
15. Brevnov M, Pawar H, Mundt J et al (2009) Developmental validation of the PrepFilerTM

Forensic DNA Extraction Kit for extraction of genomic DNA from biological samples. J
Forensic Sci 54:599–607. https://doi.org/10.1111/j.1556-4029.2009.01013.x
16. Thermo Fisher Scientific (2022) AutoMate Express™ Forensic DNA Extraction System.
Available via Thermo Fisher Scientific. https://www.thermofisher.com/order/catalog/
product/4441763?SID=srch-srp-4441763. Accessed 14 April 2022
17. Jeremy Boone (2022) Thermo Fisher Scientific Training: AutoMate Express™, PrepFiler
Express™, and PrepFiler Express BTA™ Forensic DNA Extraction Kits, 8 Apr 2022
https://doi.org/10.1007/978-1-0716-3295-6_5
5. Robotic DNA Extraction Utilizing

Qiagen BioSprint® 96 Workstation
Brittany Ziencik1
(1) Virginia Department of Forensic Science, Richmond, VA, USA
Brittany Ziencik
Email: Brittany.Ziencik@dfs.virginia.gov
Abstract
After an examination of evidentiary or reference samples has been
performed, the next step is DNA extraction. This crucial step allows for
deoxyribonucleic acid (DNA) to be released from a substrate by use of a
series of chemicals and allows the DNA from lysed cells to be taken
forward for DNA typing. To allow processing of the increased number of
forensic samples submitted for DNA typing, automated systems have
become more commonplace within forensic laboratories. The Qiagen
BioSprint® 96 workstation utilizes magnetic particle technology
(Qiagen, BioSprint® 96 DNA Handbook, 2012) to process a variety of
samples, such as liquid blood, blood stain cards, and buccal (saliva)
swabs. The following methods outlined within this chapter are based
upon the automated DNA extraction of three commonly received types
of reference samples (liquid blood, bloodstain cards, and buccal swabs)
utilizing the Qiagen BioSprint® 96 DNA Blood Kit.
Key words Extraction – Qiagen BioSprint® 96 (BioSprint®

workstation) – Automation – MagAttract Suspension G
1 Introduction
Automated DNA extraction systems, like the Qiagen BioSprint® 96
(BioSprint® workstation), utilize magnetic bead technology for DNA
purification [1] while minimizing human error and allowing for high-
throughput reproducibility, higher DNA quality, and higher DNA yield
[2, 3]. Traditional DNA extraction processes include detergent and
proteinase treatments for cell lysis, followed by purification with
organic solvents or chelating-resin suspension [4]. These traditional
methods of extraction require direct application to a sample followed
by exposing the sample to high temperatures to disrupt the cellular
structure to release the DNA [5]. These methods require human sample
manipulation and handling, which are more time-consuming and
increase the chance of contamination or sample switching. By using
magnetic bead technology, in theory, only the negatively charged DNA
will bind with the magnetic beads, leaving any debris present unbound
and free in the solution. This step is followed by a series of wash steps
to remove any inhibitors to produce a DNA lysate that can be taken
forward for polymerase chain reaction (PCR) processing and that is
more adaptable to automation [6]. Utilizing robotic systems enables the
following steps to be performed in a shorter period of time: (1) lysis of
the cell membrane releasing the DNA within the lysis solution, (2)
digestion and/or denaturation of proteins, and (3) separation of DNA
from other cellular material and/or PCR inhibitors [6].
2 Materials
The following two sections provide a list of reagents and equipment
needed to perform DNA extractions using the BioSprint® workstation.
All reagents and plastics utilized by the BioSprint® workstation should
be stored at room temperature. All reagents should be prepared while
wearing proper personal protective equipment (PPE)—such as a
laboratory coat, mask, disposable gloves, and eye protection—in a
designated clean space in order to prevent contamination. All plastics
and buffers need to be cross-linked prior to use (see Note 1).
2.1 Reagents and Supplies
1.
Qiagen BioSprint® 96 DNA Blood Kit: Contains Buffer AL, Buffer
AW1, Buffer AW2, Buffer AE, MagAttract Suspension G
(MagAttract), 96-well S-blocks (S-blocks), 96-well microplate, and
96-well rod cover.
2.
Buffer ATL: Sold separately from Qiagen BioSprint® 96 DNA Blood
Kit.
3.
20 mg/mL Proteinase K: Stable up to 1 year at room temperature;
recommended to store at 2–8 °C.
4.
DNA grade, RNase-free, or sterile water (water).
5.
100% ethanol and 100% isopropanol.
6.
Plate seals: For example, silver seal, tape pad, etc.
7.
Plastic reagent troughs to be used for a multichannel pipette.
8.
Surface decontaminant: For example, DNA-off™ of DNA Away™.
2.2 Equipment
1.
Desktop or laptop computer with compatibility to download and
contain Qiagen BioSprint® 96 software.
2.
BioSprint® 96 workstation.
3.
Centrifuge capable of holding S-block deep well plates.
4.
Heat block: Needs to be compatible with the 96-well S-blocks. A
shaker-heat block is needed for the extraction of bloodstain cards
and buccal swabs but not liquid blood.
5. Pierce plate that fits 96-well plates to produce openings allowing
pipette tips to enter individual wells.
6.
Multichannel pipette (P1000, P200, P100, P20, and P10).
2.3 Reagent Preparation

1.
Prior to performing DNA extractions using the BioSprint®
workstation, prepare the AW1 and AW2 buffers using 100%
ethanol according to the product label or insert. Table 1 is based
upon the two different volume options of AW1 and AW2 provided
with the Qiagen BioSprint® 96 DNA Blood Kit [1] (see Note 2). The
prepared AW1 and AW2 buffers should be stored at room
temperature.
2.
When using a new, unopened bottle of MagAttract Suspension G,
thoroughly shake and then vortex the bottle for 3 min to ensure the
magnetic silica beads have resuspended. Prior to using a previously
opened bottle, vortex for 1 min [1].
Table 1 Buffer AW1 and AW2 preparation
Buffer Volume of concentrated Volume of 100% ethanol to be Final volume

buffer added (mL)
AW1 27 mL 35 mL 62 mL
98 mL 130 mL 228 mL
AW2 17 mL 40 mL 57 mL
81 mL 190 mL 271 mL
This table outlines the amount of 100% ethanol (mL) that is to be

added at the two different concentrations of Buffer AW1 and AW2. The
final volume (mL) of each of the buffers is dependent on the starting
volume (mL) of the concentrated buffer and the amount of 100%
ethanol (mL) added (see Note 2) [1]
3 Methods
The following procedures outline the extraction methods for 100 μL of
liquid blood, a ~ 1/4″ diameter from a bloodstain card, and one buccal
swab (or combined cuttings of multiple swabs equivalent to one swab)
based upon the outlined methods and procedures within the Qiagen
BioSprint® 96 DNA Handbook [1]. For each of the extraction methods
outlined, all extraction controls (i.e., positive and/or negative controls)
will be processed simultaneously alongside the samples being
extracted. This chapter does not cover how to create programs on the
BioSprint® 96 workstation robot.
3.1 DNA Extraction of Liquid Blood

1.
Pipette 100 μL of liquid blood into individual wells of a labeled S-
block. Once the samples have been added into the individual wells
of a labeled S-block, verify the sample and sample name to the
extraction layout along with corresponding controls. This step
should be performed prior to any steps in the extraction method.
2.
Prior to use, incubate the Buffer AL for 30 min at 37 °C with
occasional inverting of the bottle to dissolve any precipitate.
3.
Prepare five S-blocks and two 96-well microplates with the
necessary reagent, and seal with a temporary seal; these will be
added to the BioSprint® workstation in the specified positions
(see Notes 3 and 4; Table 2) [1].
4.
Prepare a digestion buffer master mix of Buffer AL and Proteinase
K in a 50 mL conical tube and add to each sample in the S-block
(see Subheading 3.1, step 1; Notes 3 and 5; Table 3). When adding
the master mix of digestion buffer to each liquid blood sample,
ensure to mix the liquid blood sample and master mix thoroughly
via pipette. Seal the S-block with a silver seal and briefly
centrifuge.
5.
Incubate at 70 °C for 10 min.
6.
During the incubation, prepare a master mix of isopropanol and
MagAttract in a 50 mL conical tube (see Note 5; Table 4).
7. After incubation, briefly centrifuge the S-block to remove any
condensation from the seal.
8.
Wipe the seal with a Kimwipe moistened with ethanol to clean off
the seal. Pierce the seal with a sterile pierce plate.
9.
Add the prepared MagAttract mix (see Subheading 3.1, step 6;
Note 3) to each sample in the S-block. When adding the
MagAttract mix to each liquid blood sample, ensure to mix the
liquid blood sample and master mix thoroughly via pipette. After
the MagAttract mix has been added to each sample, the total
volume of lysate for each sample is 325 μL.
10.
Proceed to the robotic processing steps (see Subheading 3.4, step
1).
Table 2 BioSprint® workstation reagent plate setup for DNA extraction
BioSprint slot Reagent + plate used Volume per well (μL)

position #
Liquid Bloodstain Buccal
blood card swab
8 96-well microplate with rod – – –
cover
7 Buffer AE in 96-well 100 200 200
microplate
6 Water in S-block 500 500 500
5 Buffer AW2 in S-block 500 500 500
1 Lysate in 96-well microplate 325 640 620
This table outlines the overall volume (μL) of liquid (i.e., lysate, reagent,
etc.) that is required for each plate being used for the three extraction
methods discussed in this chapter [1]. Prior to placing the UV cross-
linked 96-well rod cover into the 96-well microplate, carefully bend the
sides of the rod cover back so that it slightly flares outward
Table 3 Digestion buffer preparation
Reagent Volume per sample (μL)

Liquid blood Bloodstain cards Buccal swabs
Buffer ATL – 200 –
Buffer AL 100 – 400
Proteinase K 10 20 20
Total 110 220 420
This table outlines the overall volume (μL) of the digestion buffer
master mix needed for each sample type. Each reagent volume should
be multiplied by the number of samples being processed, plus an
additional 10% to account for pipetting error, to calculate the total
volume needed for the extraction batch. It is important to remember
that the maximum number of samples/controls that can be run per
plate is 96
Table 4 MagAttract mix preparation
Reagent Volume per sample (μL)

Liquid blood Bloodstain cards Buccal swabs
Buffer AL – – 200
Isopropanol 100 200 200
MagAttract 15 20 20
Total 115 220 420
This table outlines the overall volume (μL) of the MagAttract master
mix needed for each sample type. Each reagent volume should be
multiplied by the number of samples being processed, plus an
additional 10% to account for pipetting error, to calculate the total
volume needed for the extraction batch. It is important to remember
that the maximum number of samples/controls that can be run per
plate is 96
3.2 DNA Extraction from Bloodstain Cards

1.
Cut a ~ 1/4″ diameter or single hole punch from the bloodstain
card and place into individual wells of a labeled S-block. Once the
samples have been added into the individual wells of a labeled S-
block, verify the sample and sample name to the extraction layout
along with the corresponding controls. This step should be
performed prior to any steps in the extraction method.
2.
Prior to use, incubate the Buffer AL and Buffer ATL for 30 min at
37 °C with occasional inverting of the bottle to dissolve any
precipitate.
3.
Prepare five labeled S-blocks and two labeled 96-well microplates
that will be added to the BioSprint® workstation (see Notes 3 and
4; Table 2) [1].
4.
For digestion of the bloodstain card samples, prepare a digestion
buffer master mix of Buffer ATL and Proteinase K in a 50 mL
conical tube (see Note 5; Table 3). Seal the S-block with a silver
seal and briefly centrifuge.
5.
Incubate at 56 °C for a minimum of 1 h in a shaker-heat block,
shaking at 900 rpm. After incubation, briefly centrifuge the S-
block to remove any condensation from the seal.
6.
7.
Add 200 μL of Buffer AL to each sample (see Note 3), seal the S-
block with a new piece of silver seal, and pulse vortex for 10 s.
After the pulse vortex, briefly centrifuge to remove any liquid
from the seal.
8.
Incubate at 56 °C for 10 min in a shaker incubator, shaking at
900 rpm.
9.
During the incubation, prepare a master mix of isopropanol and
MagAttract in a 50 mL conical tube (see Note 5; Table 4).
10. After incubation, briefly centrifuge the S-block to remove any
condensation from the seal.
11.
12.
Note 3) to each sample in the S-block. When adding the
MagAttract mix to each bloodstain card sample, ensure to mix
thoroughly via pipette. After the MagAttract mix has been added
to each sample, the total volume of lysate for each sample is
640 μL.
13.
1).
3.3 DNA Extraction from Buccal Swabs

1.
Cut one buccal swab (or combined cuttings of multiple swabs
equivalent to one swab) from each sample and place into
individual wells of a labeled S-block. Once the samples have been
added into the individual wells of a labeled S-block, verify the
sample and sample name to the extraction layout along with
corresponding controls. This step should be performed prior to
any steps in the extraction method.
2.
Prior to use, incubate the Buffer AL and Buffer ATL for 30 min at
37 °C with occasional inverting of the bottle to dissolve any
precipitate.
3.
Prepare five labeled S-blocks and two labeled 96-well microplates
that will be added to the BioSprint® workstation (see Notes 3 and
4; Table 2) [1].
4. For digestion of the buccal samples, prepare a digestion buffer
master mix of Buffer ATL and Proteinase K in a 50 mL conical tube
(see Note 5; Table 3). When adding the master mix of digestion
buffer to each buccal sample, ensure to saturate the cutting(s) of
the buccal sample thoroughly. Seal the S-block with a silver seal
and briefly centrifuge.
5.
Incubate at 56 °C for a minimum of 1 h in a shaker-heat block,
shaking at 900 rpm.
6.
During the incubation, prepare a master mix of Buffer AL,
isopropanol, and MagAttract in a 50 mL conical tube (see Note 5;
Table 4).
7.
After incubation, briefly centrifuge the S-block to remove any
condensation from the tape.
8.
9.
Using a multichannel pipette, transfer 200 μL of the lysate from
each well to a new S-block. Do not transfer the swabs to the new
S-block.
10.
Note 3) to each sample in the new S-block that contains the
transferred 200 μL lysate from the buccal swabs. When adding the
MagAttract mix to each lysate, ensure to mix thoroughly via
pipette. After the MagAttract mix has been added to each sample,
the total volume of lysate for each sample is 620 μL.
11.
1).
3.4 Robotic Processing Steps

1.
Decontaminate the instrument prior to each run with DNA-off or
70% ethanol. Do not use bleach (see Note 6).
2.
Turn on the workstation. The deck will rotate, and the magnetic
head will move into position.
3. Determine the appropriate protocol (see Note 7). Select the
appropriate protocol using the up and down arrow keys on the
4. BioSprint® workstation, then press “Start.”
Prior to loading the following required S-blocks and 96-well

microplate (elution plate), carefully remove the seal.
5.
The robot will display the selected protocol on the LCD panel and
will prompt the user when to load each of the seven previously
prepared 96-well reagent plates (see Subheading 3.1, step 3;
Subheading 3.2, step 3; or Subheading 3.3, step 3). The deck
should have rotated so that slot 8 is immediately inside the sliding
door and alternate between displaying “Paused” and “Load Rod
Cover” on the LCD panel.
6.
Load the 96-well rod cover that is inserted into the microplate
onto the rotating table in the position immediately inside the
door. After loading, press “Start.”
7.
The workstation will rotate, and a new message will appear,
asking the user to load slot 7 with the elution plate. Load slot 7,
and press “Start” again. Continue this process of loading a
particular slot until all slots are loaded (see Note 8; Table 2) [1].
8.
Slide the door shut to protect samples from contamination, and
press “Start” to process the samples [1].
9.
After the samples are processed, place a tape pad over the 96-well
microplate (elution plate) located in slot 7 containing the purified
samples, and remove the plate from the BioSprint® (see Note 9).
10.
Remove the rest of the S-blocks as instructed by the display of the
BioSprint®, disposing of biological and chemical liquid or solid
waste into appropriate containers. Press “Stop” after removing
each plate or block.
11.
Switch off the BioSprint® at the power switch.
12. Decontaminate the BioSprint® workstation with a surface
decontaminant (see Note 6) or 70% ethanol. Do not use bleach.
4 Notes
1.
In order to prepare for extractions performed using the BioSprint®,
UV crosslink all plastics (e.g., S-blocks, 96-well microplates, rod
covers, etc.) and buffers being used in order to prevent
contamination. If UV crosslinking multiple sets of plastics and
reagents, ensure a secure and sterile storage area.
2.
Once the 100% ethanol has been added to the AW1 and AW2
bottles, mark the bottles using the date and the initials of the
individual who added the ethanol.
3.
When adding the same reagent or same master mix into multiple
wells, it is more time-efficient to pour the measured amount of
reagent or master mix being used into a trough and, using a
multichannel pipette, pipette the measured amount into multiple
individual wells.
4.
For each S-block or 96-well microplate, the number of wells to fill
with buffer should match the number of samples to be processed
(e.g., for 25 liquid blood samples, fill 25 wells per S-block or 96-
well microplate) [1].
5.
When preparing the digestion buffer or MagAttract mix, cap the 50
mL conical tube and invert at least 10 times to mix; do not vortex.
6.
Buffers within the Qiagen BioSprint® 96 DNA Blood Kit contain
guanidine salts, which can form highly reactive, harmful
compounds when combined with bleach.
7.
Protocols should have been pre-programed based on the
laboratory’s needs. Any issues with programming extraction
methods to the BioSprint® workstation should seek aid from
Qiagen’s customer support team.
8. Each slot is labeled with a number from 1 to 8. Load each 96-well
plate or S-block so that well A1 is aligned with the slot label (e.g.,
well A1 faces inward) [1].
9.
Once the extraction process is complete, the 96-well microplate
(elution plate) can either be sealed securely with silver seal and
stored under refrigeration or can be directly taken forward for
quantitation.
References
1. Qiagen (2012) BioSprint® 96 DNA Handbook. Available via Qiagen. https://www.qiagen.
com/us/resources/resourcedetail?id=64902c5d-9c3c-4fe3-a3f7-668c4704d9eb&lang=en.
Accessed 10 Feb 2022
2. Witt S, Neumann J, Zierdt H et al (2012) Establishing a novel automated magnetic bead-

based method for the extraction of DNA from a variety of forensic samples. Forensic Sci Int
Genet 6(5):539–547. https://doi.org/10.1016/j.fsigen.2012.01.002
[Crossref][PubMed]
3. Lee SB, Shewale JG (2017) DNA extraction methods in forensic analysis. In: Encyclopedia of
analytical chemistry. https://doi.org/10.1002/9780470027318.a1104m.pub2
[Crossref]
4. Montpetit SA, Fitch IT, O'Donnell PT (2005) A simple automated instrument for DNA
extraction in forensic casework. J Forensic Sci 50(3):1–9
[Crossref]
5. Butler JM (2009) Chapter 5: DNA extraction. In: Fundamentals of forensic DNA typing.
Elsevier Academic Press, Burlington, MA
6. Chong KWY, Thong Z, Syn CK-C (2021) Recent trends and developments in forensic DNA
extraction. WIREs Forensic Sci 3:e1395. https://doi.org/10.1002/wfs2.1395
[Crossref]
https://doi.org/10.1007/978-1-0716-3295-6_6
6. DNA Extraction of Bone Through

Demineralization
Brandi L. Iorio1 and Ashley M. Cooley1
Brandi L. Iorio (Corresponding author)

Email: Brandi.iorio@dfs.virginia.gov
Ashley M. Cooley
Email: Ashley.cooley@dfs.virginia.gov
Abstract
In the field of forensic science, the DNA extraction of bone is utilized in
investigations involving mass disasters, unidentified remains, and
missing persons. However, bone samples can be challenging samples
due to their exposure to extreme environmental conditions over long
periods of time. The use of an effective DNA extraction method to
properly isolate and purify the DNA is essential for bone samples. This
chapter describes the DNA extraction of bone samples through a total
demineralization protocol, which aims to entirely dissolve the bone
matrix in order to access the DNA molecules.
Key words DNA extraction – Demineralization – Bone extraction –

Organic extraction – DNA analysis – Forensic science
1 Introduction
Bone samples are commonly collected in missing persons
investigations, mass disasters, and unidentified remains cases [1]. In
these types of investigations, bones are typically the only biological
samples available for DNA analysis and may be highly degraded due to
the bone samples being subjected to extreme environmental conditions
over long periods of time [2]. However, bones are able to withstand
exposure to contaminants in the environment, such as microorganisms
and fungi, which make these samples the most suitable for DNA
analysis in these types of cases [3]. For some bone samples, the
presence of humic acid from soil can pose as a potential inhibitor and
can affect downstream DNA analysis, creating a need for an extraction
protocol that effectively isolates and purifies the DNA [2]. Bone consists
primarily of collagen and minerals, and these areas with substantial
mineralization create robust barriers to DNA extraction chemicals, thus
preventing the successful release of DNA [1]. For bone samples, the
greatest success at developing DNA profiles is accomplished utilizing
demineralization procedures, which work to entirely dissolve the bone
matrix [4]. By entirely dissolving the bone matrix in these
demineralization protocols, high-quality endogenous DNA stored in the
crystal aggregates of the bone matrix is made easily accessible [1]. This
chapter describes a highly effective demineralization protocol for bone
samples that provides high yields of DNA for even the most challenging
of samples.
2 Materials
2.1 Equipment
1.
Centrifuge: Including fixed-angle or swinging bucket rotor.
2.
Chisel.
3.
Rotary tool.
4.
Hammer.
5. Laminar flow hood.
6.
Incubator: 56 °C with nutator inside.
7.
Ultraviolet (UV) crosslinker.
8.
Blender.
9.
Blender cup and lids: If not already prepared, clean an appropriate
number of blender cups and lids. Fill each cup approximately 1/3
full with 10% Liquinox, attach the lid, and run the blender for 10–
20 s. Remove the lid and rinse both the lid and cup with water,
followed by 10% bleach, then water, and ethanol. Drain excess
ethanol and allow surfaces to dry. Irradiate in a UV crosslinker for
the same amount of time required for a 50 mL conical tube.
2.2 Supplies
1.
Amicon® Ultra-4 concentrators.
2.
Cutting disc.
3.
2.0 mL or 1.5 mL microcentrifuge tubes, screw-top, or flip-cap: It is
recommended to irradiate all tubes in a UV crosslinker prior to the
DNA extraction process. It is also recommended to avoid
autoclaving the tubes, as it may affect proper closure of the tubes
and compromise the integrity of the tubes.
4.
15 mL and 50 mL conical tubes.
5.
Sanding/grinding bits.
6.
Sleeve protectors.
7.
Tips, aerosol-resistant (for pipettes).
2.3 Reagents
1.
Demineralization buffer: Prepare 0.5 M EDTA and 1% lauryl
sarcosine [5]. Mix until dissolved and adjust to pH 8.0 with NaOH.
Autoclave, cool, and filter through 0.2 μm filter to sterilize. Store at
room temperature. Irradiate in a UV crosslinker before use.
2.
Absolute ethanol.
3.
Isopropanol.
4.
10% Liquinox.
5.
n-Butanol.
6.
25:24:1 Phenol/Chloroform/Isoamyl Alcohol (PCIAA).
7.
20 mg/mL Proteinase K: Store at −20 °C.
8.
Low EDTA TE Buffer (TE−4 Buffer): Prepare 10 mM Tris-HCl and
0.1 mM EDTA [5]. Mix until dissolved and adjust to pH 7.5 with HCl.
Autoclave, cool, and filter through 0.2 μm filter to sterilize. Store at
room temperature. TE−4 will expire 3 years after the preparation
date. Irradiate in a UV crosslinker before use.
9.
Ultrapure water: Filter Type I water with a 0.2 μm filter and then
autoclave [5]. Subject 15–50 mL conical tube aliquots to 15 J/cm2
exposure time. Store at room temperature. Ultrapure water will not
expire.
3 Methods
The following methods have been adapted from the Virginia
Department of Forensic Science Mitochondrial DNA Section Procedures
and the Forensic Biology Procedures Manual: Extraction of DNA [5, 6].
All steps should be performed in a laminar flow hood while wearing
proper personal protective equipment (PPE)—including a laboratory
coat, disposable gloves, a surgical mask, a hair net, and eye protection
—in a properly disinfected space in order to prevent contamination. It
is recommended to perform this protocol with a single bone sample at a
time. If multiple bone samples are processed at the same time, each
bone sample will require its own reagent blank.
1.
In a hood, sand the exposed surfaces of the bone with a clean
sanding bit fitted to a rotary tool (see Notes 1–4).
2.
Cut approximately a 1.0 g piece from the evidence using a cutting
disc, if necessary (see Notes 5 and 6). If needed, a chisel and
hammer can be used to assist in obtaining an appropriately sized
window of bone (see Fig. 1).
3.
Clean the powdered debris off of the sample by placing the sanded
sample into a 50 mL conical tube containing approximately 25 mL
of ultrapure water, shaking back and forth several times, and
decanting into a waste container (see Note 7).
4.
Repeat the ultrapure water wash twice.
5.
Cover the sample in the conical tube with absolute ethanol, shake
back and forth several times, and decant into a waste container.
6.
Repeat the absolute ethanol wash twice.
7.
Remove the sample from the conical tube, place it in a labeled
weigh boat, and allow it to air dry in the laminar flow hood.
8.
Initiate a reagent blank by swabbing the inside surfaces of a clean
blender cup and lid with a sterile cotton swab. The reagent blank
will be the last sample processed for the remaining steps of the
extraction.
9.
Place the sample into the same blender cup used to initiate the
reagent blank, attach the lid, and run the blender until the sample
is finely ground (see Note 8).
10. Place the powder into a clean weigh boat or funnel to transfer it to
an appropriately labeled, sterile, pre-weighed or tared 15 mL
conical tube (see Notes 9 and 10).
11.
Determine the weight of the sample in the conical tube.
Approximately 0.2 g of powdered bone is needed for extraction.
The excess powder can be stored at −20 °C.
12.
Add 3 mL demineralization buffer and 200 μL Proteinase K to the
sample and reagent blank, making sure that the sample is
thoroughly suspended in the reagents.
13.
Wrap the conical tubes tightly with parafilm, focusing primarily
on the cap and upper portion, to ensure the liquid does not leak
(see Note 11).
14.
Incubate overnight at 56 °C on a nutator.
15.
To the sample, add 3 mL PCIAA, vortex thoroughly, and centrifuge
for 10 min at approximately 10,000 × g using a fixed-angle rotor
or 3270 × g using a swinging bucket rotor centrifuge (see Fig. 2).
16.
Transfer the upper aqueous layer to an appropriately labeled
sterile 15 mL conical tube (see Note 12).
17.
Dispose of the lower layer (phenol waste) in the appropriate
waste container.
18.
Repeat extraction with PCIAA until the interface is clean (see
Subheading 3, steps 15–18), disposing of waste in the
appropriate waste container.
19.
To the aqueous layer, add 3 mL n-butanol.
20.
Vortex thoroughly and centrifuge for 10 min at approximately
10,000 × g using a fixed-angle rotor or 3270 × g using a swinging
bucket rotor centrifuge (see Fig. 3).
21. Remove and discard the upper n-butanol layer and the interface
into an appropriate waste container (see Note 13).
22.
Label a sufficient number of pre-assembled, irradiated Amicon®
Ultra-4 concentrators.
23.
Transfer the lower aqueous layer to the sample reservoir of the
Amicon® Ultra-4 concentrator, avoiding the pipetting of any
residual n-butanol if not completely removed (see Subheading 3,
step 21, and Fig. 4).
24.
Centrifuge for approximately 10–30 min at 2000 × g using a
swinging bucket rotor and discard the filtrate.
25.
Add 2 mL of TE−4 buffer to the sample reservoir of the Amicon®
assembly, centrifuge for approximately 10–30 min at 2000 × g
using a swinging bucket rotor, and discard the filtrate.
26.
Repeat the TE−4 buffer wash at least once (see Note 14).
27.
Taking extreme care in not allowing the pipette to touch the sides
of the sample reservoir, pipette the retentate directly from the
sample reservoir and transfer it to an appropriately labeled sterile
1.5 mL tube (see Fig. 5).
28.
Measure the volume of the retentate with a pipette, and add TE−4
buffer, as necessary, to bring the volume up to 100 μL.
29.
The samples may be stored at 4 °C if amplified within 3 weeks or
used routinely. Store at −20 °C for long-term storage.
Fig. 1 The sampling of bone. The sampling of the bone is performed using a rotary tool with a
cutting disc
Fig. 2 Addition of PCIAA. This depicts the bone sample and the reagent blank following the
addition of PCIAA once it has been centrifuged. Note the upper, clear aqueous phase, the middle
interface, and the lower organic phase. The upper, clear aqueous layer should be collected with
a pipette, but take care to avoid the middle interface containing cellular debris
Fig. 3 Addition of n-butanol. This depicts the bone sample and the reagent blank following the
addition of n-butanol once it has been centrifuged. Note the upper n-butanol phase and the
lower aqueous phase. The lower aqueous phase should be collected with a pipette and
transferred to the sample reservoir of the Amicon Ultra-4 concentrator
Fig. 4 Transfer to Amicon Ultra-4 concentrator. This depicts the transfer of the aqueous phase
of the bone sample and the reagent blank to the sample reservoir of each Amicon Ultra-4
concentrator
Fig. 5 Collection of retentate. This depicts the retentate of the bone sample and the reagent
blank in the upper sample reservoir of the Amicon assembly that should be transferred to
sterile tubes. Note that there is approximately 40 μL of each sample that should be transferred
to a new sterile tube. The sample should then have the TE−4 added to create a final volume of
100 μL
4 Notes
1. When sampling the bone using a cutting disc, clean the hood
appropriately with 10% bleach and ethanol; change bits/discs,
gloves, and disposable sleeves between each specimen.
2.
During the sampling of the bone, it is recommended to double-
mask in the hood or wear a higher-filtration grade mask, such as a
N95, since there is excessive bone dust released into the air
during the grinding process, especially with drier samples.
Respirators are also highly encouraged due to the airborne
particles that are released into the air during the grinding and
sanding processes.
3.
The most suitable samples from adult bone specimens that are
likely to yield successful DNA results include the femur, the tibia,
and the pelvis (if these sample types are available). If sampling
the femur or tibia, collect samples from either the proximal
anterior shaft or the distal anterior shaft of the long bone for
optimal DNA results [7].
4.
Different shapes and sizes of sanding bits may be utilized for
various bone types, sizes, and shapes. For example, a pointed,
conical, tapered Dremel bit is useful for smaller pieces of bone
with a smaller surface area. Similarly, a rounded bit is useful for
larger pieces of bone as it can cover a larger surface area more
effectively.
5.
Generally, take care to avoid sampling any areas where the bone
exhibits discoloration. This discoloration may indicate high levels
of metals or humidity from the surrounding environment, which
could result in DNA degradation [7]. Ensure that the entire first
layer of the bone is sanded off, since this layer of the bone is
exposed to the environmental elements. The depth needed to
sand will vary by sample. Once this initial layer of bone is sanded
off, there should be white, creamy bone underneath. This white,
creamy bone devoid of any staining from the environmental
elements is what you should sample for DNA extraction.
Additionally, take care to sand off and completely remove any
extraneous tissue or other foreign material on the surface of the
bone.
6. When removing a section of bone, it is recommended to take at
least a 1 cm by 3 cm piece of bone if possible These dimensions
least a 1 cm by 3 cm piece of bone, if possible. These dimensions
will ensure that only one sampling is necessary.
7.
It is imperative to always use ultrapure water when cleaning the
external surface of the bone.
8.
When starting the blender, the sample may become wedged
between a blade and the wall of the cup. If this occurs, shut off the
power, remove the cup, and dislodge the sample by tapping or
rotating the blade spindle. If the sample is not completely ground
after 1 min, shut off the power, tap the container, and repeat until
the sample is completely ground.
9.
It is important to check that the conical tubes are suitable for a
range of temperatures from −20 to 56 °C. The conical tubes should
be suitable for freezer temperatures, room temperature, and
higher temperature incubations.
10.
Once the bone powder is transferred to a conical tube, the
extraction procedure may be stopped at this point for the day, if
desired, by storing the sample in the −20 °C freezer.
11.
During the overnight incubation in the nutator, the parafilm may
crack in the heat. Prior to leaving the samples incubating
overnight, check the tubes and parafilm for any cracks.
Additionally, check that the tubes are tightly screwed. If the
sample leaks, wipe the outside of the tube with 10% bleach,
change gloves, re-tighten the cap, and re-wrap with parafilm.
12.
During the step involving the removal of the aqueous layer
following the addition of PCIAA, take care to avoid aspiration of
the interface. During this process, the interface is where
completely digested proteins with both hydrophobic and
hydrophilic domains get trapped between the two layers. With the
extraction of bone samples, the interface can be thicker and
murkier.
13. Following the addition and centrifugation of the n-butanol layer,
take care to avoid pipetting the interface and n-butanol when
collecting the lower aqueous layer Prior to inserting the pipette
collecting the lower aqueous layer. Prior to inserting the pipette
tip into the lower aqueous layer, press down on the plunger
halfway into the liquid to avoid collecting any of the interface or n-
butanol. Once your pipette tip has reached the lower aqueous
layer, press entirely down onto the plunger to displace any liquid
that may have accumulated in the tip. Then, you may aspirate as
normal. You may also choose to completely remove the n-butanol
and interface layer completely.
14.
If you suspect that the sample may be inhibited, perform more

washes with the TE−4 as needed.
References
1. Loreille OM, Diegoli TM, Irwin JA et al (2007) High efficiency DNA extraction from bone by
total demineralization. Forensic Sci Int Genet 1(2):191–195. https://doi.org/10.1016/j.
fsigen.2007.02.006
[Crossref][PubMed]
2. Jakubowska J, Maciejewska A, Pawłowski R (2012) Comparison of three methods of DNA

extraction from human bones with different degrees of degradation. Int J Legal Med
126:173–178. https://doi.org/10.1007/s00414-011-0590-5
[Crossref][PubMed]
3. Baubliene J, Daugnora L, Miceikiene I (2003) Evaluation of the DNA extraction method from
ancient animal bones. Ekologija 1:8–11
4. Duijs FE, Sijen T (2020) A rapid and efficient method for DNA extraction from bone powder.
Forensic Sci Int: Reports 2:100099. https://doi.org/10.1016/j.fsir.2020.100099
[Crossref]
5. Virginia Department of Forensic Science (2020) Mitochondrial DNA section procedures

manual, rev. 5. Available via the Virginia Department of Forensic Science. https://www.dfs.
virginia.gov/wp-content/uploads/2020/10/212-D100-Mitochondrial-DNA-Section-
Procedures-Manual.pdf
6. Virginia Department of Forensic Science (2021) Forensic biology procedures manual

extraction of DNA, rev. 7. Available via the Virginia Department of Forensic Science. https://
www.dfs.virginia.gov/wp-content/uploads/2021/06/210-D2004-FB-PM-Extraction-of-
DNA.pdf
7.
International Commission on Missing Persons (2015) Standard operating procedure for
sampling bone and tooth specimens from human remains for DNA testing at the ICMP.
Available via the International Commission on Missing Persons. https://www.icmp.int/wp-
content/uploads/2015/04/icmp-sop-aa-136-2-doc.pdf
https://doi.org/10.1007/978-1-0716-3295-6_7
7. Differential Extraction with

Purification via Organic/Microcon®
and Promega DNA IQ™ Methods
Jonathan Forsberg1 and Caitlin Ayoub1
Jonathan Forsberg
Email: jonathan.forsberg@dfs.virginia.gov
Abstract
The differential extraction method allows for the separation of sperm
cell DNA from non-sperm cell DNA by incorporating two separate lysis
steps. This is crucial in forensic casework, as sexual assault samples
frequently deal with a mixture of seminal fluid and other body fluids.
After performing a differential lysis, DNA extraction can be completed
through a variety of methods. In addition to the differential lysis, two
methods will be described in this chapter for DNA purification: Organic
(Phenol)/Microcon® purification and purification with the Promega
DNA IQ™ System.
Key words Differential extraction – Spermatozoa – Epithelial cells –

Sexual assault evidence – DNA – Organic extraction – Microcon® –
Phenol – Promega DNA IQ™ System
1 Introduction
In the majority of sexual assault cases, seminal fluid, if present, will
provide the greatest opportunity for obtaining a usable DNA profile
from the forensic evidence. The differential extraction method allows
for the separation of sperm cell DNA from non-sperm cell DNA when
working with mixed body fluid samples [1, 2]. While seminal fluid also
includes epithelial cells from the donor, the separation of DNA from
sperm cells from that of other cell types (especially vaginal epithelial
cells) maximizes the likelihood of developing a probative DNA profile
from forensic evidence samples while potentially aiding in DNA
interpretation by separating the DNA sample into two fractions, often
avoiding DNA mixture profiles altogether. This method accomplishes
this by exploiting the strength of the disulfide bonds in the cellular
membranes of spermatozoa via two lysis steps. The first lysis is
intended to expose only non-sperm cell DNA. This non-sperm lysate is
set aside in a separate tube to be extracted before performing several
washes of the sperm pellet. Then a second lysis, through the inclusion
of dithiothreitol (DTT), exposes the DNA of any spermatozoa remaining
in the sample.
Many DNA purification techniques can be adapted for compatibility
with a differential extraction. Two manual DNA purification techniques
for differentially lysed samples were selected and described which
allow for the completion of the DNA extraction process. The organic
(phenol-chloroform-isoamyl alcohol (PCIAA))/Microcon® method is a
more traditional method, especially useful for challenging samples. This
method purifies DNA by trapping hydrophobic contaminants such as
lipids and protein fragments in the lower organic phase or at the
interface (protein layer), while retaining hydrophilic DNA in the upper
aqueous phase [2]. Once removed, the DNA from the aqueous phase is
further purified via a Microcon® centrifugal filter [3]. The second
purification described, DNA IQ™, is a more modern, silica-based
method that uses paramagnetic beads (resin) to bind the DNA from
lysed cells while non-DNA sample components are washed away [4, 5].
After disassociating the DNA from the DNA IQ™ Resin, the DNA is then
eluted into the final purified extract.
2 Materials
2.1 General Reagents and Supplies
1.
1.5 mL microcentrifuge tubes and compatible spin baskets.
2.
15 mL conical tubes.
3.
20 mg/mL Proteinase K: Prepare in sterile Type 1 Water. Store
frozen in small aliquots to avoid excessive freeze/thaw cycles.
Thaw immediately prior to use. Can be purchased premade.
4.
TNE: 10 mM Tris-HCl, 0.1 M NaCl, and 1 mM EDTA; prepare in
sterile Type 1 Water and mix until completely dissolved. Can be
purchased premade.
5.
20% Sarkosyl: Add N-Lauroylsarcosine to sterile Type 1 Water and
mix until completely dissolved. Filter-sterilize and store at room
temperature. Can be purchased premade.
6.
0.39 M Dithiothreitol (DTT): Add DTT to sterile Type 1 Water and
mix until completely dissolved. Filter-sterilize. Store frozen in small
aliquots to avoid excessive freeze/thaw cycles; thaw immediately
prior to use.
7.
Sterile Type 1 Water.
8.
PCR Digestion Buffer: 10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl,
and 1% SDS; prepare in sterile Type 1 Water and mix until
dissolved. Store at room temperature.
9.
Low EDTA TE Buffer (1X TE−4 Buffer): 10 mM Tris-HCl and 0.1 mM
EDTA; prepare in sterile Type 1 Water and adjust pH to 8.0 using
37.1% HCl. Autoclave for 20 min and store at room temperature.
Can be purchased premade.
2.2 Organic Differential Extraction

1.
Biological Safety Hood.
2. Microcon® DNA Fast Flow Device.
3.
25:24:1 Phenol-chloroform-isoamyl alcohol (PICAA): Adding 8-
Hydroxyquinoline to a final concentration of 5 mM (in a biological
safety hood) is optional—this will increase the contrast seen
between phases (see Subheading 3.2, steps 5 and 6). Store
refrigerated. This reagent is caustic; open/use only in ventilated
biological safety hood.
2.3 DNA IQ™ System Differential Extraction

1.
Magnetic Separation Stand.
2.
DNA IQ™ System: Contains Lysis Buffer, Resin, 2X Wash Buffer, and
Elution Buffer. To make 1X Wash Buffer, dilute the provided 2X
Wash Buffer with equal parts reagent grade ethanol and isopropyl
alcohol (2:1:1). Each reagent should be stored at room
temperature. If a precipitate forms in the provided Lysis Buffer,
warm to 37–60 °C.
3.
DNA IQ™ Lysis Buffer with DTT: Add 250 μL 0.39 M DTT to every
10 mL Lysis Buffer. Can be stored at room temperature for up to 1
month if tightly capped.
3 Methods
All methods are intended to be performed/processed using appropriate
personal protective equipment (lab coat, gloves, hair net, mask, and
safety glasses), extraction control (reagent blank), and universal
precautions for clean technique and appropriate decontamination
procedures (decontamination of surfaces using 10% bleach solution
followed by 70% ethanol, decontamination of tweezers between
samples using 10% bleach solution followed by 70% ethanol, and
changing tips between manipulation of or addition of chemicals to each
sample). The methods outlined in this chapter have been adapted from
those used at the Virginia Department of Forensic Science [6].
3.1 Differential Lysis Procedure
1.
Add 400 μL TNE, 25 μL 20% Sarkosyl, 75 μL Sterile Type I Water,
and 5 μL 20 mg/mL Proteinase K in proportional amounts to
saturate the substrate in a 1.5 mL microcentrifuge tube (see Note
1).
2.
Mix by light vortexing and then pulse spin to force the cutting into
the liquid.
3.
Place the tube into a 37 °C incubator or heat block for a minimum
of 2 h (see Note 2).
4.
Vortex vigorously for 20–30 s and pulse spin the tube (see Note
3). Remove the substrate from the liquid with sterile or fully
decontaminated forceps or tweezers and place into a new, unused
spin basket. Place the basket in the tube and close the lid. Spin the
tube for 5 min in a microcentrifuge at a minimum of 9400 × g to
remove the excess liquid from the cutting (see Note 4).
5.
Remove and discard the spin basket containing the substrate (see
Note 5).
6.
Using a pipette, carefully transfer all but ~50 μL of the
supernatant into a new labeled microcentrifuge tube with a lid
(see Note 6). The supernatant removed from the pellet is the
“non-sperm fraction.” The pellet on the bottom of the tube will
become the “sperm fraction” (see Fig. 1).
7.
Set the “non-sperm fraction” tube aside until the sperm fraction is
also ready for DNA extraction and purification (see Subheading
3.1, step 14; Note 7). Store at room temperature if completing the
DNA extraction process on the same day, or store refrigerated
until extraction will be completed.
8. Wash the sperm pellet as follows: Add 500 μL PCR Digestion
Buffer and resuspend the pellet by vortexing briefly. Spin the tube
for 5 min in a microcentrifuge at a minimum of 9400 × g. Remove
and discard all but ~50 μL of the supernatant.
9.
Repeat the wash an additional two times (see Note 8).
10.
After the final wash, remove and discard all but ~50 μL of the PCR
Digestion Buffer. Resuspend the pellet in the remaining 50 μL of
PCR Digestion Buffer by pipetting or light vortexing. This is the
“sperm fraction” (see Note 9).
11.
To each sperm fraction: Add 150 μL TNE, 50 μL 20% Sarkosyl,
40 μL 0.39 M DTT, 150 μL Sterile Type I Water, and 10 μL
12.
Mix by inverting by hand or light vortexing and place the tube into
a 56 °C incubator or heat block for a minimum of 2 h, not to
exceed an overnight incubation.
13.
Pulse spin the tube to force the condensate to the bottom of the
tube.
14.
Proceed with both the sperm fraction and the non-sperm fraction
to organic extraction with Microcon® DNA purification (see
Subheading 3.2, step 1) or to Promega DNA IQ™ extraction and
purification (see Subheading 3.3, step 1) (see Note 11). Option:
refrigerate sperm and non-sperm fractions for up to 24 h for
purification on the following day.
Fig. 1 Sperm pellet wash. Depiction of microcentrifuge tube before (left) and after (right)
removal of the supernatant during removal of the non-sperm fraction and subsequent sperm
wash steps of the differential extraction. Minimal supernatant remains to avoid disturbance of
the sperm pellet
3.2 Organic Extraction with Microcon® DNA Purification

1.
Start with the sperm fraction and non-sperm fraction lysate (see
Subheading 3.1). If samples had been temporarily refrigerated,
allow them to come to room temperature before proceeding.
2. To both the sperm fraction and non-sperm fraction: Add 500 μL
phenol-chloroform-isoamyl alcohol to each tube (see Notes 12–
14).
3.
Cap the tube tightly and mix thoroughly by hand or light vortexing
until the solution has a milky appearance (see Note 15).
4.
Spin the tube for 3 min at a minimum of 9400 × g to separate the
two phases.
5.
In a newly labeled Microcon® vial (provided with the Microcon®
MRCF0R100 assembly), insert a Microcon® concentrator and add
100 μL sterile Type I Water to the concentrator (see Note 16).
6.
Transfer the aqueous phase (see Fig. 2) to the Microcon®
concentrator and place the cap from the filtrate vial on the
concentrator (see Notes 17 and 18).
7.
Spin the Microcon® assembly in a microcentrifuge for 10–40 min
at a maximum of 2350 × g until the volume is reduced (see Note
19).
8.
Carefully remove the concentrator unit from the Microcon®
assembly and discard the fluid from the filtrate vial. Return the
concentrator to the top of the filtrate vial.
9.
Add 200 μL sterile Type I Water to the concentrator. Replace the
cap and spin the Microcon® assembly in a microcentrifuge for 10–
30 min at approximately 2350 × g until the volume is completely
reduced (see Notes 19 and 20).
10.
Remove the cap from the concentrator and add 30 μL 1X TE−4
Buffer (see Note 21).
11.
Remove the concentrator from the filtrate vial and discard the
vial. Carefully invert the concentrator and place it into a new
labeled Microcon® vial.
12.
Spin the Microcon® assembly with the inverted concentrator in a
microcentrifuge tube for 5 min at 2350 × g.
V if th DNA t t i t i th b tt f th i l
13. Verify the DNA extract is now present in the bottom of the vial,
then discard the concentrator unit and tightly close the cap on the
vial.
14.
The extract can be taken directly to quantitation or refrigerated at
2–8 °C until quantitation is performed (up to 1 week). If the
sample will be retained after processing and/or for long-term
storage of remaining DNA extracts, freeze at −10 °C or lower
indefinitely or air-dry for future reconstitution.
Fig. 2 Organic extraction layers. Depiction of microcentrifuge tube before (left) and after
(right) removal of the aqueous phase during organic extraction. Some aqueous phase remains
after pipetting to avoid disturbance of the interface or pipetting from the organic phase
3.3 DNA IQ™ Extraction and Purification
1.
Start with the sperm fraction and non-sperm fraction lysate (see
Subheading 3.1). If samples had been temporarily refrigerated,
allow them to come to room temperature before proceeding.
2.
For the non-sperm fraction, remove 100 μL of the lysate, place it
into a new, labeled 1.5 mL microcentrifuge tube (see Note 22),
and then add 220 μL DNA IQ™ Lysis Buffer with DTT to that new
tube. If more than 100 μL of the non-sperm fraction is used, add
proportional volumes of DNA IQ™ Lysis Buffer with DTT. For the
sperm fraction, add 220 μL DNA IQ™ Lysis Buffer with DTT (see
Note 23).
3.
Vigorously vortex the bottle of DNA IQ™ Resin for 30 s. Then add
8 μL DNA IQ™ Resin to each tube (see Notes 24 and 25).
4.
After adding resin, vigorously vortex each sample for several
seconds (see Note 26).
5.
Place the tubes in a microcentrifuge rack and allow the samples to
incubate at room temperature for 5 min, allowing the DNA to
adhere to the resin. After incubation, pulse spin in a
microcentrifuge (see Note 27).
6.
Transfer the sample tubes to a magnet separation stand. Open the
caps one at a time and, without disturbing the resin pellet, remove
and discard the liquid in each tube (see Fig. 3; Notes 28 and 29).
7.
Add 100 μL of the prepared DNA IQ™ Lysis Buffer with DTT into
each tube. Remove the tubes from the magnetic stand and vortex
vigorously for several seconds. Pulse spin in a microcentrifuge.
8.
Place the tubes back into the magnet separation stand and,
without disturbing the resin pellet, remove and discard the liquid
in each tube (see Notes 28 and 29).
9. Add 100 μL 1X DNA IQ™ Wash Buffer (see Note 30) to each tube.
Remove the tubes from the magnetic stand and vortex vigorously
for several seconds Pulse spin in a microcentrifuge Place the
for several seconds. Pulse spin in a microcentrifuge. Place the
tubes back into the magnet separation stand and, without
disturbing the resin pellet, remove and discard the liquid in each
tube (see Notes 28 and 29).
10.
Repeat the wash step (see Subheading 3.3, step 9) two additional
times.
11.
After the last wash step, open the cap on each tube and allow the
samples to completely air-dry (see Note 31).
12.
Add 40 μL DNA IQ™ Elution Buffer to each tube to remove the
DNA from the resin. Vortex each tube vigorously for 5 s (to avoid
pelleting the resin, do not centrifuge at this step) (see Note 32).
13.
Place the tubes in a 56 °C incubator or heat block for 5 min and
then pulse spin in a microcentrifuge (see Note 33).
14.
Place the tubes back into the magnet separation stand and
transfer the supernatant (being careful to avoid any DNA IQ™
Resin) into a clean, labeled microcentrifuge tube. This new tube
(of supernatant) contains the isolated DNA sample and is the final
DNA extract (see Note 34).
15.
The extract can be taken directly to quantitation or refrigerated at
2–8 °C until quantitation is performed (up to 1 week). If the
sample will be retained after processing, for long-term storage of
remaining DNA extracts, freeze at −10 °C or lower indefinitely or
air-dry for future reconstitution.
Fig. 3 DNA IQ™ Resin movement. Depiction of microcentrifuge tube before (left) and after
(right) placing the tube on the magnet stand during DNA IQ™ extraction/purification. DNA IQ™
Resin is seen pelleting on the magnet side of the tube (right)
4 Notes
1. A master mix of these chemicals can be made in a 15 mL conical
tube and aliquoted out to each sample. To do this, calculate the
number of samples (accounting for a reasonable overage of 10–
20%) and multiply by the volume of each component to be added
to each sample, then add these together and mix prior to
distributing to the samples. Adding too much volume (in excess of
600 μL) can cause the spin basket to sit in the flow-through
volume (see Subheading 3.1, step 4). Having enough volume to
saturate the substrate is important for proper cell lysis. This
should be considered during sample collection. Under most
circumstances, only up to two swabs/swab shells or
approximately 0.5–1 cm2 would be recommended for extraction
in a single 1.5 mL microcentrifuge tube. To facilitate placement in
the tube and allow for necessary agitation during later steps, cut
the substrate into smaller pieces, as needed, and do not tightly
pack the sample into the bottom of the tube. Having sufficient
volume to allow agitation of the substrate in this lysis mixture will
also maximize the effect of vortexing (see Subheading 3.1, step 4)
to successfully remove as many sperm cells from the substrate as
possible after the initial lysis.
2.
During this step, non-sperm cells are targeted for lysis. Incubation
can be conducted overnight, if necessary. Longer incubation times
are more likely to result in inadvertent lysis of sperm cells.
Agitation (e.g., periodic vortexing or use of a thermomixer) during
the incubation is beneficial but optional.
3.
While DNA from lysed cells is already exposed and suspended in
the lysis mixture at this point, vortexing rigorously is crucial for
releasing the intact sperm cells from the substrate, as sperm cells
can be very resistant to release.
4.
Positioning the tubes in a consistent orientation in the centrifuge
will ensure the sperm pellet can most easily be avoided when
removing the supernatant (see Subheading 3.1, steps 6 and 8).
Positioning each microcentrifuge tube with the hinges facing out,
for example, will cause the sperm pellet (which is often not
visible) to concentrate on that side of the tube (see Fig. 1).
5.
If you desire to keep the substrate, the spin basket containing the
substrate may be placed into a new tube instead of discarding.
Leaving the substrate tube open in a hood overnight or longer will
allow any moisture remaining in the substrate to dry and prevent
mold or bacterial growth.
6. To avoid disturbing or dislodging the sperm pellet, it is best to
remove the supernatant by positioning the pipette tip as close to
the meniscus as possible (see Fig. 1), keeping the tip submerged.
Follow the meniscus down as the supernatant is drawn up the
pipette tip. Keeping the sperm pellet intact is crucial to ensuring
maximum sperm recovery from the sample. If disturbance of the
sperm pellet is noticed or suspected, the sample can be re-
centrifuged at the same parameters prior to completing this step.
7.
Be sure the tube labels for the “sperm fraction” and “non-sperm
fraction” differ to prevent downstream sample switches of the
fractions.
8.
In addition to the typical three washes, one or two additional
washes may be desirable if exceptionally high non-sperm content
is expected (such as internal body samples). Additional washes
will not only further dilute any remaining non-sperm DNA present
in the sample but also add an additional risk of inadvertently
disturbing the sperm pellet (visible or invisible). If disturbance of
the sperm pellet is noticed or suspected during a wash, the
centrifuge step can be repeated prior to removing the
supernatant.
9.
Optional: ~3 μL of the sperm fraction can be pipetted onto a glass
microscope slide for fixation and staining. The pellet should be
resuspended by pipetting or light vortexing, followed by a pulse
spin (if needed) prior to slide preparation.
10.
A master mix of these chemicals can be made in a 15 mL conical
tube and aliquoted to each sample in the appropriate amounts.
The DTT present in this lysis mixture will reduce the disulfide
bonds of the sperm head to expose sperm cell DNA when
combined with the increased temperature of the incubation and
presence of Proteinase K and sarkosyl.
11. Subheadings 3.2 and 3.3 each accomplish the purification of the
DNA released during the differential lysis methods outlined in
Subheading 3.1. Organic/Microcon® DNA purification described
in Subheading 3.2 is a very effective purification method
regardless of DNA concentration and is especially robust in
dealing with difficult or dirty samples. The largest downsides to
this purification method include the time-consuming nature of
p g
this technique and caustic nature of PCIAA (which demands use
only in a ventilated fume hood) [7]. This technique also requires
more exact dexterity compared to DNA IQ™ (see Note 18). The
manual DNA IQ™ purification method described in Subheading
3.3 is simple and effective for a wide range of DNA concentrations
typically encountered in forensic casework [4]. A primary
drawback to DNA IQ™ is that it does have lower recovery rates
when dealing with DNA concentrations that exceed the capacity of
the DNA IQ™ Resin (100 ng) or when excessive non-human DNA is
present in the sample [8, 9].
12.
The volume of PCIAA added should be approximately equal to the
volume of the sample at this time. A higher volume of PCIAA
should be added if higher volumes are present.
13.
At a minimum, the early portion of the organic extraction (see
Subheading 3.2, steps 1–6) should be performed in a biological
safety hood to minimize exposure to PCIAA (caustic chemical; see
the manufacturer’s Safety Data Sheet before handling).
Completing the bulk of the protocol (see Subheading 3.2, steps 1–
12) in the hood could further lessen exposure to minute residual
phenol.
14.
Allow PCIAA to come to room temperature prior to use.
15.
Ensure that the sample tube is completely closed during this step.
If a leak occurs, in addition to leaked PCIAA (hazardous),
aerosolized DNA can escape during vortexing/agitation, causing
DNA loss and potential contamination. Screw top tubes are not
necessary but can be considered to help ensure that the risk of
leakage is minimized. The agitation does not need to be for a
prolonged period; a light vortex or a few shakes will generally
achieve this “milky” appearance. This step is necessary to ensure
that maximum exposure of all sample components (lipids, DNA,
partially digested proteins, etc.) to the hydrophobic phenol now
present in the sample is achieved, allowing proper sorting based
on polarity.
Thi t b f d i t ddi PCIAA t th l
16. This step can be performed prior to adding PCIAA to the sample
lysate (see Subheading 3.2, step 2), if desired. The Microcon®
concentrator should be seated in the vial with the filter facing up
and the narrow white portion oriented towards the bottom of the
vial [3]. The concentrator remains in this configuration when in
the tube until inversion (see Subheading 3.2, step 11).
17.
At this stage of the process, the tube contains two phases: the
aqueous phase on the top contains hydrophilic DNA and the
phenol (organic) phase on the bottom contains hydrophobic
contaminants. The interface (also commonly referred to as
interphase) exists in the middle of this mixture where the two
layers meet. This thin layer may contain partially digested
proteins with hydrophobic and hydrophilic regions and can often
extend slightly into the aqueous layer, appearing “fuzzy” at times.
18. The interface and the organic phase contain contaminants that
can cause downstream inhibition and complications. Phenol itself
is a known PCR inhibitor and can also damage the Microcon®
filter in the concentrator. The proteins at the interface can plug
the Microcon® filter used during the remainder of this protocol,
limiting the effectiveness of the wash steps. As a result, it is
important to avoid pulling from these layers when removing the
aqueous phase. The best technique for avoiding the interface and
lower organic layer is to begin pipetting with the pipette tip as
close to the top of the aqueous layer as possible, following it down
as you remove the aqueous layer, leaving a small portion of the
aqueous layer behind (see Fig. 2). Removal of the aqueous layer
can also be accomplished with a transfer pipette, based on
individual preference. If the interface or organic phase is believed
to have been pipetted with the aqueous layer, it can be returned to
the tube, followed by repeating the corresponding mixing and
centrifugation steps (see Subheading 3.2, steps 3 and 4). If a final
extract is identified as containing phenol (by observed inhibition
or smell), the extract can be brought up to a larger volume (~400–
500 μL) with an appropriate solvent, such as TNE, and the entire
extraction and purification process may be repeated (see
Subheading 3.2), ensuring better avoidance of the organic phase
(see Subheading 3 2 step 6)
(see Subheading 3.2, step 6).
19.
This protocol calls for speeds exceeding the manufacturer
recommended maximum speed of 500 × g. A speed of 2350 × g
was chosen due to the difficulty of some samples to pass through
the concentrator at lower speeds. While the speed in this protocol
is above that which is recommended by the manufacturer, it has
been used with much success. Excessive speeds may damage the
filter or cause the DNA to embed itself in the filter, so further
exceeding these recommendations is not advised. Spin times may
need to be adjusted if lower speeds are used. Once the volume has
adequately passed through (see Subheading 3.2, steps 7 and 9),
no significant volume will remain; however, the surface of the
filter should still appear shiny with moisture, and there may be a
very small ring (of negligible volume) along the outer rim of the
filter. The goal is not to completely “dry” the filter. Samples with
extraordinarily high concentrations of DNA will frequently take
longer to fully flow through (see Subheading 3.2, steps 7 and 9).
Consider rotating the assembly if this is causing issues, as this will
allow the volume to pass through more readily on the opposite
side of the filter by avoiding the more saturated pores.
20.
If the concentrator filter was stained by the lysate and the staining
has not yet been removed, the water wash (see Subheading 3.2,
steps 8 and 9) may be repeated additional times to reduce the
potential of the dye or colored material from inhibiting the
subsequent PCR amplification.
21.
If a high concentration of DNA is expected or regularly noticed for
specific sample types (far exceeding the appropriate
concentration per amplification kit), up to 100 μL may be used as
the final elution volume. Non-sperm fractions for internal body
samples are the most likely to recover the highest amounts of
DNA. To ensure DNA is not overdiluted at this step, it would
generally be more desirable to perform small sample dilutions
rather than overdiluting up front. Ensure the reagent blank
utilizes the smallest final elution volume of the associated
samples to allow maximum sensitivity to potential contaminants.
22. The remainder of the non-sperm fraction lysate can be retained in
the refrigerator for up to 24 h or discarded.
23.
Resuspend the pellet with a quick vortex or pipetting before
proceeding. This ensures that the sample is well mixed prior to
beginning.
24.
If the stock bottle of DNA IQ™ Resin has settled between samples,
re-vortex before further use. Avoiding separation of the resin from
the liquid is important to prevent unequal amounts, or a complete
lack of resin, from being added to the samples. The incorrect
amount of resin can cause inconsistent DNA yields between
samples, due to aggregate clumps or insufficient resin [9, 10].
25.
The resin beads have an approximate maximum capacity of

100 ng per sample [9]. Since the DNA extracted with DNA IQ™ is
not human-specific, if there is any bacterial, fungal, or animal DNA
present in a sample, that DNA will also be isolated and compete
with human DNA for the resin beads [8, 9].
26.
Tap the tube on the bench a few times to force the liquid to the
bottom, if needed. Do not centrifuge at this time.
27.
The proprietary DNA IQ™ Lysis Buffer contains a detergent (which
breaks open cells and separates the DNA from cellular debris) as
well as guanidinium thiocyanate (which is a chaotropic agent).
The purpose of a chaotropic agent is to allow the DNA to bind to
the paramagnetic silica-coated beads through a series of
hydrophobic interactions and hydrogen bonding. During this step,
the DNA is beginning to adhere to the silica-coated resin, while
the remainder of the cellular debris and molecules stay in solution
to be later removed.
28.
Once on the magnetic stand, if the resin doesn’t have a distinct
pellet on the side of the tube (see Fig. 3), try vortexing again and
place it back on the magnetic stand.
This is best achieved by pipetting at an angle away from the resin
This is best achieved by pipetting at an angle away from the resin
29. to avoid disturbing the pellet. At this step, the DNA has adhered to
the resin and the liquid being discarded contains cellular waste
and extraneous material.
30.
With its alcohol and low salt content, the DNA IQ™ Wash Buffer
keeps the DNA adhered to the resin while removing excess salt,
detergents, and cellular debris. These wash steps help to purify
the DNA from any potential inhibitors, contaminants, and
unwanted material that may affect downstream processing.
31.
Space out tubes as much as possible to minimize any risk of
contamination, opening each tube carefully. This will take
approximately 5 min depending on the volume of liquid
remaining in the tube. The purpose of this drying step is to
evaporate the remaining alcohol in the sample, as that is what
helps DNA adhere to the resin beads but can also act as an
inhibitor of downstream DNA testing. Do not exceed a drying time
of 20 min, as it is important to prevent the resin from completely
drying out, which can prevent successful elution of the DNA. If the
resin dries up, then the DNA will be bound irreversibly to the
resin, thereby causing inconsistent DNA yields.
32.
The DNA IQ™ Elution Buffer is a non-salt, non-alcohol solution
that helps change the stringency conditions, allowing the DNA to
dissociate from the resin beads and re-enter solution.
33.
The isolated DNA will be single-stranded due to the heat at the
elution step, so this method is not compatible with traditional gel
methods but is compatible with the STR typing more frequently
conducted nowadays.
34. If DNA IQ™ Resin is removed with the supernatant, this may cause
inhibition during PCR amplification, including quantitative PCR
(qPCR) or STR amplification. If DNA IQ™ Resin is present in the
DNA extract, pulse spin the tube in a microcentrifuge, place it back
on the magnet separation stand, and transfer the supernatant to a
new, clean, labeled microcentrifuge tube [9].
References
1. Yoshida K, Sekiguchi K, Mizuno N et al (1995) The modified method of two-step differential
extraction of sperm and vaginal epithelial cell DNA from vaginal fluid mixed with semen.
Forensic Sci Int 72(1):25–33. https://doi.org/10.1016/0379-0738(94)01668-u
[Crossref][PubMed]
2. Butler JM (2012) Chapter 2: DNA extraction methods. In: Advanced topics in forensic DNA
typing: methodology. Elsevier Academic Press, Waltham
3. Merck Millipore Ltd (2018) Microcon® centrifugal filter devices user guide. Available via
Millipore Sigma. https://www.emdmillipore.com/US/en/product/Microcon-Centrifugal-
Filters,MM_NF-C113861#documentation. Accessed 31 May 2022
4. Mandrekar PV, Krenke BE, Tereba A (2001) DNA IQ™: the intelligent way to purify DNA.
Available via Promega Corporation. https://www.promega.com/-/media/files/resources/
profiles-in-dna/403/dna-iq-the-intelligent-way-to-purify-dna.pdf?rev=f 700c4481a424373
9f23570f6834cd37&sc_lang=en. Accessed 31 May 2022
5. Hu Q, Liu Y, Yi S et al (2015) A comparison of four methods for PCR inhibitor removal.

[Crossref][PubMed]
6. Department of Forensic Science (2021) Forensic biology procedures manual: extraction of

DNA. Available via Virginia Department of Forensic Science. https://www.dfs.virginia.gov/
wp-content/uploads/2021/06/210-D2004-FB-PM-Extraction-of-DNA.pdf. Accessed 31
May 2022
7. Kö chl S, Niederstä tter H, Parson W (2005) DNA extraction and quantitation of forensic
samples using the phenol-chloroform method and real-time PCR. In: Carracedo A (ed)
Forensic DNA typing protocols, Methods in molecular biology, vol 297. Humana Press,
Totowa, pp 13–29. https://doi.org/10.1385/1-59259-867-6:013
[Crossref]
8. Frégeau CJ, De Moors A (2012) Competition for DNA binding sites using Promega DNA IQ™
paramagnetic beads. Forensic Sci Int Genet 6(5):511–522. https://doi.org/10.1016/j.
fsigen.2011.12.003
[Crossref][PubMed]
9. Huston K (2002) Technical tips: DNA IQ™ System “frequently asked questions”. Profiles in
DNA 5(1):11–12. Available via Promega Corporation. https://www.promega.com/-/media/
files/resources/profiles-in-dna/501/dna-iq-system-frequently-asked-questions.pdf?rev=
d20abf9fb6b34dedade70d22901d1c51&sc_lang=en. Accessed 31 May 2022
10.
Promega Corporation (2021) Technical bulletin: DNA IQ™ System—small sample casework
protocol. Available via Promega Corporation. https://www.promega.com/-/media/files/
resources/protocols/technical-bulletins/101/dna-iq-system-small-sample-casework-
protocol.pdf?rev=90e98272389c4c8389b0d2b29011a342&sc_lang=en. Accessed 31 May
2022
https://doi.org/10.1007/978-1-0716-3295-6_8
8. DNA Purification from Bloodstains

and Buccal Cells/Saliva on FTA® Cards
Brittany C. Hudson1, 2 and Catherine Cupples Connon1
(2) Integrative Life Sciences, Virginia Commonwealth University,
Richmond, VA, USA
Brittany C. Hudson
Email: hudsonbc@vcu.edu
Abstract
FTA® cards enable efficient, long-term storage of blood and buccal
cells/saliva samples for future forensic DNA analysis; these are typically
collected as known reference samples, as opposed to evidentiary, crime
scene samples. Upon contact with the FTA® card, cells are lysed and the
DNA is immobilized. Different FTA® cards are available and have been
specially formulated based on sample type: bloodstains are added to
the traditional FTA® Card, while colorless sources (e.g., buccal
cells/saliva) are added to the FTA® Indicating Card. The main
difference between these cards is the presence of a pink dye embedded
in the indicating cards that becomes white when exposed to colorless
fluids, like saliva; this aids in location confirmation of the stain for
future sampling. Although DNA can be eluted/extracted from FTA®
punches using various methods or, alternatively, direct STR
amplification from unpurified punches can be performed, the protocol
herein describes a simple purification method for bloodstained
punches from FTA® Cards as well as buccal/saliva-stained punches
from FTA® Indicating Cards. Following this purification, STR
amplification can be performed via the “punch-in” method.
Key words DNA purification – FTA® Card – FTA® Indicating Card –

Blood – Saliva – Buccal cells
1 Introduction
With the increased submission of reference and evidence samples
related to criminal investigations, the need for their efficient storage
and preservation has become imperative. Blood and buccal cells/saliva
routinely serve as known reference samples that are utilized for
comparison with other evidentiary samples collected in association
with a suspected crime. Traditionally, blood samples are collected in
anticoagulant-containing tubes to obtain reference DNA from known
individuals. Moreover, buccal swab samples are perhaps the most
commonly encountered reference sample type from living individuals,
even more so than blood, and are traditionally collected by swabbing
the inside of an individual’s cheeks to obtain buccal cells. While both
sample types can take up unnecessary space within a lab,
refrigeration/climate control is also necessary for the storage of blood
vials to ensure sample preservation. Buccal swabs can be stored at
room temperature for the short term but will need
temperature/climate control to prevent bacterial/fungal growth if long-
term storage is desired.
The development of FTA® paper by Lee Burgoyne in the late 1980s
provided an ideal solution to this storage dilemma. FTA® (FTA),
originally standing for “Fitzco/Flinder Technology Agreement,” is a
cellulose-based material impregnated with four proprietary chemicals
(e.g., a surfactant, chelating agent, buffer, and free radical trap) that
help to release, protect, and preserve DNA for long periods [1, 2]. These
flat cards enable space-efficient and stable storage of DNA at room
temperature for years. In addition to these benefits, the use of a
punching tool to collect a sample from the card results in a fairly
consistent recovery of DNA from blood—roughly 5–20 ng for a 1.2 mm
punch [3, 4]. Yields are often similar from saliva punches of the same
size but are subject to higher variability due to the nature of that
particular body fluid [5, 6]. Furthermore, studies have demonstrated
that DNA profiles can be successfully obtained from blood or saliva
stored on FTA for as long as 16 or 11 years, respectively [5, 7]. Upon
contact with FTA paper, cells are lysed, proteins are denatured, DNA
becomes immobilized within the cellulose matrix, and bacteria and
viruses are inactivated. Downstream DNA analysis (i.e., STR
amplification and profile generation) can be performed either directly
on a portion of the FTA card or the DNA can be eluted from the punch
and carried forward. In fact, a variety of DNA extraction and elution
methods have been evaluated for use with both blood and saliva stored
on FTA [6, 8–10]. Regardless, wash steps are necessary for both sample
types to remove cell debris—as well as heme inhibitors from blood—to
ensure efficient STR amplification [11–13]. Typically, washes are
performed with QIAcard® FTA® Wash Buffer (formerly known as FTA®
Purification Reagent; Qiagen, Hilden, Germany) and either a Tris-EDTA
(TE) buffer (10 mM Tris-HCl with either 1 mM or 0.1 mM EDTA,
referred to as TE/TE−1 or low TE/TE−4, respectively) or water [3, 4, 10,
14–17]. Blood samples can also undergo an additional wash with a
dilute sodium hydroxide or ammonium hydroxide solution [10, 17, 18].
Since buccal cells (and saliva) are essentially colorless, FTA®
Indicating Cards (FTA indicating cards; Qiagen) were developed as an
alternative to the traditional FTA® Cards (FTA cards; Qiagen) for use
with this and other colorless sample types. The proprietary pink dye
embedded in the card becomes white upon application of a colorless
body fluid, which aids in subsequent sampling for DNA analysis [14,
19]. A variety of FTA card sizes have also been made available, including
the Classic, Mini, and Micro formats, with four, two, and one sample
area(s) per card, respectively [14]. Laboratories can choose the
option(s) that best fit their needs.
This chapter will describe a simple method for the purification of
DNA from blood or buccal cells/saliva stored on FTA cards or FTA-
indicating cards, respectively, that can then be carried forward to
“punch-in” STR amplification.
2 Materials
All solutions should be prepared with Type I water. It is good laboratory
practice to aliquot reagents for short-term use (~1 month), rather than
pulling from the stock solution each time; this reduces the risk of
contaminating the stock solution.
1.
Blood on FTA® Cards or buccal cells/saliva on FTA® Indicating
Cards: Stains must be dry before proceeding (see Note 1).
2.
1.2 mm punching tool (see Note 2).
3.
Punch mat.
4.
Biosafety cabinet or hood.
5.
QIAcard® FTA® Wash Buffer: Purchase ready-to-use and store at
room temperature.
6.
Type I water: May be purchased ready-to-use as Type I, ultrapure,
amplification grade, molecular biology grade water, etc. (or
prepared in-house). Prepare in-house by autoclaving reverse
osmosis (RO) water that has been subjected to an additional
filtration system to achieve a resistivity of 18–18.3 MΩ-cm at 25 °C.
Store at room temperature. Expires within 1 year after preparation.
7.
5–7% ammonium hydroxide (NH4OH): Prepare fresh prior to use;
do not store. Stock solutions of ammonium hydroxide are generally
purchased as a 29% solution and need to be diluted further to ~5–
7%. This is only needed for bloodstains on FTA cards.
8.
Tris-EDTA (TE) Buffer: This is also referred to as TE−1 (with respect
to the concentration of EDTA relative to Tris-HCl). May be
purchased ready-to-use or prepared in-house. Prepare in-house to
a final concentration of 10 mM Tris-HCl and 1 mM EDTA; adjust to
pH 7.5–8.0. Autoclave and store at room temperature. Expires
within 1 year after preparation.
3 Method
This protocol can be utilized to simultaneously process multiple FTA
samples of the same type (see Note 1; Fig. 1), along with a single
reagent blank. Users can choose to process more than one reagent
blank, if needed. Universal precautions should be taken regarding the
handling of biohazardous materials (e.g., human body fluids), including
decontamination of laboratory surfaces/equipment with 10% bleach
followed by 70% ethanol before and after each use; changing pipette
tips in between each sample/reagent; and wearing personal protective
equipment (PPE), as defined by your laboratory policy. Basic PPE
includes a lab coat, gloves, and safety glasses.
Fig. 1 Overview of DNA purification from FTA punches. The typical workflow for DNA
purification from blood on FTA cards and saliva/buccal cells on FTA indicating cards using a
1.2 mm punch is shown above. A reagent blank is collected from an unstained area and
processed alongside the other samples of the batch
1 Formerly known as FTA Purification Reagent
2 TE−4 and Type I water have also proven to be effective for this wash step [3, 10, 14–16]
3.1 Purification from Blood on FTA Cards

1.
Add 100 μL QIAcard FTA Wash Buffer to a 1.5 mL microcentrifuge
tube (see Note 3).
2. Using a 1.2 mm punching tool, punch a single, bloodstained circle
from the FTA card and dispense it into the microcentrifuge tube
from the FTA card and dispense it into the microcentrifuge tube
(see Note 2). When implementing reduced volume protocols for
STR amplification, smaller punches or punches containing less
sample should be used to prevent over-amplification (see Note 4).
Clean the punching tool and mat between samples (see Note 5).
3.
For the reagent blank, punch an unstained area of the FTA card
and dispense it into the corresponding microcentrifuge tube
containing QIAcard FTA Wash Buffer (see Note 6).
4.
Incubate the tubes containing FTA punches and buffer at room
temperature for 15 min.
5.
Using a new tip for each sample, pipette the solution up and down
3–4 times to thoroughly mix (see Note 7). Discard the solution; be
careful to retain the punch in its tube.
6.
Add 100 μL QIAcard FTA Wash Buffer to each tube and repeat the
wash step (see Subheading 3.1, steps 4–5) one time, for a total of
two washes.
7.
Add 100 μL fresh 5–7% ammonium hydroxide to each tube and
incubate at room temperature for 15 min. Then mix and discard
the solution (see Subheading 3.1, step 5).
8.
Add 100 μL TE to each tube and incubate at room temperature for
5 min. Then mix and discard the solution, being sure to remove all
TE before proceeding (see Subheading 3.1, step 5; Notes 8 and 9).
9.
Place the tubes (with lids open) in a biosafety cabinet or hood and
allow the punches to dry at room temperature for a minimum of
3 h, up to overnight (see Note 10).
10.
Resuspend the punches in 5 μL Type I water. Punches can proceed
immediately to STR amplification or can be stored at −20 °C until
STR amplification (see Note 11).
3.2 Purification from Buccal Cells/Saliva on FTA Indicating

Cards
1. Add 100 μL QIAcard FTA Wash Buffer to a 1.5 mL microcentrifuge
tube (see Note 3).
2.
Using a 1.2 mm punching tool, punch a single, white-stained circle
from the FTA indicating card and dispense it into the
microcentrifuge tube. Larger and/or duplicate punches may prove
beneficial to improve first-pass DNA profiling success, whereas
smaller punches or punches containing less sample may prove
beneficial for reduced volume amplifications (see Notes 2 and 4).
Clean the punching tool and mat between samples (see Note 5).
3.
Prepare a reagent blank from an unstained (i.e., pink) area of the
FTA indicating card and continue through the two QIAcard FTA
Wash Buffer washes, as described for bloodstains on FTA cards (see
Subheading 3.1, steps 3–6).
4.
Continue with the TE wash and final steps as described for
bloodstains on FTA cards (see Subheading 3.1, steps 8–10). The
ammonium hydroxide wash is not needed for buccal cells/saliva
samples and should be eliminated for this sample type.
4 Notes
1.
Only process samples of the same type together; do not process
blood and buccal/saliva samples at the same time.
2.
The punching tool needs to be suitable for use with body fluids on
FTA cards (e.g., the Harris Uni-Core Punch). A 1.2 mm punching
tool is used in this protocol, but various sizes can be purchased
and utilized. Studies have demonstrated different punch sizes may
be optimal depending on the body fluid, sample age, and STR
amplification kit [3–7, 10, 15, 16]. Additionally, buccal samples
have historically produced greater variability in DNA yield, likely
due to the nature of the sample and the clumping of epithelial
cells on the matrix [5, 6]; therefore, studies have shown that
larger punches and/or duplicate punches per extraction or
“punch-in” amplification improve STR profiling results [5, 6].
f “
3. The small size of FTA punches enables their tendency to “jump”
because of static electricity or air flow [1, 4, 20]. Given this, it is

helpful to eject the FTA punch as close to the bottom of the
microcentrifuge tube as possible. Adding reagent prior to the FTA
punch also reduces the possibility of static electricity and punch
“jumping.” Alternatively, implementing a static gun could prove
useful in preventing the punches from moving out of their
respective tubes. Lastly, QIAcard FTA Wash Buffer can be added
after the punch is dispensed into the tube (see Subheading 3.1,
step 2 and Subheading 3.2, step 2), but this is not recommended
because doing so increases the possibility of the punch “jumping”
due to static electricity.
4.
Since reduced volume amplifications typically result in higher
sensitivity, adding too much sample can overwhelm the reaction
and lead to general over-amplification of the STR profile,
including increased artifacts and peak heights. Utilizing a 25–50%
bloodstained 1.2 mm punch has shown to be ideal for quarter-
volume reactions (~6 μL) for a variety of STR amplification kits
[17]. Utilizing a 50–75% bloodstained 1.2 mm punch, or a fully
stained 1.0 mm punch, will likely work well for half reactions
(~12–13 μL). The punch/stain size of buccal samples for reduced
volume amplifications should be assessed by individual
laboratories given their increased variability in yields (see Note
3).
5.
Equipment and workspaces are typically sterilized between
samples using 10% bleach and 70% ethanol. However, studies
have demonstrated that punching (and discarding) a
clean/unstained area of FTA paper in between samples is
sufficient for preventing the carryover of DNA from the punching
tool itself [18, 20]. Should a laboratory choose to implement this
practice, it would need to be assessed as part of their internal
validation. Regardless of the cleaning method used for the
punching tool, the punching mat must be decontaminated with
bleach and ethanol.
6. The reagent blank punch should be the same size as the sample
h Additi ll if t h d( f b l
punch. Additionally, if two punches are used (e.g., for buccal
samples), the reagent blank should also consist of two unstained
punches.
7.
Pipetting up and down can introduce bubbles; thus, extreme
caution must be taken not to get reagent bubbles onto/into the
shaft of the pipette within the pipette tip (if this happens, the
pipette must be taken out of commission until it can be
professionally serviced). Using a slow, steady pipetting technique
can prevent the formation of bubbles, but the use of aerosol-
barrier pipette tips is highly recommended to further protect the
pipette itself from contamination. Alternatively, aspirating a
volume greater than 100 μL with a larger pipette tip (e.g., using a
P1000 pipette set to 500 μL) will more efficiently remove the
reagent and any bubbles, as compared to exactly 100 μL, while
also preventing reagent bubbles from contacting the shaft of the
pipette.
8.
Delays in the removal of TE at this step can lead to excess leaching
of DNA from the FTA punch into the TE and may result in poor
amplification/STR profile development due to insufficient
amounts of DNA being retained on the punch.
9.
A second TE wash is necessary for reduced volume amplification
of bloodstains on FTA [17]. Failure to perform a second wash for
such samples leads to over-amplification and poor STR profiles. If
over-amplification is routinely seen in full-volume reactions of
bloodstains (or other combinations of reaction volumes and
sample types), a second TE wash should also be added.
10.
Alternatively, punches can be incubated at 56 °C for 10 min to
assist with drying [14].
11. DNA is retained on the FTA punch, but some also elutes into the
water. Generally, only the punch is STR amplified (additional Type
I water is added to the reaction to bring it up to the required
volume). However, both the punch and 5 μL water in which it was
initially resuspended (see Subheading 3.1, step 10) can be added
to the amplification reaction, if deemed necessary. Some
amplifications may be sensitive enough to generate STR profiles
from the water alone, without the punch. It is the laboratory’s
responsibility to validate the exact parameters for the
amplification of FTA-purified samples.
References
1. Butler JM (2012) Chapter 2: DNA extraction methods. In: Advanced topics in forensic DNA
typing: methodology. Elsevier Academic Press, Waltham
2. Burgoyne LA (1999) Solid medium and method for DNA storage. US Patent 5,985,327, 16
Nov 1999
3. Wong HY, Seng E, Lim S et al (2012) Amplification volume reduction on DNA database
samples using FTA™ classic cards. Forensic Sci Int Genet 6(2):176–179. https://doi.org/10.
1016/j.fsigen.2011.04.008
[Crossref][PubMed]
4. Vun Onn Liew P, Riccardi LN, Afolabi AO et al (2018) Optimization of a reduced volume PCR
amplification for PowerPlex® Fusion kit using FTA cards and generation of population
genetic data for Brunei population. Electrophoresis 39(23):2979–2990. https://doi.org/
10.1002/elps.201800256
5. Corradini B, Alù M, Magnanini E et al (2019) The importance of forensic storage support:

DNA quality from 11-year-old saliva on FTA cards. Int J Legal Med 133:1743–1750. https://
doi.org/10.1007/s00414-019-02146-6
[Crossref][PubMed]
6. Millipore Sigma (2022) Reliable DNA extraction from Whatman® FTA® cards. Available
via Millipore Sigma. https://www.sigmaaldrich.com/US/en/technical-documents/
protocol/genomics/dna-and-rna-purification/whatman-reliable-extraction-of-dna.
Accessed 31 May 2022
7. Rahikainen A, Palo JU, de Leeuw W et al (2016) DNA quality and quantity from up to 16
years old post-mortem blood stored on FTA cards. Forensic Sci Int 261:148–153. https://
doi.org/10.1016/j.forsciint.2016.02.014
[Crossref][PubMed]
8. Miles M, Saul D (2019) Improved elution of DNA from Whatman FTA cards using prepGEM
and forensicGEM Universal extraction kits. MicroGEM. https://microgembio.com/m_
resource/improved-elution-of-dna-from-whatman-fta-cards-using-prepgem-forensicgem-
universal-extraction-kits. Accessed 04 Aug 2022
9. Burgos G, Flores-Espinoza R, Ruiz-Pozo VA, Villacrés Granda I (2019) Efficient preservation

of DNA extracted from blood in FTA cards by Chelex method. Forensic Sci Int Genet Suppl
Ser 7:539–541. https://doi.org/10.1016/j.fsigss.2019.10.082
[Crossref]
10. Tack LC, Thomas M, Reich K (2007) Automated forensic DNA purification optimized for
FTA card punches and Identifiler™ STR-based PCR analysis. Clin Lab Med 27(1):183–191.
https://doi.org/10.1016/j.cll.2006.12.009
11. Akane A, Matsubara K, Nakamura H et al (1994) Identification of the heme compound

copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of
polymerase chain reaction (PCR) amplification. J Forensic Sci 39(2):362–372
[Crossref][PubMed]
12. Al-Soud WA, Rå dströ m P (2001) Purification and characterization of PCR-inhibitory

components in blood cells. J Clin Microbiol 39(2):485–493. https://doi.org/10.1128/JCM.
39.2.485-493.2001
13. Sidstedt M, Hedman J, Romsos EL et al (2018) Inhibition mechanisms of hemoglobin,

immunoglobulin G, and whole blood in digital and real-time PCR. Anal Bioanal Chem
410:2569–2583. https://doi.org/10.1007/s00216-018-0931-z
14. Qiagen (2021) QIAcard® FTA® product sheet. Available via Qiagen. https://www.qiagen.
com/us/resources/resourcedetail?id=8fe3936f-4948-487a-8a1e-35d92776cdba&lang=en.
Accessed 31 May 2022
15. Parsons L, Bright J (2012) A manual and automated method for the forensic analysis of
DNA from buccal samples on Whatman indicating FTA elute cards. Aust J Forensic Sci
44(4):393–402. https://doi.org/10.1080/00450618.2012.693949
16. Srisiri K, Jaroenwattana R, Panvisavas N et al (2017) Optimisation of DNA recovery and

analysis of urine samples stored on FTA® card. Forensic Sci Int Genet Suppl Ser 6:e520–
e522. https://doi.org/10.1016/j.fsigss.2017.09.206
17. Connon CC (2022) Developing effective and sustainable teaching labs for forensic DNA
courses. In: Proceedings of the American Academy of Forensic Sciences 74th Annual
Scientific Conference, Seattle, 2022
18. Smith LM, Burgoyne LA (2004) Collecting, archiving and processing DNA from wildlife
samples using FTA® databasing paper. BMC Ecol 4:1–11. https://doi.org/10.1186/1472-
6785-4-4
19. Moran N, Tatnell P (2016) Identification of colored dyes that are resistant to fading on
exposure to ethylene oxide; use with indicating FTA™ sample collection cards. J Forensic Sci
Med 2(2):67–73. https://doi.org/10.4103/2349-5014.184191
[Crossref]
20. Ogden SJ, Horton JK, Stubbs SL et al (2015) Performance testing of a semi-automatic card
punch system, using direct STR profiling of DNA from blood samples on FTA™ cards. J
Forensic Sci 60(S1):S207–S212. https://doi.org/10.1111/1556-4029.12622
Part III
DNA Quantification
https://doi.org/10.1007/978-1-0716-3295-6_9
9. Yield Gel via Quantitative Gel

Electrophoresis
Victoria R. Parks1 and Dayanara A. Torres1
Victoria R. Parks
Email: vrparks@vcu.edu
Abstract
Quantitative gel electrophoresis, also referred to as yield gel via gel
electrophoresis, is an early quantification method that was developed
to provide an estimate of the quality and the quantity of DNA extracted
from evidence or reference samples. To conduct quantitative gel
electrophoresis, an agarose gel that is combined with a nucleic acid gel
stain is prepared. The gel stain intercalates between double-stranded
DNA and can be visualized using UV light. DNA extract samples, along
with DNA standards (ranging from 250 to 5 ng), and a 1 KB ladder are
combined with a 6X loading dye and loaded on the agarose gel. Voltage
is applied to facilitate DNA migration through the gel from the negative
to the positive electrode, separating DNA fragments by size. After
electrophoresis is complete, the results are visualized using UV light,
and an image is captured for analysis. High-quality and -quantity DNA
should contain a compact band comparable to that of the high
molecular weight standards and ladder, with some smearing down the
sample well. If a DNA extract sample does not produce a compact band
and presents with only a smear, this is an indication that DNA
degradation has occurred. This chapter provides instructions on how to
successfully prepare an agarose gel, load DNA extract samples and
corresponding controls, appropriately set up and run quantitative gel
electrophoresis, interpret the results, and ensure comprehension of the
method so troubleshooting can be performed if needed.
Key words Yield gel – Quantitative gel electrophoresis – Forensic DNA

quantification – Agarose gel – DNA migration – GelRed® Nucleic Acid
Stain – Molecular sieve
1 Introduction
When processing biological evidentiary and known reference samples,
forensic scientists use the Federal Bureau of Investigation Quality
Assurance Standards (FBI QAS) to determine what steps should be
taken [1]. Samples are collected, the deoxyribonucleic acid (DNA) is
extracted and purified, followed by the quantification of evidence
samples. When necessary, reference samples may also be quantified.
The quantification step is imperative given that downstream
polymerase chain reaction (PCR) processing has a small input
concentration range of 0.5–2.0 ng DNA, so it is necessary to determine
the quality of the DNA and how much DNA is obtained [1, 2]. If too
much or not enough DNA is available, or if the DNA is degraded, then
the profile produced will be adversely affected [2].
One early method developed for quantification is quantitative gel
electrophoresis, also referred to as yield gel via gel electrophoresis.
This method utilizes an agarose gel that acts as a molecular sieve,
which separates DNA fragments by size, allowing for smaller fragments
to migrate faster than larger fragments [3]. During quantitative gel
electrophoresis, voltage is applied, which facilitates the migration of the
negatively charged DNA through the gel from the negative to positive
electrode. Larger DNA fragments will remain closer to where they were
loaded on the agarose gel, and smaller fragments will migrate through
the agarose gel, closer to the opposite end of the sample well. This
method is quick, inexpensive, and easy to learn and implement in the
laboratory, and it provides a crude estimate of DNA quantity and
quality. It is important to note that this method is not human-specific
and is a whole genomic quantification method [2, 4, 5].
The procedure outlined in this chapter is based on a quantitative gel
electrophoresis protocol utilized at Virginia Commonwealth University
[6]. DNA extract samples, DNA standards, and 1 KB ladders are
prepared and loaded on the agarose gel. All of these components are
combined with 6X loading dye, which consists of glycerol, bromophenol
blue, and ethylenediaminetetraacetic acid (EDTA) [7]. Glycerol adds
density to the samples and allows it to sink to the bottom of the well on
the agarose gel, preventing it from escaping into the buffer during
loading [3, 7]. Bromophenol blue provides a way to track DNA
migration during gel electrophoresis because it runs at approximately
the same rate as a 370 base pairs (bp) size fragment [7], which is much
smaller than the sample DNA (assuming it is not significantly
degraded). Bromophenol blue also provides color to the DNA extract
sample during preparation, which allows the scientist to visualize the
loading of the DNA extract samples into sample wells of the agarose gel
[3, 7]. Finally, EDTA inhibits nucleases that could break down DNA [7].
DNA standards, prepared and loaded on the agarose gel at the same
time as the DNA extract samples, are composed of varying
concentrations (commonly ranging from approximately 300 ng down to
5 ng) and are of known high-quality molecular weight [4, 5]. The DNA
standards used represent varying amounts, so the intensity of the DNA
standard bands will differ from each other [5]. The DNA standard band
intensity that is most akin to that of the DNA extract sample represents
a crude estimate of how much DNA the extracted sample contains,
allowing for the extrapolation of an estimated concentration [4, 5].
A molecular weight ladder which contains known base pair size
fragments is also loaded onto the agarose gel and is used to determine
if the sample is high quality. A DNA extract sample that contains high-
quality and high-quantity DNA should produce a compact band that is
comparable to that of the high molecular weight DNA standards and
ladder, with some smearing down the entire sample well [4, 5]. If a
sample presents without a high molecular weight compact band and
only a smear that runs along the entire gel sample well is observed, this
is an indication that the DNA has degraded; the DNA is no longer in a
whole genome form but broken into smaller fragments [4, 5]. If
downstream processing were performed, this could adversely affect the
results produced.
To visualize the gel electrophoresis results, a fluorescent nucleic
acid gel stain is added directly to the agarose during preparation. The
fluorescent gel stain intercalates, or inserts, between all double-
stranded DNA (dsDNA) in any part of the genome. This technique is
different from the current real-time quantitative PCR method, in which
primers facilitate the amplification of targeted human DNA fragments.
An intercalating dye or probe marker is then used to detect and
quantify only the targeted human DNA fragments [2]. Traditionally,
ethidium bromide (EtBr) was used for detection [4, 5]; however, this
reagent is considered toxic and a mutagen [8], so safer and more
sensitive alternatives—such as GelRed® Nucleic Acid Stain (GelRed®
stain; Biotium, Fremont, CA)—have been developed. The GelRed® stain
cannot penetrate the cell membrane or bind to DNA in living cells, and
it is non-mutagenic [9]. The fluorescent nucleic acid gel stain
intercalates between any dsDNA during electrophoresis and is
visualized using ultraviolet (UV) light after electrophoresis is complete.
An image of the agarose gel is captured after applying appropriate
filters, ensuring that the best image with clear bands is shown [4]. The
results are then interpreted to estimate the quality and quantity of
DNA.
2 Materials
2.1 Agarose Gel Equipment and Supplies
1.
Gel Rig: tray, combs, buffer tank, and lid with attached power
supply leads.
2.
Gel Imaging System: There are numerous imaging systems
available; this protocol describes use of the Gel Imaging UVP
Transilluminator System.
2.2 Agarose Gel Reagents

1.
Agarose: Store at room temperature.
2.
1 KB DNA ladder: Store at −20 °C.
3. Nucleic acid gel stain: Keep out of light.
4.
Human genomic DNA standard: Store stock and prepared serial
dilutions of DNA standard at −20 °C. Serial dilutions of DNA
standard are prepared with 1X Tris-EDTA (TE).
5.
1X Tris-acetate-EDTA (TAE): Store at room temperature.
6.
6X loading dye: prepare by combining 0.02 g Bromophenol Blue,
10 mL Glycerol, 4 mL 0.5 M EDTA, and 6 mL sterile 1X Tris-EDTA
(TE) buffer (pH 7.5). Mix well and divide into 1 mL aliquots. Store
aliquots at −20 °C.
3 Methods
This quantitative gel electrophoresis method is optimized for use with
DNA extract samples that contain dsDNA after extraction is complete
(see Note 1). When quantifying the dsDNA extract samples, ensure to
also quantify all corresponding controls associated with the samples,
including reagent blank(s). To prevent contamination of gloves and
other samples, ensure that only one tube is open at a time and that the
tubes are properly handled. Do not touch the tube by the inside of the
cap or reach over open tubes. Verify that the appropriate pipette and
corresponding tips are being used at each step. Confirm the correct
settings on the pipette to ensure that the appropriate volume is being
used. Tips should be changed after each new reagent or sample
addition to prevent contamination. Carry out all procedures at room
temperature unless otherwise specified.
3.1 Agarose Gel

1.
Prepare a 1% agarose gel in an Erlenmeyer flask by mixing
agarose with TAE buffer (see Notes 2 and 3).
2.
In a microwave, heat the agarose preparation in small increments
to solubilize the agarose (see Notes 4 and 5).
3. Using insulated gloves, carefully remove the Erlenmeyer flask
4. from the microwave.
Let the flask cool at room temperature until the bottom of the
flask can be handled without insulated gloves (approximately 50–
55 °C). To ensure even cooling, gently swirl the agarose solution
approximately every 2 min (see Note 6).
5.
While the agarose solution is cooling, prepare the gel casting tray
(see Note 7).
6.
Place gel electrophoresis combs in the notches of the prepared gel
casting tray (see Note 8 and Fig. 1).
7.
Once the Erlenmeyer flask can easily be handled without
insulated gloves (approximately 50–55 °C), add a nucleic acid gel
stain to the cooled agarose solution, swirl to create a homogenous
mixture, and pour immediately into the prepared casting tray. Be
careful to avoid the formation of bubbles (see Notes 9 and 10).
8.
Leave the casting tray at room temperature to allow the agarose
solution to solidify. It can take approximately 30 min for the
agarose gel to solidify, and it will appear opaque instead of clear
when it is ready for use.
9.
Once the gel has solidified, carefully remove the comb(s) by
slowly pulling it straight up and out of the gel, leaving empty wells
into which samples will be loaded (see Note 11).
10.
If using a gasketed casting tray, carefully remove the casting tray
from the bottom of the tank. If using a non-gasketed tray, remove
the tape from the casting tray. Re-orient the tray so that the
sample wells of the gel are located near the negative electrode
(cathode, −) on the buffer tank. This is the appropriate orientation
for electrophoresis within the gel rig (see Note 12; Fig. 2).
11. Gently pour 1X TAE buffer until the gel and sample wells are
completely covered. Start by adding 1X TAE buffer to the empty
area of the buffer tank; continue to add until the buffer level is
only a few millimeters above the gel, scarcely covering the sample
ll Th 1X TAE b ff h ld b d di l h
wells. The 1X TAE buffer should not be poured directly onto the
gel (see Fig. 2).
Fig. 1 Gel rig casting tray. The casting tray is arranged in the buffer tank before the cooled
agarose gel with GelRed® Nucleic Acid Stain is added. The silicone rubber gasket is lined up
against the buffer tank wall, forming a tight seal ensuring that the cooled agarose gel does not
leak when poured into the gel tray. Combs with 20 teeth (approximately 1.5 mm thick) are
placed towards the top of the agarose gel. (a) The casting tray configuration in the buffer tank is
shown so that the gasket side of the gel tray is visible. (b) The casting tray configuration in the
buffer tank is shown from the top, looking down on the gel rig
Fig. 2 Prepared gel rig with samples. The agarose gel is oriented so that the sample wells of the
gel are located near the negative electrode (cathode, −) on the buffer tank, which is the
appropriate orientation for electrophoresis within the gel rig. This agarose gel had two combs
added so a total of 40 wells were produced. The buffer tank is filled with 1X TAE buffer until the
agarose gel and sample wells are completely covered (a few millimeters above the wells of
agarose gel), then the 1 KB ladder/loading dye, standard/loading dye, and DNA extract
sample/dye mixtures are loaded on the agarose gel. Empty wells are also observed on the
agarose gel
3.2 DNA Standard Preparation

1.
Prepare six DNA standards (250 ng, 125 ng, 60 ng, 30 ng, 15 ng,
and 5 ng) via serial dilution in sterile microcentrifuge tubes (see
Note 13). Use Table 1 below as an example of how to prepare the
DNA standards.
2.
Thaw the stock human genomic DNA standard tube at room
temperature. The human genomic DNA standard is considered
thawed when the liquid appears clear and free from solid reagents
floating in the tube. Vortex the human genomic DNA standard
before starting the dilution series (see Notes 14 and 15).
3. Ensure to vortex and centrifuge each newly prepared standard tube
thoroughly before making the next standard.
4.
Prepare all standards first, then add the 6X loading dye (1 μL of 6X
loading dye for every 5 μL of DNA standard) to the appropriate
DNA standard tube and mix thoroughly. Before use, gently vortex
the 6X loading dye and quick-spin in a mini-centrifuge to spin down
any condensation that may have formed (see Notes 16).
5.
Store prepared DNA standards at −20 °C for no longer than
approximately 5 days. Also, ensure to limit freeze-thaw events to
less than four times (see Note 15).
Table 1 Example DNA standard preparation table
DNA Volume of DNA Volume of Volume of 6X loading

standard TE dyea
250 ng 50 μL of stock human genomic 50 μL 10 μL
DNA
(Concentration: 100 ng/μL)
125 ng 50 μL of 250 ng std 50 μL 10 μL
(50 ng/μL)
(25 ng/μL)
(12.5 ng/μL)
(6.25 ng/μL)
(3.125 ng/μL)
aPrepare all DNA standards first, then add specified amount of 6X
loading dye to tube

This table provides step by step instructions to prepare DNA standards
that will be loaded on the agarose gel and used to determine how much
DNA the extract samples contain. The stock human genomic DNA
concentration should be confirmed before beginning the serial dilution.
For this example, the stock genomic DNA concentration was verified to
be 100 ng/μL. The DNA standards range from 250 to 5 ng and are
prepared using a serial dilution. The table lists examples of DNA and TE
volumes that could be used to make each standard. Prepare all DNA
standards first, then add the specified volume of 6X loading dye to the
corresponding tube (add 1 μL of 6X loading dye for every 5 μL of DNA
standard). DNA standards prepared utilizing this table will produce
enough product for all standards (6 μL of each DNA standard) to be
loaded on approximately six to eight gel runs. Store prepared standards
at −20 °C for no longer than approximately 5 days. Also, ensure to limit
freeze-thaw events to less than four times
3.3 Sample and Control Preparation

1.
Prepare DNA extract samples and 1 KB DNA ladder to be loaded on
the agarose gel. Gently vortex and quick-spin the DNA extract
samples, 1 KB ladder, and 6X loading dye in a mini-centrifuge to
spin down any condensation that may have formed.
2.
Ladder: combine 4 μL of 6X loading dye and 1 μL of 1 KB ladder in a
new microcentrifuge tube. If adding more than one 1 KB ladder to
the gel, multiply the component volumes (6X loading dye and 1 KB
ladder) by the number of 1 KB ladders to be added to the gel (see
Notes 16 and 17).
3.
DNA extract samples (and controls): add 3 μL of 6X loading dye to
an appropriately labeled and empty microcentrifuge tube for each
DNA extract, including the extraction controls (see Note 16). Using
a new pipette tip for each sample (or control), add 15 μL of DNA
extract sample (or control) to the corresponding appropriately
labeled microcentrifuge tube. Gently mix up and down two to three
times to mix the sample with 6X loading dye.
4.
Quick spin all samples and controls to remove bubbles.
3.4 Loading on Agarose Gel and Electrophoresis

1. Load 5 μL of 1 KB ladder/loading dye mixture onto the agarose gel
by carefully dispensing the mixture into one individual well. Add
one 1 KB ladder/loading dye mixture per well and change the
pipette tip after each addition (see Notes 17–19; Fig. 2).
2.
Load 6 μL of each known DNA standard/loading dye mixture
(250 ng, 125 ng, 60 ng, 30 ng, 15 ng, and 5 ng) onto the gel. It is
suggested that DNA standards are loaded in order from largest to
smallest concentration. This should be done one DNA standard at a
time, making sure to add one DNA standard mixture per well and to
change the pipette tip after each addition (see Notes 18 and 19).
3.
Load 18 μL of each DNA extract sample (or control)/loading dye
mixture onto the gel by carefully dispensing each sample (or
control) into an individual well. This should be done one sample at
a time, making sure to change the pipette tip after each sample
addition (see Notes 18 and 19).
4.
Prepare the gel rig and power supply for electrophoresis by
covering the gel rig with the lid containing attached black and red
power supply leads. Connect the black cable (cathode, −) to the
negative electrode (cathode, −) of the gel rig, located near the
sample wells of the gel. Connect the red cable (anode, +) to the
positive electrode (anode, +), located at the opposite end of the gel
rig. Plug the other ends of the black and red cable leads to the
power supply box, ensuring that the color of the power supply lead
connects to the corresponding power supply location (see Fig. 3).
5.
On the power supply box, set the run time and voltage (V). Select
“Run/Start” to start gel electrophoresis (see Note 20).
6.
Check to confirm that small bubbles form near the negative
electrode (cathode, −) of the gel rig. This indicates that the current
is flowing properly and electrophoresis has started successfully
(see Fig. 4).
7.
Use the dye front migration to determine if the gel needs to run
longer. Make sure the dye front does not run off the gel (see Note
20 and Fig. 5).
8. After the quantitative gel electrophoresis run is complete, stop the
gel run by pressing the power button on the power supply box
gel run by pressing the power button on the power supply box,
disconnect the cables, and remove the lid. Carefully remove the
casting tray with the agarose gel and set the tray on a flat surface
while preparing the gel imaging UVP transilluminator system (UV
transilluminator) (see Note 21).
Fig. 3 Complete gel rig and power supply. The gel rig is set up for electrophoresis. The buffer
tank is filled with 1X TAE buffer until the agarose gel and gel sample wells are completely
covered (a few millimeters above the wells of agarose gel). The agarose gel is oriented so that
the sample wells are located near the negative electrode (cathode, −). The 1 KB ladder/loading
dye, standard/loading dye, and DNA extract sample/dye mixtures are loaded on the agarose gel.
The buffer tank is covered with a lid containing attached power supply leads. The black power
supply lead connects to the negative electrode (cathode, −). The red power supply lead
connects to the positive electrode (anode, +). The other ends of the power supply leads are
connected to the power supply box, ensuring that the color of the power supply lead connects
to the corresponding power supply location. The power supply box is turned on. The suggested
time (75 min) and voltage (120 volts) are set for the quantitative gel electrophoresis run
Fig. 4 Gel rig with bubbles. The quantitative gel electrophoresis setup is complete. The lid
containing attached power supply leads is connected to the gel rig and the other end of the
power supply leads are plugged into the power supply box. The power supply box is on, and
electrophoresis has started. Bubbles form near the negative electrode (cathode, −) wire inside
the buffer tank, which is located towards the back of the gel rig, near the sample wells of the gel.
As the run continues, a smaller number of bubbles also form near the positive electrode (anode,
+) wires, which are located near the front of the gel rig. The formation of bubbles indicates that
the current is flowing properly, and electrophoresis has started successfully
Fig. 5 Yield gel dye front. During electrophoresis, samples migrate from the negative electrode
(cathode, −) to the positive electrode (anode, +). To track migration, the 1 KB ladder, DNA
standards, and DNA extract samples are combined with 6X loading dye, which migrates at
approximately the same rate as a 370 bp-sized DNA fragment. The gel sample wells that are
closest to the negative electrode (cathode, −) are empty because the DNA extract samples and
controls have migrated through the agarose gel. In this example, samples were not loaded in the
bottom row of wells, so dye front migration from this row is not observed. Bubbles are
observed near the electrode wires because electrophoresis is occurring
3.5 Capture Gel Image

1.
Ensure that an appropriate SD card is inserted into the UV
transilluminator (see Fig. 6).
2.
Power on the UV transilluminator and wait for the image preview
screen to complete the process check. The screen on top of the UV
transilluminator instrument will appear blank when the UV
transilluminator is ready for use (see Fig. 6).
3. Open the UV transilluminator door and turn ON the white light
switch at the top of the instrument (see Fig. 6).
4.
Lightly wet a dry lab cleaning wipe with reverse osmosis water
(RO), distilled water (dH2O), or double distilled water (ddH2O)
and wipe the inside platform of the UV transilluminator.
5.
To the middle of the UV transilluminator platform, add
approximately a quarter-sized amount of RO, dH2O, or ddH2O, and
place the agarose gel onto the water, with the sample well
openings and bands facing upwards towards the top of the
instrument (see Note 22).
6.
Confirm that the gel is centered and that there are no bubbles
present under the gel. To remove any bubbles, reposition the gel
by sliding it around the UV transilluminator platform (see Note
23).
7.
Switch off the white light and close the instrument door. Switch on
the UV power light and ensure that the appropriate wavelength
for the agarose gel is selected (see Note 24; Fig. 6).
8.
Observe the agarose gel fluorescence by opening the instrument’s
UV-blocking viewing window (see Fig. 6). Close the UV-blocking
viewing window after evaluating the gel.
9.
Prior to capturing the gel image, press the “Live” button on the UV
transilluminator instrument screen. This will display the gel on
the UV transilluminator screen in real time.
10. On the screen, verify that all bubbles have been removed and the
entire gel is being captured. If any bubbles are present or the
location of the gel needs to be adjusted, turn off the UV light, and
open the UV transilluminator door. Remove any bubbles by sliding
the agarose gel around the UV transilluminator platform or
reposition the agarose gel in the center. Close the UV
transilluminator door, turn on the UV power light, and press the
“Live” button. Again, verify the entire gel is being captured on the
screen and all bubbles have been removed (see Note 25).
11.
Press the “+” button to increase the exposure of your gel in the
image preview screen. The normal exposure is between 0.400 and
0.600 s. The gel in the image preview screen is properly exposed
when the ladder and sample bands appear clear and focused, in
addition to the bands being clearly distinct from the background.
12.
Press the “Capture” button, and then press the “Save” button. This
will save the gel image onto the SD card.
13.
Print the gel image.
Fig. 6 UV transilluminator. A suggested imaging system, BioDoc-It™ Gel Imaging System UVP
Transilluminator was utilized as an example for this protocol. (a) UV transilluminator is turned
on with the preview screen shown after the process check is complete. The SD card is used to
save the final gel image. The top of the UV transilluminator contains the white light and power
switch. The UV power light and wavelength setting switch can be found at the bottom of the UV
transilluminator. The UV-blocking viewing window is closed. (b) The door of the UV
transilluminator is open, indicating where the agarose gel should be placed in the middle of the
platform. (c) Top of the UV transilluminator showing the location of the white light and power
switch, the preview screen, and control panel. (d) Bottom of the UV transilluminator, showing
the UV power light switch, the wavelength setting button (302 nm or 365 nm), and the closed
UV blocking viewing window. (e) UV transilluminator with the UV blocking viewing window
open, allowing for review of the agarose gel without opening the instrument door
3.6 Data Interpretation
1.
Label wells of the gel image with DNA extract sample, DNA
standards, and 1 KB ladder names (see Note 19).
2.
Document whether each DNA extract sample produced a band or
not, then determine the DNA extract sample bands’ approximate
size in base pairs by comparing them to the 1 KB ladder (see Note
26 and Fig. 7).
3.
Assess the quality of the DNA extract sample. High quality DNA
extract samples are not degraded, and will produce a compact band
that migrates similar to that of the high molecular weight DNA
standards and ladder. The compact band should be observed
towards the top of the gel, close to the sample loading wells. Some
smearing in the sample lane will also be present. If the DNA extract
sample is degraded and of poor quality, only a smear with NO
visible band towards the top of the gel will be observed (see Note
26 and Fig. 7).
4.
To estimate the quantity (ng) of DNA present in each DNA extract
sample well, visually compare the thickness and brightness of the
band to those of the DNA standards. The DNA standard that is the
most akin to the DNA extract sample band corresponds to an
estimate of that DNA extract sample amount. Interpolations may be
necessary if the DNA extract sample band appears to be an amount
that is between two standards (see Notes 27 and 28).
5.
To determine DNA concentration (ng/μL), divide the amount of
DNA (ng) (see Subheading 3.6, step 4) by the volume of DNA
loaded on the gel (15 μL) (see Note 29).
6.
To determine total DNA yield (ng), multiply the sample
concentration (ng/μL) (see Subheading 3.6, step 5) by the final
elution volume obtained at the end of extraction (see Note 30).
Fig. 7 Yield gel results. The image above is an example of a yield gel obtained after
electrophoresis has concluded. The gel was stained with the GelRed® stain. Wells 1–7 contain a
1 KB DNA ladder and DNA standards. All standards are high quality with compact bands and
some smearing down the sample well. Wells 8–18 contain DNA extract samples or reagent
blanks. Wells 19 and 20 are empty and not labeled. Thermo Scientific™ 1 KB DNA ladder
identifying the base pair size for each fragment can be used to determine the 1 KB ladder bands
on the agarose gel (Thermo Scientific™ Gene Ruler™ 1 KB DNA ladder is the copyright property
owned by Life Technologies Corporation, a part of Thermo Fisher Scientific Inc. (Reproduced
from Ref. [13] with permission from Thermo Fisher Scientific)
4 Notes
1.
Make sure to verify that the method used for extraction produces
dsDNA as the final product. If samples are extracted utilizing a
method that produces single-stranded DNA (ssDNA), then reliable
quantification results will not be obtained using this quantitative
gel electrophoresis method. The fluorescent nucleic acid gel stain
functions by inserting, or intercalating, between the dsDNA to
produce optimal quantification results.
2. For quantitative gel electrophoresis, the whole genome or larger
DNA fragments are being targeted, so a lower agarose
concentration (1%) is ideal. If the agarose concentration is
increased (for example, to 2%), the pore size will decrease,
allowing for better separation of smaller fragments [3]. If DNA
fragments are smaller than 100 bp then it is recommended that a
fragments are smaller than 100 bp, then it is recommended that a
polyacrylamide gel is used because it allows for better resolution
of the smaller fragments [3].
3.
If a casting tray with an approximate length of 14 cm and width of
12 cm is utilized, then a 1% agarose gel can be prepared by
mixing 1.75 g of agarose with 175 mL of TAE buffer. Various gel
rigs with varying casting tray sizes are available. Ensure to
calculate the appropriate volumes needed to create a 1% agarose
gel for the gel rig being utilized. The length of the casting tray
mentioned in this example will create an agarose gel that is long
enough to allow for two rows of samples to be loaded (see Fig. 2).
4.
It is suggested that the initial microwave time should be a total of
approximately 1 min, divided into two 30-s increments. A
potential consequence of prolonged microwaving is that the
agarose preparation can boil over the top of the Erlenmeyer flask.
To limit this, firmly cover the top of the Erlenmeyer flask with a
paper towel or other available dry lab cleaning wipes.
5.
The agarose preparation is considered solubilized when the
solution appears clear. Use an insulated glove to remove the
Erlenmeyer flask from the microwave. If the solution appears
cloudy, that indicates that the solution is not solubilized. Continue
to heat the solution in 30-s increments and swirl to mix and melt.
Repeat until the agarose goes completely into the solution and
appears clear.
6.
While the agarose is cooling, it is important to swirl the agarose to
prevent uneven cooling. If the agarose is too hot when it is poured
into the gel casting tray, it can warp the casting tray and damage it
for future use. If the agarose is allowed to overcool, it will begin to
solidify in the Erlenmeyer flask. The agarose would then need to
be reheated and appropriately cooled before being poured into
the casting tray.
7. Gel casting trays (which hold the gel) are available with or
without silicone rubber gaskets on the sides. If utilizing a
gasketed gel tray, place the tray in the buffer tank so the gasket
id f th t li i t th b ff t k ll d t
side of the tray lines up against the buffer tank walls and creates a
tight seal (see Fig. 1). It may be necessary to run the gasket side of
the gel tray under deionized water so the tray can more easily
slide into place within the gel buffer tank without the silicone
rubber gasket slipping out. If the gel tray is not gasketed,
laboratory tape can be used to form a tight seal around the gel
tray. Ensure that the tape forms a tight seal around the bottom of
the gel tray and that the tape is high enough around the open ends
of the gel tray. This will ensure that the agarose will not leak out of
the bottom or over the top of the tape. Place the taped gel tray on
a flat surface and not into the buffer tank before adding the cooled
agarose. Continue to follow the instructions outlined in
Subheading 3.1, and remember to remove the laboratory tape
before placing the gel tray with the solidified agarose gel in the
buffer tank.
8.
The gel rig utilized will determine the length of the agarose gel
produced and the number of gel electrophoresis combs that can
be placed on the gel. Various-sized combs are available for gel
electrophoresis. Ensure to use the appropriately sized comb,
which will produce wells that allow for the entire sample amount
to be loaded into the well of the agarose gel. This will help to
produce results with optimal resolution, where DNA bands are
sharp and bright. The width and depth of the wells created by the
combs determine how much sample volume can be loaded on the
agarose gel [10]. The width of the comb also affects the resolution
of the bands. Thin wells can produce sharper bands but allow for
less sample volume to be added. Thick wells allow more sample
volume to be loaded on the agarose gel, but the bands produced
will be broader and the resolution will not be as sharp [10].
9. One available nucleic acid stain is the GelRed® Nucleic Acid Stain
(GelRed® stain), which is utilized to help visualize DNA on the
agarose gel. Other nucleic acid gel stains may be available and can
be substituted. Traditionally, ethidium bromide was utilized;
however, this is a known carcinogen and mutagen. Appropriate
precautions, including wearing personal protective equipment
(PPE) should be taken [8]. GelRed® stain and other nucleic acid
i id d f d ii l i If
stains are considered safer and more sensitive alternatives. If
GelRed® stain is utilized, ensure to add 1 μL of GelRed® stain for
every 10 mL of agarose solution prepared. If utilizing another
nucleic acid gel stain, ensure to abide by manufacturer
instructions.
10.
If bubbles form while pouring the agarose solution into the
casting tray, use an unfiltered pipette tip to pop them. Make sure
to remove all of the bubbles because they could interfere with the
sample run and distort results.
11.
If the comb(s) is removed before the agarose gel is solidified, the
wells will collapse, and a new agarose gel will need to be
prepared.
12.
To confirm which side of the buffer tank is the negative electrode
(cathode, −) and positive electrode (anode, +), place the lid with
attached power supply leads on top of the buffer tank. The black
power supply lead connects to the negative electrode (cathode, −),
which, if oriented correctly, should be the electrode on the top
right-hand corner of the gel rig. Make sure to orient the sample
wells of the agarose gel towards the negative electrode (cathode,
−) before loading samples. DNA is negatively charged and will
migrate towards the positive electrode (anode, +). If the agarose
gel is incorrectly oriented when placed in the buffer tank, then the
samples will run in the wrong direction or the samples will be lost
due to immediately running off the agarose gel. Quantitative gel
electrophoresis will need to be restarted.
13.
A serial dilution is when the DNA standards undergo a series of
dilutions (six for this protocol) from a higher to a lower
concentration (250–5 ng), utilizing a predetermined dilution
factor throughout the process to decrease the concentration.
Table 1 provides an example of how to prepare the DNA standard
serial dilution. Based on laboratory requirements, the volumes
needed could vary. Ensure to recalculate volumes for each
standard dilution accordingly.
14. One available human genomic DNA standard is the Promega™
H G i DNA G3041 S d d O h h i
Human Genomic DNA G3041 Standard. Other human genomic
standards may be available and can be substituted. Verify the
starting stock concentration for the chosen standard by
quantification (for example, real-time PCR or UV-Spectrometry)
before preparing the serial dilution necessary for quantitative gel
electrophoresis.
15.
Avoid multiple or unnecessary DNA standard freeze-thaw events.
This can degrade the DNA standards, which will have an adverse
effect on the quantification results. Ensure to only thaw the DNA
standards if intending to use them shortly thereafter. Glycerol can
be added during DNA standard preparation (50% glycerol + 50%
ddH2O) to facilitate DNA stability and limit DNA degradation [11,
12]. Glycerol helps to ensure that the prepared DNA standards do
not freeze entirely at −20 °C, thereby reducing the likelihood of ice
crystal formation, which could shear and degrade the DNA
standards [11, 12].
16.
6X loading dye consists of glycerol, bromophenol blue, and EDTA
[7]. If 6X loading dye is added to the stock human genomic DNA
standard tube, stock 1 KB ladder, or DNA extract sample tube,
then those controls or samples cannot be used for further
processing (for example, amplification, additional quantification).
Adding 6X loading dye to any sample or stock control tube will
inhibit downstream processing.
17.
A minimum of two 1 KB ladders should be loaded on each row of
the quantitative gel electrophoresis. It is suggested to load one
ladder in the first well before adding any samples or DNA
standards and one in the last well after all DNA extract samples
have been added to the agarose gel. If a large number of DNA
extract samples will be loaded on the agarose gel, then additional
ladders can be added as needed.
18. When adding extract samples or controls to the agarose gel,
ensure that the bottom of the gel is not punctured with the pipette
tip. Stop if the tip touches the bottom of the gel. Pull the pipette
tip up slightly, but not out of the well, and slowly dispense the
sample Ensure to only press down to the “first” stop on the
sample. Ensure to only press down to the first stop on the
pipette when dispensing the sample. Do not press down to the
“second” stop of the pipette because that can create bubbles and
push the sample/loading dye mixture out of the well. Confirm that
the sample/loading dye mixture is in the well and does not escape
into the buffer before proceeding. If the sample/loading dye
mixture is inadvertently pushed out of the well and escapes into
the buffer, load a new aliquot of that sample/loading dye mixture
into the next available well. Document the affected well to ensure
it is not analyzed on the gel image.
19.
Document the well location of each DNA extract sample, DNA

standard, and 1 KB ladder added to the agarose gel. One
possibility of how to load samples and controls on the agarose gel
is to add the 1 KB ladder into the first well of the gel, followed by
DNA standards (from the highest to lowest concentration), and
then DNA extract samples. The last component added should be
another 1 KB ladder. If following the suggested loading order, well
numbering can be recorded from left to right, in consecutive
order, with the top left well into which the first 1 KB ladder is
added being considered “well 1.” This information is used to
identify the location of each DNA extract sample or control on the
gel image.
20. The suggested gel electrophoresis time for this protocol is
approximately 75 min and a voltage of 120 V. The dye front is used
to track DNA migration during gel electrophoresis. It is
recommended that the dye front migrate approximately three
quarters of the way through the agarose gel. The 6X loading dye
contains bromophenol blue, which migrates at approximately the
same rate as a 370 bp size fragment. Note that other dyes with
varying migration rates may be available and can be substituted.
The dye should travel far enough to ensure that the 1 KB ladder
and DNA fragments separate sufficiently enough to analyze. If the
quantitative gel electrophoresis does not run long enough, then
the 1 KB ladder and DNA extract sample separation will not be
sufficient to interpret results correctly. If the quantitative gel
electrophoresis runs too long then the 1 KB ladder fragments and
electrophoresis runs too long, then the 1 KB ladder fragments and
DNA extract samples could be lost due to it migrating off the
agarose gel or into the next sample row, if more than one row was
set up on a single agarose gel. Time and voltage can be increased
or decreased, if needed. Increasing the voltage can allow the DNA
to migrate through the agarose gel faster, but voltage that is too
high can cause the agarose gel to melt. Decreasing the voltage can
allow for better separation of DNA fragments but takes longer to
complete the quantitative gel electrophoresis run.
21.
One available UV transilluminator that is used as an example in
this protocol is the BioDoc-It™ Gel Imaging System UVP
Transilluminator, manufactured by Thermo Fisher Scientific.
Other UV transilluminators are available and can be substituted.
Ensure to abide by manufacturer instructions and laboratory
standard operating procedures (SOP).
22.
Avoid placing the agarose gel on the UV transilluminator upside
down. The well openings should not face the bottom of the UV
transilluminator but should face up towards the top. If the agarose
gel is placed upside down on the UV transilluminator, then the
image captured will show the results of the agarose gel in reverse
order from how it was documented and added to the agarose gel.
It will make interpreting results extremely difficult, likely
resulting in errors.
23.
If bubbles are observed under the gel and not removed, they will
appear as bright spots on the instrument’s image preview screen,
which could obstruct the data and make interpreting results
difficult.
24.
Standard agarose gels often use 302 nm wavelength. Use caution
and verify the appropriate UV setting. An incorrect setting could
damage the DNA and result in poor gel images.
25. The UV light will automatically turn off when the door of the
BioDoc-It™ Gel Imaging System UVP Transilluminator is opened.
Not all UV transilluminators have this feature, so if a different UV
transilluminator is substituted for this process, be sure to review
h i l dl b SOP fi
the instrument manual and laboratory SOP to confirm
appropriate steps pertaining to UV function and safety.
26.
Example to interpret data for Sample 1 (see Fig. 7): make sure to
use the 1 KB ladder that is closest in proximity to the DNA extract
sample band. Sample 1 quality and size (bp) is determined to be
high quality because a compact band is observed at “>10,000 bp”
with some smearing down the sample well.
27.
Example to interpret data for Sample 1 (see Fig. 7): To
determining the quantity (ng) of DNA, Sample 1 was visually
compared to all DNA standards (250 ng, 125 ng, 60 ng, 30 ng,
15 ng, and 5 ng) to determine an estimated amount of DNA in the
well of Sample 1. This sample produced a compact band that is
comparable to 30 ng.
28.
The DNA standard quantity used for this protocol ranges from
250 to 5 ng. The smallest estimate of DNA quantity that can be
determined is 5 ng. Samples that appear to have a slight compact
band indicating that DNA could be present, but less than 5 ng of
DNA, should be documented as “<5 ng” of DNA, not zero.
29.
Example to interpret data for Sample 1 (see Fig. 7): The
concentration (ng/μL) of Sample 1 is determined by dividing the
quantity of Sample 1 (30 ng) by the volume of Sample 1 loaded on
the agarose gel (15 μL). Ensure that the volume corresponds to
only the amount of Sample 1 loaded on the gel. Do not include the
total volume of Sample 1/loading dye mixture (18 μL) that was
loaded on the gel. The concentration is determined to be 2 ng/μL.
30.
Example to interpret data for Sample 1 (see Fig. 7): The total DNA
yield (ng) is determined by multiplying Sample 1 concentration
(2 ng/μL) by the final elution volume obtained at the end of
extraction (for this example the final elution volume was 100 μL
but can vary based on extraction method performed. Ensure to
use the appropriate final elution volume for this calculation). The
total DNA yield is determined to be 200 ng.
References
testing laboratories. Available via Federal Bureau of Investigation. https://www.fbi.gov/
file-repository/quality-assurance-standards-for-forensic-dna-testing-laboratories.pdf/
view. Accessed 3 Feb 2022
2. Butler JM (2012) DNA Quantitation. In: Advanced topics in forensic DNA typing:
methodology. Academic/Elsevier, Waltham, Massachusetts
3. Lee PY, Costumbrado J, Hsu C et al (2012) Agarose gel electrophoresis for the separation of
DNA fragments. J Vis Exp 62:1–5. https://doi.org/10.3791/3923
[Crossref]
4. Lee SB (2014) Advances in forensic DNA quantification: a review. Electrophoresis 45:3044–

3052. https://doi.org/10.1002/elps.201400187
[Crossref]
5. Baechtel FS (1989) The extraction, purification, and quantification of DNA. Proceedings of

the international symposium on the forensic aspects of DNA analysis. United States
Government Printing Office, Washington, DC
6. Connon CC (2022) DNA quantification #1: yield gel & UV spectrophotometry. In: FRSZ 438
Forensic Molecular Biology Lab. Virginia Commonwealth University—Department of
Forensic Science, Richmond
7. ThermoFisher Scientific (2022) Loading dyes and buffers. Available via ThermoFisher.
https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular-
biology/thermo-scientific-nucleic-acid-electrophoresis-purification/dna-electrophoresis-
thermo-scientific/loading-dyes-buffers.html#dyes. Accessed 9 Apr 2022
8. Sigma-Aldrich (2022) Ethidum bromide safety data sheet, Revision 6.2. Available via
Sigma-Aldrich. https://www.sigmaaldrich.com/US/en/sds/sigma/e7637. Accessed 3 Feb
2022
9. Biotium Safety Report for GelRed® and GelGreen® (2013) A summary of mutagenicity and
environmental safety test results from three independent laboratories for the nucleic acid
gel stains GelRed® and GelGreen®. Available via Biotium. https://biotium.com/wp-
content/uploads/2013/07/GelRed-and-GelGreen-Safety-Report.pdf. Accessed 3 Feb 2022
10. Lee SV, Bahaman AR (2012) Discriminatory power of agarose gel electrophoresis in DNA
fragments analysis. In: Magdeldin S (ed) Gel electrophoresis—principles and basics.
InTechOpen, London, pp 41–56. https://doi.org/10.5772/36891
[Crossref]
11. Schaudien D, Baumgä rtner W, Herden C (2007) High preservation of DNA standards diluted
in 50% glycerol. Diagn Mol Pathol 16:153–157. https://doi.org/10.1097/PDM.
0b013e31803c558a
[Crossref][PubMed]
12.
Rö der B, Frü hwirth K, Vogl C et al (2010) Impact of long-term storage on stability of
standard DNA for nucleic acid-based methods. J Clin Microbiol 48:4260–4262. https://doi.
org/10.1128/JCM.01230-10
13. Thermo Fisher Scientific (2019) GeneRuler 1 kb DNA Ladder. Available via Thermo Fisher
Scientific. https://assets.fishersci.com/TFS-Assets/LSG/manuals/MAN0013004_
GeneRuler_1kb_DNALadder_250ug_UG.pdf. Accessed 31 Jan 2022
https://doi.org/10.1007/978-1-0716-3295-6_10
10. Quantitative PCR of Alu Repeats

Using PowerUp™ SYBR® Green Master
Mix
Sierra L. Laveroni1 and Victoria R. Parks1
Sierra L. Laveroni
Email: laveronis@vcu.edu
Abstract
Quantitative PCR is one of the fundamental steps performed when
processing routine casework in a forensic laboratory. Quantitative PCR
of Alu repeats using a SYBR® Green master mix can produce calculated
estimates of how much DNA was extracted from a sample. This process
offers more efficiency, human specificity, and can be performed faster
than other outdated quantification methods, such as slot blot or yield
gel. A qPCR master mix is prepared and consists of Alu-F primers, Alu-R
primers, water, and SYBR® Green master mix. The Alu-F and Alu-R
primers target Alu sequences that are present hundreds of thousands
of times throughout the human genome and are effective markers for
human DNA quantification. During qPCR, the 7500 system facilitates
the amplification of target Alu repeats. The SYBR® Green I fluorescent
dye intercalates between the amplified dsDNA targets. During each
amplification cycle, the 7500 system agitates the SYBR® Green I dye,
resulting in a fluorescence signal that is recorded when it passes a
specified Ct value. After qPCR amplification is complete, a standard
curve is created and used to determine how much DNA a sample
contains. This chapter provides instructions on how to accurately
prepare a 96-well plate for qPCR, use the 7500 system and associated
software to set up the qPCR amplification, and interpret the
corresponding results produced.
Key words Quantitative PCR – PowerUp™ SYBR® Green Master Mix –

SYBR® Green I dye – 7500 Real-Time PCR instrument – SDS software –
Standard curve – Alu repeats
1 Introduction
The Federal Bureau of Investigation Quality Assurance Standards (FBI
QAS) mandate that evidentiary samples must be quantified to
determine the amount of human deoxyribonucleic acid (DNA) present
prior to downstream processing, including amplification and short
tandem repeat (STR) profile analysis [1]. The accuracy and reliability of
this step is an integral part of obtaining a full STR profile.
Quantitative polymerase chain reaction (qPCR) using the Applied
Biosystems 7500 Real-Time PCR System (7500 system; Applied
Biosystems, Waltham, MA) is the most common way to quantify DNA
extract samples [2, 3]. There are three main phases of qPCR
amplification: denaturation, annealing, and extension. During the first
phase, double-stranded template DNA is separated, or denatured, by
heating the DNA to approximately 95 °C. The second phase cools the
qPCR reaction to approximately 60 °C, which facilitates annealing, or
addition, of primers to the denatured DNA strands. The primers bind to
targeted locations on the genome and facilitate the amplification of that
region. Finally, the temperature is increased to approximately 72 °C so
that the DNA polymerase can efficiently extend the formation of the
new DNA strand by adding deoxyribose nucleotide triphosphates
(dNTPs) to the template strands of DNA [4].
The qPCR amplification method outlined in this protocol is
optimized for use with high-quality DNA samples, including single-
source database samples, and targets numerous Alu repeats utilizing
the PowerUp™ SYBR® Green Master Mix (SYBR® Green master mix;
Applied Biosystems). The SYBR® Green master mix contains a DNA-
binding fluorescent marker, SYBR® Green I dye, which intercalates
between double-stranded DNA (dsDNA) during qPCR amplification and
produces a fluorescent signal that is detected by the 7500 system [5–7].
Another essential component of the SYBR® Green master mix is the hot
start polymerase—Dual-Lock Taq DNA polymerase [5–8]. The purpose
of Taq polymerase is to attach nucleotides to the existing template
strand of DNA during qPCR amplification, forming a new target DNA
strand [4]. The Dual-Lock Taq was introduced to maximize specificity
and reproducibility of the master mix by better controlling the Taq
enzyme, preventing early activation, which can lead to nonspecific
binding [6, 8].
For qPCR amplification to successfully proceed, Alu forward (Alu-F)
and Alu reverse (Alu-R) primers are utilized to target human and
higher primate specific Alu repeats. These primers have proven to be
useful at quantifying human DNA alongside intercalating reagents such
as the SYBR® Green I dye [9, 10]. Alu repeats were targeted for qPCR
amplification because there are roughly 500,000 to 1,000,000 copies of
Alu sequences approximately 124 bp long throughout the entire human
genome. This allows for a large number of targets to be amplified in a
single qPCR reaction utilizing a single set of primers [9, 10]. This is
beneficial because forensic evidentiary samples are susceptible to
degradation. If numerous human genome targets are amplified during
qPCR, it is likely that quantification results can still be obtained [9].
Finally, to create optimal conditions for qPCR amplification and
assist in new DNA template formation, the SYBR® Green master mix
contains deoxyribonucleoside triphosphates (dNTPs) with a
deoxyuridine triphosphate/deoxythymidine triphosphate
(dUTP/dTTP) blend, heat-labile uracil-DNA glycosylase (UDG), ROX
passive reference dye, and optimized buffer components [6, 8]. The
building blocks of DNA are comprised of dNTPs, which are nucleotides
bonded to three phosphate groups: Adenine (A), Guanine (G), Thymine
(T), and Cytosine (C) [4]. Heat-labile UGD is an enzyme that prevents
reamplification of carryover PCR products by removing any uracil that
has been added to either the single or double stranded DNA [6, 8].
Nucleotides dUTP/dTTP are utilized in the master mix to support
activity from UDG and maintain optimal PCR results [6]. In addition, the
ROX passive reference dye is added to provide a consistent fluorescent
signal that is used to normalize the SYBR® Green I dye signal by
correcting the fluorescence fluctuation that can occur from well to well
due to minor pipetting or reading discrepancies during the qPCR
process [4, 6, 7]. Finally, proprietary buffer components have been
optimized to facilitate stable and successful amplification.
To ensure accurate quantification, DNA standards consisting of
known concentrations are amplified along with DNA extract samples.
The DNA standards are prepared using a serial dilution where the
standards are diluted from higher to lower concentration using a
consistent dilution factor. During qPCR amplification, a cycle threshold
(Ct) value is captured for each DNA standard. The Ct values indicate the
number of cycles required for the sample fluorescent signal to
overcome background fluorescence so that it can be distinguished as
being contributed by the sample [5, 6]. These known DNA standard
concentrations and their corresponding Ct values are used to generate
a standard curve, represented by a linear regression line of best fit
(y = mx + b), where y is the Ct value, m is the slope, b is the y-intercept,
and x is the log of the initial DNA concentration [7]. As the qPCR
amplification process advances, the amount of sample target dsDNA
produced increases exponentially. This generates a positive correlation
between fluorescent signal and concentration. If a DNA extract sample
has a high concentration of DNA, then it will produce a stronger
fluorescent signal earlier in the amplification process and overcome
background noise to cross the Ct earlier. This means that the amount of
fluorescent signal produced is inversely proportional to the Ct value [3,
10, 11]. The DNA extract sample Ct values are plotted on the standard
curve, and using the linear regression equation allows for the sample
concentration to be determined (quantity = 10(y–b)/m) [7].
The 7500 system is used to initiate qPCR amplification and then
detect the fluorescent signal during each cycle of the amplification. The
7500 system utilizes a tungsten-halogen lamp to direct light through
five excitation filters before passing through the optical adhesive cover
of the 96-well plate and into each well. The light excites the fluorescent
dyes. A system of lenses, emission filters, and mirrors focus the emitted
fluorescent dye signal onto the charge-coupled device (CCD) camera
based on wavelength [12, 13]. The sequence detection software (SDS)
captures the fluorescent emission data from the CCD camera and
applies analysis algorithms to determine the contribution of each dye
[12]. The SDS software displays the data every cycle as a normalized
reporter signal (Rn), which is calculated by dividing the fluorescence
emission intensity of the SYBR® Green I dye by the fluorescence
emission intensity of the ROX passive reference dye [4, 13]. Once all of
the quantification data is compiled by the software, qPCR data analysis
can proceed.
It is important to note that unlike some commercially available kits,
the SYBR® Green master mix assay does not include an internal positive
control (IPC), which is used to determine if the qPCR amplification
reaction is working properly and detect if inhibition is present. In
addition, this assay does not target multiple locations with varying
lengths on the genome, which could be used to determine if
degradation is present. This assay also does not contain primers that
specifically target male Y-STR regions that could be used to assess if a
mixture is present by comparing the ratio of male DNA to total human
DNA. As noted previously, the SYBR® Green master mix assay only
utilizes a single primer set that targets Alu repeats. One additional
difference to note is that most commercial kits utilize a TaqMan™ probe
assay, not an intercalating dye, for the detection of a fluorescent signal.
The TaqMan™ probe contains a fluorescent reporter dye located near a
quencher dye, preventing it from producing a signal. During
amplification, the Taq DNA polymerase cleaves the TaqMan™ probe,
releasing the fluorescent reporter dye, which produces a fluorescent
signal that is detected by the 7500 system [4, 7]. Despite these
differences, the SYBR® Green assay is still considered to be a preferable
option for quantifying high-quality DNA samples due to its low cost
when compared to other commercial kits.
2 Materials
Prepare solutions using sterile, Type I water and analytical grade
reagents. Prepare all reagents under an amplification hood at room
temperature.
1. Applied Biosystems 7500 Real-Time PCR System with SDS
software.
2.
96-well plate centrifuge.
3.
96-well plate base: This is a protective base that the plate sits in
so that the bottom of the wells do not come into direct contact
with surfaces.
4.
96-well plate: The plate needs to be an optical plate with a
notched corner at A12 so that it is compatible with the real-time
PCR instrument used in this protocol.
5.
Adhesive film applicator tool.
6.
Adhesive film for 96-well plate.
7.
PowerUp™ SYBR® Green Master Mix: Store at 4 °C.
8.
Human genomic DNA: Aliquot and store at −20 °C; limit
freeze/thaw events.
9.
Tris-ethylenediaminetetraacetic (EDTA) buffer (TE−4): 10 mM
Tris-HCl and 0.1 mM EDTA, at a final pH of 8.0. Store at room
temperature.
10.
Alu-F primer (GTCAGGAGATCGAGACCATCCC): custom order.
Resuspend the dried down primers with TE−4 to create a 100 μM
stock primer solution; aliquot and store at −20 °C (see Notes 1
and 2). For the working stock, further dilute the stock solution to
24 pmol/μL, preparing only the volume needed. The working
stock is not intended to be stored; if prepared in advance, it can be
stored short term at −20 °C.
11. Alu-R primer (TCCTGCCTCAGCCTCCCAAG): custom order.
Resuspend the dried down primers with TE−4 to create a 100 μM
stock primer solution; aliquot and store at −20 °C (see Notes 1
and 2). For the working stock, further dilute the stock solution to
24 pmol/μL, preparing only the volume needed. The working
stock is not intended to be stored; if prepared in advance, it can be
stored short term at −20 °C.
3 Methods
Carry out all procedures using sterile, Type I water, under a clean
amplification hood, and at room temperature unless otherwise noted.
To prevent contamination of gloves or other samples, ensure that only
one tube is open at a time and hold the tubes properly. Never touch the
inside of the tube or cap and avoid reaching over open tubes. At each
step, confirm that the appropriate pipette and corresponding tips are
used. Verify the setting on the pipette to ensure that the appropriate
volume is used. Ensure to utilize sterilized consumables.
3.1 Plate Layout Form Setup

1.
Determine the total number of reactions that will be amplified,
including all DNA extract samples and controls.
2.
Print a 96-well plate layout form and document the well location
where DNA extract samples and controls will be added. The DNA
standards can be added in duplicate or singlicate to the 96-well
plate layout form (see Notes 3 and 4; Fig. 1).
Fig. 1 Example of a suggested 96-well plate layout form. Utilizing a plate layout form such as
this, the DNA extract samples, DNA standards (in duplicate or singlicate), and an optional NTC
are documented analogous to how they will be added to the 96-well plate for qPCR
amplification
3.2 SDS Plate Document Setup

1.
Turn on the computer corresponding to the 7500 system and wait
for it to power on completely (see Fig. 2a). The 7500 system does
not need to be turned on to create the SDS plate document (see
Note 5).
2.
On the computer, select the ABI Prism 7500 SDS software (SDS
software) icon. When the “Quick Startup” window opens, select
“Create New Document” (Fig. 3a) or select “New” from the “File”
menu to open a new document (see Notes 6 and 7).
3.
A “Define Document” window will open. Ensure that “Assay” is set
to “Standard curve,” “Container” is set to “96-Well Clear,”
“Template” is set to “Blank Document,” and “Run Mode” is set to
“Standard 7500” (see Note 8; Fig. 4).
4.
“Operator,” “Comments,” and “Plate Name” are optional and up to
the individual laboratory to determine.
5.
Click “Next.”
6.
A “Select Detectors” window will appear. Select the necessary
detector for the SYBR green assay from the list on the left side of
the window and select “Add” to assign the appropriate detector to
the “Detectors in Document” box. On the top right side of the
window, select “ROX” from the “Passive Reference” drop down list
(see Notes 9 and 10).
7.
Click “Finish” (see Note 6).
8.
A blank 96-well plate document will open. Reference the 96-well
plate layout form (see Subheading 3.1, step 2) that documents the
locations of all DNA extract samples and controls.
At th t f th 96 ll l t d t i d l t th
9. At the top of the open 96-well plate document window, select the
“Setup” tab, and then double-click on any well to bring up the
“Well Inspector” window (see Fig. 5).
10.
In the “Well Inspector” window, enter “Sample Name.” Ensure that
the DNA extract sample or control name corresponds to the
appropriate well location and check the “Use” box.
11.
The “Detector,” “Reporter,” and “Quencher” for each well should
already be populated from the options set up previously (see Note
10 and Subheading 3.2, step 6).
12.
Under the Task drop down menu, select “Standard” for the DNA
standards, “Unknown” for all DNA extract samples, and “NTC” for
an optional NTC sample (see Notes 3 and 11–13).
13.
Select “Quantity” for each of the DNA standards and enter their
corresponding concentration (ng/μL). Leave this selection empty
for DNA extract samples.
14.
Once all selections have been made, select the “Close” button.
15.
Confirm that the sample name and appropriate “Task” appears in
the assigned well location of the “Plate” document tab. On the top
left of the well location, ensure that the DNA extract samples
display a “U” and sample name; the DNA standards display an “S,”
standard name, and corresponding assigned concentration. If an
optional NTC was added, ensure it displays an “N” or “U,” and
control name (see Note 13).
16.
Repeat the sample entry process (see Subheading 3.2, steps 9–
15) for all wells of the “Plate” document tab that will contain a
DNA extract sample or control. This should correspond to the 96-
well plate layout form (see Subheading 3.1, step 2).
17. Once all sample wells have been assigned, select the “Instrument”
tab at the top of the screen. Under the “Thermal Cycler Protocol,”
select the “Thermal Profile” tab. Verify the PCR parameters are set
with one initial cycle of 95 °C for 5 min, followed by 35 cycles of
95 °C for 15 s 68 °C for 30 s and 72 °C for 45 s
95 C for 15 s, 68 C for 30 s, and 72 C for 45 s.
18.
Select “Save As” and save the file as a .sds file (see Note 14).
Fig. 2 7500 Real-Time PCR System and computer orientation. An example setup of the 7500
Real-Time PCR System , including laptop computer and instrument, is displayed. (a) The 7500
system is set up with the corresponding laptop computer. (b) The 7500 system power button
that is pressed to turn on the instrument. (c) A slight indentation on the tray door of the 7500
system that is pushed to unlatch the tray door and allow the plate holder to slide out. This
indentation should also be gently pushed to close the tray door
Fig. 3 SDS quick startup document window. The “Quick Startup Document” window appears
when the SDS software is opened. This window is used to create a new document or open an
existing document. (a) The “Create New Document” button is selected to launch a new
document. This option allows the scientist to set up a new plate with unique specifications. (b)
After the qPCR amplification is completed, data is ready to be analyzed. If the software was
closed between the end of qPCR and the start of data analysis, the saved files can be reopened
by using the “Open Existing Document” button and navigating to the file location within the file
explorer. The same process can be followed if the data was transferred to a different device for
analysis
Fig. 4 SDS define document window. The “Define Document” window allows the user to
specify conditions in the SDS software so that it reads the data and runs the protocol
appropriately. The following selections should be made for the qPCR amplification protocol—
Assay: Standard Curve (Absolute Quantitation); Container: 96-Well Clear; Template: Blank
Document; and Run Mode: Standard 7500. The operator, comments, and plate name are
optional
Fig. 5 SDS well inspector window. The “Well Inspector” settings define the content of each well
of the 96-well plate. This will ensure the SDS software reports accurate information for each
well once the qPCR amplification is complete. Add the sample name in the designated field.
Ensure that the “Use” box is checked. The detector, reporter, and quencher options will be
assigned during the plate file setup. Under task, select “Standard” for DNA standards and
“Unknown” for DNA extract samples. If an optional NTC was added, the “NTC” or “Unknown”
option can be selected. Ensure that the passive reference is ROX
3.3 DNA Standards Preparation

1.
Label microcentrifuge tubes with identifying information. It is
suggested that at a minimum the DNA standard name (for example,
Standard 1, Standard 2, Standard 3, etc.), concentration, and date
prepared are included.
2.
Thaw an aliquot of the human genomic DNA at room temperature,
then vortex and centrifuge briefly before starting the serial dilution
(see Note 2).
3.
Use Table 1 as an example of how to prepare the DNA standards via
serial dilution by combining human genomic DNA and TE−4. Each
newly prepared standard tube should be vortexed and centrifuged
before making the next standard. Add each dilution to the
appropriately labeled microcentrifuge tube (see Notes 3, 15, and
16).
4.
Store prepared DNA standards at −20 °C for approximately 5 days
and limit freeze-to-thaw events to less than four.
Table 1 Example of how to prepare DNA standard serial dilution
Standard DNA standard Volume of DNA Volume of TE−4

1 16 ng/μL 5.0 μL of human genomic DNA (e.g., 160 ng/μL) 45.0 μL
2 4 ng/μL 12.5 μL of 16 ng/μL std 37.5 μL
3 1 ng/μL 12.5 μL of 4 ng/μL std 37.5 μL
4 0.25 ng/μL 12.5 μL of 1 ng/μL std 37.5 μL
5 0.063 ng/μL 12.5 μL of 0.25 ng/μL std 37.5 μL
Standard DNA standard Volume of DNA Volume of TE−4
In this example, eight DNA standards (Standards 1–8) are prepared via
serial dilution for use with the qPCR assay. The volumes used in this
example are only one option and should be adjusted depending on each
laboratory’s needs. The human genomic DNA concentration should be
verified before beginning the serial dilution. For this example, the
concentration was determined to be 160 ng/μL. DNA standards are
added at the same time as DNA extract samples during qPCR
amplification setup and are used to create a standard curve, which
allows for determination of the DNA extract sample concentration. DNA
standards originate from a stock solution that is serially diluted, with
concentrations ranging from 16 to 0.001 ng/μL. After the first standard
is prepared, each subsequent standard is prepared from a four-fold
dilution of the previous standard. This example will produce enough of
each DNA standard so that approximately eight plates with DNA
standard added in duplicate can be prepared
3.4 qPCR 96-Well Plate Preparation

1.
Calculate the volume needed for each component of the qPCR
master mix, which consists of SYBR® Green PCR Master Mix,
water, Alu-F primer, and Alu-R primer. Use Table 2 to calculate the
needed volumes of each reagent by multiplying each component
by the total number of reactions. Include one or more extra
reactions to account for pipetting error (see Note 17).
2.
Obtain SYBR® Green master mix, Alu-F primers, Alu-R primers,
DNA extract samples, corresponding controls, and water. Place
these on ice or in an ice block (except the SYBR® Green master
mix); they must remain cold throughout the qPCR amplification
setup process. Make sure to only remove them from ice when
ready to use. The SYBR® Green master mix can remain at room
temperature.
3. Prepare a qPCR tray by placing a 96-well plate into a 96-well plate
base. Avoid touching the sides or bottom of the wells and do not
place the plate directly on the bench top (see Note 18).
4.
Ensure that all reagents, samples, and standards have completely
thawed (see Note 2). Gently vortex and quick spin each, when
applicable (if the SYBR® Green master mix was purchased in a
5 mL quantity, the bottle should be swirled, not vortexed, given
that it cannot be centrifuged).
5.
Transfer the calculated reagents from Table 2 into the labeled
qPCR master mix tube (see Note 19).
6.
Vortex the master mix tube for 3–5 s, followed by brief
centrifugation to pull liquid from the top and sides of the tube.
7.
Following the 96-well plate layout form (see Subheading 3.1, step
2), add 23 μL of the qPCR master mix into the bottom of each well
that will contain a DNA extract sample or control (see Note 20
and Fig. 6).
8.
Following the 96-well plate layout form, add 2 μL of each DNA
extract sample and control to the plate. Ensure to change the
pipette tips after each addition (see Notes 21 and 22).
9.
Once all of the DNA extract samples and controls have been added
to the 96-well plate, seal the plate by placing an adhesive film on
top of the plate, ensuring all wells are completely covered with the
adhesive film. Do not touch the optical adhesive film and only
handle it by the removable tabs. Use a film applicator or a plastic
sealing tool to tightly seal the plate. The plastic sealing tool should
be firmly run over the entire adhesive film and in-between all the
rows and columns. Remove the tabs once the plate is completely
sealed (see Note 23).
10.
Centrifuge the reaction plate in a 96-well plate centrifuge at
approximately 500 × g for 20 s to remove any bubbles that may
have been introduced and spin down reagents that might be on
the side of the well (see Note 24).
Table 2 Volume of qPCR reagents needed per reaction
Component Volume per reaction
PowerUp™ SYBR® Green Master Mix 12.5 μL

Water 8.5 μL
Alu-F primers 1 μL
Alu-R primers 1 μL
Total volume 23 μL
Use of a qPCR master mix chart outlining each component of the qPCR
master mix and the volumes of each component required for a single
reaction helps to ensure that all components are added correctly. This
should be used to create a single tube of master mix based on the
number of total reactions expected (DNA extract samples, DNA
standards, NTC, and pipetting error). The volumes for each component
will be multiplied by the total number of reactions plus the additional
reactions needed for pipetting error. After the master mix is prepared,
23 μL will be added to the corresponding wells of the 96-well plate.
Fig. 6 Correct and incorrect addition of liquid to plate well. When adding qPCR master mix,
DNA extract samples, or controls to the 96-well plate, ensure that the liquid is correctly
deposited to the bottom of a well of the reaction plate. The left pane (a) is an example of how to
correctly pipette liquid into a well of the reaction plate. All of the liquid is at the bottom of the
well. The middle pane (b) is an example of how to incorrectly add liquid into a well of the
reaction plate. The liquid is on the side of the well instead of the bottom of the well. The right
pane (c) is also an example of how to incorrectly add liquid into a well of the reaction plate. An
air bubble is present at the bottom of the well, prohibiting the liquid from getting to the bottom
of the well. (Copyrighted properties are owned by Life Technologies Corporation, a part of
Thermo Fisher Scientific Inc. www.thermofisher.com. © 2021 Thermo Fisher Scientific Inc.
Used under permission. Reproduced from Ref. [15])
3.5 Running the Reaction Plate on the 7500 Real-Time

System
1.
If powered off, turn on the computer corresponding to the 7500
system and wait for it to power on completely (see Fig. 2a). Then
turn on the 7500 system by pressing the power button on the
lower right corner and wait for approximately 2 min for the
instrument to warm up (see Note 5 and Fig. 2b).
2.
On the computer, select the SDS software icon. When the “Quick
Startup” window opens, select “Open Existing Document” (see Fig.
3b) or select “File” then “Open” to navigate to the previously saved
SDS plate document (see Note 6 and Subheading 3.2, step 18).
Ensure all sample names and parameters meet specified
conditions.
3.
On the 7500 system, press the indentation on the bottom right side
of the tray door to open the slide out plate holder and place the
sealed 96-well plate in the plate holder. The A1 position of the
reaction plate should match the A1 position marker on the top left
corner of the slide out plate holder. The notched corner of the
reaction plate should be positioned on the top right corner of the
slide out plate holder (see Figs. 2c and 7).
4.
Close the tray door by pressing the indentation on the bottom
right-hand side of the drawer until there is a slight click (see Fig.
2c).
5.
In the SDS software, select the “Instrument” tab and click “Start.”
This will initiate the qPCR amplification. Do not leave the 7500
system until the “Estimated Time” window appears. This indicates
that the qPCR amplification has successfully started and that there
were no errors while initiating.
6. The qPCR amplification takes approximately 1 h and 45 min to
complete. After qPCR amplification is complete, a window will
appear indicating successful completion; click OK and turn off the
instrument by pressing the button on the bottom right (see Fig. 2b).
Fig. 7 Proper orientation of 96-well plate in the 7500 Real-Time PCR System. The plate holder
of the 7500 system is circled in red. When the 96-well plate is placed into the plate holder, the
notched corner of the plate should be in the top right-hand corner, and well A1 of the plate will
be in the top left corner. (Copyrighted properties are owned by Life Technologies Corporation, a
part of Thermo Fisher Scientific Inc. www.thermofisher.com. © 2021 Thermo Fisher Scientific
Inc. Used under permission. Reproduced from Ref. [15])
3.6 qPCR Data Analysis and Interpretation

1.
Review the “Instrument” tab to verify that the “Estimated Time
Remaining” and “Status” values are grayed out. The green analysis
button should also be enabled. At this point, the qPCR
amplification is complete but the data has not been analyzed.
2.
Select the “Results” tab, then select the “Amplification Plot” tab.
Verify that the analysis settings on the right side of the screen
have the “Data” drop down set to “Delta Rn vs Cycle,” the
“Detector” drop down set to “All,” and the “Analysis Settings” set to
“Auto Ct” (see Note 25 and Fig. 8).
3. Under the “Results” tab, select the “Standard Curve” tab and click
the green arrow at the top of the screen, or select “Analyze” under
g p , y
the “Analysis” menu. This will analyze the data and display the
standard curve (see Note 26).
4.
Once the standard curve is generated, review the “Slope,”
“Intercept,” and “R2” values in the bottom right-hand corner of the
screen to ensure that they fall within the appropriate ranges.
Slope should be between −3.7 and −3.3, and R2 should be greater
than or equal to 0.98. Acceptable y-intercept values are
determined by each laboratory during the validation of the 7500
system (see Notes 3, 27–29, and Fig. 9a).
5.
If a standard curve does not meet the passing parameters (see
Subheading 3.6, step 4), then individual standard points must be
evaluated to determine if there are outliers that are affecting the
regression line. These outlier data points can be removed from
the standard curve (see Fig. 9b). No more than two DNA standards
can be omitted from the standard curve when standards are
added in duplicate and only one of each DNA standard duplicate
should be omitted (see Note 30).
6.
If removing a standard point is necessary, select the “Results” tab,
then select the “Plate” tab. Double-click the corresponding well to
open the “Well Inspector” window, check the box “Omit Well,” and
then press “Close.” Select the green “Analyze” arrow at the top of
the screen or select “Analyze” from the “Analysis” menu to apply
the changes to the standard curve. The well that was omitted will
be crossed out, and the data will no longer be included in the data
interpretation (see Note 31). Confirm the standard curve
parameters are within the acceptable range (see Note 32 and
7.
Review the amplification plot by selecting the “Results” tab, and
then the “Amplification Plot” tab.
8. At the bottom of the page, select the DNA standards by clicking
and dragging through the desired wells. This will bring up the
amplification plot for the selected wells. For the DNA standards,
the spacing between each amplification curve should be uniform
the spacing between each amplification curve should be uniform
and approximately two cycle number values apart (x-axis) when
crossing the threshold. This indicates that the DNA standard
concentrations were diluted uniformly and that the DNA
standards were prepared correctly (see Fig. 8).
9.
Once the standard curve and amplification plot have been
reviewed and determined to meet acceptable passing parameters,
then the sample data can be reviewed by navigating to the “Plate”
document tab or the “Report” tab (see Note 33).
10.
Data from the qPCR process can be exported by selecting the
“Export” option from the “File” menu and then selecting “Results.”
When the “Export File” window opens, navigate to the
appropriate save location and press “Save.” An “Export Settings”
window will open after the file save location is selected. Check
one of the following: “Export only selected wells,” “Apply Report
Settings for Data Columns,” or click “OK” to bypass either export
option (see Note 34). Once a selection has been made, the data file
will be saved as a .csv file in the specified location and can be
opened using Excel or other spreadsheet programs.
11.
Review all sample “Qty” (quantity) values to determine how to
accurately prepare the samples for STR amplification in an effort
to generate a full human STR profile (see Note 35).
12.
To estimate the total yield of a sample, multiply the “Qty” value by
the final elution volume (see Note 36).
Fig. 8 Amplification plot of standards loaded in duplicate. Reviewing the amplification plot of
the DNA standards showing all of the Ct values for the various standard concentrations is a
helpful way to assess whether the standards amplified as expected. The Ct values are
approximately two cycles apart, which is expected for these standards [13]. The parameters
outlined in red to the right of the plot represent the appropriate settings that should be selected
to ensure the amplification plot is displayed correctly. In addition, Standard 1 (16 ng/μL) and
Standard 2 (4 ng/μL) are noted with red arrows as an example of expected results for DNA
standards that were accurately pipetted during the serial dilution setup. The x-axis represents
the cycle number of the qPCR amplification, while the y-axis represents Delta Rn. Delta Rn is the
fluorescence emission intensity of the normalized reported signal (Rn) minus the baseline
(which includes the initial cycles of qPCR reaction where there is minimal change in
fluorescence signal [15]). The Rn represents the ratio of the fluorescence emission intensity of
the reporter dye (SYBR® Green) divided by passive reference dye (ROX). The red line across the
graph represents the Auto Ct threshold set by the 7500 system
Fig. 9 Passing and failing SDS standard curves. Eight DNA standards are plotted on the graph
to create a regression line. The x-axis represents the log of the concentration while the y-axis
represents the cycle threshold. The upper pane (a) displays an image of a passing standard
curve plot. The graph formatting options circled in red at the top right of the standard curve
plot are formatting tools that will enable the user to adjust the scale and position of the graph
to ensure all the data points can be seen on the plot. The standard curve values circled in red at
the bottom right of the plot represent passing standard curve values with the slope (−3.44), y-
intercept (16.06), and R2 (0.994) falling within the appropriate ranges. One set of data points
has been circled as an example, but all DNA standards on this curve follow what is described in
this example. The circled data points represent DNA Standard 8 located in wells H11 and H12.
Standard 8 has the lowest concentration (0.001 ng/μL) of the standards and therefore has the
highest Ct value (approximately 26). The data points for wells H11 and H12 appear to be
overlapping, which indicates the fluorescent signals crossed at similar Ct values for both DNA
standards and that those standards were pipetted precisely. The lower pane (b) displays an
image of a failing standard curve plot. The standard curve values circled in red at the bottom
right of the plot represent a failing standard curve, where the value for R2 (0.93) is not within
the acceptable range. This standard curve has several DNA standards that are not overlapping
and spaced apart. This indicates that the standards with the same concentrations (circled data
points in red are wells D11 and D12, both of which are Standard 4, with a concentration of
0.25 ng/μL) crossed at different Ct values, indicating poor pipetting or other issues. Because of
this and other poor-quality standards, the R2 value was adversely affected, resulting in a failing
standard curve. This means that qPCR amplification was not optimally performed and did not
meet validated requirements for what is considered a passing qPCR amplification. The data
produced will be unreliable and the qPCR amplification must be repeated
4 Notes
1.
Primers can be prepared and aliquoted into smaller volumes. This
will limit the number of freeze-to-thaw events the primers
undergo. Aliquots can be stored at −20 °C for up to 1 year. Thermo
Fisher Scientific is one available manufacturer of the custom Alu-F
and Alu-R primers used in this protocol. Other suitable
manufacturers that produce custom Alu primers necessary for
qPCR amplification may be utilized.
2.
If reagents are not allowed to thaw completely to room
temperature, then the incorrect concentration of reagents may be
added to the qPCR master mix (either too much or too little) and
the quantification reaction will not work accurately. This could
adversely affect qPCR amplification, resulting in a failed
quantification. The reagents are considered thawed when the
liquid appears clear and free from solid reagents floating in the
tube. Once the reagents have completely thawed, vortex and
centrifuge the tubes to pull down any liquid on the sides of the
tubes.
3.
DNA standards are amplified along with DNA extract samples. The
suggested DNA standards concentrations values can range from
16 to 0.001 ng/μL and will be used to generate a standard curve
at the end of the qPCR amplification. The standard curve consists
of the log concentrations plotted on the x-axis and their respective
Ct value plotted on the y-axis.
4. DNA standards can be loaded in singlicate or duplicate on the 96-
well plate; the laboratory needs to validate the option they plan to
implement (both can be validated for increased flexibility). For
analysts with precise pipetting skills, loading in singlicate will give
bl l l di i d li DNA d d l d d
comparable results to loading in duplicate. DNA standards loaded
in singlicate allow for more samples to be added to the 96-well
plate and save on reagent costs since fewer DNA standards are
required.
5.
The 7500 system contains a tungsten-halogen lamp that has a
half-life of approximately 2000 h [14]. If the instrument is on
(regardless of whether it is running or not), then the lamp’s life is
being consumed. Do not turn the instrument on until immediately
before use and turn the instrument off once qPCR amplification is
complete.
6.
If the 7500 system is not turned on before opening the SDS
software program, an error message will appear stating the
program could not detect the SDS instrument. The 7500 system
does not need to be turned on to create an SDS plate document.
When the error message appears, select “Cancel” and proceed
with the SDS plate document setup.
7.
SDS software version 1.4 was utilized for the figures and method
outlined in this protocol. Newer versions of the software are
available and can be utilized with the 7500 system or for analysis.
The SDS software can be downloaded from the Thermo Fisher
website.
8.
In order to minimize possible errors and time spent preparing the
electronic plate map, a template can be developed and saved in
the SDS software. The template can contain defined locations for
DNA standards, optional NTC, and additional controls. When the
template file is opened, only the DNA extract samples will need to
be added. This template file can be opened when creating a new
file instead of generating a blank new document each time. Select
the “Browse” button to the right of the “Template” drop down
menu in the “Define Document” window. Navigate to the
appropriate file on the computer and select “Open” to add the
previously created electronic template to the “Define Document”
window selection.
If the proper detector is not available, click the “New Detector”
If the proper detector is not available, click the New Detector
9. box at the bottom of the window and input the name, description,
reporter dye, quencher dye, color, and any notes relevant to the
detector being added, then click “OK.” This will add the new
detector to the list. A detector is a virtual representation specific
to each DNA target fluorescent marker used for analysis on the
7500 system [15]. The detector and its defining conditions will be
dictated by the laboratory validation of reporter dye SYBR® Green
I.
10.
ROX is a passive reference dye that is not affected by the
amplification process and will maintain a consistent fluorescence
signal throughout the qPCR amplification [4, 6, 7, 11]. ROX is a
component of the qPCR master mix and thus added to each well.
When ROX is paired with another fluorescent molecule such as
the SYBR® Green I dye, the software will use the ROX signal to
normalize variations in the fluorescence signal from well to well
that could be caused by factors such as minor pipetting
discrepancies, different amounts of condensation, or uneven
illumination [11, 16]. Normalization helps to create more precise
data from every cycle on the 7500 system. Although ROX helps to
improve data from non-PCR related issues, it cannot correct bad
data or poor pipetting technique [16]. “ROX” should be selected
when the “Detector” is assigned (see Subheading 3.2, step 6). The
passive reference designation can be verified in the “Well
Inspector” window (see Subheading 3.2, step 9), ensuring “ROX”
is selected. If this setting needs to be modified, select the “Passive
Reference” drop down list found at the bottom right side of the
“Well Inspector” window and select the appropriate designation.
11.
“Unknown” indicates that the well contains a sample with an
unknown amount of DNA that must be determined through qPCR.
A label of “Unknown” signals the software to calculate an
approximate DNA concentration “quantity” based on the standard
curve [11].
12. An optional NTC, or no template control, can be used during qPCR
amplification to identify contamination from qPCR master mix
reagents. The NTC well of the 96-well plate will contain all qPCR
g p q
®
master mix reagents (SYBR Green master mix, Alu-F primers,
Alu-R primers, and water), but it will not contain a DNA extract
sample. Instead, water will be added to the master mix to bring
the reaction up to the required volume. If qPCR reagents are free
from contamination, then DNA should not be detected, or the Ct
value should be greater than the laboratory-specified conditions.
If a DNA concentration value is obtained for the NTC or the NTC Ct
value is below the laboratory-specified conditions, that indicates
contamination has occurred and the subsequent sample data
cannot be analyzed. Quantification must be performed again with
reagents that are free of contamination to troubleshoot what may
have caused reagent contamination.
13.
If an NTC is assigned as an “NTC” in the “Well Inspector” window,
then the only time a concentration will be produced is when the
NTC crosses the quantification conditions validated by the
laboratory (acceptable numerical or Ct value) [6, 11]. If the
laboratory wants to consistently propagate a quantity for the NTC
results (either a numerical value or “UND” (undetermined)), even
if the NTC has not crossed the validated Ct value, then an option is
to assign the NTC as an “Unknown” in the well inspector window.
This option will ensure a result is obtained, and the scientist will
determine if it falls within an acceptable range.
14.
The file must be saved as the file type “.sds.” If the file is
inadvertently saved as “.sdt” (template file), then the file cannot be
read by the SDS software, preventing qPCR amplification from
starting.
15.
At each step of the serial dilution, the concentration will undergo
a four-fold dilution. This means that the concentration will be
reduced by a factor of four from the previous dilution, or the
concentration will be diluted 1:4. A 1:4 dilution means that for
each 1 μL of DNA standard that is added, 3 μL of TE−4 will also be
added to dilute the concentration appropriately.
16. Human Genomic DNA (G3041) is manufactured by Promega,
which is one of many human genomic DNA available for qPCR
amplification Other suitable manufacturers produce human
amplification. Other suitable manufacturers produce human
genomic DNA that may be purchased. It is important to note that
the concentration of each human genomic DNA tube should be
verified using UV-spectrometry or qPCR prior to preparing the
serial dilution. In addition, to limit degradation due to numerous
freeze-to-thaw events, it is suggested that the DNA standards are
prepared using a 50% glycerol and 50% water mixture [17, 18].
The glycerol in the mixture will keep the standards from
completely freezing while in long-term storage at −20 °C,
minimizing degradation from freeze-to-thaw events [17, 18]. If
DNA standards are degraded, that will have an adverse effect on
the quantification results, so ensure to limit the freeze-to-thaw
events to less than four.
17.
Additional pipetting error reactions should be added to all qPCR
master mix calculations. The pipetting error can be adjusted
based on the number of samples that will be quantified by
calculating approximately 5% of the total reaction volume. For
example, if performing a quantification of a full plate that will be
96 samples total (inducing controls), then the pipetting error
should be about five additional reactions. The pipetting error is
added to account for user mistakes or possible minor
discrepancies when pipetting master mix into the wells of the 96-
well plate.
18.
A 96-well plate base keeps the bottom of the 96-well plate from
coming into contact with any surface, including the amplification
hood. It also prevents the scientist from touching the outside or
bottom of the plate wells. Utilizing a 96-well plate base also limits
the transfer of dust or debris onto the plate, which could inhibit
accurate fluorescence detection during qPCR amplification and
adversely affect the results. Applied Biosystems manufactures the
MicroAmp™ Splash-Free 96-Well Base, which is just one option for
qPCR bases. Other suitable manufacturers produce bases for qPCR
amplification and may be purchased.
19. A larger qPCR master mix tube will be needed if a substantial
number of samples are quantified. Since 23 μL of master mix will
be added into each well of the 96-well plate that contains a DNA
extract sample or controls, this value should be multiplied by the
number of reactions that are loaded on the plate. For example, if
quantifying 96 samples and including a pipetting error of five,
then 23 μL should be multiplied by 101. This equates to a total of
2323 μL of qPCR master mix; therefore, a tube larger than 1.5 mL
would be needed. The qPCR master mix volume should be
calculated before preparing the qPCR master mix tube to ensure
that the appropriately sized tube is used.
20.
If qPCR master mix is the first reagent being added to the plate,
then it is not necessary to change the pipette tip between each
well, but it is suggested that the pipette tip be changed at a
minimum every column. When dispensing reagents, ensure that
the pipette tip is at a slight angle and the liquid is dispensed to the
bottom of the well. This will help avoid introducing air bubbles. If
liquid is left on the side of the well or air bubbles are present, then
it could have an adverse effect on the qPCR amplification (see Fig.
6).
21.
The pipette tip must be changed between each DNA extract
sample and control addition to avoid contamination. While
pipetting samples or controls into the 96-well plate, place the
pipette tip into the previously deposited qPCR master mix to
ensure the sample is accurately deposited into the well. Also,
make sure to press the plunger of the pipette to the first stop only;
do not press to the second stop of the pipette plunger because
that could cause excess bubbles to form within the wells. These
bubbles could be difficult to remove, adversely affecting the qPCR
amplification.
22. It is strongly suggested that a method is created to track the
addition of DNA extract samples or controls into the 96-well plate.
One suggestion is to have another scientist witness the sample
addition into the 96-well plate, noting the addition on the 96-well
plate layout form (see Subheading 3.1, step 2). Another option is
to set up a box of pipette tips so it is analogous to the 96-well
plate layout form. Use the box of pipette tips to track wells that
had DNA extract samples or controls added. Wells of the 96-well
l t th t h d l dd d t it ill t h ti i th
plate that had a sample added to it will not have a tip in the
corresponding location of the tip box. Wells that still need a DNA
extract sample or control added will have a tip in the
corresponding location of the tip box. One final option is to set up
a tube rack with all samples and controls that will be added to the
96-well plate. Ensure that the tube rack setup corresponds to the
96-well plate layout form. Once a sample is added to the 96-well
plate, that sample should be placed separately from the remaining
samples that still need to be added.
23.
Ensure that the optical adhesive film is applied appropriately and
that all 96 wells of the reaction plate are tightly sealed. The
adhesive film should be centered on all 96 wells of the reaction
plate so that each edge has an appropriate amount of film to seal
the wells tightly when the sealing tool is firmly run over the top of
the adhesive film, between each row or column of wells, and along
the outer edges of the plate. If it appears that some wells are not
properly covered, or if a well is inadvertently left partially open,
then reactions (qPCR master mix combined with DNA extract
samples or controls) could be lost due to evaporation during the
amplification process. If this occurs, the reaction will not work
properly and the results produced will be unreliable or unusable.
Applied Biosystems is the manufacturer for the MicroAmp™
Optical Adhesive Film and the MicroAmp™ Adhesive Film
Applicator. Other suitable manufacturers produce optical adhesive
film and sealing tools used for qPCR and may be purchased.
24.
Confirm that all bubbles have been removed from the bottom of
the 96-well plate and the reagents have been pulled to the bottom
of the wells. If bubbles are not removed, they could interfere with
proper amplification and will impact the quality of the data
produced. If bubbles are observed after the first centrifugation,
then repeat the centrifuge step using the same parameters.
Bubbles positioned at the top of the reagents in a well are okay, as
they will pop during the initial denaturation step of qPCR.
25. Cycle threshold (Ct) is the cycle at which the DNA extract samples
fluorescence can be distinguished from the background
fluorescence Any signal that is considered to be background
fluorescence. Any signal that is considered to be background
fluorescence falls below the specified threshold and cannot be
distinguished as being contributed by the DNA extract sample,
other qPCR components, or the 7500 system. The more DNA an
extract sample contains, the earlier that sample fluorescence will
cross the Ct threshold. This means that the sample can be
distinguished from the background fluorescence much faster. DNA
extract samples with a lower concentration of DNA will take
longer to produce a strong enough fluorescent signal to overcome
background fluorescence. It will take longer for that sample to
cross the Ct threshold, resulting in higher Ct value. Unless
specified, the SDS software will assign the analysis setting to Auto
Ct. The SDS software determines this value by calculating the
baseline start and end values, in addition to determining the
optimal threshold in the amplification plot. Based on those values,

the SDS software will then calculate the Auto Ct value [11].
26.
It is not necessary to analyze the qPCR data using the 7500
system. Data can be transferred to another computer that
contains the SDS software and analyzed. To export the SDS file so
it can be transferred to another computer, select “Save as” from
the “File” menu and choose the appropriate location to store the
SDS file. Transfer the file to a new computer and then open the
SDS software. Wait for the “Quick Startup” screen to appear and
select the “Open Existing Document” button (see Fig. 3b). Do not
select the “Create New Document” button. Select the appropriate
data file that was stored on the computer.
27.
If the scale of the standard curve cuts off data points, the six graph
formatting buttons in the top right-hand corner of the “Standard
Curve” tab will allow for manipulation of the scale and placement
of the graph to ensure all data points are captured on the screen
(see Fig. 9a).
28. Slope represents how efficient the PCR reaction was. Acceptable
slope values range from −3.3 to −3.7. A slope of −3.3 indicates that
a reaction was 100% efficient, meaning the quantity of DNA was
doubled each cycle. A slope value of greater than −3.3 means that
PCR was more than 100% efficient [7]. A slope value of −3.7 or
less indicated that PCR was not as efficient (approximately 85%
or less), and extraneous factors might be affecting qPCR. The y-
intercept represents the expected Ct value for a sample with
concentration of 1.0 ng/μL (example of an acceptable range is
14.5–17.5 but varies based on laboratory validation of each 7500
system). The R2 value measures how well the regression line fits
the data points. If the regression line fits the data points perfectly,
then R2 will equal 1. If R2 is less than 0.98, this indicates that the
data does not follow a cohesive linear trend and the data is not
consistent.
29.
The acceptable y-intercept range is affected by the Ct threshold
value. Each 7500 system is validated according to laboratory
guidelines. Each instrument could potentially contain a different
Ct threshold value, resulting in varying acceptable y-intercept
ranges.
30.
If DNA standards are added to the 96-well plate in duplicate, then
no more than two DNA standards total and only one of each
duplicate pair can be omitted during analysis. For example: wells
A11 and A12 (Standard 1 in both wells) should not be omitted
from the standard curve. However, well A11 (Standard 1) and well
C12 (Standard 3) can be omitted (see Fig. 1). If the DNA standards
are added to the 96-well plate in singlicate, then only one DNA
standard may be removed during analysis.
31.
If a DNA standard point is removed, then the qPCR data must be
reanalyzed. If two DNA standard points were removed and the
standard curve is still failing the specified conditions (see
Subheading 3.6, step 4), then re-quantification must be
performed to obtain an accurate concentration value. If the
amplification continues to produce failing results, this indicates
that a DNA standard, consumables, instrument, or pipetting issue
has occurred. Troubleshooting must be performed and each
possibility needs to be reviewed one at a time to determine the
cause of the failing quantifications.
If the standard curve does not meet the validated passing
If the standard curve does not meet the validated passing
32. parameters, then the Ct threshold value can be adjusted manually
in conjunction with or instead of omitting standard points. This is
only performed in an attempt to obtain sample quantification
data, and it is important to note that this data is still considered
failing because it does not meet the validated passing parameters.
All samples should be re-quantified to obtain accurate results. To
manually adjust the Ct threshold, select the “Amplification Plot”
tab and set the “Analysis Settings” to “Manual Ct.” This option will
allow for manual adjustment of the threshold numerical value,
which will adjust the placement of the threshold line on the
amplification curve. Adjusting the threshold manually will change
how the cycle number and level of fluorescence correspond to
each other on the standard curve, therefore changing the slope, y-
intercept, and R2 values. To achieve the optimal results when
adjusting the manual threshold, ensure that it is assigned within
the exponential phase of the amplification curve and above the
baseline [15]. This change will also affect the sample
quantification data by over- or under-estimating the results.
33.
To review only the DNA extract sample name and concentration,
select the “Plate” document tab. The value shown for each sample
represents concentration in nanograms per one microliter (ng/
μL). The data can also be reviewed by navigating to the “Results”
tab and then selecting the “Report” tab. The data is presented in a
table format and includes information such as sample name,
detector, task, Ct, quantity, and mean quantity. Quantity refers to
the concentration of DNA for a specific sample in nanograms per
microliter (ng/μL). Mean quantity refers to the average
concentration of DNA between identical samples (such as
standards that are loaded in duplicate). The “Report” table can
make it easier to determine the correlation between data points.
When reviewing the data, a general inverse relationship should be
observed between concentration of a sample and its Ct value. The
higher the “Quantity” of a DNA extract sample, the lower the “Ct”
value will be.
34. When exporting data, checking the option to “Export only selected
wells” will only export data for the highlighted wells. These wells
wells will only export data for the highlighted wells. These wells
must be selected before choosing this export option. Checking the
option to “Apply Report Settings for Data Columns” will apply the
previously specified report settings, which define the columns
that are included on the export file for all samples (for example,
the column can be limited to only sample name, Ct, and Quantity).
To change the report settings, select “Report Settings” from the
“Tools” menu. To bypass all export setting options mentioned
above, do not check any of the boxes and select “OK.” This will
export all data columns associated with all sample wells.
35.
Most commercially available STR amplification kits have been
optimized for a DNA concentration input range of 0.3–1.0 ng/μL.
If too much DNA is added to the STR amplification reaction, then it
could overload the amplification reaction, resulting in an over-
saturated or inhibited profile. If too little DNA is added to the
amplification reaction, then a poor partial or no profile could be
produced. Once samples are quantified, the initial volume may
need to be diluted so that the individual sample(s) can achieve the
proper concentration for amplification. Sample(s) that exhibit too
little DNA may need to be concentrated using a centrifugal filter
unit or the maximum amount of sample may need to be added to
the amplification reaction.
36.
Final elution volume is the volume obtained at the end of the
extraction procedure.
References
testing laboratories. Available via the Federal Bureau of Investigation. https://www.fbi.
gov/file-repository/quality-assurance-standards-for-forensic-dna-testing-laboratories.pdf.
Accessed 23 Apr 2022
2. Thornton B, Basu C (2015) Rapid and simple method of qPCR primer design. In: Basu C
(ed) PCR primer design, Methods in molecular biology, vol 1275, 2nd edn. Humana Press,
New York, pp 173–179. https://doi.org/10.1007/978-1-4939-2365-6_13
[Crossref]
3.
Zhang Q, Wang J, Deng F et al (2015) TqPCR: a touchdown qPCR assay with significantly
improved detection sensitivity and amplification efficiency of SYBR green qPCR. PLoS One
10(7):1–19. https://doi.org/10.1371/journal.pone.0132666
[Crossref]
4. Butler JM (2009) DNA Quantification. In: Fundamentals of forensic DNA typing. Academic
Press Elsevier, Burlington, MA
5. Malinen E, Kassinen A, Rinttilä T et al (2003) Comparison of real-time PCR with SYBR

gGreen I or 5′-nuclease assays and dot-blot hybridization with rDNA-targeted
oligonucleotide probes in quantification of selected fecal bacteria. Microbiology
149(1):269–277. https://doi.org/10.1099/mic.0.25975-0
6. Applied Biosystems (2016) PowerUp™ SYBR™ Green Master Mix user guide: universal 2X
master mix for real-time PCR workflows, revision C.0. Available via Thermo Fisher. https://
www.thermofisher.com/document-connect/document-connect.html?url=
https%3A%2F%2Fassets.thermofisher.com%2FTFS-
Assets%2FLSG%2Fmanuals%2FMAN0013511_PowerUp_mastermix_UG.pdf. Accessed 6
Apr 2022
7. Bio Rad Laboratories (2006) Real-time PCR applications guide. Available via Bio Rad.
https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_5279.pdf. Accessed
18 Apr 2022
8. Applied Biosystems (2020) PowerUp SYBR Green Master Mix product bulletin available via
Thermo Fisher. https://assets.thermofisher.com/TFS-Assets/GSD/Product-Bulletins/
PowerUp-SYBR-Green-Product-Bulletin-2018.pdf. Accessed 27 Feb 2022
9. Shewale JG, Schneida E, Wilson J et al (2007) Human genomic DNA quantitation system, H-
quant: development and validation for use in forensic casework. J Forensic Sci 52(2):364–
370. https://doi.org/10.1111/j.1556-4029.2006.00369.x
[Crossref][PubMed]
10. Nicklas J, Buel E (2003) Development of an Alu-based, real-time PCR method for
quantitation of human DNA in forensic samples. J Forensic Sci 48(5):1–9. https://doi.org/
10.1520/JFS2002414
[Crossref]
11. Applied Biosystems (2010) Applied Biosystems 7500/7500 Fast Real-Time PCR System:
standard curve experiments, revision C. Available via Thermo Fisher. https://assets.
fishersci.com/TFS-Assets/LSG/manuals/7500_7500_fastreal_pcr_stdcurve_ug.pdf.
12. Ong Y, Irvine A (2016) Quantitative real-time PCR: a critique of method and practical
considerations. Hematology 7(1):59–67. https://doi.org/10.1080/10245330290015573
[Crossref]
13. Applied Biosystems (2004) Applied Biosystems 7500 Real-Time PCR System and Applied
Biosystems 7500 Fast Real-Time PCR System: a real fast and real versatile approach to real-
time PCR. Available via Thermo Fisher. https://www.gene-quantification.de/abi7500.pdf.
14.
Applied Biosystems (2010) Applied Biosystems 7500/7500 Fast Real-Time PCR Systems:
system maintenance, revision D. Available via Thermo Fisher. https://tools.thermofisher.
com/content/sfs/manuals/4387777d.pdf. Accessed 18 July 2022
15. Applied Biosystems (2010) Absolute quantification getting started guide, revision B.
Available via Thermo Fisher. http://tools.thermofisher.com/content/sfs/manuals/
4378656b.pdf. Accessed 20 July 2022
16. Applied Biosystems (2015) ROX passive reference dye for troubleshooting real-time PCR.
Available via Thermo Fisher. https://assets.thermofisher.com/TFS-Assets/GSD/
Application-Notes/co016741-rox-dye-for-qqpcr-app-note.pdf. Accessed 16 Apr 2022
17. Schaudien D, Baumgä rtner W, Herden C (2007) High preservation of DNA standards diluted
in 50% glycerol. Diag Mol Pathol 16(3):153–157. https://doi.org/10.1097/PDM.
0b013e31803c558a
[Crossref]
18. Rö der B, Frü hwirth K, Vogl C et al (2010) Impact of long-term storage on stability of
standard DNA for nucleic acid-based methods. J Clin Microbiol 48(11):4260–4262. https://
doi.org/10.1128/JCM.01230-10
https://doi.org/10.1007/978-1-0716-3295-6_11
11. Quantitation of DNA Using the

Applied Biosystems Quantifiler® Trio
DNA Quantification Kit
Kelly L. Knight1 , Angelina Mauriello1 and Georgia Williams1
(1) Forensic Science Program, George Mason University, Fairfax, VA,
USA
Kelly L. Knight
Email: kknight6@gmu.edu
Abstract
Following the isolation of deoxyribonucleic acid (DNA) from biological
samples, the quantitation of amplifiable human DNA is a critical next
step in the process of DNA analysis. The Quantifiler® Trio kit provides a
simple way to accurately estimate the quantity of human and male DNA
with concentrations as low as 5 pg/μL or less. Not only can the
Quantifiler® Trio kit determine the quantity of human DNA present, but
it can also give an indication of the quality of the sample, which is
essential information to have in the decision-making process regarding
any downstream testing being done. In this chapter, we describe how to
prepare and process quantitation reactions using the Quantifiler® Trio
kit. We also provide basic information on how to interpret the results.
Key words DNA quantitation – Quantifiler Trio – Quantification – DNA

degradation – DNA inhibition – Degradation index – Forensic DNA –
Quantitative real-time PCR – qPCR – RT-qPCR
1 Introduction
Following the isolation of deoxyribonucleic acid (DNA) from biological
samples, the quantitation of amplifiable human DNA is a critical next
step in the process of DNA analysis. Current quantitation kits used in
DNA laboratories, such as the Quantifiler® Trio DNA Quantification Kit
(Quantifiler® Trio; Applied Biosystems, Waltham, MA), can provide a
wealth of information about the samples being tested. Not only can the
Quantifiler® Trio kit determine the quantity of human DNA present, but
it can also provide information regarding the presence of a mixture of
male and female DNA, as well as give an indication of the quality of the
sample. More specifically, the results can indicate whether a sample is
possibly inhibited or degraded. This information is essential to the
decision-making process regarding any downstream testing being
done.
The Quantifiler® Trio kit is made by Applied Biosystems® and is
optimized for use with the Applied Biosystems® 7500 Real-Time PCR
system, as well as their new PCR systems (e.g., the QuantStudio® 5
Real-Time PCR System). The kit contains four reagents: Quantifiler®
THP PCR Reaction Mix, Quantifiler® Trio Primer Mix, Quantifiler® THP
DNA Dilution Buffer, and Quantifiler® THP DNA Standard [1]. The
reaction mix contains dNTPs, buffer, Taq DNA polymerase enzyme,
passive reference standard, and stabilizers. Because the Quantifiler®
Trio assay combines four 5’ nuclease assays, the primer mix contains
four sets of target-specific primers and four different dye-labeled
TaqMan® probes. The internal PCR control (IPC) template is a synthetic
DNA template, which is also included in the primer mix. Evaluating the
IPC is a way to confirm whether a sample is truly negative or whether a
reaction has been negatively affected either by the presence of PCR
inhibitors or if there has been an instrument or assay setup failure.
In addition to the IPC (130 bases), the other targets in this assay
include a small autosomal human target (80 bases), a large autosomal
human target (214 bases), and a human male target (75 bases) [1]. The
human male target on the Y-chromosome quantifies the amount of male
DNA present, which is particularly useful in mixed samples containing
both male and female DNA. The size of the small autosomal target
allows for improved amplification and quantitation of degraded
samples. In samples that are degraded, it is expected that there will be
increased amplification success of smaller fragments in comparison to
larger fragments. Therefore, by comparing the relationship between the
large and small autosomal target DNA concentrations, an indication of
degradation can be determined.
Each TaqMan® probe has a reporter dye on the 5’ end and a
nonfluorescent quencher at the 3’ end. During the reaction, the probe
anneals to the complementary sequence between the forward and
reverse primer. The proximity of the quencher to the reporter dye
prevents the reporter from fluorescing. As the Taq polymerase extends
and creates the complementary strand, it will eventually cleave the
reporter dye from the probe. Once the reporter dye and the quencher
are no longer in close proximity, the reporter dye will fluoresce. As the
process continues with each of the 40 cycles of amplification, the
fluorescence for a particular sample will continue to accumulate. Once
this fluorescence has exceeded the established baseline, the cycle
threshold (CT) value will be measured, which is the cycle number at
which a sample crosses the threshold of detection. The fewer cycles it
takes for a sample to cross the CT, the more DNA is present in the
sample.
The Quantifiler Trio® kit uses the real-time quantitative PCR (qPCR)
method. In comparison to historical methods of DNA quantitation,
qPCR is more accurate, more sensitive, and less labor-intensive [2–4].
qPCR allows you to monitor the products in real time as the polymerase
chain reaction is occurring [4]. The qPCR reaction has three phases of
product growth: exponential, linear, and plateau [1]. During the
exponential phase of growth, there is a doubling of the PCR product.
This is the phase in which the qPCR measurements are taken and the CT
values are determined. In the linear phase, one or more of the reaction
components are beginning to decrease, so there is less than doubling
growth. In the final phase, plateau, the PCR product growth slows
dramatically and begins to stop as the reaction components are
consumed.
To determine the quantity of DNA present in each sample, the CT
value of the unknown samples is compared to a standard curve, which
is prepared by making a set of standards with known amounts of DNA
using the Quantifiler® THP DNA Standard and the Quantifiler® THP
dilution buffer. The Applied Biosystems® User Guide for Quantifiler®
Trio recommends preparing a standard dilution series ranging from
50.000 ng/μL to 0.005 ng/μL [1]. Each standard is processed in
duplicate on every plate. The cycle threshold (CT) and known DNA
concentration of the standard dilution series are plotted against each
other to generate the standard curve. The unknown samples can then
be compared to the standard values by using a formula generated from
the curve. The software uses the regression line formula
CT = m[log(Qty)] + b to calculate the best fit of the standard data points,
with m indicating the slope of the equation, which represents the PCR
amplification efficiency; Qty is the starting DNA quantity; and b is the y-
intercept, which represents the expected CT value for a 1 ng/μL sample
[2]. Each target will have different regression formulas based on the
standards [2]. The target concentration for each extracted DNA sample
is calculated through extrapolation by plotting a log of the standard
curve using the known concentrations of the standards and their CT
values.
Overall, Quantifiler® Trio provides a simple way to accurately
estimate the quantity of human and male DNA with concentrations as
low as 5 pg/μL or less. After the reactions and software have been set
up, the samples are PCR amplified, analyzed, and the results are then
interpreted. Quantifiler® Trio has been thoroughly validated and is
currently being used in forensic laboratories around the world to
reliably quantitate human DNA samples [5–11].
2 Materials
1.
Extracted DNA samples.
2.
Quantifiler® Trio DNA Quantification Kit: Quantifiler® THP PCR
Reaction Mix, Quantifiler® Trio Primer Mix, Quantifiler® THP DNA
Standard, and Quantifiler® THP DNA Dilution Buffer.
3.
Real-time Quantitative PCR instrument.
4. 96-well optical reaction plate.
5.
Optical adhesive film.
6.
Adhesive film applicator.
7.
Applied Biosystems MicroAmp 96-Well Base.
8.
HID Real-Time PCR Analysis Software.
3 Methods
The methods that follow are based on the manufacturer’s guidelines, as
described in the Applied Biosystems® User Guide for Quantifiler® Trio
[1]. All procedures should be performed at room temperature. The
standards and reactions should be prepared in an area away from
samples that have been amplified, ideally in a separate pre-
amplification space. It is also recommended to prepare the standards
and reactions in a PCR Workstation with HEPA-filtered air to protect
samples and minimize contamination. Other preventative measures
should be taken as well to minimize contamination, such as wearing
personal protective equipment and working in a clean space. Prior to
running reactions, the HID Real-Time PCR Analysis Software and
instrument should be set up/calibrated.
3.1 Preparation of DNA Quantification Standards

1.
Calculate the volume of each component needed to prepare the
standard curve dilution series (see Table 1).
2.
Label five microcentrifuge tubes with the appropriate standard
name: Standard 1, Standard 2, Standard 3, Standard 4, or Standard
5.
3. Vortex and centrifuge the Quantifiler® THP DNA Dilution Buffer,
and then dispense the required amount to each microcentrifuge
t b ( T bl 1)
tube (see Table 1).
4.
To make Standard 1, vortex the Quantifiler® THP DNA Standard for
3–5 s. Using a new pipette tip, add the appropriate volume of
Quantifiler® THP DNA Standard for your dilution series to the tube
for Standard 1 (see Table 1). Vortex to mix the dilution thoroughly,
and then either tap the tube or centrifuge to bring the liquid back
to the bottom.
5.
To prepare Standard 2, use a new pipette tip to add the appropriate
volume of the previously prepared standard to the tube to make the
next standard (see Table 1). Vortex to mix the dilution thoroughly,
and then either tap the tube or centrifuge to bring the liquid back
to the bottom. Repeat these steps for each subsequent standard
until you complete the dilution series (see Note 1). Diluted DNA
quantification standards can be stored for up to 2 weeks at 2–8 °C.
Longer-term storage is not recommended.
Table 1 Example preparation of DNA standards
Standard Concentration (ng/ Volumes

μL)
Std. 1 50.000 10 μL [100 ng/μL 10 μL Quantifiler® THP DNA Dilution
stock] Buffer
Std. 2 5.000 10 μL [Std. 1] 90 μL Quantifiler® THP DNA Dilution
Buffer
Buffer
Buffer
Buffer
This table provides an example of how to prepare the DNA standards

for the standard curve. Individual users can modify the volumes to best
suit their laboratory’s specific needs
3.2 Preparation of the Reaction Plate
1.
Calculate the volume of each component needed to prepare the
reactions. For each occupied well of the plate, there should be 8 μL
of Quantifiler® Trio Primer Mix and 10 μL of Quantifiler® Trio THP
PCR Reaction Mix (see Note 2).
2.
Vortex the Quantifiler® Trio Primer Mix for 3–5 s and then
centrifuge briefly before opening the tube.
3.
Gently vortex and centrifuge the Quantifiler® THP PCR Reaction
Mix before use.
4.
Pipet the required volumes of each component into a
microcentrifuge tube labeled “Master Mix” as calculated (see
5.
Vortex the Master Mix for 3–5 s, then centrifuge briefly.
6.
Dispense 18 μL of the Master Mix into each applicable well of a 96-
well optical reaction plate (see Notes 3 and 4).
7.
Add 2 μL of sample, standard, or control to the applicable wells (see
Note 4).
8.
Seal the reaction plate with an optical adhesive cover using an
adhesive film applicator (see Note 5).
9.
Place the plate in a plate centrifuge to spin the plate at 867 × g for
about 20 s. If using a mini-plate spinner, spin for 30–60 s. Inspect
for bubbles. If bubbles are present, tap the plate while still in the
base holder on the benchtop to bring the bubbles to the liquid
surface and centrifuge again, if necessary (see Note 6).
3.3 Processing the Reaction Plate

1. Turn on the instrument computer and the instrument. Launch the
HID Real-Time PCR Analysis Software and select the Quantifiler
Trio assay.
2.
Start a new experiment. In the Experiment Properties screen (see
Fig. 1), enter a name for the experiment. All of the other properties
on this screen should be defined (see Note 7).
3.
Click Plate Setup from the toolbar on the left side to create a plate
map by adding the sample names and their appropriate sample
type. Click Add New Sample and type the sample name. Repeat for
each sample. Click Assign Targets and Samples. The targets are
automatically assigned. Select the well and then select the sample
from the Assign column.
4.
Verify that the run method is correct under the following
parameters (see Fig. 2): number of cycles—40; holding stage—
95 °C for 2 min; initial cycling stage—95 °C for 9 s; and final cycling
stage—60 °C for 30 s.
5.
Save the experiment.
6.
Load the plate onto the instrument plate adapter to correspond
with the labeled corners of the instrument.
7.
Start the run by clicking on the Start Run button on the upper right
side of the software window. When the run ends, remove the plate
and allow it to cool to room temperature before handling. The plate
should be discarded after use in the appropriate waste container.
Fig. 1 Experiment properties screen. This is the Experiment Properties window. Once you
select your instrument, the other settings should already be pre-selected for you, including the
Experiment Type, Reagents, and Ramp Speed. You will use this window to name your
experiment. Many analysts choose to include the experiment date and their initials in the
experiment name but confirm the proper naming convention with your individual laboratory
Fig. 2 Run method parameters. These are the standard run parameters. Always verify that
your run parameters are correct before beginning your run
3.4 Evaluation of the Standard Curve and Interpretation of

Data
1.
After the run is complete, open the experiment for analysis (if it is
not already open) and click the green Analyze button on the upper
right side of the software window.
2. Verify that the standard curves for all three targets (large
autosomal, small autosomal, and Y) passed by clicking Analysis in
the left panel and then click on Standard Curve (see Fig. 3). To view
all three targets on the standard curve, select All from the Target
drop-down list in the Plot Settings. View the CT values for the
standards, slope, y-intercept, and R2 values. Figure 3 shows an
example of a standard curve with all three targets displayed. Verify
e a p e o a sta da d cu ve w t a t ee ta gets d sp ayed Ve y
that your standard curve is within the appropriate range (see Table
2 and Note 8).
3.
View the analysis summary (see Fig. 4) and evaluate the QC Flags
Detail in the specified tab (see Fig. 5 and Note 9).
4.
View the amplification plot by clicking Analysis, followed by
Amplification Plot (see Fig. 6).
5.
Export the results by clicking Analysis, followed by View Plate
Layout. Select the desired well(s) to export and then click Export.
Select Results as the type of data to export, select whether you want
separate files or one file, and then click Start Export.
6.
Review and assess the quality of the results (see Fig. 7 and Note
10).
Fig. 3 Example of standard curve with all target. The standard curve can be evaluated with all
targets overlapping as shown in this figure or you can select a specific target and evaluate the
individual standard curves
Table 2 Parameters for a good quantitation standard curve
Slope Y-intercept R2
Large autosomal −3.00 to −3.70 25.00–27.00a ≥0.980
Small autosomal −3.00 to −3.60 25.00–27.00a ≥0.980
Male −3.00 to −3.60 25.00–27.00a ≥0.980
This table shows the generally accepted ranges for a standard curve to
be considered suitable; however, each individual user should follow the
guidelines established by their validation studies done in their
laboratories and put forth in their protocols
aWhile the manufacturer has not provided a specified range for the y-
intercept value, our laboratory validation studies have shown that an

acceptable range is between 25.00 and 27.00. Again, these guidelines
should be established by each individual laboratory
Fig. 4 Example of analysis summary. This is an example of the analysis summary after a run is
completed. It is important to evaluate any thresholds that were not met. A green square
indicates a threshold has been passed. Red hexagons indicate a threshold has not been met
Fig. 5 Example of QC flags detail. By clicking on the QC Flags Detail tab, you can evaluate how
many wells (frequency) as well as which specific wells had a QC flag
Fig. 6 Example of amplification plot display. By highlighting all samples in the plate layout, you
can get an overview of the amplification plot for all of the samples together. You can also click
on individual samples to evaluate each sample’s amplification plot
Fig. 7 Example of exported results. After the data is exported, you can easily review the results
and the quality of the data, specifically any QC flags that did not pass. Use this information to
help make decisions as to whether the results are reliable or whether certain samples (or
perhaps even the entire plate) need to be rerun
4 Notes
1.
This is a ten-fold (1:10) dilution series with five concentration
points, as recommended by the manufacturer. DNA quantification
standards are important for the accurate analysis of run data.
Pipetting accuracy and consistency are critical in these steps.
2.
Including an additional 2–3 samples in your calculations will
provide excess volume for the loss that occurs during
pipetting/reagent transfers. It is helpful to create a plate setup
worksheet to do these calculations. Make sure you account for
standards and controls, such as reagent blanks, that were created
during other steps prior to quantitation. It is recommended to
load standards in duplicate and to also include a non-template
control that has no extracted sample in it. This is an additional
measure to confirm there is no contamination or issue with your
master mix.
I i h l f l 96 ll l f i h ill
3. It is helpful to use a 96-well plate map for setting up how you will
load your plate. Also, while preparing the reactions, keep the 96-
well optical reaction plate free from scratches and particulate
matter, and avoid touching the bottom of the plate. This can
interfere with fluorescence detection. Place your plate into a base
such as the Applied Biosystems MicroAmp 96-Well Base to protect
the bottom of the plate.
4.
As you begin to load the plate, pay careful attention again to the
way you are pipetting. Make the decision before beginning
whether you will stop at the first pipette stop when you eject the
liquid or if you will “blow it out” by completely depressing the
pipette plunger. Whichever method you decide, stay consistent.
Keep in mind that if you decide to completely depress the plunger,
while it may ensure that all of the liquid is ejected, you also
increase the potential for bubbles, which may affect fluorescence
and aerosol production, the latter of which may lead to potential
contamination.
5.
This is an important step to reduce well-to-well contamination
and sample evaporation. The cover should be carefully placed
evenly over the entire plate, and then use the applicator to go
through every column and row to ensure the adhesive is sticking
to the plate. Pay careful attention to the outer edges as well.
6.
Bubbles in reaction wells can cause noise in the fluorescence
signal and can affect results. If a centrifuge or plate spinner is not
available, you can try lightly tapping the plate while in the base
holder to remove the bubbles. Avoid scratching or smudging the
outer areas of the plate wells while doing this.
7.
The HID Real-Time PCR Analysis Software User Guide [12] should
be referred to for specific details on how to create a new
experiment. After selecting your instrument, the following
settings are standard: Experiment Type—Quantitation HID
Standard Curve; Reagents—TaqMan ® Reagents; and Ramp Speed
—Standard (~1 h to complete a run).
A slope of 3 3 indicates 100% amplification efficiency and an R2
8. A slope of −3.3 indicates 100% amplification efficiency, and an R2
value of 1.00 indicates a perfect fit between the regression line
and the data points. If the R2 value is <0.98, some laboratory
protocols will allow for the removal of one or more data points,
but caution should be taken if removing points from the standard
curve, as doing so will affect the CT values of the samples and may
decrease the accuracy of the results. If the standard curve fails, the
quantitation values for the samples are inconclusive. Depending
on how much sample extract you have to work with and where
you think the error occurred, you will need to redo the plate and
possibly remake the standards. If you believe the standard
dilution series was made incorrectly, remake the standards. If you
believe it was a pipetting error when loading the plate or some
other plate-specific error, remake the plate with the previously
made standards.
9.
The degradation index value flags can be used to evaluate the
quality of a sample. The degradation index is automatically
calculated in the software by dividing the small autosomal target
DNA concentration (ng/μL) by the large autosomal target DNA
concentration (ng/μL). This index can be affected by both
degraded samples and the presence of inhibitors, which may
disproportionately affect the amplification of the large autosomal
target. A degradation index less than 1 indicates that a sample is
not likely degraded or inhibited. An index between 1 and 10
indicates slight to moderate degradation and possible inhibition.
An index greater than 10 indicates significant degradation.
10. The IPC CT value flags can also be used to evaluate the quality of a
sample. When reviewing the results, the IPC CT values should be
evaluated to determine whether the samples are truly negative or
if something has negatively impacted the reactions. Samples that
are truly negative will have successful amplification of the IPC and
no signal detected for the other three targets. Samples that are
potentially inhibited will have no amplification or suppressed
amplification when compared against the average IPC CT values of
the samples. Also, by comparing the degradation index (see Note
9) to the IPC CT flag, you can evaluate whether your sample is
more likely degraded or inhibited. The IPC values of samples
should be compared to the IPC CT values of standards with similar
concentrations. The values should be relatively consistent;
however, it should be noted that a higher-than-average IPC CT
value is not always an indication of inhibition. Samples with
concentrations of DNA may have higher IPC CT values without the
presence of inhibitors. Laboratories should develop their own
interpretation guidelines by performing validation studies.
However, samples with IPC CT values that are two cycles higher
than the average should be considered for possible inhibition.
Acknowledgment
We thank the George Mason University College of Science and the
Forensic Science Program for supporting the forensic DNA laboratory.
References
1. Thermo Fisher Scientific (2018) Quantifiler™ HP and Trio DNA Quantification Kits user
guide, revision H. Available via Thermo Fisher Scientific. https://assets.thermofisher.com/
TFS-Assets/LSG/manuals/4485354.pdf. Accessed 05 May 2022
2. Horsman KM, Hickey JA, Cotton RW et al (2006) Development of a human-specific real-

time PCR assay for the simultaneous quantitation of total genomic and male DNA. J
Forensic Sci 51(4):758–765. https://doi.org/10.1111/j.1556-4029.2006.00183.x
[Crossref][PubMed]
3. Westring CG, Kristinsson R, Gilbert DM et al (2007) Validation of reduced-scale reactions

for the Quantifiler® Human DNA kit. J Forensic Sci 52(5):1035–1043. https://doi.org/10.
1111/j.1556-4029.2007.00525.x
4. Butler JM (2005) Forensic DNA typing: biology, technology, and genetics of STR markers,
2nd edn. Elsevier Academic Press, London, pp 111–124
5. Green RL, Roinestad IC, Boland C et al (2005) Developmental validation of the Quantifiler®
real-time PCR kits for the quantification of human nuclear DNA samples. J Forensic Sci
50(4):1–17. https://doi.org/10.1520/jfs2004478
[Crossref]
6. Gouveia N, Brito P, Serra A et al (2015) Validation of Quantifiler® Trio DNA Quantification

Kit in forensic samples. Forensic Sci Int: Genet Suppl Ser 5:e24–e25. https://doi.org/10.
1016/j.fsigss.2015.09.010
7.
Holt A, Wootton SC, Mulero JJ et al (2016) Developmental validation of the Quantifiler® HP
and Trio kits for human DNA quantification in forensic samples. Forensic Sci Int Genet
21:145–157. https://doi.org/10.1016/j.fsigen.2015.12.007
8. Janssen K, Olsen M, Olsen GH et al (2015) Validation of automated PCR-setup of the

Quantifiler® Trio DNA Quantification Kit on the Biomek® 4000 laboratory automation
workstation. Forensic Sci Int Genet Suppl Ser 5:e587–e589. https://doi.org/10.1016/j.
fsigss.2015.09.232
9. Vieira-Silva C, Afonso-Costa H, Ribeiro T et al (2015) Quantifiler® Trio DNA validation and

usefulness in casework samples. Forensic Sci Int Genet Suppl Ser 5:e246–e247. https://doi.
org/10.1016/j.fsigss.2015.09.098
10. Cho Y, Kim HS, Kim M et al (2017) Validation of reduced reagent volumes in the
implementation of the Quantifiler® Trio quantification kit. J Forensic Sci 63(2):517–525.
https://doi.org/10.1111/1556-4029.13578
11. Ballantyne J, Hanson E, Green R et al (2013) Enhancing the sexual assault workflow: testing
of next generation DNA assessment and Y-STR systems. Forensic Sci Int Genet Suppl Ser
4(1):e228–e229. https://doi.org/10.1016/j.fsigss.2013.10.117
[Crossref]
12. Thermo Fisher Scientific (2018) HID real-time PCR analysis software user guide. Available
via Thermo Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/
MAN0009819_HID_PCRAnalysisSoftware_UG.pdf. Accessed 05 May 2022
https://doi.org/10.1007/978-1-0716-3295-6_12
12. QIAGEN’s Investigator®

Quantiplex® Pro Kit
Michelle D. Bonnette1
(1) InVita Healthcare Technologies, Jacksonville Beach, FL, USA
Abstract
The QIAGEN Investigator® Quantiplex® Pro Kit is a real-time
quantitative PCR assay utilized by forensic DNA laboratories to
determine the amount of amplifiable human and male DNA in a sample
prior to downstream amplification of specific STR markers for human
identity testing. This quantification method includes two internal
controls that assist the analyst in a preliminary evaluation of the
sample in regard to both inhibition or degradation that may be present
in the sample and subsequently affect the more targeted downstream
amplification of specific markers for identity testing. The internal
controls are analogous to the quality sensors contained in QIAGEN’s
Investigator® 24plex line of amplification kits, ensuring that the
sample’s performance in the quantitation step can accurately predict
the success of the STR amplification results. This chapter describes the
physical plate setup of a quantitative PCR assay utilizing the QIAGEN
Investigator® Quantiplex® Pro Kit as well as the steps and software
configurations involved in running such a plate on the Applied
Biosystems 7500 Real-Time PCR System for Human Identification using
HID Real-Time PCR Analysis Software v1.1 or 1.2.
Key words Forensic DNA – Quality sensors – Quantification – Real-

time qPCR – DNA degradation – DNA inhibition
1 Introduction
It is essential to assess the quantity of DNA present in an extract prior
to amplification in order to obtain the appropriate results. The
Investigator® Quantiplex® Pro Kit (Quant Pro; QIAGEN, Hilden,
Germany) is a real-time quantitative polymerase chain reaction (qPCR)
simultaneously running four assays designed to use a small portion of
an extract to estimate the total quantity of amplifiable human DNA and
male DNA present in the sample. The results obtained can also aid in
determining the quantity of extract needed for an STR reaction, the
ratio of male to female DNA present in a sample, and the level of DNA
degradation, as well as the presence of possible PCR inhibitors in the
extract. This robust assay can produce accurate results for low
quantities of male DNA even in the presence of abundant female DNA
(up to 2,500,000:1), which is often the case with sexual assault
evidence [1].
The kit consists of sequence-specific primers, sequence-specific
TaqMan® probes labeled with fluorescent dyes, and a reaction mix
containing deoxyribonucleotide triphosphates (dNTPs) [2]. The
reagents are mixed with a small volume of sample extract and then
placed in a real-time qPCR instrument, such as an Applied Biosystems®
7500 Real-Time PCR System (7500), for analysis. At the start of PCR
thermal cycling, the TaqMan® probes are intact and the proximity of
the quencher on the 3’ end of the probe and the reporter fluorescent
dye on the 5’ end prevents the emission of fluorescence [3]. During
synthesis, the QuantiNova® DNA Polymerase, a novel hot-start enzyme,
hydrolyzes the probes, thereby separating the quenchers from the
reporter dyes [2]. A CCD camera enclosed within the real-time
instrument records the resulting fluorescence. The amount of
fluorescence emitted from each sample is proportional to the amount of
DNA that is amplified through each cycle of the PCR process. The
analysis software plots the amount of fluorescence emitted with each
cycle number from each dye, compares it to a series of known quantity
standards, and estimates the amount of human and male DNA present
in each sample extract. This estimate is based upon the value of the
cycle threshold (CT). The sooner it takes a sample to cross the
fluorescence threshold (i.e., fewer cycles), the greater the initial
number of DNA molecules present in the sample extract.
The shorter of the autosomal targets in this kit is a 91-base pair
(bp) proprietary region of the 4NS1C® locus, which is present on
numerous autosomes in the human genome [2]. This target region is
detected using the FAM™ dye channel on the real-time instrument. In
addition to this 91 bp target, a longer 353 bp region of the 4NS1C®
locus is amplified as the longer autosomal target [2]. Because of its
increased length, this longer target is more susceptible to degradation
and can therefore provide a helpful assessment of the overall
degradation of each sample. This target is visualized in the TAMRA dye
channel, while the male target is an 81 bp fragment visualized using the
Cy®5 dye channel, and the 434 bp internal [positive] control (IC) is
detected in the JOE™ dye channel [2].
2 Materials
1.
Applied Biosystems 7500 Real-Time PCR System .
2.
96-well optical reaction plate and compatible base.
3.
Optical adhesive film.
4.
Adhesive film applicator.
5.
Investigator® Quantiplex® Pro Kit: Contains Quantiplex Pro
Reaction Mix, Quantiplex Pro Primer Mix, Male Control DNA M1
(50 ng/μL), QuantiTect® Nucleic Acid Dilution Buffer, and Quick-
Start Protocol. Store at −30 °C to −15 °C immediately upon receipt
(see Note 1).
3 Methods
This protocol is based on the manufacturer’s recommendations for the
Investigator® Quantiplex® Pro Kit [2]. One duplicate set of four
standards ranging from 0.0025 ng/μL to 50 ng/μL is processed with
each plate. These standards establish the standard curve, which is
utilized to estimate the quantity of DNA in each sample. The standard
curve should be evaluated after each run using the values in Table 1 as
a guideline (see Note 2). Present in the master mix, and thus each
sample, is an internal control (IC). This control is added in a fixed
concentration and should demonstrate that amplification occurred
properly within each sample (see Note 3). A No-Template Control
(NTC) consisting of master mix and 2 μL QuantiTect Nucleic Acid
Dilution Buffer should be run with each plate. The NTC sample should
be evaluated after each run and should quantify as a negative sample,
and its IC should be in the appropriate range (see Note 4). Lastly, any
extraction reagent blanks associated with the samples being quantified
should also be taken through this quantification step. The quantitation
plate should be set up in a hood or biological safety cabinet while
wearing appropriate personal protective equipment (see Note 5).
Table 1 Recommended guidelines for acceptable ranges of standard curve values by target
Total human target Male target Degradation target

Slope −3.362 to −3.059 −3.426 to −3.107 −3.331 to −2.997
Y-intercept 25.357 to 26.419 23.508 to 24.762 24.600 to 27.034
R2 ≥0.99 ≥0.99 ≥0.99
Evaluate the standard curves using these recommended values and

adjust upon further internal validation at your laboratory
3.1 Preparation of DNA Standards

1.
There are four concentration points in the standard curve for each
assay. The control DNA contains pooled male DNA at a
concentration of 50 ng/μL. To ensure pipetting accuracy, the
minimum input volume of DNA for dilutions should be 5 μL. The
standard curve is designed to be set up using a 1:27 dilution
series (see Note 6). Table 2 shows an example of the standard
dilution series with concentrations ranging from 50 ng/μL to
0.0025 ng/μL.
2. Label four microcentrifuge tubes as Standard 1, Standard 2,
Standard 3, and Standard 4.
3.
Vortex and pulse spin both the Male Control DNA M1 and
QuantiTect Nucleic Acid Dilution Buffer thoroughly.
4.
Aliquot 130 μL undiluted Male Control DNA M1 into the Standard
1 tube.
5.
Aliquot 130 μL of QuantiTect Nucleic Acid Dilution Buffer into
each of Standard tubes 2 through 4.
6.
Pipette 5 μL of Standard 1 into Standard 2.
7.
Vortex for at least 5 s and pulse spin this dilution briefly before
removing an aliquot for the next dilution.
8.
9.
Vortex for at least 5 s and pulse spin this dilution briefly before
removing an aliquot for the next dilution.
10.
11.
Vortex for at least 5 s and pulse spin this dilution briefly (see Note
7).
Table 2 Quantification standards preparation guide
Standard DNA standard amount QuantiTect Nucleic Acid Standard DNA

Dilution Buffer amount concentration (ng/
μL)
Standard 130 μL of undiluted Male N/A 50
1 Control DNA M1 (50 ng/μL)
Standard 5 μL of standard 1 130 μL 1.8519
2
3
Standard DNA standard amount QuantiTect Nucleic Acid Standard DNA
Dilution Buffer amount concentration (ng/
μL)
4
This table depicts the smallest final volumes for standards preparation.
To ensure pipetting accuracy, the minimum input volume of DNA for
dilutions should be 5 μL. These volumes provide approximately 30
plates worth of standard curves and are stable for 1 week after
preparation. Volumes may be scaled up to accommodate laboratories
with higher expected usage
3.2 Quantification Setup

1.
Determine the amount of each reagent needed for the master mix
by calculating the total number of samples, standards, and controls
on the plate multiplied by the amount of each reagent needed per
reaction (see Note 8). The master mix should consist of 9 μL
Quantiplex Pro Reaction Mix and 9 μL Quantiplex Pro Primer Mix
per reaction (see Table 3).
2.
If not already thawed, thaw the primer and reaction mixes
completely. Vortex and pulse spin prior to use.
3.
Add the calculated volumes to an appropriately sized tube. Vortex
and pulse spin the master mix prior to use.
4.
Obtain a 96-well optical reaction plate, place it in a base, and
dispense 18 μL of master mix into each sample well to be used (see
Notes 5 and 9).
5.
Add 2 μL of each sample, standard, or control (use the QuantiTect®
Nucleic Acid Dilution Buffer for NTCs) to the appropriate wells (the
standards are run in duplicate) (see Note 5).
6. Seal the plate with an optical adhesive cover (see Note 10). Avoid
touching the center of the optical cover. Fingerprints or smudges
can affect fluorescence, leading to erroneous readings. If a print or
smudge occurs, clean the area with at least 70% ethanol or
g , %
isopropanol and a clean, lint-free lab wipe.
7.
Vortex and centrifuge the plate to ensure all liquid is in the bottom
of each well and to remove any bubbles in the bottom of the wells
(see Note 11).
Table 3 qPCR reaction composition
Component Volume per reaction (μL)

Quantiplex Pro Primer Mix 9
Quantiplex Pro Reaction Mix 9
DNA 2
Total volume 20
It is recommended to add at least 5% extra samples in your calculations

for the master mix preparation (Quantiplex Pro Primer Mix and
Quantiplex Pro Reaction Mix) to account for any loss during the transfer
steps. 18 μL of the master mix will be added to the 2 μL of DNA,
standard, or control sample for a total reaction volume of 20 μL
3.3 Creating an Instrument Plate Record and Starting a

Run on the 7500
1.
Turn on the computer with the HID Real-Time PCR Analysis
Software v1.1 or 1.2 and log on.
2.
Turn on the instrument by pressing the blue power button on the
lower right front of the instrument.
3.
Open the HID Real-Time PCR Analysis Software in the Custom
Assays mode.
4. If you are using a template file, then select New Experiment -
> From Template (see Fig. 1), select the correct template file from
its stored location, and proceed to assign the samples, standards,
and controls to the plate setup (see Subheading 3.3, step 8). If you
are not using a template file, proceed with the next step (see
Subheading 3.3, step 5) (see Note 12).
5.
If you are not using a template file, select the Advanced Setup by
clicking on the arrow below the Design Wizard (see Figs. 2 and 3).
6.
Once the new window opens, enter a new Experiment Name in
the appropriate field. Select the following settings: Instrument:
7500 (96 Wells); Experiment Type: Quantitation—Standard
curve; Reagents: TaqMan Reagents; Ramp Speed: Standard; and
unselect the Include Melt Curve option (see Fig. 4).
7.
Click on Plate Setup from the menu on the left and define the four
targets in the Define Targets section (see Note 13). Select the
following Reporter settings: Human: FAM; IC: JOE; Degradation:
TAMRA; and Male: Cy5. Select “None” for all four of the targets’
Quencher settings (see Fig. 5).
8.
If an import file was generated in the QIAGEN Quantification
Assay Data Handling Tool, go to File, Import, and browse to the
.txt import file to import the plate setup with standards, sample
names, and targets (see Notes 14 and 15). If the plate setup is
imported, proceed to (1) programming the thermal cycler if you
did not use a template or (2) saving and starting the run if a
template was used (see Subheading 3.3, step 14 or 16,
respectively).
9.
If an import file was not generated, define the names of the
samples, controls, and standards (e.g., Standard 1 or Std1,
Standard 2 or Std2, etc.) using the Define Samples tool on the
right panel (see Note 16).
10.
If replicates are needed, they should be assigned before
proceeding to the next step. Define replicates by using the same
sample name or by using the Define Biological Replicate Groups
panel. Switch to the tab Assign Targets and Samples. In the Plate
Layout, select the wells in use and assign all four Targets by
checking the boxes (see Fig. 6 and Note 17).
11. Select the wells for the no-template controls (NTC) and flag them
as Negative Control using the gray N button Leave the IC (JOE)
as Negative Control using the gray N button. Leave the IC (JOE)
Task for NTC reactions set to Unknown. Enter the sample name.
12.
Select the wells for the standard curve and flag them as Standard
using the orange S button. Select Quantity for the appropriate
detector and enter the quantity of DNA in the well in accordance
with the DNA standards (see Table 1). Although units are not
entered for Quantity, a common unit must be used for all standard
quantities (e.g., ng/μL). The units used for standard quantities
define the quantification units for the analysis of results. Leave the
IC (JOE) Task for standard reactions set to Unknown.
13.
Assign the samples to the plate layout by clicking on the wells and
checking the appropriate box on the left panel (see Fig. 7).
14.
Click Run Method from the menu on the left. Program the cycler
according to Table 4.
15.
On the thermal profile, verify the holding times against those in
Table 4 and ensure the sample volume is set to 20 μL (see Fig. 8).
16.
To save the plate document, select File > Save As.
17.
Select the location for the plate document.
18.
Enter a file name.
19.
For file type, select Experiment Document Single files (*.eds).
20.
Click Save.
21.
Open the instrument’s plate holder tray by pressing on the
depressed circle in the blue strip on the front of the instrument.
22.
Once the plate holder tray opens, position the plate so that well
A1 is in the upper left corner and the notched corner is in the
upper right.
23. Gently push the plate holder closed.
24.
Click the green Start Run button at the top right of the screen in
the HID Real-Time PCR Analysis Software. The run takes
approximately 1 h to complete.
Fig. 1 Home screen for the HID Real-Time PCR Analysis Software v1.1 or 1.2. This screenshot
shows how to start a new experiment from a template. (Reproduced from Ref. [2] with
permission from QIAGEN)
Fig. 2 Starting a new experiment. If not using a template, the user will need to select Advanced
Setup by clicking the arrow button directly below the Design Wizard. (Reproduced from Ref. [2]
with permission from QIAGEN)
Fig. 3 Starting a new experiment using Advanced Setup. The Advanced Setup option becomes
available and will be utilized if not using a template. (Reproduced from Ref. [2] with permission
from QIAGEN)
Fig. 4 Selecting the correct “Experiment Properties” settings. The specific properties of the
experiment, like the instrument used and experiment type, are defined in this screen.
(Reproduced from Ref. [2] with permission from QIAGEN)
Fig. 5 Selecting the correct “Target” settings. This screen allows the user to define and
configure the four targets specific to the Investigator® Quantiplex® Pro DNA Quantification
Kit. (Reproduced from Ref. [2] with permission from QIAGEN)
Fig. 6 Assigning the Targets. This screen allows the user to assign the targets to the wells in
use, as well as specify which wells are to contain unknown samples, controls, or standards and
specify the quantity of those standards. (Reproduced from Ref. [2] with permission from
QIAGEN)
Fig. 7 Entering the sample names and assigning the samples. To assign the samples to the plate
layout, click the appropriate well and check the appropriate box(es) on the left side of the
screen. (Reproduced from Ref. [2] with permission from QIAGEN)
Table 4 Thermal cycling parameters
Step Temperature Time Number of Comment

cycles
Initial PCR activation 95 °C 3 min 1 Hot-start to activate DNA
polymerase
2-step cycling:
Denaturation 95 °C 5s 40
Combined 60 °C 35 s 1 Perform fluorescence data
annealing/extension collection
Program the thermal cycler according to these specifications
Fig. 8 Adjusting the thermal profile (HID Real-Time PCR Analysis Software v1.2). The thermal
profile should be adjusted to match what is displayed in this figure. (Reproduced from Ref. [2]
with permission from QIAGEN)
3.4 Analyzing a Run

1.
Open the completed run file using the HID Real-Time PCR
Analysis Software by opening the software in the Custom Assays
Mode, then go to Open, and then Browse to locate the saved file.
2. In the Amplification Plot tab (found in the Analysis tab of the
menu on the left), select all sample wells in the View Plate Layout
tab. Click the Analysis Settings button (on the right side of the
window, next to Analyze/Reanalyze). Set all the analysis
thresholds: Male to 0.2, Degradation to 0.2, and IC to 0.05 (see Fig.
9 and Notes 18 and 19).
3.
Use a Manual Baseline with Start Cycle set to 3 and End Cycle set
to 15 for all targets.
4.
Verify that options for Auto Threshold and Auto Baseline are
deselected for all targets.
5.
To view the standard curve, select the Standard Curve tab (found
in the Analysis section of the menu on the left).
6.
View the calculated regression line, slope, y-intercept, and R2
values (see Fig. 10). Evaluate the standard curve for each Target
using the values listed in Table 1. At the top of the Standard Curve
graph is a dropdown menu where you can toggle between the
various Targets and the values below the graph update
accordingly. The slope indicates the amplification efficiency of the
standard reactions. The R2 (correlation coefficient) indicates the
closeness of fit between the regression line and the individual
data points. The Y-intercept indicates the expected CT value for a
sample with a quantity of 1 ng/μL (see Notes 20 and 21).
7.
View the concentrations of the unknown samples by clicking on
the View Well Table tab on the right half of the screen (see Fig. 11)
to display data for the selected wells. This summarizes the data
from the four targets in the unknown samples. The Human Target
shows the quantity of DNA present with the same units as used
for the standards (i.e., if ng/μL was used for the definition of the
standards, then the quantities for the unknowns will be reported
in ng/μL). The Male and Degradation Targets show the quantity of
male and human DNA present, respectively, with the same units as
used for the standards (see Note 22). The IC Target shows the CT
value for the internal control (see Note 23).
8. To export and save the results report, go to File, followed by
Export, and then Results. The analysis settings must be saved first,
and then the results may be saved in either .txt or .csv format.
9.
A run report may also be generated by clicking on Print Report at
the top of the screen. Select the desired information to be
included in the report in the window that opens. Click Print
Report.
10.
Remove the plate from the instrument, discard, and power down
the instrument.
Fig. 9 Sample analysis for the QPP_FAM, QPP_JOE, QPP_ATTO550, and QPP_ATTO647N
channels. From the Amplification Plot tab, you can cycle through the various detectors to set the
thresholds and baseline. (Reproduced from Ref. [2] with permission from QIAGEN)
Fig. 10 Standard curve. The standard curve for each detector is visualized via the Standard
curve tab. Users can cycle through the various detectors via the Target dropdown in the upper
left side of the tab. (Reproduced from Ref. [2] with permission from QIAGEN)
Fig. 11 Unknown sample concentrations. The View Well Table tab displays results data for
each well separated by Target. (Reproduced from Ref. [2] with permission from QIAGEN)
4 Notes
1.
Kit reagents should be stored immediately upon receipt at −30 °C
to −15 °C in a constant-temperature freezer. After first use, store
the kit components at 2–8 °C. Avoid re-freezing the kit
components. The QuantiTect Nucleic Acid Dilution Buffer may also
be stored at −30 °C to −15 °C, if desired. Quantiplex Pro Primer
Mix must be stored protected from light. Each lot of kits must be
evaluated prior to use in casework.
2.
These values are a general guideline. Internal validation within
your laboratory will dictate the best performance standards to be
utilized in your laboratory’s setting.
3.
If the CT value of the IC is shifted by greater than or equal to
1 cycle (as compared to the ICs of the standards), it is possible
inhibition may have occurred during the PCR process.
4.
If an NTC exhibits a quantity value for the human, male, or
degradation target, none of the data associated with the run can
be used. The assay must be repeated.
5.
Extra care must be taken to be certain that the proper orientation
of the plate is used. It is necessary to keep the reaction plate in a
base (such as a MicroAmp™ 96-Well Base) at all times and to
utilize a plate map.
6.
If using QuantiTect Nucleic Acid Dilution Buffer to dilute the
Control DNA, the dilutions are stable for at least 1 week at 2–8 °C.
7.
The final volumes of the standards may be increased to fit the
laboratory’s needs. Additionally, other standard curve
configurations including more points can also be utilized—see
“Appendix: Alternative Standard Curves” in the Investigator®
Quantiplex® Pro Handbook.
8. It is recommended to add at least 5% extra samples to the
calculations to account for any loss during pipetting.
9.
Placing the 96-well plate directly on a counter/surface or
touching the outside of the wells in any way may interfere with
subsequent fluorescent readings.
10.
Ensure the plate is securely sealed around the outer edges and
between wells using an adhesive film applicator tool, such as the

MicroAmp™ Adhesive Film Applicator tool. A proper seal is vital to
preventing evaporation during thermal cycling or cross-
contamination between wells.
11.
If all the well contents are not at the bottom of the well, the
reaction may yield faulty results. Likewise, having a bubble in the
bottom of the well can adversely affect the fluorescent readings,
also yielding inaccurate results.
12.
The template file loads all of the settings needed to start an
Investigator Quantiplex Pro run, including the standard curve
settings, the cycling profile, and the targets needed for
fluorescence acquisition. Download the template files from the
product resources page [4].
13.
By default, only two targets are shown. Click on Add New Target
to add the additional two targets.
14.
Download the QIAGEN Quantification Assay Data Handling Tool
from the product resources page [5].
15. If using the QIAGEN Quantification Assay Data Handling Tool
(strongly recommended for easy to visualize quantification
results), use the import sheet rather than manually entering all
data in the HID Real-Time PCR Analysis Software. The
Quantification Setup tab in the QIAGEN Quantification Assay Data
Handling Tool allows users to select their quantification
instrument, enter sample IDs, arrange standards in the
orientation of your choice, and automatically generate a batch
import file with all of this information configured appropriately
for the instrument chosen.
16.
Naming of Standards is required for proper subsequent analysis
with the QIAGEN Quantification Assay Data Handling Tool.
17.
Important: Do not highlight the wells that are not in use (i.e.,
those without reaction mix). Including unused wells will
significantly impact the scale of the X and Y axes when viewing the
data.
18.
These threshold values are a general guideline. Internal validation
within your laboratory will dictate the best threshold settings to
be utilized in your laboratory’s setting.
19.
These thresholds are also pre-defined in the template file found
on the product resources page [4].
20.
If the standard curve values fall outside the guidelines, one non-
concordant point may be removed from the standard curve. To
remove a point, click on the appropriate well to highlight it, then
right-click and select Omit, then select Well. Once a point has been
removed, click the green Analyze button at the top right of the
screen to recalculate the standard curve.
21.
If the slope, y-intercept, and/or R2 values are still out of range
after one point has been deleted, all samples should be
interpreted with caution or re-quantified. QIAGEN does not
recommend the use of the Auto Threshold or Auto Baseline
features, even when the standard curves do not pass using the
conditions supplied in this chapter.
22.
If the quantity of the smaller autosomal Human Target is
significantly larger than that of the larger autosomal Degradation
Target, this is indicative of degradation in the sample. For
example, if using the Qiagen Quant Assay Data Handling Tool to
import your quantitation results, the tool is defaulted to flag
samples for possible degradation when there is a ten-fold increase
in value of the Human target.
23 When the sample IC CT is significantly greater than expected (at
23. When the sample IC CT is significantly greater than expected (at
least 1 cycle), this is a possible sign of PCR inhibition and such
samples should be interpreted with caution. It may be beneficial
to re-quantify using a set of dilutions to dilute out any inhibitors
present in the sample. Possible inhibition detected by the IC is not
an absolute indicator that there will be inhibition observed with
amplification used in association with the development of STR
profiles for human identification.
References
1. Vraneš M, Scherer M, Elliott K (2017) Development and validation of the Investigator®
Quantiplex Pro Kit for qPCR-based examination of the quantity and quality of human DNA in
forensic samples. Forensic Sci Int Genet Suppl Ser 6:e518–e519. https://doi.org/10.1016/j.
fsigss.2017.09.207
2. QIAGEN (2018) Investigator® Quantiplex® Pro handbook. Available via QIAGEN. https://
www.qiagen.com/us/resources/resourcedetail?id=901fab34-fae8-4247-bc24-
057840b27c50&lang=en. Accessed 31 July 2022
3. Quintas Gonçalves JA (2021) Quantitative and qualitative evaluation of human and male
DNA in sexual assault cases: validation of the Investigator Quantiplex Pro RGQ Kit and
comparison with the Quantifiler Trio DNA Quantification Kit. Dissertation, University of
Porto
4. QIAGEN (2022) Investigator Quantiplex Pro template files ABI 7500. Available via QIAGEN.
www.qiagen.com/QPpro-template-files. Accessed 31 July 2022
5. QIAGEN (2022) QIAGEN Quantification Assay Data Handling and STR Setup Tool v4.0.
Available via QIAGEN. www.qiagen.com/QIAGEN Quantification Assay Data Handling
Toolhttps://www.qiagen.com/us/resources/resourcedetail?id=ba2c4611-5a06-4842-a9f6-
827f8b54848e&lang=en. Accessed 31July2022
Part IV
STR Amplification
https://doi.org/10.1007/978-1-0716-3295-6_13
13. DNA Amplification Using Promega’s

PowerPlex® Fusion Systems (5C and
6C)
Caitlin McCaughan1 and Kristy A. Lenz2
(1) Bexar County Criminal Investigation Lab, San Antonio, TX, USA
(2) Promega Corporation, Madison, WI, USA
Caitlin McCaughan
Email: caitlin.mccaughan@bexar.org
Abstract
Multiplex amplification and typing of short tandem repeat (STR) loci
enable the rapid characterization of forensic samples for human
identification purposes with the potential for high discriminatory
power. Many commercial multiplex kits are available for consideration
and purchase by DNA testing laboratories, including the PowerPlex®
Fusion 5C and PowerPlex® Fusion 6C Systems offered by Promega
Corporation. Herein we describe full-volume and half-volume
amplification protocols utilizing extracted DNA for these respective
multiplex kits, as well as procedures for direct amplification of lytic and
nonlytic storage card punches and swabs.
Key words DNA amplification – Forensic science – Polymerase chain

reaction (PCR) – Short tandem repeat (STR) – PowerPlex® Fusion –
CODIS
1 Introduction
DNA amplification utilizing polymerase chain reaction (PCR) and
subsequent typing of short tandem repeat (STR) loci offers a highly
discriminatory method for forensic human identification. PCR enables
the targeting of specific regions of DNA via primers and employs a
cycling process to exponentially amplify the input DNA. The current
method for forensic DNA analysis is the amplification and detection of
STR loci. STR loci are highly variable and consist of short repeat
sequences in which alleles can be distinguished by the number of
copies of the repeat sequence [1, 2]. The highly polymorphic nature of
STR loci enables them to be informative of PCR-based genetic markers
for forensic human identification, providing strong discriminatory
power [3].
In order to effectively deploy a national DNA database for forensic
purposes, DNA testing laboratories needed to employ a standard set of
STR loci that could be compared. Originally, 13 core Combined DNA
Index System (CODIS) loci were selected, with the Federal Bureau of
Investigation increasing this requirement to 20 core STR loci in 2017
[4, 5]. Following the expansion of the CODIS core loci, several
commercial STR multiplex kits became available for consumer
purchase that included these 20 loci and additional discriminatory loci.
Multiplex kits allow the simultaneous amplification and fluorescent
detection of multiple STR loci in a single reaction. Two such kits offered
include the PowerPlex® Fusion 5C and PowerPlex® Fusion 6C Systems
from Promega Corporation (Madison, WI).
The PowerPlex® Fusion 5C (Fusion 5C) System is a five-dye
multiplex consisting of 22 autosomal STR loci, 1 Y-chromosome STR (Y-
STR) locus, and Amelogenin as a sex-indicating locus. Fusion 5C
includes the following core CODIS loci: CSF1PO, FGA, TH01, TPOX, vWA,
D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51,
D21S11, D1S1656, D2S441, D10S1248, D12S391, D22S1045, D2S1338,
and D19S443, as well as Penta E, Penta D, Amelogenin, and DYS391 (see
Fig. 1) [1, 6, 7]. Three years after the release of the Fusion 5C System,
Promega released PowerPlex® Fusion 6C (Fusion 6C), a six-dye STR
multiplex. Fusion 6C enables the inclusion of more loci, a total of 27,
within a single reaction because of the addition of the purple (TOM) dye
channel, increasing the overall discriminatory power. The included loci
consist of the core 20 CODIS loci; 3 Y-STRs (DYS391, DYS576, and
DYS570); and Amelogenin, Penta D, Penta E, and SE33 (see Fig. 1) [7–9].
Both Fusion 5C and Fusion 6C provide accurate, robust, and sensitive
STR genotyping suitable for forensic casework [10, 11]. In addition, the
PowerPlex® Fusion Systems are compatible with both full- and half-
volume reactions, as well as direct amplification reactions from several
common sample substrates including DNA storage cards and swabs [12,
13]. Half-volume reactions allow for similar amplification performance,
while utilizing less reagents, enabling a more cost-effective method for
laboratories purchasing large amounts of consumables. Direct
amplification allows laboratories to perform amplification with
minimal pre-processing of buccal and blood samples and is generally
used for databasing purposes.
Fig. 1 PowerPlex® Fusion 5C and 6C Loci. The configuration of loci included in the
PowerPlex® Fusion 5C System (top) and the PowerPlex® Fusion 6C System (bottom) are
displayed. Fusion 5C allows the co-amplification and subsequent fluorescent detection of 24
loci, while Fusion 6C includes 27 loci within a single reaction utilizing an additional dye
channel. (Reproduced from Ref. [7] with permission from the Promega Corporation)A*
= Amelogenin
2 Materials
Per manufacturer recommendations, the following protocols were
developed for use with previously extracted and purified DNA or direct
amplification samples. The optimal concentration of template DNA per
full-volume reaction is 0.25–0.5 ng for Fusion 5C and 1 ng for Fusion 6C
[1, 8]. For half-volume reactions, studies have shown an optimal DNA
input of 0.5 ng for Fusion 5C and 0.5–0.75 ng for Fusion 6C [14, 15].
Template DNA input amount is best determined on a per-laboratory
basis and depends on a variety of factors. This should be optimized
based on internal validation results.
2.1 PowerPlex® Fusion 5C System

1.
Pre-amplification Components Box: PowerPlex® Fusion 5X Master
Mix, PowerPlex® Fusion 5X Primer Pair Mix, 2800M Control DNA,
and Amplification Grade Water (see Note 1).
2.
Post-amplification Components Box: PowerPlex® Fusion Allelic
Ladder Mix and WEN Internal Lane Standard 500 (see Note 1).
2.2 PowerPlex® Fusion 6C System

1.
Pre-amplification Components Box: PowerPlex® Fusion 6C 5X
Master Mix, PowerPlex® Fusion 6C 5X Primer Pair Mix, 2800M
Control DNA, and Amplification Grade Water (see Note 2).
2.
Post-amplification Components Box: PowerPlex® Fusion 6C Allelic
Ladder Mix and WEN Internal Lane Standard 500 (see Note 2).
2.3 All Amplification Protocols

1.
TE−4 buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0. To prepare TE−4
buffer, mix together 10 mL of 1 M Tris-HCl (pH 8.0), 0.2 mL of 0.5 M
EDTA (pH 8.0), and 990 mL of deionized water. Alternatively,
dissolve 1.21 g Tris base and 0.037 g EDTA (Na2EDTA • 2H2O) in
900 mL deionized water. Adjust to pH 8.0 with HCl. Bring the final
volume to 1 L with deionized water. Autoclave after combining all
components (see Note 3).
2. Thermal Cycler: GeneAmp® PCR System 9700 with a gold-plated
silver or silver sample block; Veriti® 96-Well Thermal Cycler; or
ProFlex® PCR System (see Note 4).
3.
Centrifuge compatible with 96-well plates or reaction tubes.
4.
Aerosol-resistant pipette tips (see Note 5).
5.
Microcentrifuge tubes: non-stick, RNAse-free, 1.5 mL.
6.
PCR reaction plate or tubes: 0.2 mL 96-well plate, 8-tube strips, or
individual tubes.
7.
8-cap strips or foil seal.
8.
PCR Cooler: this is a 96-well cooling block that may be used to
house the reaction plate or individual tubes during amplification
setup.
2.4 Direct Amplification of Lytic Storage Cards (see Note 6)

1.
5X AmpSolution™ Reagent (pre-amplification reagent).
2.
1.2 mm punching tool: 1.2 mm Harris Uni-Core Punch (or
equivalent manual punch) and cutting mat.
2.5 Direct Amplification of Nonlytic Storage Cards (see

Note 7)
1.
PunchSolution™ Reagent: pre-amplification reagent.
2.
5X AmpSolution™ Reagent: pre-amplification reagent.
3.
1.2 mm punching tool: 1.2 mm Harris Uni-Core Punch (or
4. Heat block: needs insert capable of accepting 96-well plate, or a 96-
well thermal cycler can be used. Must be in the pre-amplification
room. Set to 70 °C.
2.6 Direct Amplification of Swabs
1.
SwabSolution™ Reagent: pre-amplification reagent.
2.
Microcentrifuge tubes or deep-well plate: 1.5 mL ClickFit
Microtube or other 1.5 mL microcentrifuge tube with locking cap
or screw top; or 2.2 mL, square, deep, 96-well plate.
3.
Heat block: set to 70 °C for 1.5 mL tubes or 90 °C for a deep-well
plate. An adapter is required for use with the 96-well plate.
3 Methods
3.1 Amplification of Extracted DNA Using PowerPlex®
Fusion 5C in a Full Reaction Volume
1.
Completely thaw the PowerPlex® Fusion 5X Master Mix,
PowerPlex® Fusion 5X Primer Pair Mix, and Amplification Grade
Water.
2.
Centrifuge tubes briefly to bring contents to the bottom and then
vortex reagents for at least 15 s (see Note 8).
3.
Calculate the number of reactions by adding the number of
samples, plus a positive and negative control. Table 1 provides an
example of amplification setup for a full-volume PCR reaction (see
Note 9).
4.
Turn on the thermal cycler and ensure the amplification
parameters are set up according to Table 2 for a full-volume
extracted DNA amplification reaction (see Note 10).
5.
Add the final volume of each reagent (excluding the Amplification
Grade Water, as volumes will differ based on quantity of sample
DNA) to a clean tube and vortex the PCR amplification mix for 5–
10 s (see Note 11).
6 U i ith l b l d 0 2 L 96 ll ti l t l b l d
6. Using either a labeled 0.2 mL 96-well reaction plate or labeled
0.2 mL reaction tubes, pipette 10 μL of the PCR amplification mix
into each reaction well or tube for the number of samples,
including the positive and negative controls (see Note 12).
7.
Add up to 15 μL of template DNA (targeting 0.25–0.5 ng total) for
each sample to its respective well or tube (see Note 13). Add
Amplification Grade Water or TE−4 buffer to bring the total
volume of each well or tube to 25 μL.
8.
Prepare the positive amplification control by vortexing the 2800M
Control DNA and diluting to a concentration of 0.1 ng/μL. Add
5 μL (0.5 ng) to its respective well or tube. Add 10 μL of
volume to 25 μL.
9.
Prepare the negative amplification control by pipetting 15 μL of
either Amplification Grade Water or TE−4 buffer into its respective
well or tube (see Note 14).
10.
Seal the plate or cap the tubes and place in the thermal cycler.
11.
Run the protocol for a full-volume extracted DNA amplification
reaction (see Table 2). When complete, samples are ready for
electrophoretic detection or can be stored at −20 °C protected
from light (see Note 15).
Table 1 Amplification setup for Fusion 5C and Fusion 6C
Volume per reaction (μL)

Full-volume DNA Up to 15
Amplification of extracted DNA Fusion 5C: 0.25–0.5 ng Up to 15
Fusion 6C: 1 ng
5X Master Mix 5.0
5X Primer Pairs 5.0
Amplification Grade To final volume of 25
Water
Total volume 25
Volume per reaction (μL)
Half-volume DNA 5.0
Amplification of extracted DNA Fusion 5C: 0.5 ng 5.0
Fusion 6C: 0.5–0.75 ng
5X Master Mix 2.5
5X Primer Pairs 2.5
Amplification Grade 2.5
Water
Total volume 12.5
Half-volume 5X Master Mix 2.5
Direct amplification of storage card 5X Primer Pairs 2.5
punches
Water
5X AmpSolution™ Reagent 2.5
Total volume 12.5
Half-volume 5X Master Mix 2.5
Direct amplification of swabs 5X Primer Pairs 2.5
Water
Swab Extract 2.0
Total volume 12.5
This table provides the amplification setup, including reagent

components, for Fusion 5C and Fusion 6C 25 μL and 12.5 μL reactions
for extracted DNA and 12.5 μL reactions for direct amplification of
storage card punches and swabs. This table was adapted from the
PowerPlex® Fusion Technical Manual, PowerPlex® Fusion 6C Technical
Manual, and the Virginia Department of Forensic Science Procedure
Manual [1, 8, 14].
Table 2 PCR parameters for PowerPlex® Fusion 5C amplification
Extracted DNA amplification Direct amplification

Full-volume Half-volume Half-volume
96 °C for 1 min 96 °C for 1 min 96 °C for 1 min
94 °C for 10 s 94 °C for 10 s 94 °C for 10 s
For 30 cycles, then: For 28 cycles, then: For 26 cycles, then:
60 °C for 10 min, then: 60 °C for 10 min, then: 60 °C for 20 min, then:
4 °C soak 4 °C soak 4 °C soak
Incorporated here are the PCR conditions optimized by the Promega

Corporation (full-volume extracted DNA reactions and half-volume
direct amplification reactions) and the Virginia Department of Forensic
Science (half-volume extracted DNA reactions) using Fusion 5C. Ramp
modes vary based on the thermal cycler. Use Max Mode if cycling on a
GeneAmp® PCR System 9700; use the 9700 Simulation Mode if cycling
on a ProFlex® PCR System; use a ramping rate of 100% if cycling on a
Veriti® 96-Well Thermal Cycler [1, 14]

Fusion 5C in a Half Reaction Volume
1.
Water.
2.
3.
example of amplification setup for a half-volume PCR reaction (see
Note 9).
4.
parameters are set up according to Table 2 for a half-volume
5. Add the final volume of each reagent to a clean tube and vortex
the PCR amplification mix for 5–10 s (see Note 11).
6.
Using either a labeled 0.2 mL 96-well reaction plate or labeled

0.2 mL reaction tubes, pipette 7.5 μL of the PCR amplification mix
7.
Add 5 μL of template DNA (targeting 0.5 ng total) for each sample
to its respective well or tube (see Note 13).
8.
5 μL (0.5 ng) to its respective well or tube.
9.
10.
11.
Run the protocol for a half-volume extracted DNA amplification
reaction (see Table 2 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at −20 °C
protected from light (see Note 15).

Fusion 6C in a Full Reaction Volume
1.
Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,
PowerPlex® Fusion 6C 5X Primer Pair Mix, and Amplification
Grade Water for the first use. After the first use, components
should be stored at 2–10 °C (see Note 2).
2.
3. Calculate the number of reactions by adding the number of
example of amplification setup for a full-volume PCR reaction (see
4. Note 9).
parameters are set up according to Table 3 for a full-volume
5.
Add the final volume of each reagent (excluding the Amplification
Grade Water, as volumes will differ based on quantity of sample
DNA) to a clean tube and vortex the PCR amplification mix for 5–
10 s (see Note 11).
6.
0.2 mL reaction tubes, pipette 10 μL of the PCR amplification mix
7.
Add up to 15 μL of template DNA (targeting 1 ng total) for each
sample to its respective well or tube (see Note 13). Add
volume of each well or tube to 25 μL.
8.
Control DNA and diluting to a quantity of 0.1 ng/μL. Add 10 μL
(1 ng) to its respective well or tube. Add 5 μL of Amplification
Grade Water or TE−4 buffer to bring the total volume to 25 μL.
9.
10.
11.
Run the protocol for a full-volume extracted DNA amplification
reaction (see Table 3). When complete, samples are ready for
Table 3 PCR parameters for PowerPlex® Fusion 6C amplification

For 29 cycles, then: For 28 cycles, then: For 25 cycles, then:
60 °C for 10 min, then: 60 °C for 10 min, then: 60 °C for 10 min, then:
4 °C soak 4 °C soak 4 °C soak
Incorporated here are the PCR conditions optimized by Promega

Corporation (full-volume extracted DNA reactions and half-volume
direct amplification reactions) and in a study (half-volume extracted
DNA reactions) using Fusion 6C. Ramp modes vary based on the
thermal cycler. Use Max Mode if cycling on a GeneAmp® PCR System
9700; use the 9700 Simulation Mode if cycling on a ProFlex® PCR
System; use a ramping rate of 100% if cycling on a Veriti® 96-Well
Thermal Cycler [8, 15]

1.
Grade Water for the first use. After the first use, components
should be stored at 2–10 °C (see Note 2).
2.
3.
example of amplification setup for a half-volume PCR reaction (see
Note 9).
4. Turn on the thermal cycler and ensure the amplification
5.
Add the final volume of each reagent to a clean tube and vortex
6.
0.2 mL reaction tubes, pipette 7.5 μL of the PCR amplification mix
7.
Add 5 μL of template DNA (targeting 0.5–0.75 ng total) for each
sample to its respective well or tube (see Note 13).
8.
5 μL (0.5 ng) to its respective well or tube.
9.
10.
Seal the plate or cap the tubes and place in the preheated thermal
cycler.
11.
Run the protocol for a half-volume extracted DNA amplification
reaction (see Table 3 and Note 16). When complete, samples are
ready for electrophoretic detection or can be stored at −20 °C
protected from light (see Note 15).
3.5 Direct Amplification of Lytic Storage Cards Using

PowerPlex® Fusion 5C in a Half Reaction Volume
1.
PowerPlex® Fusion 5X Primer Pair Mix, 5X AmpSolution™
Reagent, and Amplification Grade Water (see Note 17).
2. Centrifuge tubes briefly to bring contents to the bottom and then
vortex reagents for 15 s before each use (see Note 8).
3.
example of direct amplification setup for a half-volume PCR
reaction (see Note 9).
4.
direct amplification reaction (see Notes 10, 18, and 19).
5.
6.
0.2 mL reaction tubes, pipette 12.5 μL of the PCR amplification
mix into each reaction well or tube for the number of samples,
including the positive and negative controls.
7.
Add one 1.2 mm punch from a lytic storage card containing buccal
or blood cells (see Notes 20 and 21).
8.
Control DNA and diluting to a concentration of 5 ng/μL. Add 1 μL
(5 ng) to its respective well or tube (see Notes 22 and 23).
9.
Reserve a well or tube containing PCR amplification mix as a
negative amplification control. An additional negative control with
a blank punch may be performed to detect contamination from
the storage card or punch device.
10.
Seal the plate or cap the tubes, and briefly centrifuge to bring
storage card punches to the bottom of the wells and remove any
air bubbles.
11.
Place samples in the thermal cycler.
12. Run the protocol for a half-volume direct amplification reaction
(see Table 2 and Note 16). When complete, samples are ready for
p p
3.6 Direct Amplification of Nonlytic Storage Cards Using

1.
Completely thaw PunchSolution™ Reagent and mix by gentle
inversion. After thawing, store at 2–10 °C.
2.
Place one 1.2 mm nonlytic storage card punch per sample into the
wells of a labeled 0.2 mL 96-well reaction plate or labeled 0.2 mL
reaction tubes.
3.
Add 10 μL of PunchSolution™ Reagent to each 1.2 mm punch (see
Note 24).
4.
Incubate the plate or tubes at 70 °C for 30 min or until wells are
dry (see Notes 25 and 26).
5.
PowerPlex® Fusion 5X Primer Pair Mix, 5X AmpSolution™
Reagent, and Amplification Grade Water (see Note 17).
6.
7.
8.
9.
10. Pipette 12.5 μL of the PCR amplification mix into each reaction
well or tube containing samples, including the positive and
negative controls, changing pipette tips between each addition of
amplification mix to prevent cross-contamination.
11.
(5 ng) to its respective well or tube (see Notes 22 and 23).
12.
13.
air bubbles.
14.
15.
Run the protocol for a half-volume direct amplification reaction
3.7 Direct Amplification of Swabs Using PowerPlex®

1.
Completely thaw SwabSolution™ Reagent in a 37 °C water bath
and mix by gentle inversion. After thawing, store at 2–10 °C.
2.
Set a heat block capable of accepting 1.5 mL tubes to 70 °C. The
heat block must reach 70 °C prior to the incubation (see
Subheading 3.7, step 5; samples can also be processed in a deep-
well plate (see Note 27)).
3.
Place buccal swab head only in a 1.5 mL ClickFit (or other locking
cap) tube, discarding the swab handle.
4. Add 1 mL of SwabSolution™ Reagent to each buccal swab head.
Close the tube (see Note 28).
5.
Incubate samples at 70 °C for 30 min (see Note 29).
6.
Water.
7.
8.
9.
10.
11.
12.
Pipette 2 μL of swab extract for each sample into the appropriate
well of the reaction plate or appropriate reaction tube.
13.
2 μL (5 ng) to its respective well or tube (see Note 22).
14.
Amplification Grade Water or TE−4 buffer into its respective well
or tube (see Note 30).
15. Seal the plate or cap the tubes, and briefly centrifuge to bring
16. contents to the bottom of the wells and remove any air bubbles.
17.
3.8 Direct Amplification of Lytic Storage Cards Using

1.
PowerPlex® Fusion 6C 5X Primer Pair Mix, 5X AmpSolution™
Reagent, and Amplification Grade Water (see Notes 2 and 17).
2.
3.
4.
direct amplification reaction (see Notes 10 and 31).
5.
6.
7.
or blood cells (see Notes 20 and 21).
8. Prepare the positive amplification control by vortexing the 2800M
Control DNA and adding 1 μL (10 ng) to its respective well or tube
9. (see Notes 22 and 23).
10.
air bubbles.
11.
Place samples in the preheated thermal cycler.
12.
3.9 Direct Amplification of Nonlytic Storage Cards Using

1.
Completely thaw PunchSolution™ Reagent and mix by gentle
inversion. After thawing, store at 2–10 °C.
2.
Place one 1.2 mm nonlytic storage card punch per sample into the
wells of a labeled 0.2 mL 96-well reaction plate or labeled 0.2 mL
reaction tubes.
3.
Note 24).
4.
Incubate the plate or tubes at 70 °C for 30 min or until wells are
dry (see Notes 25 and 26).
5. Completely thaw the PowerPlex® Fusion 6C 5X Master Mix,
PowerPlex® Fusion 6C 5X Primer Pair Mix, 5X AmpSolution™
Reagent, and Amplification Grade Water (see Notes 2 and 17).
6.
7.
8.
9.
10.
Pipette 12.5 μL of the PCR amplification mix into each reaction
well or tube containing samples, including the positive and
negative controls, changing pipette tips between each addition of
amplification mix to prevent cross-contamination.
11.
Control DNA and adding 1 μL (10 ng) to its respective well or tube
12.
13.
air bubbles.
14.
15. Run the protocol for a half-volume direct amplification reaction
3.10 Direct Amplification of Swabs Using PowerPlex®

1.
Completely thaw SwabSolution™ Reagent in a 37 °C water bath
and mix by gentle inversion. After thawing, store at 2–10 °C.
2.
heat block must reach 70 °C prior to the incubation (see
Subheading 3.10, step 5; samples can also be processed in a deep-
well plate (see Note 27)).
3.
Place buccal swab head only in a 1.5 mL ClickFit (or other locking
cap) tube, discarding the swab handle.
4.
Add 1 mL of SwabSolution™ Reagent to each buccal swab head.
5.
Incubate samples at 70 °C for 30 min (see Note 29).
6.
Grade Water (see Note 2).
7.
8.
example of a direct amplification setup for a half-volume PCR
9.
11.
12.
well of the reaction plate or appropriate reaction tube.
13.
(10 ng) to its respective well or tube (see Note 22).
14.
Amplification Grade Water or TE−4 buffer into its respective
reaction well or tube (see Note 30).
15.
contents to the bottom of the wells and remove any air bubbles.
16.
17.
4 Notes
1. Store all Fusion 5C components in a freezer between −30 °C and
−10 °C with the exception of the 2800M Control DNA and the
WEN Internal Lane Standard 500. Ensure the 2800M control DNA
is stored at 2–10 °C at least 24 h prior to use and do not refreeze
after opening. The WEN Internal Lane Standard 500 should also
be stored at 2–10 °C after first use. Optionally, all Fusion 5C
components may be stored for up to 1 year at 2–10 °C. Do not
store reagents in the refrigerator door, where the temperature can
fluctuate. Storing reagents in the refrigerator door can
compromise stability. The Primer Pair Mix, Allelic Ladder Mix, and
WEN ILS 500 are light-sensitive and must be stored in the dark. It
is best to store pre-amplification and post-amplification
components separately.
2.
Store all Fusion 6C components in a freezer between −30 °C and
−10 °C initially. All components should be stored at 2–10 °C after
first use and will remain stable for approximately 6 months.
Ensure the 2800M Control DNA is stored at 2–10 °C at least 24 h
prior to use. Do not store reagents in the refrigerator door, where
the temperature can fluctuate. Storing reagents in the refrigerator
door can compromise stability. The Primer Pair Mix, Allelic
Ladder Mix, and WEN ILS 500 are light-sensitive and must be
stored in the dark. It is best to store pre-amplification and post-
amplification components separately.
3.
If the DNA template is stored in TE buffer that is not pH 8.0 or
contains a higher EDTA concentration, the volume of DNA added
should not exceed 20% of the final reaction volume. PCR
amplification efficiency and quality can be greatly altered by
changes in pH (due to added Tris-HCl), available magnesium
concentration (due to chelation by EDTA) or other PCR inhibitors,
which may be present at low concentrations depending on the
source of the template DNA and the extraction procedure used.
4.
Other thermal cyclers may be compatible with the PowerPlex®
Fusion Systems, and an internal validation can determine if
another is suitable. An aluminum block is not recommended for
use because the material is not compatible with the
recommended Max Mode for ramping.
5. PCR amplification is a very sensitive technique that can be
contaminated by extraneous sources of DNA. Proper personal
protective equipment (PPE) is highly recommended, including
disposable gloves, lab coats, and face masks. Additionally, aerosol-
resistant pipette tips are encouraged to prevent contamination of
the pipette shaft that can occur due to aerosols generated during
aspiration of the liquid. Contamination events have also been
limited by the use of separate pre- and post-amplification setup

areas.
6.
Lytic storage card sample types include buccal cells collected with
swabs or Whatman EasiCollect™ devices transferred to FTA® or
FTA® Indicating Cards, or liquid blood spotted onto FTA® Cards.
7.
Nonlytic storage card sample types include buccal samples on
Bode Buccal DNA Collector™ devices and blood or buccal samples
on Whatman® 903 cards or other nonlytic storage cards.
8.
Do not centrifuge Primer Pair Mix and Master Mix after vortexing,
as the heavier components of the mixes may settle to the bottom
and not distribute evenly.
9.
When calculating the volume of reagent for the number of
samples, always include extra samples in the calculations to
account for pipetting errors. We have had success in including two
(2) extra samples in the calculation per every ten.
10.
Turning the thermal cycler on prior to amplification setup allows
the instrument to warm up and the lid to heat, enabling startup of
the protocol as soon as samples are in place.
11.
Failure to vortex the PCR amplification mix sufficiently can result
in poor amplification or locus-to-locus imbalance.
12.
We have had success in limiting the number of PCR artifacts
detected during electrophoretic separation by utilizing a PCR
cooler to prepare PCR reactions. An alternative to an ice bath, a
PCR cooler will keep samples cold during PCR setup. The risk of
contamination is lessened with a dry incubation method.
13.
To limit possible DNA transfer from tube top to tube top, utilize a
clean Kimwipe (or similar delicate task wiper) to open each tube
containing DNA.
14. The negative control should always be prepared last and capped
last, as the purpose of this control is to determine if
contamination was introduced during PCR setup.
15.
Long-term storage of amplified samples at 4 °C or higher may
produce artifacts.
16.
The thermal cycler may prompt the user to enter total sample
volume and decimal numbers may not be possible. If so, enter
13 μL as total sample volume.
17.
The 5X AmpSolution™ Reagent should be thawed completely,
mixed by vortexing and stored at 2–10 °C. The reagent may be
turbid after thawing or storage at 2–10 °C. If this occurs, warm the
buffer briefly at 37 °C and then vortex until clear.
18.
Testing at Promega shows 26 cycles work well for a variety of
sample types used for direct amplification. Cycle number
optimization is recommended to get the most desirable results for
the sample types tested. To optimize the cycle number, choose
several samples that represent typical sample types encountered
in the laboratory and prepare according to the laboratory’s
workflow. Prepare three identical reaction plates using the same
samples. Amplify samples using the provided thermal cycling
protocol but subject each plate to a different cycle number (for
example, 25, 26, and 27 cycles). Following amplification, use your
laboratory’s validated separation and detection protocols to
determine the optimal cycle number for the sample type.
19.
The final extension for direct amplification is 20 min compared to
10 min for the extracted DNA protocol to allow sufficient time for
adenylation of large amounts of amplicon, reducing the
appearance of N–1 artifact peaks.
20. The lytic storage card punch can be added to the reaction plate or
tubes prior to the PCR amplification mix. The order of adding
storage card punches and PCR amplification mix to a tube or well
is interchangeable and can depend on the preferred workflow of
the laboratory Adding storage card punches to empty wells can
the laboratory. Adding storage card punches to empty wells can
result in issues with static electricity.
21.
Lytic storage card punches can also be treated with
PunchSolution™ Reagent if poor amplification results are
obtained following the protocol for lytic storage cards. If cells are
not lysed when deposited on the lytic storage card, additional lysis
is required to release sufficient DNA for successful amplification.
22.
The mass of 2800M should be adjusted depending on the number
of amplification cycles used. The mass of DNA should be reduced
if the cycle number is increased and increased if the cycle number
is decreased. Increase or decrease the mass of 2800M Control
DNA by two-fold for every one-cycle decrease or increase,
respectively.
23.
Do not include blank storage card punches in the positive control
reactions.
24.
Though it is preferred to add punches to the plate first, adding
punches to empty wells can be problematic. Adding
PunchSolution™ Reagent to the well before adding the punch is
acceptable and may help alleviate static problems.
25.
Do not cover the plate with a lid or sealer or place the plate in a
thermal cycler with a closed, heated lid. A closed, heated lid will
prevent evaporation, even with an open plate. If using a thermal
cycler with a heated lid, leave the lid open to allow efficient
evaporation.
26.
Incubation for the full 30 min is recommended to ensure complete
evaporation. Shorter incubation times may result in poor
performance caused by PunchSolution™ Reagent carryover.
27. Place the heat block adapter on a heat block that is set to 90 °C.
The adapter sits on top of the heat block and allows efficient heat
transfer to the plate. The heat block must reach 90 °C prior to the
incubation. Place each buccal swab head in an empty well of a
deep-well plate. Add 1 mL of SwabSolution™ Reagent to each
deep we p ate dd o SwabSo ut o eage t to eac
buccal swab head. Place the deep-well plate on the preheated heat
block adapter. You do not need to seal the plate.
28.
It is not necessary to vortex samples after adding SwabSolution™
Reagent prior to incubation or after the 30-min incubation is
complete.
29.
Buccal swab extracts may be stored at 4 °C for 4 years.
30.
Additional negative controls can be included. Assemble a reaction
containing the swab extract prepared from a blank swab or
assemble a reaction where the SwabSolution™ Reagent is
processed as a blank without a swab.
31.
Testing at Promega shows 25 cycles work well for a variety of
References
1. Promega Corporation (2017) PowerPlex® Fusion System for use on the Applied
Biosystems™ Genetic Analyzers technical manual. Available via Promega. https://www.
promega.com/~/media/files/resources/protocols/technical%20manuals/101/
powerplex%20fusion%20system%20protocol.pdf. Accessed 04 Apr 2022
2. Panneerchelvam S, Norazmi MN (2003) Forensic DNA profiling and database. Malays J Med
Sci 10(2):20–26
3.
Budowle B, Moretti TR, Baumstark AL et al (1999) Population data on the thirteen CODIS
core short tandem repeat loci in African Americans, US Caucasians, Hispanics, Bahamians,
Jamaicans, and Trinidadians. J Forensic Sci 44(6):1277–1286
[Crossref][PubMed]
4. Tan JYY, Tan YP, Ng S et al (2017) A preliminary evaluation study of new generation
multiplex STR kits comprising of the CODIS core loci and the European Standard Set loci. J
Forensic Leg Med 52:16–23. https://doi.org/10.1016/j.jflm.2017.07.017
[Crossref][PubMed]
5. Hares DR (2015) Selection and implementation of expanded CODIS core loci in the United
States. Forensic Sci Int Genet 17:33–34. https://doi.org/10.1016/j.fsigen.2015.03.006
[Crossref][PubMed]
6. Oostdik K, Lenz K, Nye J et al (2014) Developmental validation of the PowerPlex® Fusion

System for analysis of casework and reference samples: a 24-locus multiplex for new
database standards. Forensic Sci Int Genet 12:69–76. https://doi.org/10.1016/j.fsigen.
2014.04.013
7. Promega Corporation (2022) STR amplification. Available via Promega. https://www.

promega.com/products/forensic-dna-analysis-ce/str-amplification/Accessed 30 Apr 2022
8. Promega Corporation (2015) PowerPlex® Fusion 6C System for use on the Applied
Biosystems® Genetic Analyzers technical manual. Available via Promega. https://www.
promega.com/~/media/files/resources/protocols/technical%20manuals/101/
powerplex%20fusion%206c%20system%20protocol.pdf. Accessed 04 Apr 2022
9. Ensenberger MG, Lenz KA, Matthies LK et al (2016) Developmental validation of the

PowerPlex® Fusion 6C System. Forensic Sci Int Genet 21:134–144. https://doi.org/10.
1016/j.fsigen.2015.12.011
10. Pfoser K, Owen S (2013) Evaluation of the PowerPlex® Fusion System for use on the ABI
PRISM® 310 Genetic Analyzer. Promega Corporation. https://www.promega.com/
resources/profiles-in-dna/2013/evaluation-of-the-powerplex-fusion-system-for-use-on-
the-abi-prism-310-genetic-analyzer/. Accessed 04 Apr 2022
11. Cisana C, Cerri N, Bosetti A et al (2017) PowerPlex® Fusion 6C System: evaluation study
for analysis of casework and database samples. Croat Med J 58:26–33. https://doi.org/10.
3325/cmj.2017.58.26
12. Promega Corporation (2016) PunchSolution™ Kit technical manual. Available via Promega.
https://www.promega.com/resources/protocols/technical-manuals/101/punchsolution-
kit-protocol/. Accessed 16 Apr 2022
13. Promega Corporation (2016) SwabSolution™ Kit technical manual. Available via Promega.
https://www.promega.com/resources/protocols/technical-manuals/101/swabsolution-
kit-protocol/. Accessed 16 Apr 2022
14.
Virginia Department of Forensic Science (2020) Forensic biology procedures manual 210-
D2007. PowerPlex® Fusion amplification and long term storage. Available via Virginia
Department of Forensic Science. https://www.dfs.virginia.gov/wp-content/uploads/2020/
07/210-D2007-FB-PM-PP-FUSION-Amp-and-Storage.pdf. Accessed 04 Apr 2022
15. McCaughan CM (2021) PowerPlex® Fusion 6C System versus PowerPlex® Fusion 5C: a
comparison of performance metrics. Thesis, Virginia Commonwealth University
https://doi.org/10.1007/978-1-0716-3295-6_14
14. Amplification of Extracted DNA and

Direct Amplification with the
PowerPlex® Y23 System
Jonelle M. Thompson1
(1) Promega Corporation, Madison, WI, USA
Jonelle M. Thompson
Email: Jonelle.Thompson@promega.com
Abstract
The PowerPlex® Y23 System offered by Promega Corporation contains
23 Y-STR loci (DYS19, DYS385a/b, DYS389I/II, DYS390, DYS391,
DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458,
DYS481, DYS533, DYS549, DYS570, DYS576, DYS635, DYS643, and Y-
GATA-H4). The PowerPlex® Y23 System is designed to amplify DNA
from purified extracts as well as direct amplification from substrates
used to collect database samples (e.g., swabs and storage cards).
Protocols are provided for full-volume reactions for DNA extracts, as
well as half-volume reactions for direct amplifications from different
substrates.
Key words PowerPlex® Y23 – DNA typing – Short tandem repeat

(STR) – Y-STR – Polymerase chain reaction (PCR) – Direct amplification
1 Introduction
The PowerPlex® Y23 System is made up of STR (short tandem repeat)
loci that are specific to the Y chromosome. STR loci consist of repetitive
sequence elements 3–7 base pairs in length [1–4]. These areas of the
human genome are highly polymorphic and can be detected using
polymerase chain reaction (PCR) [5–9]. Alleles of STR loci are
differentiated by the number of copies of the repeat sequence
contained within the amplified region. STR markers on the Y
chromosome (Y-STR) have qualities that are distinct from autosomal
markers and are useful for human identification [10–16]. Y-STR
markers are found on the non-recombining region of the Y
chromosome (NRY) and produce a haploid profile when amplified from
male DNA. This quality simplifies male/female mixture interpretation
by removing the female contribution from a DNA profile [17, 18].
The PowerPlex® Y23 System is a 5-dye system. The blue
(fluorescein) channel consists of DYS576, DYS389I, DYS448, DYS389II,
and DYS19. The green (JOE) channel consists of DYS391, DYS481,
DYS549, DYS533, DYS438, and DYS437. The yellow (TMR-ET) channel
consists of DYS570, DYS635, DYS390, DYS439, DYS392, and DYS643.
DYS393, DYS458, DYS385a/b, DYS456 and Y-GATA-H4 are in the red
(CXR-ET) channel [19, 20]. Fragments included in the internal lane
standard are detected in the orange channel and are labeled with WEN
(WEN Internal Lane Standard 500 Y23) (see Fig. 1).
Fig. 1 PowerPlex® Y23 System Layout. PowerPlex Y23 allows the co-amplification and four-
color detection of 23 loci. (Reproduced from Ref. [23] with permission from the Promega
Corporation)
The PowerPlex® Y23 buffer was optimized for amplification of
extracted DNA samples and can accommodate direct amplification from
a variety of substrates, including blood and buccal samples on lytic and
nonlytic storage cards, as well as samples collected on swabs [21, 22].
2 Materials
2.1 Materials Necessary for All Amplification Protocols
1.
PowerPlex® Y23 System: Pre-amplification reagents include
PowerPlex® Y23 5X Master Mix, PowerPlex® Y23 10X Primer Pair
Mix, 2800M Control DNA (10 ng/μL), and Amplification Grade
Water; post-amplification reagents include PowerPlex® Y23
Allelic Ladder Mix and WEN Internal Lane Standard 500 Y23 (see
Note 1).
2.
Stabilizer Reagent: Post-amplification reagent.
3.
PowerPlex® 5C Matrix Standard: Post-amplification reagent.
4.
Thermal cycler: GeneAmp® PCR System 9700 with a gold-plated
or silver sample block, or ProFlex® PCR System.
5.
Centrifuge compatible with 96-well plates or PCR tubes.
6.
Microcentrifuge tubes: Non-stick, RNAse-free, 1.5 mL.
7.
96-well reaction plate (see Note 2) or PCR tubes.
8.
8-cap strips (see Note 2) or foil seal.
9. TE−4 Buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0. To prepare
TE−4 buffer, mix together 10 mL of 1 M Tris-HCl (pH 8.0), 0.2 mL
of 0.5 M EDTA (pH 8.0), and 990 mL of deionized water.
Alternatively, dissolve 1.21 g Tris base and 0.037 g EDTA
(Na2EDTA • 2H2O) in 900 mL of deionized water. Adjust to pH 8.0
with HCl. Bring the final volume to 1 L with deionized water.
A l f bi i ll
Autoclave after combining all components.
10.
95 °C dry heating block, water bath, or thermal cycler for post
PCR.
2.2 Direct Amplification of Lytic Storage Cards (see Note 3)

1.
5X AmpSolution™ Reagent: Pre-amplification reagent.
2.
1.2 mm punching tool: 1.2 mm Harris Uni-core Punch (or
equivalent manual) punch and cutting mat.
2.3 Direct Amplification of Nonlytic Storage Cards (see

Note 4)
1.
PunchSolution™ Reagent: Pre-amplification reagent.
2.
5X AmpSolution™ Reagent: Pre-amplification reagent.
3.
1.2 mm punching tool: 1.2 mm Harris Uni-core Punch (or
4.
Heat block: Needs insert capable of accepting 96-well plate, or a
96-well thermal cycler can be used. Must be in the pre-
amplification room. Set to 70 °C.

1.
SwabSolution™ Reagent: Pre-amplification reagent.
2.
Microcentrifuge tubes or deep-well plate: 1.5 mL ClickFit
Microtube or other 1.5 mL microcentrifuge tube with locking cap
or screw top; or 2.2 mL, square, deep, 96-well plate.
3.
Heat block: Set to 70 °C for 1.5 mL tubes or 90 °C for a deep-well
plate. An adapter is required for use with the 96-well plate (see
Note 5).
3 Methods
Prior to starting the amplification setup, ensure all proper personal
protective equipment is available. The use of gloves and aerosol-
resistant pipette tips are highly recommended to prevent cross-
contamination. In addition, keep all pre-amplification and post-
amplification reagents in separate rooms, and prepare amplification
reactions in a room with dedicated equipment, supplies, and space for
amplification reaction setup. Do not store reagents in the refrigerator
door where the temperature can fluctuate, as this can compromise
stability.
3.1 Amplification of Extracted DNA

1.
Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23 10X
Primer Pair Mix, and Amplification Grade Water completely.
2.
Use a clean 96-well reaction plate and label it appropriately, for
example, with the experiment name, date, and your initials. PCR
tubes can also be used.
3.
Centrifuge reagent tubes briefly to bring contents to the bottom
and then vortex for 15 s before each use (see Note 6).
4.
Determine the number of reactions to be set up. This should
include positive and negative control reactions (see Note 7).
5.
Calculate the final volumes needed for each reagent (see Table 1).
6.
Assemble the PCR amplification reaction mix using the final
volume of each reagent. Add Amplification Grade Water to the
1.5 mL tube first, followed by PowerPlex® Y23 5X Master Mix and
PowerPlex® Y23 10X Primer Pair Mix (see Note 8).
7.
Vortex the PCR amplification mix for 5–10 s and then pipette the
PCR amplification mix into each reaction well or PCR tube (see
Note 9).
8. Add 0.5 ng template DNA for each sample to the respective well or
tube containing PCR amplification mix (see Notes 10 and 11).
9.
For the positive amplification control, vortex the tube of 2800M
Control DNA and then dilute an aliquot to 0.5 ng in the desired
template DNA volume.
10.
Add desired volume of the diluted 2800M DNA to a reaction well
or tube containing PCR amplification mix.
11.
For the negative amplification control, pipette Amplification
Grade Water or TE−4 buffer instead of template DNA into a
reaction well or tube containing PCR amplification mix.
12.
Seal or cap the reaction plate or PCR tubes (see Note 12).
13.
Briefly centrifuge the plate or PCR tubes to bring contents to the
bottom of the wells (see Note 13).
14.
Place the reaction plate or PCR tubes in the thermal cycler.
15.
Run the recommended protocol for amplification of extracted
DNA (see Table 2). Adjustments to the ramp rates are needed for
different thermal cycler models (see Note 14).
16.
After completion of the thermal cycling protocol, proceed with
fragment analysis or store amplified samples at −20 °C protected
from light (see Notes 15 and 16).
Table 1 Reaction mix setup
Volume per reaction

PCR amplification Extracted DNA Direct amplification of lytic Direct
mix component amplification and non-lytic storage cards amplification
from swabs
Amplification Grade Up to 17.5 μL 6.25 μL 6.75 μL
Water
PowerPlex® Y23 5X 5.0 μL 2.5 μL 2.5 μL

Master Mix
Volume per reaction
PCR amplification Extracted DNA Direct amplification of lytic Direct
mix component amplification and non-lytic storage cards amplification
from swabs
PowerPlex® Y23 2.5 μL 1.25 μL 1.25 μL

10X Primer Mix
5X AmpSolution™ N/A 2.5 μL N/A
Reagent
Total reaction 25.0 μL 12.5 μL 12.5 μL
volume
Full reactions are used for amplification of extracted DNA, while half
reactions are used for the various direct amplifications. The reaction
mix is prepared by combining the Amplification Grade Water,
PowerPlex® Y23 5X Master Mix, and the PowerPlex® Y23 10X Primer
Mix. The volume of amplification grade water is dependent on the
volume of DNA extract desired. The total volume of water and DNA
extract will be 17.5 μL to bring the total reaction for extracted DNA to
25 μL. Direct amplification of swabs also requires the addition of 2 μL
of SwabSolution™ extract
Table 2 Amplification cycling parameters
Extracted DNA amplification (full reaction) Direct amplification (half reaction)

96 °C for 2 min, then: 96 °C for 2 min, then:
94 °C for 10 s 94 °C for 10 s
61 °C for 1 min 61 °C for 1 min
72 °C for 30 s 72 °C for 30 s
For 30 cycles, then: For 25 cycles, then:
4 °C soak 4 °C soak
Cycling parameters for both extracted DNA full volume reactions and
direct amplification half reactions are the same except for the number
of cycles
3.2 Direct Amplification of Lytic Storage Cards Using Half

Reaction Volume
1. Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23 10X
Primer Pair Mix, 5X AmpSolution™ Reagent, and Amplification
Grade Water completely (see Note 17).
2.
3.
4.
5.
6.
1.5 mL tube first, and then add PowerPlex® Y23 5X Master Mix,
PowerPlex® Y23 10X Primer Pair Mix, and 5X AmpSolution™
Reagent (see Note 8).
7.
Vortex the PCR amplification mix for 5–10 s and then pipette
12.5 μL of PCR amplification mix into each reaction well or PCR
tube (see Note 9).
8.
or blood cells to the respective well or tube containing PCR
amplification mix (see Note 18).
9.
Control DNA and then dilute an aliquot to 5 ng/μL (see Notes 19
and 20).
10.
Add 1 μL (5 ng) of the 2800M Control DNA to a reaction well or
tube containing 12.5 μL of PCR amplification mix.
11. Reserve a well or tube containing PCR amplification mix as a
12.
13.
Briefly centrifuge the plate or PCR tubes to bring storage card
punches to the bottom of the wells (see Note 13).
14.
Place the reaction plate or PCR tubes in the thermal cycler (see
Note 21).
15.
Run the recommended protocol for direct amplification of lytic
storage cards (see Table 2). Adjustments to the ramp rates are
needed for different thermal cycler models (see Note 14).
16.
3.3 Direct Amplification of Nonlytic Storage Cards

1.
Thaw PunchSolution™ Reagent (see Note 22).
2.
3.
Place one 1.2 mm nonlytic storage card punch per sample into a
well of the 96-well reaction plate or PCR tube.
4.
Note 23).
5.
Incubate plate at 70 °C for 30 min or until wells are dry (see Notes
24 and 25).
6. Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23 10X
Primer Pair Mix, 5X AmpSolution™ Reagent, and Amplification
Grade Water completely (see Note 17).
7.
8.

9.
10.
tube 1.5 mL first, and then add PowerPlex® Y23 5X Master Mix,
PowerPlex® Y23 10X Primer Pair Mix, and 5X AmpSolution™
Reagent (see Note 8).
11.
12.5 μL of PCR amplification mix into each reaction well or PCR
tube (see Note 9).
12.
Change pipette tips between each addition of amplification mix to
prevent cross-contamination.
13.
Control DNA and then dilute an aliquot to 5 ng/μL (see Notes 19
and 20).
14.
Add 1 μL (5 ng) of the 2800M Control DNA to a reaction well or
tube containing 12.5 μL of PCR amplification mix.
15.
16.
17. Briefly centrifuge the plate or PCR tubes to bring storage card
punches to the bottom of the wells (see Note 13).
18.
Note 21).
19.
Run the recommended protocol for direct amplification of
nonlytic storage cards (see Table 2). Adjustments to the ramp
rates are needed for different thermal cycler models (see Note
14).
20.

1.
Thaw SwabSolution™ in a 37 °C water bath and mix by gentle
inversion (see Note 26).
2.
heat block must reach 70 °C prior to the incubation step (samples
can also be processed in a deep-well plate; see Note 27).
3.
Place buccal swab head in a 1.5 mL tube.
4.
Add 1 mL of SwabSolution™ Reagent to each buccal swab head.
5.
Incubate samples for 30 min (see Note 29).
6.
Thaw the PowerPlex® Y23 5X Master Mix, PowerPlex® Y23 10X
Primer Pair Mix, and Amplification Grade Water completely.
7.
8.
Use a clean 96-well reaction plate and label it appropriately. For
example, the experiment name, date, and your initials. PCR tubes
can also be used.
9. Determine the number of reactions to be set up. This should
10.
11.
1.5 mL tube first, followed by PowerPlex® Y23 5X Master Mix and
PowerPlex® Y23 10X Primer Pair Mix (see Note 8).
12.
10.5 μL of PCR amplification mix into each reaction well or tube
(see Note 9).
13.
well of the reaction plate or PCR tube.
14.
Control DNA and then dilute an aliquot to 2.5 ng/μL (see Note
19).
15.
Add 2 μL (5 ng) of the diluted 2800M to a reaction well or tube
containing 10.5 μL of PCR amplification mix.
16.
For the negative amplification control, pipette 2 μL of
Amplification Grade Water or TE−4 buffer instead of swab extract
into a reaction well or tube containing PCR amplification mix (see
Note 30).
17.
18.
Briefly centrifuge the plate to bring contents to the bottom of the
wells (see Note 13).
19.
Note 21).
20. Run the recommended protocol for direct amplification of swabs
(see Table 2). Adjustments to the ramp rates are needed for
) j p
different thermal cycler models (see Note 14).
21.
4 Notes
1.
Store all components in a freezer between −30 °C to −10 °C in a
non-frost-free freezer upon receipt. Ensure that the 2800M is
stored at 2–10 °C for 24 h prior to use. The Primer Pair Mix, Allelic
Ladder Mix, and WEN ILS 500 are light-sensitive and must be
stored in the dark. All components may be stored for up to 1 year
at 2–10 °C after the initial thaw. Do not refreeze the WEN ILS 500
Y23.
2.
MicroAmp® from Applied Biosystems is recommended.
3.
Lytic storage card sample types include buccal cells collected with
swabs or Whatman EasiCollect™ devices transferred to FTA® or
FTA® Indicating Cards, or liquid blood spotted onto FTA® Cards.
4.
Nonlytic storage card sample types include buccal samples on
Bode Buccal DNA Collector™ devices and blood or buccal samples
on Whatman™ 903 cards or other nonlytic storage cards.
5.
The heat block adapter will be needed if processing buccal swabs
in a deep-well plate. The heat block adapter sits on top of the heat
block and allows efficient heat transfer to the plate.
6.
Do not centrifuge the 10X Primer Pair Mix or 5X Master Mix after
vortexing, as this may cause the reagents to be concentrated at the
bottom of the tube.
7. Add 10–15% to the reaction number to compensate for pipetting
error. While this approach does consume a small amount of each
reagent, it ensures that you will have enough PCR amplification
mix for all samples. It also ensures that each reaction contains the
f
same PCR amplification mix.
8.
Do not store the PCR amplification mix for a prolonged period.
Add the mix to the wells of the reaction plate or PCR tubes as soon
as the mix is prepared. Add DNA as soon as possible to each well
or PCR tube and follow immediately by thermal cycling.
9.
Failure to vortex the PCR amplification mix sufficiently can result
in poor amplification, including locus-to-locus imbalance.
10.
Store DNA templates in TE−4 buffer. If the DNA template is stored
in TE−4 buffer that is not pH 8.0 or contains a higher EDTA
concentration, the volume of DNA added should not exceed 20%
of the final reaction volume. PCR amplification efficiency and
quality can be greatly altered by changes in pH (due to added
Tris–HCl), available magnesium concentration (due to chelation
by EDTA), or other PCR inhibitors, which may be present at low
concentrations depending on the source of the template DNA and
the extraction procedure used.
11.
Apparent DNA concentrations can differ, depending on the DNA
quantification method used. Perform experiments to determine
the optimal DNA amount based on your DNA quantification
method and internal validation.
12.
Seal or cap the reaction plate or PCR tubes to prevent evaporation.
Excessive evaporation changes the concentration of PCR
components in the reaction which can negatively impact
amplification of some or all loci.
13.
Briefly centrifuge the plate or PCR tubes to ensure all reaction
components are at the bottom of the tube and remove any air
bubbles that may have formed at the bottom of the tube. This
ensures the DNA is fully accessible to PCR components.
14. Ramp modes vary based on thermal cycler. Use Max Mode if
cycling on a GeneAmp® PCR System 9700; use the 9700
Simulation Mode if cycling on a ProFlex® PCR System.
15.
Long-term storage of amplified samples at 4 °C or higher may
produce artifacts.
16.
Following amplification and setup for running on the capillary
electrophoresis (CE) instrument, the CE plate should be processed
soon. If the CE plate will not be injected immediately, we strongly
recommend including Stabilizer Reagent in the loading cocktail
and injecting the samples within 48 h. Omitting Stabilizer Reagent
from the loading cocktail may result in loss of signal in the
amplified samples.
17.
The 5X AmpSolution™ Reagent should be thawed completely,
mixed by vortexing and stored at 2–10 °C. The reagent may be
turbid after thawing or storage at 2–10 °C. If this occurs, warm the
buffer briefly at 37 °C and then vortex until clear.
18.
The lytic storage card punch can be added to the reaction plate
prior to the PCR amplification mix. This may result in static
electricity issues depending on the environmental conditions in
the laboratory.
19.
The mass of 2800M should be adjusted depending on the number
of amplification cycles used. This mass of DNA should be reduced
if the cycle number is increased and increased if the cycle number
is decreased. Increase or decrease the mass of 2800M Control
DNA by two-fold for every one-cycle decrease or increase,
respectively.
20.
Do not include blank storage card punches in the positive control
reactions.
21. Testing at Promega shows 25 cycles work well for a variety of
p p g
22.
After initial thawing of PunchSolution™ Reagent, store at 2–10 °C.
23.
In this protocol, the punch is added to the empty well and then the
PunchSolution™ Reagent is added. Though it is preferred to add
punches to the plate first, doing so can be problematic. Adding
PunchSolution™ Reagent to the well before adding the punch is
acceptable and may help alleviate static problems.
24.
Do not cover the plate with a lid or sealer or place the plate in a
thermal cycler with a closed, heated lid. A closed, heated lid will
prevent evaporation, even with an open plate. If you use a thermal
cycler with a heated lid, leave the lid open to allow efficient
evaporation.
25.
Promega strongly recommends incubating for the full 30 min.
Shorter incubation times may result in poor performance.
26.
After initial thawing of SwabSolution™ Reagent, store at 2–10 °C.
27.
Place the heat block adapter on a heat block that is set to 90 °C.
The heat block must reach 90 °C prior to the incubation. Place
each buccal swab head in an empty well of a deep-well plate. Add
1 mL of SwabSolution™ Reagent to each buccal swab head. Place
the deep-well plate on the preheated heat block adapter. You do
not need to seal the plate.
28.
You do not need to vortex samples after addition of
SwabSolution™ Reagent prior to incubation or after the 30-min
incubation is complete.
29.
Buccal swab extracts may be stored at 4 °C up to 4 years.
30. containing the swab extract prepared from a blank swab or
assemble a reaction where the SwabSolution™ Reagent is
processed as a blank without a swab.
References
1. Edwards A, Civitello A, Hammond HA et al (1991) DNA typing with trimeric and tetrameric
tandem repeats: polymorphic loci, detection systems, and population genetics. In:
Proceedings from the second international symposium on human identification 1991: new
technologies, standardization of methods, and data sharing for DNA typing laboratories.
Promega Corporation, Madison, pp 31–52
2. Edwards A, Civitello A, Hammond HA et al (1991) DNA typing and genetic mapping with
trimeric and tetrameric tandem repeats. Am J Hum Genet 49(4):746–756
3. Edwards A, Civitello A, Hammond HA et al (1992) Genetic variation at five trimeric and

tetrameric tandem repeat loci in four human population groups. Genomics 12(2):241–253.
https://doi.org/10.1016/0888-7543(92)90371-X
[Crossref][PubMed]
4. Warne D, Watkins C, Bodfish P et al (1991) Tetranucleotide repeat polymorphism at the

human beta-actin related pseudogene 2 (ACTBP2) detected using the polymerase chain
reaction. Nucleic Acids Res 19(24):6980. https://doi.org/10.1093/nar/19.24.6980
5. Ausubel F, Brent R, Kingston R et al (1996) Unit 15: the polymerase chain reaction. In:
Current protocols in molecular biology, vol 2. John Wiley and Sons, New York
6. Sambrook J, Fritsch E, Maniatis T (1989) Chapter 14: in vitro amplification of DNA by the
polymerase chain reaction. In: Molecular cloning: a laboratory manual, 2nd edn. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor
7. Erlich H (ed) (1989) PCR technology: principles and applications for DNA amplification.
Stockton Press, New York
8. Innis M, Gelfand D, Sninsky J et al (eds) (1990) PCR protocols: a guide to methods and
applications. Academic Press, San Diego
9. Butler J (2005) Forensic DNA typing, 2nd edn. Elsevier Academic Press, London
10. Gusmao L, Carracedo A (2003) Y chromosome-specific STRs. Profiles in DNA 6(1):3–6
11. Jobling MA, Pandya A, Tyler-Smith C (1997) The Y chromosome in forensic analysis and
paternity testing. Int J Legal Med 110(3):118–124. https://doi.org/10.1007/
s004140050050
[Crossref][PubMed]
12.
Gill P, Brenner C, Brinkmann B et al (2001) DNA Commission of the International Society of
forensic genetics: recommendations on forensic analysis using Y-chromosome STRs. Int J
Legal Med 114(6):305–309. https://doi.org/10.1007/s004140100232
[Crossref][PubMed]
13. Roewer L, Krawczak M, Willuweit S et al (2001) Online reference database of European Y-

chromosomal short tandem repeat (STR) haplotypes. Forensic Sci Int 118(2):106–113.
https://doi.org/10.1016/S0379-0738(00)00478-3
[Crossref][PubMed]
14. Butler J, Schoske R, Vallone P et al (2002) A novel multiplex for simultaneous amplification
of 20 Y chromosome STR markers. Forensic Sci Int 129(1):10–24. https://doi.org/10.
1016/S0379-0738(02)00195-0
[Crossref][PubMed]
15. Kayser M, Caglia A, Corach D et al (1997) Evaluation of Y-chromosomal STRs: a multicenter

study. Int J Legal Med 110(3):125–133. https://doi.org/10.1007/s004140050051
[Crossref][PubMed]
16. Ruitberg C, Reeder D, Butler J (2001) STRBase: a short tandem repeat DNA database for the
human identity testing community. Nucleic Acids Res 29(1):320–322. https://doi.org/10.
1093/nar/29.1.320
17. Prinz M, Boll K, Baum H et al (1997) Multiplexing of Y chromosome specific STRs and
performance for mixed samples. Forensic Sci Int 85(3):209–218. https://doi.org/10.1016/
S0379-0738(96)02096-8
[Crossref][PubMed]
18. Prinz M, Ishii A, Coleman A et al (2001) Validation and casework application of a Y

chromosome specific STR multiplex. Forensic Sci Int 120(3):177–188. https://doi.org/10.
1016/S0379-0738(00)00467-9
[Crossref][PubMed]
19. Thompson J, Ewing M, Frank W et al (2013) Developmental validation of the PowerPlex

Y23 System: a single multiplex Y-STR analysis system for casework and database samples.
Forensic Sci Int Genet 7(2):240–250. https://doi.org/10.1016/j.fsigen.2012.10.013
20. Promega Corporation (2021) PowerPlex® Y23 technical manual TMD035. Available via
Promega Corporation. https://www.promega.com/resources/protocols/technical-
manuals/101/powerplex-y23-system-for-use-on-the-applied-biosystems-genetic-
analyzers-protocol/. Accessed 14 July 2022
21. Promega Corporation (2021) PunchSolution™ Kit technical manual. Available via Promega
Corporation. https://www.promega.com/resources/protocols/technical-manuals/101/
punchsolution-kit-protocol/. Accessed 14 July 2022
22. Promega Corporation (2021) SwabSolution™ Kit technical manual. Available via Promega
Corporation. https://www.promega.com/resources/protocols/technical-manuals/101/
swabsolution-kit-protocol/. Accessed 14 July 2022
23.
Promega Corporation (2022) PowerPlex® Y23 System. Available via Promega Corporation.
https://www.promega.com/products/forensic-dna-analysis-ce/str-amplification/
powerplex-y23-system/?catNum=DC2305. Accessed 14 July 2022
https://doi.org/10.1007/978-1-0716-3295-6_15
15. Applied Biosystems’ GlobalFiler™

PCR Amplification Kit
Georgia Williams1 , Megan M. Foley2 and Kelly L. Knight1
(1) Forensic Science Program, George Mason University, Fairfax, VA,
USA
Georgia Williams
Email: gwilli25@gmu.edu
Abstract
The GlobalFiler™ PCR Amplification Kit is one of the most sensitive kits
that exist today that makes the PCR amplification of human DNA
possible. PCR amplification using this specific kit makes millions of
copies of 24 specific target sequences in the DNA, called markers or
loci. This kit is a 6-dye, short tandem repeat (STR) multiplex assay kit
that has a synthetic mix of primers and single-stranded
oligonucleotides that are combined with DNA samples and then
subjected to 29 or 30 cycles of denaturing, annealing, and extension, as
per laboratory protocol. Methods for instrument operation will vary
depending on the thermal cycler instrument model that is used.
Nevertheless, the GlobalFiler™ PCR Amplification Kit has proven to be a
very useful tool to DNA analysts, amplifying extremely low quantities of
DNA, making it possible to detect partial, if not full, genetic profiles
from a wide range of sample types. This chapter discusses the typical
preparation and PCR amplification of human forensic DNA samples,
using the GlobalFiler™ PCR Amplification Kit.
Key words GlobalFiler™ – PCR – Amplification – STR – DNA
polymerase – Multiplex – Loci – CODIS – ThermoFisher – Forensic
Genetics
1 Introduction
The GlobalFiler™ PCR Amplification Kit (GlobalFiler™; Applied
Biosystems, Waltham, MA) is a sensitive and useful kit for forensic
scientists, specifically DNA analysts, as it was developed specifically for
casework [1]. It is used to conduct Polymerase Chain Reaction (PCR) of
specific target sequences of the human genome in
unknown/questioned samples and known/reference high quantity
samples. An advantage of conducting PCR in forensics is that only a
small quantity of sample is necessary because the reaction is essentially
“xeroxing” the template DNA millions to billions of times, which allows
profiles to be generated from minute quantities of DNA. This PCR
product is often referred to as an amplicon [2], and its production
ensures that analysts have enough DNA for not only immediate testing
but also future testing.
GlobalFiler™ is a 6-dye, short tandem repeat (STR) multiplex assay
for the amplification of human genomic DNA. This kit amplifies the
original 13 loci used for the Combined DNA Index System (CODIS), as
well as seven loci from the expanded European Standard Set of Loci
(ESSL) and SE33—a highly discriminating locus [1]. The kit delivers a
24-locus multiplex, high discrimination power, high sensitivity,
tolerance to inhibitors, and maximization of performance on degraded
samples, as well as completion of amplification in a relatively quick
period of time—approximately 75 min.
The 24 loci amplified by GlobalFiler™ include 21 autosomal STR loci
(D3S1358, vWA, D16S539, CSF1PO, TPOX, D8S1179, D21S11, D18S51,
D2S441, D19S433, TH01, FGA, D22S1045, D5S818, D13S317, D7S820,
SE33, D10S1248, D1S1656, D12S391, and D2S1338); one Y-STR locus
(DYS391); one polymorphic insertion/deletion marker on the Y-
chromosome (Y indel); and one sex-determining marker (Amelogenin)
(see Fig. 1) [3].
Fig. 1 Layout of the 24 GlobalFiler™ PCR amplification kit loci. The target loci that are
amplified during PCR amplification are arranged by dye color and base pair size. Loci of smaller
base pair size are positioned to the right and the larger sized loci are found on the left. In the
green dye channel, “Y” is representative of the Y-indel (deletion/insertion marker on the Y-
chromosome) and “A” represents Amelogenin (sex-determining marker). (Reproduced from Ref.
[3] with permission from Catherine C. Connon)
GlobalFiler™ contains two sets of reagents (pre-amplification and

post-amplification), which are housed separately after initial thaw and
use. The first set of reagents is the one discussed in this chapter and is
used to conduct PCR amplification. These reagents are housed in the
pre-amplification “clean” space and include GlobalFiler™ Master Mix
(GMM), GlobalFiler™ Primer Mix (GPM), and the DNA Control 007
(positive control) (see Fig. 2).
Fig. 2 GlobalFiler™ pre-amplification reagents. Reagents include (from left to right):
GlobalFiler™ Primer Mix, GlobalFiler™ Master Mix, and DNA Control 007. The GlobalFiler™
Primer Mix and GlobalFiler™ Master Mix are combined to make an overall PCR amplification
master mix, and the DNA Control 007 is used to make PCR amplification positive control
samples
The GlobalFiler™ Master Mix contains enzymes (including DNA

polymerase), deoxyribonucleotide triphosphates (dNTPs), salts, and
buffer. The GlobalFiler™ Primer Mix contains the forward and reverse
primers specific to the chosen STR sequences. DNA Control 007 is a
known human male DNA sample used as a positive amplification
control with a concentration of 0.1 ng/μL [4]. The DNA profile that is
generated for the positive control indicates whether the amplification
and/or capillary electrophoresis processes worked properly.
It is extremely important that all equipment, reagents, and supplies
used to prepare amplification reactions are stored and remain in
designated “clean” pre-amplification areas at all times. These items
should not be used to handle amplified DNA or other potential sources
of DNA contamination. Also, amplified DNA and the equipment,
reagents, and supplies used to handle the amplified DNA (e.g., thermal
cyclers, pipettes, allelic ladders, etc.) should not be brought into the
designated “clean” pre-amplification area. A carryover of trace amounts
of amplified DNA into other samples before amplification can lead to
unreliable and inaccurate results that can be misinterpreted [5]. The
second set of reagents in GlobalFiler™ simply includes the allelic ladder
for capillary electrophoresis. The allelic ladder should be transferred
and stored separately in a post-amplification area upon receipt, as it is
not used in the amplification process, and therefore, will not be
discussed further in this chapter.
In this chapter, full reaction volume methods are discussed and are
applicable to both questioned (unknown) and reference (known)
samples. GlobalFiler™ and similar kits are typically expensive, and as a
result, to reduce costs, some laboratories perform half reactions, which
essentially cut the required volumes of the reagents in half. This
ensures that more value is achieved from each kit by being able to
process two times as many samples. This is a more cost-efficient
method but is generally utilized only when processing reference
samples.
Applied Biosystems also manufactures other versions of
GlobalFiler™, including the GlobalFiler™ IQC PCR Amplification Kit, the
GlobalFiler™ Express Kit, and the CLA GlobalFiler™ PCR Amplification
Kit, which should not be confused with the version discussed in this
chapter. The GlobalFiler™ IQC Kit has two Internal Quality Control (IQC)
markers that are amplified in addition to the 24 loci from the original
GlobalFiler™ PCR Amplification Kit. The IQC version of the kit is used
when analysts are handling extremely challenging samples and sample
quality is in question; this version of the kit can help to distinguish if
sample inhibition or degradation has occurred. The GlobalFiler™
Express Kit is used primarily to direct amplify from single-source
samples collected using treated and untreated paper, as well as swabs.
Finally, the CLA GlobalFiler™ Kit is typically used for cell line
authentication. It is extremely important to note that the primer set and
the allelic ladder in each of the three versions of this kit are different
and as a result must not be interchanged.
GlobalFiler™ has proven to be an overall effective tool in Forensic
DNA analysis and as a result, it is routinely used in many forensic
laboratories across the world.
2 Materials
Forensic DNA analysis typically involves the investigation of low
quantity and unknown samples. As a result, the materials—specifically
the plastics that are used to handle and store DNA samples (e.g., PCR
tubes, 96-well plate and pipette tips, etc.)—must be sterile or
autoclaved to ensure that there are no contaminants or inhibitors
present. In addition to being sterile, pipette tips must also be optimally
designed to prevent cross contamination (e.g., accompanied with
aerosol resistant tips). Finally, all reagents must be within expiration.
1.
DNA extracts.
2.
0.2 mL PCR tubes or 96-well plate (see Notes 1 and 2).
3.
Strip caps or adhesive seal and sealing tool: Needed if not using
individual PCR tubes with caps (see Note 3).
4.
Amplification tube rack or 96-well plate holder.
5.
Nuclease-free water or low Tris-EDTA buffer: the latter is prepared
from 10 mM Tris-HCl and 0.1 mM EDTA; pH 8.0 (see Note 4). Store
at room temperature after preparation. It expires on the date that
the individual reagents expire or 1 year after it is made (whichever
comes first).
6.
GlobalFiler™ PCR Amplification Kit: GlobalFiler™ Master Mix
(GMM), GlobalFiler™ Primer Mix (GPM), and DNA Control 007
(positive control). Store all reagents at −25 °C to −15 °C upon
receipt and 2–8 °C after initial use.
7. Thermal cycler (see Note 5).
3 Methods
It is very important to adhere to laboratory precautions not only to
ensure the safety of the analysts, but most importantly to reduce, if not
completely prevent, contamination of samples. One such precaution is
wearing proper personal protective equipment (PPE), which includes
lab coat, gloves, and hair net. A second precaution is to decontaminate
work areas by wiping them down with 10% bleach solution, followed
by 70% ethanol, before and after handling samples. Thirdly, all
materials that are used to collect and handle samples must be
autoclaved and/or sterilized. Additionally, it is also important to work
in a biosafety cabinet to keep a clean flow of air and prevent
contaminants from being introduced into the samples and reagents.
Also, the pipette tips that are recommended for use in a forensic DNA
lab are the aerosol barrier pipette tips, which due to the barrier filter
inside the tips prevents contamination of the pipette shaft and cross-
contamination of samples. In addition to wearing proper PPE and
ensuring that the immediate work area, equipment, and supplies are
contaminant-free, it is imperative that two separate spaces are
designated pre-amplification (where the preparation of samples for
amplification occurs) and post-amplification (where actual PCR
amplification and subsequent procedures occur). Finally, to further
ensure that there is no contamination of samples, analysts must always
include controls with every thermal cycler run set of samples. These
controls include a reagent blank, which is subjected to the same
amplification reagents and procedures as a regular sample, but it has
no DNA. A positive control and a negative control should also be
included in each run set of samples. Collectively, the controls assess for
contamination and whether the instruments are working properly. The
methods presented in this chapter are derived from a variety of sources
[1–5].
3.1 Preparing DNA Samples and PCR Amplification Master

Mix
1. In the designated pre-amplification “clean” area, allow DNA
extracts to come to room temperature (include the corresponding
reagent blank from the extraction procedure), then vortex and
quick spin (see Note 6). Prepare each DNA extract such that
~1.0 ng DNA can be added to the PCR reaction using a volume of
15 μL; this equates to a concentration of 0.0667 ng/μL (see Notes
7–11). Extracts can be diluted/prepared using nuclease-free water
or TE−4 buffer (see Note 12).
2.
Allow the GlobalFiler™ reagents to come to room temperature (see
Note 13).
3.
Secure the required number of sterile amplification tubes in a rack
and label them with the appropriate sample identifiers. Include
two tubes for the positive (DNA Control 007) and negative
(nuclease-free water or TE−4, whichever was used to prepare DNA
extractions; see Subheading 3.1, step 1) amplification controls. If
using a 96-well plate, label the plate with the appropriate identifier
and retain it in a 96-well base.
4.
Calculate the required volume of each GlobalFiler™ component
needed to prepare the PCR amplification master mix by multiplying
the volume needed in each reaction, by the number of samples—
include controls and additional reactions to compensate for any
pipetting error (see Notes 14 and 15 and Table 1).
5.
Vortex the GlobalFiler™ Master Mix and the GlobalFiler™ Primer
Mix for 10 s, then centrifuge briefly to remove liquid from the caps.
6.
Using an appropriately sized tube, prepare the master mix as
calculated. Pipette the GlobalFiler™ Master Mix first, followed by
the GlobalFiler™ Primer Mix.
7.
Vortex and briefly centrifuge the master mix.
Table 1 GlobalFiler™ master mix reaction composition
Amplification kit component Volume per reaction

Amplification kit component Volume per reaction
GlobalFiler™ Master Mix (GMM) 7.5 μL
GlobalFiler™ Primer Mix (GPM) 2.5 μL
Total volume of PCR amplification mix (master mix) 10 μL
The volumes in this table are representative of a full volume reaction.

When preparing the master mix, prepare enough for all
samples/controls being processed and include extra reactions to
account for pipetting error (about one extra for every 15
samples/controls). In addition to 10 μL of master mix, 15 μL of DNA is
added per reaction to achieve a total reaction volume of 25 μL
3.2 Preparing Amplification Reactions

1.
Pipette 10 μL of the master mix into each PCR tube or well (see
Notes 16 and 17).
2.
Vortex and briefly centrifuge all samples (see Note 18).
3.
Add 15 μL of a sample into the corresponding tube/well (see Note
19).
4.
Add 15 μL of the reagent blank “extract” to the corresponding
tube/well (see Note 20).
5.
For the positive amplification control, add 10 μL of the DNA Control
007 and 5 μL of nuclease-free water or TE−4 buffer (whichever was
used for the DNA samples; see Subheading 3.1, step 1) to the
corresponding tube/well. This achieves the 1.0 ng target amount
(see Note 9).
6.
For the negative amplification control, add 15 μL of nuclease-free
water or TE−4 buffer (whichever was used for the DNA samples; see
Subheading 3.1, step 1) to the corresponding tube/well.
7. Cap/seal the tubes/plate (see Notes 21 and 22). Vigorously flick
the tubes once or spin down the plate for 60 s. Ensure that all
bubbles have been removed (see Note 23).
8.
Transfer the prepared amplification tubes or plate to the post-
amplification area.
3.3 Thermal Cycler Instrument Operation

1.
Turn the thermal cycler on and select the appropriate run method
2.
Verify the appropriate PCR amplification parameters (see Fig. 3) for
the appropriate instrumentation used.
3.
Place tubes (see Note 26) or plate into the heat block of the
thermal cycler, secure the lid, and then start the instrument (see
Note 27).
4.
Once amplification is complete (after approximately 1 h and
15 min), gently remove the tubes or plate (see Note 28).
5.
Immediately proceed to capillary electrophoresis detection (not
covered in this chapter) or store the amplification product in the
dark at 2–8 °C for up to 2 weeks or − 25 °C to −15 °C for more than
2 weeks.
Fig. 3 Applied Biosystems™ ProFlex™ 96-well PCR System display screen. The screen is
showing the PCR amplification parameters for GlobalFiler™, 29 cycles. The times and
temperatures for each stage of amplification, as well as the overall reaction volume and
temperature of the heated cover, are also shown. This should be verified before starting a run
4 Notes
1.
Some thermal cyclers require a 0.1 mL tube, so be sure to confirm
the compatibility of the tubes with the thermal cycler before
beginning.
2.
PCR tubes can be individual tubes (with caps) or strip tubes (with
strip caps).
3.
The adhesive seal and sealing tool are only applicable if a 96-well
plate is used.
4. The low Tris-EDTA (aka low-TE or TE −4) buffer has ten times
lower concentration of EDTA than regular TE buffer.
5.
Examples of thermal cyclers that can be used to amplify samples

include, but are not limited to, Applied Biosystems’ GeneAmp®
PCR System 9700 and its successors—the VeritiPro™ or ProFlex™
PCR System.
6.
Questioned and reference samples should always be prepared
separately, with the questioned samples prepared first. This will
help to decrease the chance of cross contamination between
known and unknown samples. Each set of samples (questioned
and reference) must have its own reagent blank and amplification
controls. The negative amplification control MUST be last in this
sequence, as this will provide a final control check for
contamination during the PCR set up.
7.
Making a 0.0667 ng/μL dilution is the most effective approach for
extracts with concentrations >1.0 ng. Alternatively, if the
undiluted extract has a concentration of 0.0667–1.0 ng/μL, it may
be more efficient at this point to only calculate the volume of
undiluted extract needed to achieve an input of 1.0 ng in
combination with the volume of water/TE−4 needed to bring that
volume up to 15 μL; with this approach, the volumes of DNA
extract and water/TE−4 will be added directly to the PCR reaction
(see Subheading 3.2, steps 1–3). For either of these approaches,
the author recommends pipetting no less than 1 μL for either DNA
extract or water/TE−4.
8.
DNA extracts that have a concentration less than 0.0667 ng/μL
should not be combined with water or TE−4 buffer, as doing so will
further dilute the sample. Instead, the maximum volume of 15 μL
of undiluted extract should be added directly to the PCR reaction
9. Per manufacturer recommendation, the input/target amount of
DNA is 1.0 ng if using a 29-cycle PCR reaction; this includes the
amplification of the positive control via DNA Control 007, which is
supplied at a concentration of 0.1 ng/μL. The manufacturer
recommends a decrease to 0.5 ng if using a 30-cycle reaction.
Laboratories must perform an internal validation to identify the
range of input DNA that is reliable for their workflow.
Laboratories may find that the parameters for question versus
known samples need to be optimized separately.
10.
For each sample, be sure to document the volumes needed, to be

able to easily reference during the amplification setup process.
11.
Excel, although not required, may be used to record volumes and
concentrations to aid in quick calculations.
12.
Although nuclease-free water can be used to dilute samples, TE−4
buffer is more effective in protecting DNA from degradation.
Whichever is selected should be utilized for all DNA samples
(when applicable), as well as the positive and negative
amplification controls. The reagent blank from the extraction
procedure will not have water or TE−4 added to its PCR reaction.
13.
GlobalFiler™ reagents are light and temperature sensitive.
Keeping the reagents in the kit box or in the refrigerator when not
in use is effective in protecting them from light. These reagents
should not remain at room temperature for an extended period of
time.
14.
The combination of the GlobalFiler™ Master Mix and the
GlobalFiler™ Primer Mix will result in an overall PCR
amplification master mix, which is simply referred to as “master
mix” in this chapter.
15.
The volume of additional master mix that is used to compensate
for pipetting error will be determined by the number of samples.
That is, one extra reaction should be added for every 15 samples,
including controls.
16. A plate map with an identical setup to the thermal cycler
instrument should be used to document sample location. This will
t l f l i ll h i 96 ll l t
prove extremely useful especially when using a 96-well plate.
17.
If nuclease-free water or TE−4 is being added directly to a reaction
(see Note 7), add that to the applicable tubes/wells after the
master mix has been added to all tubes/wells. Be sure to add
components of the amplification to the tubes/wells in the
following order: master mix, nuclease-free water or TE−4 buffer (if
needed), and then samples, which include DNA extracts, reagent
blank, and amplification controls. This will help decrease the
likelihood of cross contaminating pipette tips and samples.
Standard precaution is to change tips in between each DNA
source.
18.
Pipette samples directly into the reagents already in the

tubes/wells to prevent samples from sticking to the sides of the
tubes/wells.
19.
Be sure to reduce the volume of DNA being added to a given
tube/well if water or TE−4 was added directly (see Notes 7 and
17).
20.
If multiple reagent blanks were processed during extraction, it is
suggested to select the reagent blank with the highest
quantitation signal to proceed with amplification. If all of the
reagent blanks have no/the same quantitation signal, randomly
select one to proceed with. This guideline is optional but if
incorporated, needs to be made clear in the laboratory’s standard
operating procedures (SOP).
21.
The final overall reaction volume in each tube/well is 25 μL.
22. It is extremely important to ensure that tubes/plates are
capped/sealed appropriately. Failure to do so can lead to
evaporation and inefficient amplification. Furthermore, amplified
samples contain billions of copies (or more) of the targeted DNA
regions. As a result, improperly capped or sealed tubes/plates will
cause samples to leak out and cause significant contamination of
the lab, instrumentation, and most importantly, other samples.
23.
Bubbles prevent efficient amplification.
24.
Creating and saving a run method on the thermal cycler
instrument helps analysts to avoid re-entering amplification
parameters each time that samples are to be amplified. These
parameters are based on the kit manufacturer’s guidelines and
recommendations.
25.
Review the manufacturer’s guidelines regarding ramp rates for
the thermal cycler being used.
26.
If using amplification tubes, be sure to sit them in a retainer base
before placing them in the thermal cycler to prevent the tubes
from melting (see Fig. 4).
27.
Manufacturers of thermal cyclers sometimes produce different
models with varying numbers of heat blocks. For example, the
ProFlex™ 96-well PCR System has one heat block (see Fig. 4),
while the ProFlex™ 2 × 96-well PCR System has two different heat
blocks; if using the latter, the user must verify which block will be
used before beginning a run.
28.
After a PCR amplification run is complete, the tubes/plate tend to
get slightly stuck in the heat block, so it is important to remove
the retainer base/plate gently and carefully to avoid disrupting
the amplified product or flinging individual tubes.
Fig. 4 Applied Biosystems™ ProFlex™ 96-well PCR System. (a) This figure displays the single
heat block and heated cover model of the ProFlex™ 96-well PCR System instrument. (b)
Displayed in this figure is the retainer base apparatus that is placed on the heat block prior to
loading amplification tubes to prevent them from melting during a run
References
1. Ludeman MJ, Zhong C, Mulero JJ et al (2018) Developmental validation of GlobalFiler™ PCR
Amplification Kit: a 6-dye multiplex assay designed for amplification of casework samples.
Int J Legal Med 132(6):1555–1573
2. Butler M, John (2005) Forensic DNA typing, 2nd edn. Elsevier Academic Press, MA
3. Connon CC (2022) STR biology & modern DNA detection techniques [PowerPoint slides].
Virginia Commonwealth University, FRSC 438 Forensic Molecular Biology
4. Thermo Fisher Scientific (2019) GlobalFiler™ and GlobalFiler™ IQC PCR Amplification Kits
User Guide, Revision F. Available online via https://assets.thermofisher.com/TFS-Assets/
LSG/manuals/4477604.pdf. Accessed 20 May 2022
testing laboratories. Available via the Scientific Working Group on DNA Analysis Methods
(SWGDAM). https://www.swgdam.org/_f iles/ugd/4344b0_d73afdd0007c4ed6
a0e7e2ffbd6c4eb8.p df. Accessed 07 Sept 2022
https://doi.org/10.1007/978-1-0716-3295-6_16
16. QIAGEN’s Investigator® 24plex QS

and GO! PCR Amplification
Michelle D. Bonnette1
(1) InVita Healthcare Technologies, Jacksonville Beach, FL, USA
Abstract
The Investigator® 24Plex kits are multiplex PCR kits utilized by forensic
laboratories to simultaneously amplify 22 of the most commonly
utilized STR markers for human identity testing, including the 20 core
CODIS loci, along with the sex marker Amelogenin and 2 novel quality
sensors. These quality sensors are unique internal PCR controls that
provide useful insight to the analyst regarding possible inhibition or
degradation within the sample. This chapter describes the use of the QS
version of the kit designed for use with extracted DNA from casework
samples, as well as the use of the GO! version of the kit designed for
direct amplification of reference samples.
Key words Forensic DNA – Investigator 24plex GO! – Investigator

24plex QS – Quality Sensor (QS) markers – Short tandem repeat (STR)
typing – Direct amplification – CODIS loci
1 Introduction
In order to ascertain if genetic material is present in a sample, purified
DNA must be replicated and labeled for detection in order to develop an
STR profile. The Investigator® 24plex Kits are six-dye short tandem
repeat (STR) multiplex kits that utilize the enzymatic process of
Polymerase Chain Reaction (PCR) to amplify 21 autosomal STR loci, one
Y-STR (DYS391), the sex determining marker (Amelogenin), and two
quality sensors—one large (QS2 at 475 base pairs) and one small (QS1
at 74 base pairs)—that provide a unique tool to help interpret STR
profile results. The six fluorescence dye labels are 6-FAM, BTG, BTY,
BTR2, BTO, and BTP (see Fig. 1) [1]. These 23 loci include the original
13 core CODIS loci and seven markers from the expanded European
Standard Set of Loci (ESSL) that make up the newly expanded core
CODIS loci (20 loci total) to increase the discriminatory power, reduce
the possibility of adventitious matches, and improve data sharing
across countries using different loci. The quality sensors are a
component of the kit’s primer mix and are amplified simultaneously
with the sample’s DNA to help determine if the PCR reaction was
successful, as well as to differentiate between failed PCR due to the
absence of DNA, inhibition, or degradation [2]. Each kit is comprised of
a fluorescent dye-labeled, locus-specific primer mix, PCR fast reaction
mix (which includes the enzyme Taq DNA polymerase), 9948 positive
control DNA, allelic ladder, DNA size standard (BTO), and nuclease-free
water (QS kit only) [3, 4].
Fig. 1 Investigator® 24plex kit loci. QIAGEN provides commercially available STR kits for a
single amplification of the 20 core CODIS loci (which includes the European Standard Set) plus
SE33, DYS391, Amelogenin (A), Quality Sensor 1 (*1), and Quality Sensor 2 (*2). The layout of
loci by dye channel as they appear in an electropherogram are displayed in this illustration.
(Reproduced from Ref. [1] with permission from Catherine C. Connon)
Direct PCR is often employed in high-throughput settings, such as

databasing laboratories processing convicted offender and arrestee
samples, as well as in casework laboratories for the processing of
known samples [5]. Direct amplification reduces the time to process
samples and fewer steps in the DNA analysis can mitigate the risks of
cross-over contamination [6, 7]. However, there is often less control
over the precise amount of DNA template being input into a direct
amplification workflow. Low levels of input DNA can result in stochastic
effects, like peak imbalance and/or complete allele drop-out, while
excess template DNA can lead to increased stutter, non-specific
amplification, and/or incomplete adenylation [8]. For these reasons, it
is recommended that the Investigator® 24plex QS Kit be utilized for
processing questioned casework samples that often result in mixtures
and/or originate from more challenging sample sources.
2 Materials
2.1 General Materials
1.
0.1–0.2 mL thin-walled reaction tubes (individual or strips with
strip caps) or 96-well amplification plate with bubble strip caps or
adhesive seal (see Note 1).
2.
Amplification cover: Needed if using adhesive seal.
3.
Thermal cycler.
2.2 Amplification with Investigator® 24plex QS

1.
Investigator® 24plex QS Kit: Fast Reaction Mix 2.0, Nuclease-Free
water, Primer Mix 24plex QS, Control DNA 9948 (0.1 ng/μL), DNA
size standard 500 (BTO), Allelic Ladder 24plex, and Protocol Card
(see Note 2).
2.
Low Tris-EDTA (TE) Buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0;
aka TE−4 buffer or low-EDTA TE buffer.
2.3 Direct Amplification with Investigator® 24plex GO!

1. Investigator® 24plex GO! Kit: Fast Reaction Mix 2.0, Primer Mix
24plex GO!, Control DNA 9948 (5 ng/μL), DNA size standard 24plex
(BTO), Allelic Ladder 24plex, and Quick-Start Protocol (see Note 2).
2.
Investigator STR GO! Punch Buffer.
3.
Investigator STR GO! Lysis Buffer.
4.
1.2 mm punching tool (see Note 3).
5.
2.2 mL deep well plate (optional).
6.
Thermomixer (see Note 4).
7.
Type I water.
3 Methods
Wear appropriate personal protective equipment (at a minimum: lab
coat, gloves, and face mask) when carrying out the following
procedures and handling materials. Refer to Safety Data Sheets (SDS) to
determine the safety hazards for chemicals and reagents used in the
standard operating procedures. The amplification positive (9948) and
negative controls are incorporated into the sample set following all
other samples. One set of controls must be tested with each sample set
(see Notes 5–8). The Investigator® 24plex QS Kit should be used with
DNA extracts from routine forensic casework, while the Investigator®
24plex GO! Kit should be used for direct amplification of reference
samples (casework or databasing). Half reaction volumes are sufficient
when amplifying buccal samples with the Investigator® 24plex GO! Kit.
However, full reaction volumes may be used when necessary. Inhibited
blood samples may require a water wash prior to direct amplification
(see Note 9).
3.1 Amplification with Investigator® 24plex QS Kit

1. Using the estimated quantities of DNA obtained from the
applicable quantification kit, calculate the number of microliters
(and/or the necessary dilution) to be added to the amplification
reaction in order to obtain a concentration of 0.033–0.067 ng/μL.
The combined volume of TE−4 buffer and sample DNA should
equal 15 μL. A typical target amount of DNA comprised within the
15 μL is 0.5–1.0 ng; however, this may vary based on analyst
discretion and nature of the sample (see Note 10). Table 1
displays examples of how to set up samples for a 0.5 ng target.
2.
Obtain and label an appropriate quantity of 0.1 or 0.2 mL thin-
walled amplification tubes or a 96-well amplification plate.
3.
Place the tubes/plate in an appropriate retainer for stability.
4.
Obtain the following components from refrigerated storage: Fast
Reaction Mix 2.0, Primer Mix 24plex QS, and Control DNA 9948
(0.1 ng/μL).
5.
Vortex the PCR components well and centrifuge briefly prior to
use.
6.
Prepare the PCR reaction mix by adding the following volumes
per reaction to a labeled microcentrifuge tube: 7.5 μL Fast
Reaction Mix 2.0 and 2.5 μL Primer Mix 24plex QS (see Notes 11
and 12).
7.
Vortex well and pulse spin. Primer Mix 24plex QS is much less
dense than Fast Reaction Mix 2.0 and will float on top if not
thoroughly vortexed.
8.
Allow the sample extracts to equilibrate to room temperature.
Vortex and pulse spin all tubes.
9.
Dispense 10 μL of PCR reaction mix into each sample’s
amplification tube/well.
10.
Dispense the calculated volume of neat extract/diluted extract
and/or TE−4 buffer to each sample’s associated tube/well (see
Note 13).
Add the 9948 Positive Control and the TE−4 buffer Negative
Add the 9948 Positive Control and the TE buffer Negative
11. Control, in that order, as the last two samples of the batch. All
tubes/wells should now contain a total volume of 25 μL.
12.
Visually check the bottom of each tube/well to see that each one
contains the same volume of liquid (see Note 14). If so, make sure
that all caps are secure. Alternatively, add an adhesive seal and
make sure the seal is adequately secure over the entire plate.
13.
Vortex and centrifuge the tubes/plate.
14.
Turn on the thermal cycler. Load the samples onto the thermal
cycler. Gently push the tubes/plate completely down into the heat
block. Pull the lid closed over the samples until it clamps (see
Note 4).
15.
Select and confirm the 29-cycle thermal cycler program for full
reactions of DNA extracts (see Table 2 and Note 15).
16.
Press Start.
17.
When amplification is complete, the samples can remain at 10 °C
(in the thermal cycler) for up to 24 h. Pulse spin the tubes/plate
after removal and freeze at −25 °C to −15 °C or proceed to
preparation for capillary electrophoresis.
Table 1 Recommended normalization parameters
If you are preparing Then…

the…
DNA sample and the Add 15 μL of sample to the PCR tube/wella
concentration is ≤
desired target
DNA sample and the Dilute a portion of the sample with TE−4 buffer so that only 0.5 ng
concentration is > of total DNA is in a volume of 15 μL. Add 15 μL of sample to the PCR
desired target tube/well.
Positive control Add 5 μL of 9948 and 10 μL TE−4 buffer to the PCR tube/well
If you are preparing Then…
the…
Negative control Add 15 μL TE−4 buffer to the PCR tube/well
These guidelines require dilution of samples prior to their addition to

the amplification plate/tubes. This allows for a more streamlined and
less error prone amplification setup. After master mix addition, 15 μL
of each sample, whether it is neat or has been diluted, will be added to
each well
aIf the sample volume is significantly greater than 15 μL, it is advised to
concentrate the sample using your laboratory’s validated concentration

protocol
Table 2 Thermal cycling parameters
Temperature 24plex QS DNA 24plex GO! FTA/Non-FTA 24plex GO! Buccal

extracts blood samples swabs
Time Number of Time Number of cycles Time Number of
cycles cycles
98 °C 30 s 3 cycles 30 s 3 cycles 30 s 3 cycles
64 °C 55 s 40 s 40 s
72 °C 5s 5s 5s
96 °C 10 s 26 cycles 10 s 23 cycles 10 s 24 cycles
61 °C 55 s 40 s 40 s
72 °C 5s 5s 5s
68 °C 2 min – 2 min – 2 min –
60 °C 2 min – 2 min – 2 min –
10 °C ∞ – ∞ – ∞ –
The thermal cycling parameters differ slightly between kits and

between substrate types with regards to direct amplification. The
Investigator® 24plex QS Kit should be used with DNA extracts from
routine forensic casework, while the Investigator® 24plex GO! Kit
should be used for direct amplification of reference samples (casework
or databasing). Nonetheless, all thermal cycling parameters must first
begin with a 98 °C hot-start to activate the DNA polymerase
3.2 Direct Amplification (Investigator® 24plex GO! Kit)
with FTA or Non-FTA Blood Samples
1.
2.
3.
If water wash is needed, add 20 μL Type I water to the
tubes/wells (see Note 9). Otherwise, proceed directly to
preparing the PCR reaction mix (see Subheading 3.2, step 7).
4.
Punch samples into the tubes/wells by taking a 1.2 mm punch
from the center of the blood spot with a suitable punching tool
(see Note 3). Do not use more than one punch at a time [4].
5.
Spin down the tubes/plate to ensure punches are submerged in
water.
6.
Remove water from tubes/wells using a mechanical pipette.
7.
Reaction Mix 2.0, Primer Mix 24plex GO!, and Control DNA 9948
(5 ng/μL). For FTA blood samples only, also obtain Investigator
STR GO! Punch Buffer; the latter is not needed for non-FTA blood
samples (see Note 16).
8.
use.
9.
Reaction Mix 2.0, 12.5 μL Primer Mix 24plex GO!, and 2.0 μL
Investigator STR GO! Punch Buffer, if using (see Notes 11, 12, and
16).
10. Vortex well and pulse spin. Primer Mix 24plex GO! is much less
11. thoroughly vortexed.
Dispense 22 μL of PCR reaction mix for FTA samples (or 20 μL for
non-FTA samples) into each sample’s amplification tube/well.
12.
If the water wash was not performed (i.e., punches have not been
added; see Subheading 3.2, steps 3–6), punch samples into the
appropriate tubes/wells by taking a 1.2 mm punch from the
center of the blood spot with a suitable punching tool (see Notes 3
and 13). Do not use more than one punch at a time [4].
13.
Spin down the tubes/plate to ensure punches are submerged in
the PCR reaction mix and verify all punches are present in the
appropriate tubes/wells.
14.
For each amplification set, add 1 μL of positive control to the
appropriate tube(s)/well(s).
15.
For each amplification set, include a negative control in the
appropriate tube(s)/well(s). The negative control should not
include any template DNA. Do not add a blank punch or water to
the negative control tube/well [4].
16.
17.
18.
Note 4).
19.
Select and confirm the 26-cycle thermal cycler program for full
reactions of FTA/non-FTA blood samples (see Table 2 and Note
15).
20. Press Start.
21.
3.3 Half Reaction, Direct Amplification (Investigator®

24plex GO! Kit) with Buccal Swab Samples
1.
Place swab head(s) in a microcentrifuge tube or deep well plate.
2.
Add 500 μL STR GO! Lysis Buffer to each sample.
3.
Seal the plate or cap the tubes and place in a thermomixer at 95 °C
shaking at 1200 rpm for 5 min.
4.
5.
6.
Reaction Mix 2.0, Primer Mix 24plex GO!, and Control DNA 9948
(5 ng/μL).
7.
use.
8.
Reaction Mix 2.0 and 6.25 μL Primer Mix 24plex GO! (see Notes
11 and 12).
9.
Vortex well and pulse spin. Primer Mix 24plex GO! is much less
thoroughly vortexed.
10. Dispense 10 μL of PCR reaction mix into each sample’s
amplification tube/well.
11.
Add 1 μL of swab lysate to each tube/well containing PCR reaction
mix (see Notes 13 and 17).
12.
For each amplification set, add 1 μL of positive control to the

appropriate tube(s)/well(s) in the amplification plate.
13.
For each amplification set, include a negative control (blank swab
lysate) in the appropriate tube(s)/well(s) [4].
14.
15.
16.
Note 4).
17.
Select and confirm the 27-cycle thermal cycler program for half
reactions of buccal swabs (see Table 2 and Note 15).
18.
Press Start.
19.
4 Notes
1. Lower throughput scenarios (generally associated with smaller
casework laboratories or reamplification instances) may find the
0.1–0.2 mL reaction tube option more cost-effective and less
wasteful while high-throughput scenarios (typical of larger
casework laboratories or databasing laboratories) will more
frequently utilize 96-well PCR plates. Consult your thermal
cycler’s manufacturer recommendation for compatibility with 0.1
and/or 0.2 mL reaction tubes.
2.
It is important to minimize the number of freeze-thaw cycles for
the kit reagents to fewer than 20 freeze-thaw cycles. Kit reagents
should be stored at −20 °C until first use. After first use (i.e., initial
thaw), reagents should be stored between 2 and 8 °C for up to
6 months or can be placed back in storage at temperatures below
−20 °C if they will not be used for an extended period of time. It is
recommended to only thaw what you need. Keep the kit
components protected from direct exposure to light. Excessive
exposure can affect fluorescent probes. Each lot of kits must be
evaluated prior to use. Amplification reagents must be stored
separately from evidentiary samples.
3.
Manual and automated punching tools are available. The Harris
Uni-Core Punch (1.2 mm) and accompanying punching mat can be
utilized for manual punching. Alternatively, the BSD 600 puncher
with accompanying instrument, computer, and appropriate
software can be utilized for automated punching directly into the
96-well amplification plate.
4.
Extreme temperatures may affect the performance of
instruments. The ideal temperature range for a room housing
instrumentation is 20–25 °C.
5.
9948 is amplified as a positive control. This control is used to
evaluate the performance of the amplification and subsequent
typing procedures. See the Investigator® 24plex Kit User
Handbooks (product overview) for the known profile that is
generated from 9948.
6. TE−4 buffer is amplified as the negative control in the
Investigator® 24plex QS Kit. This control contains all chemical
g p
components of the amplification reaction in addition to TE−4
buffer and should exhibit no profile except for the large and small
quality sensor peaks.
7.
Extraction reagent blanks must be amplified at a volume equal to
the highest preparation volume of any sample in its associated
batch. In other words, the same concentration conditions as the
forensic samples that contain the least amount of DNA. This
control contains all of the chemical components of both the
extraction and amplification reactions and should exhibit no
profile except for the quality sensors. Furthermore, the reagent
blank must be amplified using the same primers and instrument
as its associated forensic sample(s).
8.
For the Investigator 24plex GO! Kit only, blood plates have a
combined reagent blank/amplification negative control.
9.
This wash is often required if the blood card was made from a
very low-volume blood tube or if the initial amplification was
done without a water wash and the resulting DNA profile
exhibited signs of inhibition.
10.
For samples that have either been through quantification or an
initial amplification and exhibit a high level of degradation, a
target template of greater than 1 ng may be necessary to generate
a complete DNA profile. If –A peaks are observed, the samples can
be re-amplified using less template DNA.
11.
Additional samples may be added to the calculation to account for
volume lost during pipetting.
12.
It is highly recommended to dispense immediately after
preparation. Otherwise, store at 2–8 °C until ready to dispense
into reaction tubes/wells.
13. Individual tubes should be capped immediately after sample
addition. If strip caps are utilized, cap after each completed
column to reduce the risk of cross contamination. Alternatively, an
adhesive plate seal may be applied after all samples/controls have
b dd d
been added.
14.
If there is a noticeable difference in sample volume, this may
indicate a pipetting error or an omission in adding the extract or
master mix. If the cause of the volume difference is not readily
obvious or able to be remedied, this tube/well may need to be
omitted from the assay and set up again.
15.
Ramp rates should be assigned as follows: Veriti® 96-Well Fast
Thermal Cycler—“100%”; GeneAmp™ PCR System 9700 with an
aluminum block—“Std Mode”; or GeneAmp™ PCR System 9700
with a silver block or gold-plated silver block—“Max Mode”. Do
not use “9600 Emulation Mode” [3, 4].
16.
When amplifying non-FTA samples, do not add Investigator STR
GO! Punch Buffer.
17.
Anywhere from 0.5–3.0 μL of swab lysate may be used if 1 μL does
not yield desirable results in the initial amplification attempt.
References
1. Connon CC (2022) STR biology & modern DNA detection techniques [PowerPoint slides].
Virginia Commonwealth University, FRSC 438 Forensic Molecular Biology
2. Kraemer M, Prochnow A, Bussmann M et al (2017) Developmental validation of QIAGEN

Investigator® 24plex QS Kit and Investigator® 24plex GO! Kit: two 6-dye multiplex assays
for the extended CODIS core loci. Forensic Sci Int Genet 29:9–20. https://doi.org/10.1016/j.
fsigen.2017.03.012
3. Qiagen (2021) Investigator® 24plex QS handbook for multiplex amplification of the CODIS
core loci, the European standard set of loci, plus SE33, DYS391, and Amelogenin. Available
via Qiagen. https://www.qiagen.com/us/resources/resourcedetail?id=debe09ab-5483-
478b-aeb3-e5c128e78a92&lang=en. Accessed 14 June 2022
4. Qiagen (2021) Investigator® 24plex GO! handbook for multiplex amplification of the CODIS
core loci, the European standard set of loci, plus SE33, DYS391, and Amelogenin. Available
via Qiagen. https://www.qiagen.com/us/resources/resourcedetail?id=97fbda9a-d69a-
4523-aea8-ae6c38de3ff2&lang=en. Accessed 14 June 2022
5.
Myers BA, King JL, Budowle B (2012) Evaluation and comparative analysis of direct
amplification of STRs using PowerPlex® 18D and Identifiler® Direct systems. Forensic Sci
Int Genet 6(5):640–645. https://doi.org/10.1016/j.fsigen.2012.02.005
6. Caputo M, Bobillo MC, Sala A et al (2017) Optimizing direct amplification of forensic

commercial kits for STR determination. J Forensic Legal Med 47:17–23. https://doi.org/10.
1016/j.jflm.2017.01.003
7. Ambers A, Wiley R, Novroski N et al (2018) Direct PCR amplification of DNA from human
bloodstains, saliva, and touch samples collected with MicroFLOQ® swabs. Forensic Sci Int
[Crossref][PubMed]
8. Cavanaugh SE, Bathrick A (2018) Direct PCR amplification of forensic touch and other
challenging DNA. Forensic Sci Int Genet 32:40–49. https://doi.org/10.1016/j.fsigen.2017.10.
005
[Crossref][PubMed]
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023
https://doi.org/10.1007/978-1-0716-3295-6_17
17. Low Volume STR Amplification Options: Coupling with

Standard or Fast PCR, Traditional or Normalized DNA
Extraction, and/or Traditional or Alternative Capillary
Electrophoresis
(1) Department of Forensic Science, Virginia Commonwealth University, Richmond, VA, USA

Abstract
STR amplification leads directly to profile development, which is also impacted by DNA extraction and
capillary electrophoresis detection. Amplification for forensic human identification purposes is inherently a
costly process; reduced volume reactions have long been an effective cost-savings measure. Processing
known, high-quality, single-source DNA samples (i.e., buccal samples) allows for the use of even lower
reaction volumes. This chapter provides examples of 3 μL and 6 μL reactions for a variety of commercial
amplification kits for use with buccal samples, including standard and fast PCR using KAPA2G™ Multiplex
Mix. These reactions can be utilized with traditional DNA extracts or those obtained from a normalized
extraction with the ChargeSwitch® Forensic DNA Purification Kit. They can be detected via traditional
capillary electrophoresis using POP-4™ polymer and a 36 cm array, or an alternative method using POP-6™
polymer and a 22 cm array on the 3130 series Genetic Analyzer instruments. This chapter also includes
protocols for the normalized extraction and alternative detection method.
Key words PCR – STR profiles – Amplification – Low volume – Fast PCR – KAPA2G™ Multiplex Mix –
Normalized extraction – ChargeSwitch® Forensic DNA Purification Kit – Capillary electrophoresis
1 Introduction
STR profile development is a critical, and complex, process for forensic human identification purposes. As
the field experiences technological advancements, it is often fruitful to revisit long-standing protocols to
incorporate these advancements in an effort to improve such methods. PCR reaction volumes have
dramatically decreased over the decades, originally beginning with 100 μL reactions when first developed in
the 1980s and currently reaching down to just a few microliters for high-quality, single-source samples [1,
2]. As a comparison, typical forensic evidentiary samples (which are more challenging than single-source
buccal samples) are routinely amplified using 15–25 μL reactions; using today’s standards, a “full” reaction
for forensic amplification kits is usually 25 μL [3–12]. These reductions served as a cost-savings measure for
the expensive commercial amplification kits used for forensic human identification purposes but also
resulted in the added benefit of increased sensitivity. High-quality, single-source reference samples, such as
buccal swabs, have been successfully amplified with lower reaction volumes compared to evidentiary
samples because the former are not subject to complications arising from potential mixtures of DNA,
degradation, and/or inhibition and can thereby still yield high-quality STR profiles using very low reaction
volumes [2].
In addition to striving to reduce costs, PCR amplification protocols have also been modified over the
decades to reduce overall processing time. The traditional reaction for forensic purposes generally takes 3–
3.5 h for roughly 30 PCR cycles—give or take a few cycles [3, 6, 8, 9]. Various efforts have been pursued to
reduce processing time, including, but not limited to, use of (1) faster cycling thermal cycler instruments
(“fast,” “ultra-fast,” or “rapid” thermal cyclers) that employ faster ramp rates to ramp between the various
temperatures in a PCR cycle (this is partially achieved through the use of heat block materials that are better
conductors, like gold-plated or silver, as compared to traditional materials like aluminum); (2) shorter PCR
phases (i.e., less time allotted for denaturation, annealing, and extension); (3) a 2-step PCR cycle, as
compared to the traditional 3-step cycle (the annealing and extension steps are combined); (4) a shorter
final extension for adenylating polymerases or complete removal of this step via the use of a non-
adenylating polymerase; (5) faster acting polymerases; (6) a reduced hot-start activation step; (7) a reduced
reaction volume (the increased sensitivity of reduced volume reactions results in fewer PCR cycles); and (8)
thin-walled PCR tubes to help with faster ramp rates and reduced times allotted for denaturation and
annealing/extension [2, 13–19]. Fast, low volume amplification has been achieved with a Veriti® 384-well
thermal cycler (Applied Biosystems, Waltham, MA) with run times of about 1 h or less for several
commercial amplification kits supplemented with KAPA2G™ Fast Multiplex Mix (KAPA Biosystems,
Wilmington, MA) [2].
Additional efforts to reduce overall processing time outside of amplification have included direct
amplification and normalized extraction [5, 7–12, 14, 20, 21]. Both of these eliminate the need to quantify
the DNA sample prior to amplification, which is currently acceptable for reference samples only per the FBI
Quality Assurance Standards [22]. However, direct amplification has the added benefit of bypassing the
extraction step as well (though often needs some kind of brief pre-amplification processing), whereas
normalized extraction has the added benefit of being compatible with very low reaction volumes for
amplification due to the lack of a substrate present in the reaction. A normalized extraction has been
specifically developed using the ChargeSwitch® Forensic DNA Purification Kit (Invitrogen, Waltham, MA)
that is compatible with fast, low volume amplifications [20].
One additional noteworthy strategy to reduce processing time via the 3130 series Genetic Analyzers has
been to modify the electrophoresis setup with a combination of POP-6™ polymer (Applied Biosystems) and
a 22 cm capillary array, as compared to the traditional POP-4™ polymer, 36 cm array setup [23]. Use of this
more viscous polymer combined with the shorter array provides sufficient resolution (as long as the
amplicons are not too long) accompanied by a shorter run time (reduced from ~45 min to ~25 min), and
leads to increased sensitivity (i.e., higher peak heights) such that injection voltage can be reduced from 3 kV
to 2 kV. The 3500 series Genetic Analyzers have already incorporated modifications to reduce
electrophoresis time to ~30 min, thus the modifications applied to the 3130 series are not necessary for the
newer Genetic Analyzers.
Depending upon a laboratory’s needs and their instrumentation, there are indeed a variety of options
that exist to incorporate low volume amplifications to develop STR profiles for forensic human identification
purposes.
2 Materials
All solutions should be prepared with Type I water. It is good laboratory practice to aliquot reagents for
short-term use (~1 month), rather than pulling from the stock solution each time; this reduces the risk of
contaminating the stock solution. Plastic consumables (i.e., tips, tubes, etc.) must be autoclaved for
sterilization (or purchased sterile); aerosol-barrier pipette tips are highly recommended.
2.1 STR Amplification

1.
DNA extracts: These can be prepared via a traditional DNA extraction/purification method of the user’s
choice (must be quantified) or from a normalized DNA extraction procedure (no quantification
required) (see Subheading 3.2). The amplification protocols included in this chapter have not been
optimized for direct amplification.
2.
STR amplification kit: User can select the STR amplification kit of their choice. Examples include
AmpFlSTR® Identifiler®, Identifiler® Plus, Yfiler®, and Yfiler® Plus PCR Amplification Kits; GlobalFiler™
PCR Amplification Kit; and the PowerPlex®16, 16 HS, Fusion, Fusion 6C, and Y23 Systems. Store as
indicated.
3.
96-well or 384-well plate (see Note 1).
4. Adhesive sealing film for PCR.
5.
Thermal cycler: Needs to be equipped with a heat block compatible with the amplification plate (96-
versus 384-well) and kit (some protocols require gold-plated, silver, etc. and are not compatible with
aluminum blocks). Program the thermal cycling parameters in advance, so that the instrument is ready
at the time of amplification.
6.
KAPA2G™ Fast Multiplex PCR Kit: Contains KAPA2G™ Fast Multiplex Mix (see Note 2). Store at −15 °C to
−20 °C upon receipt.
2.2 Normalized DNA Extraction

1.
Buccal samples: Buccal cells collected on sterile cotton swabs, Buccal DNA Collectors™ (buccal
collector), etc.
2.
ChargeSwitch® Forensic DNA Purification Kit: Contains ChargeSwitch® Lysis Buffer, ChargeSwitch®
Magnetic Beads, ChargeSwitch® Purification Buffer, ChargeSwitch® Wash Buffer, ChargeSwitch®
Elution Buffer, and 20 mg/mL Proteinase K. Prepare a working stock of 50% Lysis Buffer by combining
the desired volume of buffer with an equal volume of Type I water. Upon receipt, store Proteinase K at
2–8 °C and all other components at room temperature. If stored properly, all components are stable for
6 months.
3.
Magnetic particle separator (MPS): Author recommends the BioSprint® 96 workstation or KingFisher®
96.
4.
96-well rod cover.
5.
96-well microplate.
6.
96-well S-blocks: This plate has square, deep wells.
7.
Sterile, pierceable foil seal.
8.
Sterile tape seal.
9.
Sealing tool.
10.
Piercing tool.
11.
Plate centrifuge: Must be compatible with 96-well S-blocks and 96-well microplates.
12.
Sonicator.
13.
Oven incubator.
2.3 Capillary Electrophoresis Detection

1.
3130 or 3500 series Genetic Analyzer and compatible Data Collection software version. All reagents and
consumables that get loaded directly onto the instrument need to be compatible with the specific model.
2.
POP-4™ or POP-6™ polymer: Store at 2–8 °C upon receipt (see Note 3).
3.
36 cm or 22 cm capillary array (see Note 3).
4.
MicroAmp® Optical 96-well or 384-well reaction plate.
5. 96-Well or 384-well plate septa.
6.
Plate base and retainer.
7.
Formamide: Aliquot and store at 2–8 °C upon receipt; once thawed, do not re-freeze.
8.
Internal size standard: Store as instructed by manufacturer.
9.
Allelic ladder: Store as instructed by manufacturer.
3 Method
This low volume amplification protocol is general and can be adapted for a variety of commercial
amplification kits. It is described here for high-throughput processing and can be used with DNA extracts
generated from traditional extraction procedures or using the supplied normalized extraction procedure
(see Subheading 3.2) for buccal samples on swabs or buccal collectors. Appropriate controls need to be
processed at the amplification stage, including any associated extraction controls (e.g., reagent blanks), as
well as the amplification positive and negative controls. STR profile detection options also include use of
various capillary electrophoresis instruments (e.g., 3130 or 3500 series Genetic Analyzers), as well as a
traditional (see Subheading 3.3) or alternative method specifically crafted for the 3130 series (see
Subheading 3.4). Amplification and capillary electrophoresis detection setup should be performed in a
biological specimen hood. Furthermore, universal precautions should be taken regarding the handling of
biohazardous materials (e.g., human body fluids), including decontamination of laboratory
surfaces/equipment with 10% bleach followed by 70% ethanol before and after each use; changing pipette
tips in between each sample/reagent; and wearing personal protective equipment (PPE), as defined by your
laboratory policy. Basic PPE includes a lab coat, gloves, and safety glasses.
3.1 3 μL or 6 μL STR Amplification

1.
Retrieve DNA extracts of the samples being amplified. If frozen or refrigerated, allow them to come to
room temperature. Samples being amplified from traditional DNA extraction protocols must be
quantified prior to amplification to determine their concentration of human DNA. Samples being
amplified from the ChargeSwitch® normalized extraction (see Subheading 3.2) do not need to be
quantified.
2.
Retrieve the amplification kit components from the freezer/refrigerator and allow them to come to
room temperature. Keep reagents protected from light and do not leave them at room temperature for
an extended period of time.
3.
If processing DNA extracts from a traditional extraction method, all extracts need to be diluted
appropriately for amplification (~0.375–1.500 ng or ~0.500–1.500 ng input DNA for 3 μL or 6 μL,
respectively; see Note 4) based on the reaction volume and kit used (see Tables 1 and 2). DNA extracts
from the ChargeSwitch® normalized extraction (see Subheading 3.2) do not need to be further diluted
but are only suitable for use with 3 μL reaction volumes (see Note 5).
4.
Vortex and quick spin each amplification reagent (see Note 6).
5.
Using an appropriately sized tube, prepare enough amplification master mix for all samples/controls,
including an extra 10% for pipetting error (see Tables 1 and 2). Dispense the specified volume of
master mix into the appropriate wells of an amplification plate (see Notes 1 and 7).
6. Add the appropriate amount of DNA extract: 0.900 μL normalized extract for 3 μL reactions (includes
older kits modified for fast PCR with KAPA2G™); 1.000 μL or 1.200 μL traditional extract for 3 μL
reactions; or 2.000 μL or 2.400 μL traditional extract for 6 μL reactions (see Tables 1 and 2). Add the
positive amplification control (supplied with the kit) and negative amplification control (water). All
samples/controls should be added to their designated wells (see Note 7)
samples/controls should be added to their designated wells (see Note 7).
7.
Apply and securely seal the plate with an adhesive seal for PCR (see Note 8).
8. Centrifuge the plate for ~5 s.
9.
Transfer the plate to the thermal cycler, securely close the lid, and begin the appropriate PCR program
(see Tables 3 and 4 and Note 9).
10.
Once amplification is complete, remove the amplification plate from the thermal cycler. Proceed
immediately to capillary electrophoresis detection (see Subheading 3.3 or Subheading 3.4) or store the
plate at 4 °C until ready to do so (see Note 10).
Table 1 Examples of 3 μL and 6 μL amplification reactions
Component Identifiler® Identifiler® PowerPlex® PowerPlex® GlobalFiler™ PowerPlex® PowerPlex® Yfiler® Yfiler®
Plus 16 16 HS Fusion Fusion 6C Plus
3 μL Rxn mix 1.145 1.200 0.300 0.600 1.500 0.600 0.600 1.100 1.200
Reactions
Polymerase 0.055 – 0.100 – – – – 0.100 –
Primer set 0.600 0.600 0.300 0.300 0.500 0.600 0.600 0.600 0.600
Water T: – T: – T: 1.100 T: 0.900 T: – T: 0.600 T: 0.600 T: – T: –
N: 0.300 N: 0.300 N: 1.400 N: 1.200 N: 0.100 N: 0.100 N: 0.100 N: 0.300 N: 0.30
Total MM T: 1.800 T: 1.800 T: 1.800 T: 1.800 T: 2.000 T: 1.800 T: 1.800 T: 1.800 T: 1.80
N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.100 N: 2.10
DNA T: 1.200 T: 1.200 T: 1.200 T: 1.200 T: 1
.000 T: 1
.200 T: 1
.200 T: 1
.200 T: 1.20
extract N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.900 N: 0.90
6 μL Rxn mix 2.290 2.400 0.600 1.200 3.000 1.200 1.200 2.200 2.400
Reactions
Polymerase 0.110 – 0.200 – – – – 0.200 –
Primer set 1.200 1.200 0.600 0.600 1.000 1.200 1.200 1.200 1.200
Water – – 2.200 1.800 – 1.200 1.200 – –
Total MM 3.600 3.600 3.600 3.600 4.000 3.600 3.600 3.600 3.600
DNA 2.400 2.400 2.400 2.400 2.000 2.400 2.400 2.400 2.400
extract
This table provides examples of master mix preparation and DNA extract volumes (μL) for a variety of
commercially available STR amplification kits. Since exact reagent names may vary from kit to kit, generic
reagent names are used here for each of the components. PCR reaction mix, polymerase, and primer sets are
all supplied in the kit; Type I water may be supplied in the kit or may need to be supplied separately. If no
polymerase volume is listed, it is included in the PCR reaction mix by the manufacturer. These amplifications
are suitable for DNA extracts obtained from traditional methods as well as those obtained from the
ChargeSwitch® normalized extraction procedure. Volumes included are per sample and an extra 10% should
be prepared for pipetting error
Rxn mix = PCR reaction mix
Total MM = Total master mix; includes PCR reaction mix, polymerase, primer set, and water
T = traditional DNA extract; quantitation is required, and the reaction should target ~0.375–1.500 or
~0.500–1.500 ng DNA for 3 μL or 6 μL reactions, respectively
N = normalized DNA extract; only suitable for 3 μL reactions in these settings
Table 2 Examples of 3 μL fast amplification reactions
Component Identifiler® Identifiler® Plus PowerPlex® 16 PowerPlex® 16 HS Yfiler®

KAPA2G™ Fast Multiplex Mix 1.500 1.500 1.500 1.500 1.500
Primer set 0.600 0.600 0.300 0.300 0.600
Type I water – – 0.900 0.900 –
Total master mix 2.100 2.100 2.100 2.100 2.100
Component Identifiler® Identifiler® Plus PowerPlex® 16 PowerPlex® 16 HS Yfiler®
DNA extract 0.900 0.900 0.900 0.900 0.900
Older amplification kits had not yet incorporated fast PCR technology. This table provides examples of how
to modify the 3 μL reaction reagents to include KAPA2G™ Fast Multiplex Mix in place of the manufacturer-
supplied PCR reaction mix and polymerase. Traditional DNA extracts (targeting ~0.375–1.500 ng DNA) or
those obtained from the Charge-Switch® normalized extraction procedure can be used. Volumes
(μL) included are per sample and an extra 10% should be prepared for pipetting error.
Table 3 Examples of PCR thermal cycling parameters for 3 μL and 6 μL amplification reactions
PCR step Identifiler® Identifiler® PowerPlex® PowerPlex® GlobalFiler™ PowerPlex® PowerPlex® Yfiler® Yfiler® PowerP
Plus 16 16 HS Fusion Fusion 6C Plus Y23
Polymerase 95 °C 11 min 95 °C 11 min 96 °C 2 min 96 °C 2 min 95 °C 1 min 96 °C 1 min 96 °C 1 min 95 °C 95 °C 96 °C 2
activation 11 min 1 min
# of cycles 26 26 10/18 10/18 27 28 27 28 28 28
(3 μL) 27 27 10/19 10/19 28 29 28 29 29 29
(6 μL) 94 °C 1 min 94 °C 20 s 94/90 °C 94/90 °C 94 °C 10 s 94 °C 10 s 96 °C 5 s 94 °C 94 °C 94 °C 1
Denaturation 59 °C 1 min 59 °C 3 min 30 s 30 s 59 °C 90 s 59 °C 1 min 60 °C 1 min 1 min 4s 61 °C 1
Annealing 72 °C 1 min – 60 °C 30 s 60 °C 30 s – 72 °C 30 s – 61 °C 61.5 °C 72 °C 3
Extension 70 °C 45 s 70 °C 45 s 1 min 1 min
72 °C –
1 min
Final 60 °C 60 min 60 °C 10 min 60 °C 30 min 60 °C 30 min 60 °C 10 min 60 °C 10 min 60 °C 10 min 60 °C 60 °C 60 °C 2
extension 80 min 22 min
Hold 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C 4 °C
Total time ~2.75 h ~2 h ~2 h ~2 h ~1 h ~1 h ~0.75 h ~3 h ~1 h ~1.25 h
This table provides examples of PCR thermal cycling parameters for each of the STR amplification reactions
shown in Table 1. All of these low volume reactions use slightly fewer cycles compared to the standard
volume reaction for each kit. For 3 μL reactions, the thermal cycler used must be compatible with a 384-well
plate. Review the PowerPlex® 16/16 HS technical manuals for more information regarding ramp rates
Table 4 Examples of PCR thermal cycling parameters for 3 μL fast amplification reactions
PCR step Identifiler® Identifiler® Plus PowerPlex® 16 PowerPlex® 16 HS Yfiler®

Polymerase activation 95 °C 1 min 95 °C 1 min 96 °C 1 min 96 °C 1 min 95 °C 1 min
# of cycles 26 26 10 / 18 10 / 18 28
Denaturation 95 °C 5 s 95 °C 10 s 94/90 °C 15 s 94/90 °C 15 s 95 °C 5 s
Annealing 63 °C 40 s 63 °C 50 s 60 °C 15 s 60 °C 15 s 63 °C 40 s
Extension – – 70 °C 30 s 70 °C 30 s –
Final extension 72 °C 10 min 72 °C 10 min 72 °C 10 min 72 °C 10 min 72 °C 10 min
Hold 25 °C 25 °C 25 °C 25 °C 25 °C
Total time ~42 min ~50 min ~50 min ~50 min ~44 min
This table supplements Table 2 to demonstrate how the PCR thermal cycling parameters can be altered for
older amplification kits to achieve fast PCR. Most of the kits are able to utilize a 2-step PCR process, which
helps facilitate fast PCR. The thermal cycler used needs to be compatible with a 384-well plate and have a
gold-plate or silver heat block. Review the PowerPlex® 16/16 HS technical manuals for more information
regarding ramp rates
3.2 Normalized DNA Extraction via ChargeSwitch®

1. For each sample being processed, add ~¼ of a buccal swab or a 6 mm punch from a buccal collector to
the corresponding well of a 96-well S-block; only process one type of sample (see Notes 7 and 11).
Reserve an empty well for a reagent blank; a positive extraction control can also be processed but is
not required (see Note 12). This plate is referred to as the “sample plate” in this protocol.
2.
Using an appropriately sized tube (e.g., 50 mL conical tube), prepare a lysis buffer mixture consisting of
300 μL 50% ChargeSwitch® Lysis Buffer and 5 μL Proteinase K per sample (see Table 5). Include an
extra 10–15% for pipetting error. Gently mix by inversion (see Note 13).
3.
Using a multichannel pipette and a reagent trough, add 305 μL of the prepared lysis buffer mixture to
the respective wells of the sample plate.
4.
Apply and securely seal the sample plate with a foil seal using a sealing tool (see Note 14).
5.
Vortex the sample plate for 5 s, followed by a 1 min centrifugation.
6.
Sonicate the sample plate for 2 min.
7.
Incubate the sample plate in a 56 °C oven for 1–2 h for buccal swabs or overnight for buccal collector
punches.
8.
During the last 30 min or so of the incubation, prepare both wash plates and the elution buffer plate
needed for the MPS by adding the necessary reagent volumes (see Table 6 and Note 15). After each
reagent plate is prepared, apply a temporary tape seal and quick spin (see Note 16).
9.
For the lysate plate, add 100 μL ChargeSwitch® Purification Buffer to the corresponding wells of a
clean 96-well S-block (see Notes 15 and 17). Apply a temporary tape seal and centrifuge the plate for a
few seconds (see Note 16).
10.
Thoroughly vortex the ChargeSwitch® Magnetic Beads for 15 s. Quickly transfer the necessary volume
of beads to a reagent trough, including an extra 10–15% for pipetting error. Using a multichannel
pipette, add 0.5 μL (for buccal swabs) or 1.0 μL (for buccal collector punches) of beads to the
appropriate wells of the lysate plate (see Note 18). Apply a temporary tape seal and quick spin the
lysate plate (see Note 16).
11.
Retain each of the reagent plates in a safe location until all plates are ready for loading on the MPS.
12.
After the incubation of the sample plate is complete (see Subheading 3.2, step 7), remove the sample
plate from the oven and centrifuge it for ~30 s.
13.
Use a (clean) manual plate piercer to pierce through the foil seal of the sample plate (see Note 19).
Remove the temporary tape seal from the lysate plate and use a multichannel pipette to transfer the
lysate from the sample plate to the respective wells of the lysate plate; do not transfer the substrate
(see Note 20). Apply a temporary tape seal and quick spin the lysate plate (see Note 16).
14.
Turn on the MPS and select the protocol for DNA purification using the ChargeSwitch® kit; press
“Start”. Load the rod cover and reagent plates when prompted in positions 1–5 (loaded in reverse
order; see Table 6).
15.
After the MPS is prepared, press “Start” to begin the purification process. Purification takes ~20 min.
16.
Once the purification process is complete, remove the elution plate from position 4 of the MPS. If
proceeding immediately to amplification (see Subheading 3.1), apply a temporary tape seal (see Note
16). Otherwise, securely seal the plate with a foil seal using a sealing tool and store the plate at 4 °C for
up to 1 week or at −20 °C for long-term storage.
17.
Remove and discard the rod cover and other reagent plates from the MPS.
Table 5 Lysis for normalized extraction

Reagent Swab Punch
50% ChargeSwitch® Lysis Buffer 300 μL 300 μL

Proteinase K 5 μL 5 μL
Incubation at 56 °C 1–2 h overnight
A normalized extraction using the ChargeSwitch® Forensic DNA Purification Kit is suitable for use with
buccal swabs or buccal collector punches, followed by low volume amplification (quantitation not required).
The lysis buffer mixture described in the table above consists of 50% ChargeSwitch® Lysis Buffer and
Proteinase K and is added to the corresponding wells of the prepared sample plate. The volumes used for
sample lysis are the same for the each of the buccal samples, but the incubation times are different
Table 6 Supplies and reagent plates for the MPS
Position Plate name Reagent + plate used Volume (μL) per well
Swab Punch
5 N/A 96-well microplate with rod cover N/A N/A
4 Elution plate ChargeSwitch® Elution Buffer in S-block 60 80
3 Wash 2 plate ChargeSwitch® Wash Buffer in S-block 125 125
2 Wash 1 plate ChargeSwitch® Wash Buffer in S-block 125 125
1 Lysate plate ChargeSwitch® Purification Buffer + ChargeSwitch® Magnetic Beads in S-block 100 100
0.5 1.0
The above table defines which reagents and plates are needed for DNA purification using the ChargeSwitch®
Forensic DNA Purification Kit on a 96-well magnetic particle separator (MPS). The plates are loaded in
reverse order, starting with position 5 and ending with position 1
3.3 Traditional Capillary Electrophoresis Detection

1.
Prepare enough formamide/size standard mixture for all samples/controls from the amplification
plate, as well as the allelic ladders that will be processed (see Table 7 and Notes 21 and 22). Vortex
thoroughly for 5–10 s.
2.
Carefully remove the adhesive seal from the amplification plate and add 4 μL water to each well
containing amplification product (see Note 23).
3.
Transfer 10 μL of the prepared formamide/size standard mixture to the necessary wells of a
MicroAmp® Optical 96-Well or 384-Well Reaction Plate (see Notes 7 and 24).
4.
Transfer 1 μL of the diluted amplification product to the corresponding wells of the detection plate.
5.
Transfer 1 μL of the manufactured-supplied allelic ladder to the corresponding wells of the detection
plate.
6.
Carefully cover the plate with the corresponding septa (96-well or 384-well).
7.
Centrifuge the plate for 10–20 s. Ensure that all necessary wells contain reagent.
8.
Denature the plate for 5 min at 95 °C. Immediately snap freeze for 5 min.
9.
While the plate is denaturing and/or snap freezing, prepare the instrument for electrophoresis:
replace/replenish any reagents (anode/cathode buffer, water, and/or polymer), as necessary; preheat
the oven to 60 °C; and prepare the plate map in the Data Collection software, using a 3 kV 7 s or a
1.2 kV 15 s injection with the 3130 or 3500 series instrument, respectively (see Note 25). The protocol
used should be standard for fragment analysis using POP-4 polymer and a 36 array.
10. Once the denature/snap freeze step is complete (see Subheading 3.3, step 8), secure the detection
plate in a base and retainer. Load it on the capillary electrophoresis instrument, link the plate map, and
start the run.
11.
Once the plate has been processed, the data files can be imported into the STR profile analysis software
of choice, such as GeneMapper™ ID-X.
12.
The detection plate can be discarded or stored at −20 °C for up to 1 month if future reprocessing is
desired.
Table 7 Preparing amplification product for detection
PCR step GeneScan™ 500 LIZ®a GeneScan™ 600 LIZ® v2.0b ILS 600c WEN ILS 500d
Formamide 10 μL 10 μL 10 μL 10 μL
Size standard 0.2 μL 0.4 μL 0.5 μL 0.4 μL
A mixture of formamide and size standard is prepared as specified in the above table, of which 10 μL is
combined with 1 μL diluted amplification product in the detection plate. Select the appropriate size
standard for the amplification kit used; some kits are compatible with more than one size standard
aFor use with Identifiler®, Identifiler® Plus, and Yfiler®
bFor use with Identifiler®, Identifiler® Plus, GlobalFiler™, Yfiler®, and Yfiler® Plus
cFor use with PowerPlex® 16 and PowerPlex® 16 HS
dFor use with PowerPlex® Fusion, PowerPlex® Fusion 6C, and PowerPlex® Y23
3.4 Alternative Capillary Electrophoresis Detection (POP-6 and 22 cm Array)

1.
To prepare the 3130 series Genetic Analyzer for alternative capillary electrophoresis, ensure that a
22 cm array and POP-6 polymer are installed (see Note 26). If not, perform the Change Polymer Type
Wizard first (selecting POP-6 as the polymer type), followed by the Install Array Wizard (selecting a
22 cm array as the array length) (see Note 27).
2.
Next, prepare run modules in the Data Collection software. Click on Module Manager in the navigation
pane on the left. Click New to prepare a new run module. Complete the information requested in the Run
Module Editor (see Fig. 1); the type of module should be designated as “regular” from the drop-down list
(see Note 28). The module settings from the template selected should be modified to match those
displayed in Table 8 for the desired amplification kit (see Notes 29 and 30). Repeat this process for the
accompanying spectral run module (designate as “spectral” from the drop-down list) needed for the kit
3.
Once the run modules have been prepared, new instrument protocols need to be created as well (see
Note 33). Click on Protocol Manager in the navigation pane, then click New. Complete the information
requested in the Protocol Editor (see Fig. 2). Select the newly created, regular run module (it should
appear in the drop-down list) and the corresponding dye set (see Note 34). Repeat this process for the
spectral instrument protocol, selecting the newly created, spectral run module. Only the spectral
protocol has the polymer and array length designated.
4.
Once the instrument and Data Collection software have been set up for detection using POP-6 polymer
and a 22 cm array, prepare the detection plate as described for traditional detection (see Subheading
3.3). When preheating the oven (see Subheading 3.3, step 9), set it to 63 °C. Using the run modules
displayed in Table 8, these samples will undergo a 2 kV 7 s injection (see Note 25).
Fig. 1 Creating new run modules for alternative capillary electrophoresis. Both a regular and spectral run module need to be created for
alternative capillary electrophoresis. Any existing run module (of the same type) can be selected from the drop-down list to be used as a
template, after which the necessary settings can be altered. Settings need to coincide with the amplification kits (see Table 8), or more precisely,
with the dye sets used. The regular and spectral run modules displayed above are for use with the Identifiler®, Identifiler® Plus, and Yfiler®
amplification kits (all of these use Dye Set G5 from Applied Biosystems)
Table 8 Creating run modules for alternative capillary electrophoresis
Parameter Identifiler® Identifiler® Plus, Yfiler® PowerPlex® 16, PowerPlex® 16 HS

Regular Spectral Regular Spectral
Oven temperature 63 °C 63 °C 63 °C 63 °C
Polymer fill volume 5900 5900 5900 5900
Current stability 5 5 5 5
PreRun voltage 14 14 14 14
PreRun time 60 180 60 180
Injection voltage 2 1.2 2 3
Injection time 7 18 7 18
Voltage # of steps 10 40 10 40
Voltage step interval 20 15 20 15
Data delay time 175 1 175 1
Run voltage 14 14 14 14
Run time 905 480 1150 480
If desired, the 3130 series Genetic Analyzer can be used for detection of STR profiles using modified
conditions (POP-6 polymer and a 22 cm array) to reduce the detection time. To do so, the instrument needs
modified run modules and instrument protocols that are compatible with this setup. Use the table above to
modify the run module settings accordingly for the desired amplification kit. Once the run modules are
defined, instrument protocols can be set up to utilize the new run modules. Regular and spectral run
modules/protocols are needed for a kit
Fig. 2 Creating new instrument protocols for alternative capillary electrophoresis. Once the regular and spectral run modules have been
created, corresponding instrument protocols need to be created for each type as well. The newly created run modules will appear in the drop-
down list and can be selected for the specific type of protocol (regular versus spectral). Notice that only the spectral protocol has fields to
designate the polymer type and array length. The regular and spectral protocols displayed above are for use with the Identifiler®, Identifiler®
Plus, and Yfiler® amplification kits, as these all use Dye Set G5
4 Notes
1.
A 96-well plate is needed for 6 μL amplifications and a 384-well plate is needed for 3 μL amplifications.
2.
This reagent is only needed for fast PCR protocols for kits that were not originally designed for fast
PCR, such as AmpFlSTR Identifiler/Identifiler Plus and PowerPlex 16/16 HS. Newer kits like
GlobalFiler and PowerPlex Fusion/Fusion 6C have already been optimized for fast PCR and are sold as
such.
3.
POP-6 and the 22 cm array are only used for the alternative detection method for the 3130 series
Genetic Analyzer.
4.
DNA input is relative and based on the quantification method used. The overall workflow also impacts
the amount of DNA that is targeted. Laboratories will need to evaluate what range of input DNA yields
optimal STR profiles for each of the amplification kits they plan on using. Minor adjustments to cycle
number (increasing or decreasing by one cycle) may also prove fruitful.
5. Use of a normalized extraction procedure allows extracts to proceed immediately to amplification,
without the need for quantification. A specific volume of extract is added to the reaction. If the
resultant STR profiles are routinely not high quality, the volume of extract added to the reaction can be
modified per kit, with modifications made to the volume of water added to the master mix to
compensate for the change in DNA volume. If more significant changes are needed for a specific kit,
alterations can be made to the volume of beads and/or Elution Buffer used in the normalized
extraction, and/or the number of PCR cycles for amplification, the volume of PCR product used for
capillary electrophoresis detection, and/or the injection parameters (injection voltage and/or time).
There are many opportunities for fine tuning and customization of the process for individual
There are many opportunities for fine tuning and customization of the process for individual
laboratories. Once a suitable combination of parameters is identified, it is reasonable to expect >95%
first-pass success rate for buccal samples.
6.
Manufacturers advise against centrifugation of some highly concentrated reagents (e.g., some
PowerPlex® reagents). Read manufacturer protocols carefully.
7.
Follow appropriate documentation practices (e.g., use of a plate map designating the identification and
location of each sample/control).
8.
Make sure the seal is secure—especially around the corners and edges—and devoid of creases. A
poorly sealed plate is susceptible to evaporation, which can lead to poor amplification, especially for
these very low reaction volumes.
9.
It is good practice to turn the thermal cycler on in advance to allow it to initialize. The PCR program
should also be entered and stored in advance.
10.
The fluorescent signal decreases over time, so the plate should be processed within roughly 12–24 h
following amplification. If necessary, the plate can be store at −20 °C for future detection. Freezing
should help deter the loss of fluorescent signal somewhat, but loss will still occur.
11.
The protocols are different for buccal swabs versus buccal collectors, so do not process a plate with
both types of samples.
12.
Though no longer required by the FBI Quality Assurance Standards [22], a laboratory can choose to
process a positive extraction control in their standard operating procedure (SOP).
13.
Mixing should be thorough to create a homogenous solution, but if too aggressive, bubbles may result,
in which case 10–15% extra for pipetting error may not be enough.
14.
It is imperative that the plate is securely sealed, otherwise contamination will occur when the plate is
vortexed (see Subheading 3.2, step 5).
15.
Use a multichannel pipette and a reagent trough for each reagent/plate. Include 10–15% extra volume
for pipetting error.
16.
The temporary plate seals can be applied by (a gloved) hand. They will only be on the plates for a short
period of time and do not need to be thoroughly sealed using a sealing tool.
17.
Do not make a mixture of purification buffer and magnetic beads. These components need to be added
separately to ensure that the required amount of beads is added to each well.
18.
Gently and slowly pipette the beads up and down in the reagent trough to ensure that they are mixed
prior to transferring the required volume to the lysate plate. Also check that each tip of the
multichannel pipette has the appropriate volume of beads immediately prior to transferring them to
the lysate plate. Once the beads have been added to the lysate plate, gently and slowly pipette up and
down a few times in the purification buffer that is already present in the wells to ensure that all of the
beads are transferred from the tips. Tips may need to be changed between additions of beads.
19.
The plate piercer must be decontaminated in between each use. It is suggested to soak it in a detergent
for several minutes, scrub the piercers with a scrubbing tool (wire brush), soak in 10% bleach for
several minutes, and then thoroughly rinse with Type I water. Air dry prior to its next use.
20. Be sure to transfer all of the liquid lysate from the sample plate to the lysate plate. There should be
~300 μL transferred to each well. It is recommended to set the pipette to something higher than 300
(e.g., 400) to ensure that all lysate is transferred. Be mindful of bubble formation during the transfer.
21.
The formamide/size standard preparation in Table 7 includes a very small amount of overage. An
additional 5–10% extra should be prepared to account for pipetting error.
22.
A minimum of two allelic ladders should be processed. For a full plate, three ladders may be beneficial
—especially if your particular capillary electrophoresis instrument is subject to run-to-run
migration/separation variability—but is not required. Instruments with low levels of run-to-run
variability should be fine with two ladders.
23.
Given the low volume reactions, the amplification product needs to be diluted in preparation for
detection.
24.
Ensure that there are no empty wells in the set of wells that will be injected together.
25.
Injection time may need to be altered slightly given instrument-to-instrument sensitivity.
26.
This alternative process is for 3130 series Genetic Analyzers, not the 3500. The latter already has
decreased electrophoresis run times.
27.
The Wizards drop-down menu is located along the toolbar at the top of the Data Collection window.
For more information, see the reference guides supplied by the manufacturer [24, 25].
28.
A regular run module is used for STR profile detection. A separate spectral run module is needed for
spectral calibration.
29.
The oven temperature has been increased to 63 °C compared to that used in traditional capillary
electrophoresis for this instrument type and amplification product to help reduce processing time with
the more viscous POP-6 polymer [14, 23].
30.
The injection voltage has been reduced from that used in traditional capillary electrophoresis for this
instrument type and amplification product given the increased sensitivity under these conditions. The
injection parameters can be further adjusted via slight changes to the injection time to fine-tune the
resulting STR profiles (most notably to adjust peak heights).
31.
For more information regarding creating/modifying new modules, see the reference guides supplied
by the manufacturer [24, 25].
32.
A new spectral calibration needs to be performed using the new run module. The instrument must
have POP-6 polymer and a 22 cm array installed at the time of the spectral calibration.
33.
Instrument protocols use a specific run module, so run modules must be created first.
34.
For the Identifiler, Identifiler Plus, and Yfiler Plus kits, Dye Set G5 is used. For PowerPlex 16 and
PowerPlex 16 HS, select the dye set that has been customized for these kits in the instrument being
used.
References
1. Mullis KB, Faloona FA (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155:335–350.
https://doi.org/10.1016/0076-6879(87)55023-6
[Crossref][PubMed]
2. Connon CC, LeFebvre AK, Benjamin RC (2016) Validation of low volume, fast PCR amplification of STR loci for reference DNA samples. J
Forensic Leg Investig Sci 2:008. https://doi.org/10.24966/FLIS-733X/100008
[Crossref]
3. Thermo Fisher Scientific (2018) AmpFlSTR™ Identifiler™ PCR Amplification Kit user guide, revision K. Available via Thermo Fisher
Scientific. https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2Fcms_041201.pdf. Accessed 18 July 2022
4.
Thermo Fisher Scientific (2018) AmpFlSTR™ Identifiler™ Plus PCR Amplification Kit user guide, revision H. Available via Thermo Fisher
Scientific. https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2F4440211_AmpFlSTR_IdentifilerPlus_UG.pdf. Accessed 18 July 2022
5. Thermo Fisher Scientific (2019) GlobalFiler™ and GlobalFiler™ IQC PCR Amplification Kits user guide, revision F. Available via Thermo
Fisher Scientific. https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2F4477604.pdf. Accessed 18 July 2022
6. Thermo Fisher Scientific (2014) AmpFlSTR® Yfiler® PCR Amplification Kit user guide, revision J. Available via Thermo Fisher Scientific.
https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2F4358101_AmpflstrYfilerKit_UG.pdf. Accessed 18 July 2022
7. Thermo Fisher Scientific (2019) Yfiler™ Plus PCR Amplification Kit user guide, revision D. Available via Thermo Fisher Scientific. https://
www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-
Assets%2FLSG%2Fmanuals%2F4485610_YfilerPlus_UG.pdf. Accessed 18 July 2022
8. Promega Corporation (2022) PowerPlex® 16 System technical manual. Available via Promega. https://www.promega.com/-/media/files/
resources/protocols/technical-manuals/101/powerplex-16-system-protocol.pdf. Accessed 18 July 2022
9. Promega Corporation (2022) PowerPlex® 16 HS System for use on the Applied Biosystems® Genetic Analyzers technical manual. Available
via Promega. https://www.promega.com/-/media/files/resources/protocols/technical-manuals/101/powerplex-16-hs-system-protocol.
pdf. Accessed 18 July 2022
10. Promega Corporation (2020) PowerPlex® Fusion System for use on the Applied Biosystems® Genetic Analyzers technical manual. Available
via Promega. https://www.promega.com/-/media/files/resources/protocols/technical-manuals/101/powerplex-fusion-system-protocol.
pdf. Accessed 18 July 2022
11. Promega Corporation (2020) PowerPlex® Fusion 6C System for use on the Applied Biosystems® Genetic Analyzers technical manual.
Available via Promega. https://www.promega.com/-/media/files/resources/protocols/technical-manuals/101/powerplex-fusion-6c-
system-protocol.pdf. Accessed 18 July 2022
12. Promega Corporation (2021) PowerPlex® Y23 System for use on the Applied Biosystems® Genetic Analyzers technical manual. Available
via Promega. https://www.promega.com/-/media/files/resources/protocols/technical-manuals/101/powerplex-y23-system-protocol.pdf.
13. Connon CC, LeFebvre AK, Benjamin RC (2016) Assessment of four polymerases for low volume, fast PCR amplification of STR loci for DNA
reference samples. J Forensic Leg Investig Sci 2:009. https://doi.org/10.24966/FLIS-733X/100009
[Crossref]
14. Connon CC (2015) Improving processing efficiency for forensic DNA samples. Dissertation, University of North Texas
15. Verheij S, Harteveld J, Sijen T (2012) A protocol for direct and rapid multiplex PCR amplification on forensically relevant samples. Forensic
Sci Int Genet 6(2):167–175. https://doi.org/10.1016/j.fsigen.2011.03.014
[Crossref][PubMed]
16. Laurin N, Frégeau C (2012) Optimization and validation of a fast amplification protocol for AmpFlSTR® Profiler Plus® for rapid forensic
human identification. Forensic Sci Int Genet 6(1):47–57. https://doi.org/10.1016/j.fsigen.2011.01.011
[Crossref][PubMed]
17. Foster A, Laurin N (2012) Development of a fast PCR protocol enabling rapid generation of AmpFlSTR® Identifiler® profiles for genotyping
of human DNA. Investig Genet 3:1–11. https://doi.org/10.1186/2041-2223-3-6
[Crossref]
18. Vallone PM, Hill CR, Butler JM (2008) Demonstration of rapid multiplex PCR amplification involving 16 genetic loci. Forensic Sci Int Genet
3(1):42–45. https://doi.org/10.1016/j.fsigen.2008.09.005
[Crossref][PubMed]
19. Hedman J, Albinsson L, Ansell C et al (2008) A fast analysis system for forensic DNA reference samples. Forensic Sci Int Genet 2(3):184–189.
https://doi.org/10.1016/j.fsigen.2007.12.011
[Crossref][PubMed]
20. Connon CC, LeFebvre AK, Benjamin RC (2016) Development of a normalized extraction to further aid in fast, high-throughput processing of
forensic DNA reference samples. Forensic Sci Int Genet 25:112–124. https://doi.org/10.1016/j.fsigen.2016.07.019
[Crossref][PubMed]
21. Gray K, Crowle D, Scott P (2014) Direct amplification of casework bloodstains using the Promega PowerPlex® 21 PCR amplification system.
[Crossref][PubMed]
22. FBI (2020) Quality Assurance Standards for forensic DNA testing laboratories. Available via Scientific Working Group on DNA Analysis
Methods (SWGDAM). https://www.swgdam.org/_f iles/ugd/4344b0_d73afdd0007c4ed6a0e7e2ffbd6c4eb8.p df
23.
Connon CC, LeFebvre AK, Benjamin RC (2016) Validation of alternative capillary electrophoresis detection of STRs using POP-6 polymer and
a 22 cm array on a 3130xl Genetic Analyzer. Forensic Sci Int Genet 22:113–127. https://doi.org/10.1016/j.fsigen.2016.02.006
[Crossref][PubMed]
24. Applied Biosystems (2010) Applied Biosystems 3130/3130xl Genetic Analyzers: getting started guide, revision D. Available via Thermo
Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/cms_041468.pdf. Accessed 18 July 2022
25. Thermo Fisher Scientific (2021) Applied Biosystems 3500/3500xL Genetic Analyzer: user guide, revision E. Available via Thermo Fisher
Scientific. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/100031809_3500_3500xL_Software_v3_1_UG.pdf. Accessed 18 July
2022
Part V
STR Profile Detection and
Interpretation
https://doi.org/10.1007/978-1-0716-3295-6_18
18. Capillary Electrophoresis with

Applied Biosystems’ 3500 Genetic
Analyzer
Kara Kovach1
(1) Erie County Central Police Services Forensic Laboratory, Buffalo,
NY, USA
Abstract
The Applied Biosystems® 3500/3500xL Genetic Analyzer is a capillary
electrophoresis system used to perform fragment analysis of forensic
samples (Thermo Fisher Scientific, Applied Biosystems 3500/3500xL
Genetic Analyzer User Guide, Revision C, 2010). In this chapter, a
procedure is described that details how to load reagents, set up the
software, and prepare and process a sample plate.
Key words Applied Biosystems – Genetic Analyzer – Capillary

electrophoresis – Fragment analysis – 3500 – 3500xL
1 Introduction
The Applied Biosystems® 3500/3500xL Genetic Analyzer is a capillary
electrophoresis system used to perform fragment analysis of forensic
samples using either an 8-capillary array (3500) or a 24-capillary array
(3500xL) [1]. Polymer fills each of the capillaries and acts as a sieve
that separates fluorescently labeled DNA fragments by size. In the
detection cell of the instrument, a laser excites the fluorescent labels
causing them to emit light of different wavelengths, which is then
captured by a CCD camera [1]. The 3500 Data Collection Software
collects the data from the camera and generates an electropherogram.
While the 3500 Data Collection Software is capable of basic data
analysis, it needs to be transferred to a secondary software program
(such as GeneMapper™ ID-X) for further analysis [1]. The 3500 and
3500xL Genetic Analyzers are fully automated and can process 96
samples in approximately 6 or 2 hours, respectively (however, this is
subject to variation depending on the amplification kit utilized) [1].
Additionally, the instrument is capable of performing electrophoresis of
a 364-well plate. In this chapter, a procedure is described that details
how to load reagents, set up the software, and prepare and process a
sample plate.
2 Materials
The materials required for instrument setup and capillary
electrophoresis (CE) plate setup are:
1.
Anode Buffer Container (ABC) (see Notes 1–4).
2.
Cathode Buffer Container (CBC) (see Notes 1–4).
3.
Capillary Array (8-capillary for the 3500 and 24-capillary for the
3500xL).
4.
Polymer Pouch (see Notes 1, 2, 4, and 5).
5.
Conditioning Reagent (see Notes 1, 2, and 6).
6.
CBC septa.
7.
Internal lane standard (ILS).
8.
Amplification kit-specific allelic ladder.
9.
PCR amplification products.
10. Formamide (see Notes 7 and 8).
11.
MicroAmp™ Optical 96-Well plates.
12.
96-well plate septa.
13.
Plate base and retainer.
14.
Plate centrifuge.
15.
Heat block or thermocycler.
16.
96-well ice block.
17.
Distilled or deionized water.
18.
Pump syringe.
19.
Fragment analysis HID standard, or Sequencing standard (see
Note 9).
3 Methods
The protocols below are based on the manufacturer’s user guide for the
instrument and on-site training provided by an Applied Biosystems
representative [1, 2].
3.1 Turning the Instrument On

1.
Turn on the computer and wait for the login screen to appear.
2.
Turn on the instrument and wait for the indicator light to turn
green.
3.
Log into the computer.
4. Wait for the 3500 Server Monitor to indicate “Y” for all indicators
(see Fig. 1).
5.
Log into the 3500 Data Collection Software.
Fig. 1 3500 server monitor. When starting up the instrument, it is important to wait for the
3500 Server Monitor to show “Y” for all indicators prior to opening the 3500 Data Collection
Software
3.2 Turning the Instrument Off

1.
Exit the 3500 Data Collection Software.
2.
Turn off the instrument.
3.
Turn off the computer.
3.3 Loading the Anode Buffer Container (ABC)

1. Remove the ABC from storage and bring to room temperature.
2.
Tilt the ABC so that most of the buffer is in the larger side of the
container, verifying that it is at the fill line. Remove the seal.
3.
Slide the ABC into place underneath the pump (see Note 10 and
Fig. 2).
4.
Close the instrument door and click “Refresh” on Dashboard to
update (see Fig. 3).
Fig. 2 3500 interior components: pump block. The pump block contains some of the
consumables used by the instrument, as well as the polymer delivery pump, which is
responsible for pumping polymer into the array. The areas of particular importance are
indicated on the figure: (a) Anode Buffer Container (ABC); (b) polymer pouch; (c) arm that
raises and lowers the polymer pouch during installation of a new pouch; (d) the Polymer
Delivery Pump, which contains thin channels in which bubbles may arise; (e) port to inject
water into the pump channels to eliminate bubbles that remain after running the Remove
Bubbles wizard
Fig. 3 Consumables pane on the dashboard. This information pane on the Dashboard keeps
track of important information on the 3500 consumables that are currently loaded on the
instrument. (a) Prior to each run, check to ensure that reagents are not expired and that there
are enough consumables remaining to run your sample plate. (b) After loading new reagents
onto the instrument, click the “Refresh” button to update the information in the system
3.4 Loading the Cathode Buffer Container (CBC)

1.
Remove the CBC from storage and bring to room temperature.
2.
Tilt the container back and forth until the buffer reaches the fill line
on both sides. Place on a flat surface and remove the seal.
3.
Carefully wipe off any liquid that is on the top of the container with
a laboratory wipe.
4.
Place the appropriate septa on both sides of the CBC. The septa
with the collar are placed on the left side (or the side with 24 larger
holes). The flat septa are placed on the right side (the side with 48
smaller holes) (see Note 11 and Fig. 4).
5.
Carefully load the CBC onto the autosampler. The side with 24 holes
should be on the “A” side of the autosampler (see Note 12 and Fig.
4).
6.
Close the instrument door and click “Refresh” on the Dashboard to
update (see Fig. 3).
Fig. 4 Autosampler with CBC and plate retainer loaded. The autosampler is home to the CBC
and is the area onto which sample plates are loaded. (a) The CBC (with septa) is installed at the
front of the autosampler. (b) When installing the CBC, squeeze the middle part of the CBC.
(c) Additionally, when loading sample plates onto the instrument, the notched edge of the plate
retainer should face out and to the right
3.5 Maintenance Wizards

1.
The 3500 Data Collection Software has “Maintenance Wizards” (see
Fig. 5) that have detailed instructions on how to perform a variety
of functions. After performing each wizard, click “Refresh” on the
Dashboard to update the reagent information (see Fig. 3).
2.
Use the “Install a capillary array” wizard to install or change a
capillary array (15–45 min) (see Note 13).
3.
Use the “Remove bubbles from the polymer pump” wizard when
bubbles have been identified in the polymer pump (5–15 min).
These should be removed prior to running the instrument.
4.
Use the “Wash the pump chamber and channels” wizard when
there is dried polymer present in the polymer delivery pump
(>40 min). Dried polymer should be removed from these areas
prior to running the instrument.
5. Use the “Fill the array with fresh polymer” wizard when installing a
6. new array on the instrument.
Use the “Replenish the polymer installed on the instrument” wizard
when installing a polymer pouch of the same polymer type (10–
20 min) (see Note 14).
7.
Use the “Change the type of polymer installed on the instrument”
wizard when changing the type of polymer installed on the
instrument (60–70 min).
8.
Use the “Shutdown the instrument” wizard if the instrument will
not be used for more than 2 weeks, or if the instrument is being
moved and requires the conditioning reagent (60 min).
9.
Use the “Reactivate the instrument” wizard after an instrument has
been shut down using the “Shutdown the instrument” wizard
(45 min).
Fig. 5 Maintenance wizard home screen. The 3500 Data Collection Software has wizards that
perform common maintenance tasks. These wizards are located within the “Maintenance” tab,
under the “Maintenance” header in the navigation pane
3.6 Spatial Calibrations
1.
Go to the “Maintenance” tab and in the “Calibration” navigation
pane, select Spatial (see Note 15 and Fig. 6).
2.
In the “Options” pane, select whether to perform the calibration
with or without filling the array with fresh polymer from the
polymer pouch by selecting either “Fill” or “No Fill,” respectively
3.
Click “Start Calibration”.
4.
Evaluate the results. Ensure that each capillary has one sharp peak.
The “+” needs to be at the point/top of every peak. All peaks should
be approximately the same height. “Accept Results” or “Reject
Results” based on these criteria.
Fig. 6 Spatial and spectral calibration wizards. The 3500 Data Collection Software has wizards
to aid in performing spatial and spectral calibrations. These can be found within the
“Maintenance” tab, under the “Calibrate” header in the navigation pane. (a) Select “Spatial” to
perform a spatial calibration. (b) Select “Spectral” to perform a spectral calibration
3.7 Spectral Calibrations

1. Prior to performing a spectral calibration, check the status of the
reagents in the Dashboard to ensure that they are not expired (see
Note 18). Additionally, check the status of the pouch and the
capillary array to ensure that there are more “Samples
Remaining” and “Injections Remaining” than will be used by your
plate (see Fig. 3).
2.
Check for bubbles in the polymer pump and run the “Remove
Bubble” wizard if any are identified (see Note 19).
3.
Set the oven temperature to either 60 °C (POP-7™ and POP-4™) or
50 °C (POP-6™) and click “Start Pre-heat” prior to setting up the
spectral calibration plate (see Note 20).
4.
Calibration standards should be prepared according to the
product insert (see Note 21).
5.
Set up your spectral calibration plate according to Fig. 7.
6.
Place septa on the plate (see Note 11).
7.
Centrifuge your plate at maximum speed for 3 min. Ensure that
the liquid is at the bottom of each loaded well.
8.
Place the plate into the plate base (blue). Attach the plate retainer
(white) to the base (see Note 22 and Fig. 8).
9.
Press the “Tray” button on the instrument.
10.
Wait until the autosampler tray finishes its movement. Open the
door. The indicator light on the instrument will blink yellow.
11.
Place the plate onto the autosampler tray in either position A or B,
noting which position is used. The labels on the plate retainer
should face you and the notched corners of the plate and the
autosampler should line up (see Fig. 4).
12.
Close the door. Wait until the autosampler tray finishes its
movement and the indicator light is green.
13. Go to the “Maintenance” tab, and in the “Calibration” navigation
pane, select Spectral (see Fig. 6).
14.
In the “Calibration Settings” pane, choose the number of wells,
plate position, chemistry standard, and dye set (see Note 21 and
Fig. 9).
15.
Select “Allow Borrowing” (see Note 23 and Fig. 9).
16.
Click “Start Run”.

17.
After the run is complete, review the data. Green indicates a
passing capillary, red a failing capillary, and yellow a borrowed
capillary with an arrow pointed to the capillary that was
borrowed from (see Fig. 10). Click on each capillary to display the
data and ensure that it meets the criteria established in Table 1.
18.
If the criteria in Table 1 is met for all capillaries, click “Accept
Results.” If any capillaries do not meet the criteria, click “Reject
Results.”
Fig. 7 Spectral calibration plate. This guide indicates how to set up the spectral calibration
plate according to the number of capillaries and plate capacity of your 3500 instrument. (a) For
a 96-well plate on an 8-capillary instrument, use wells A1 through H1. (b) For a 96-well plate
on a 24-capillary instrument, use wells A1 through H1, A2 through H2, and A3 through H3.
(c) For a 384-well plate on a 24-capillary instrument, use columns 1, 3, and 5 in rows A, C, E, G,
I, K, M, and O. The 8-capillary instrument does not support 384-well plates [1]
Fig. 8 Plate assembly. The 96-well plate with septa (shown on the right) is secured within the
plate base (blue; middle) and the plate retainer (white; left) prior to loading onto the
instrument
Fig. 9 Spectral calibration set up screen. (a) When running a spectral calibration, the software
requires you to indicate the number of wells of your plate and its position on the autosampler,
(b) the chemistry standard and dye set being used, and (c) whether you want to “Allow
Borrowing” (which enables the software to use data from an adjacent capillary). (d) Once this
information is entered, click “Start Run” to begin the calibration [1]
Fig. 10 Spectral calibration capillary run data. This is an example of a passing spectral
calibration. The green squares indicate that the capillaries passed. If a capillary failed during a
run, the square for that capillary in that run column would be red. If the instrument was able to
borrow data from an adjacent capillary, the square for the failed capillary in the “Overall” row
would be yellow with an arrow indicating which capillary the data was borrowed from [1]
Table 1 Acceptance criteria for a spectral calibration
4- Dye 4-Dye Fragment 5-Dye Fragment

Sequencing analysis/HID analysis/HID
Order of peak in the spectral profile Blue-green- Blue-green-yellow- Blue-green-yellow-
from left to right yellow-red red red-orange
Order of the peaks in the raw data Red-yellow- Red-yellow-green- Orange-red-yellow-
profile from left to right blue-green blue green-blue
Extraneous peaks in the raw data None None None
file
Use this table to assess the results of the spectral calibration for each
capillary. Pay attention to whether you are looking at the spectral
profile or the raw data profile as the expected peak color order is
different.
3.8 Preparing the Instrument for Electrophoresis

1.
In the Dashboard, check the status of the reagents to ensure that
they are not expired. Additionally, check the status of the pouch
and the capillary array to ensure that there are more “Samples
Remaining” and “Injections Remaining” than will be used by your
plate (see Fig. 3).
2. Check for bubbles in the polymer pump and run the “Remove
Bubble” wizard if any are identified (see Note 19).
3.
Click “Create Plate from Template” located on the Dashboard (see
Fig. 11).
4.
Choose the appropriate template from the list for your plate (see
Note 24). Select the chosen template and click “Open.”
5.
Enter a plate name and your initials in the “Owners” box, and click
“Save.” The number of wells, plate type, capillary length, and
polymer should be pre-set by your template (see Fig. 12).
6.
Click “Assign Plate Contents” (see Fig. 12).
7.
Using either the “Plate View” or the “Table View,” enter your
sample names in their assigned wells.
8.
In “Plate View,” assign assays, file name conventions, and results
group by highlighting the wells to be injected and clicking the
checkbox next to the chosen settings. Multiple assays can be used
in a single plate by assigning different settings to different wells
(see Note 24 and Fig. 13).
9.
(Optional) You can specify the sample type (sample, controls,
allelic ladder, etc.) at this stage by changing it either on the “Table
View” screen or by expanding the “Customize Sample Info” pane
on the “Plate View” screen (see Note 25 and Fig. 13).
10.
Save your plate (see Fig. 13). Stay on this screen until you have
loaded your plate onto the instrument (see Subheading 3.10).
11.
(Optional) You can print the plate map for reference while loading
your sample plate by clicking “View Plate Grid Report” and
selecting “Print.” You can also choose to print this in list format by
clicking “Export.” These different formats contain the same
information.
12. Continue on to set up the sample plate (see Subheading 3.9).
Fig. 11 Dashboard shortcuts and tabs. The shortcuts located on the Dashboard contain most of
the functions you will need to perform. The “Create Plate from Template” option is circled and
is the shortcut you would click to begin setting up a sample plate run. Additionally, you can
navigate to the maintenance wizards with one of these shortcuts. The tabs at the top help you to
navigate between screens in the software. The main tabs to be aware of are the “Dashboard”
tab, which functions as a home button; the “Workflow” tab, which is where you will find your
current plate setup and run information; and the “Maintenance” tab, which is where you will
find the maintenance wizards and spectral/spatial calibration wizards
Fig. 12 “Define Plate Properties” screen. The “Define Plate Properties” screen is the first screen
you will encounter when setting up a sample plate in the 3500 Data Collection Software. (a) Fill
out the plate name and owner’s initials, (b) save the plate by clicking the “Save Plate” button,
and (c) then click the “Assign Plate Contents” button to navigate to the next screen
Fig. 13 “Assign Plate Contents” screen. The “Assign Plate Contents” screen is where you input
information about your sample plate into the 3500 Data Collection Software. (a) You can do this
using either the “Plate View” or the “Table View” and can toggle between them using the tabs
towards the top. (b) Once you have added your samples, assign appropriate assays, file name
convention, and results group as determined by your laboratory’s protocols. (c) Then, assign
the appropriate sample type (Allelic Ladder, Sample, Positive Control, etc.) to the wells by
expanding the “Customize Sample Info” pane and (d) using the drop-down menu labeled
“Sample Type”. (e) When complete, load your physical sample plate onto the autosampler and
click the “Link Plate for Run” button
3.9 Sample Plate Set Up

1.
Set the oven temperature to either 60 °C (POP-7™ and POP-4™) or
50 °C (POP-6™) and click “Start Pre-heat” prior to setting up the
sample plate (see Note 20).
2.
Prepare a formamide:ILS master mix for all samples, controls, and
allelic ladders that will be processed. Aliquot specified volume of
master mix into every well of the 96-well plate that will be used on
the instrument (see Notes 26–28 and Fig. 14).
3.
Add 1 μL of DNA amplification product into the assigned wells.
4.
Add 1 μL of the appropriate allelic ladder into the assigned wells
5. Once all samples and allelic ladders are added, place septa on the
plate (see Note 11).
6.
Centrifuge the plate at maximum speed for 3 min. Check to ensure
that all liquid is at the bottom of each well.
7.
(Optional but recommended) Denature the plate at 95 °C for 3 min.
Follow by placing the plate on ice for 3 min (see Notes 31 and 32).
8.
Place the plate into the plate base (blue). Attach the plate retainer
(white) to the base (see Note 22 and Fig. 8).
9.
Continue on to process the plate on the instrument (see Subheading
3.10, step 1).
Fig. 14 Injection capacity of the 3500 versus 3500xL. The outlines demonstrate the number of
wells one injection of the 3500 (blue) versus the 3500xL (orange) would encompass. Ensure
that all wells within an injection are loaded with a suitable liquid (do not use water)
3.10 Processing the Plate on the Instrument

1.
Confirm that the oven has reached the run temperature. If the oven
was not preheated, complete this step described previously (see
Subheading 3.9, step 1; and Notes 33 and 34).
2. Press the “Tray” button on the instrument.
3.
Wait until the autosampler tray finishes its movement. Open the
door. The indicator light on the instrument will blink yellow.
4.
Place the plate onto the autosampler tray in either position A or B,
noting which position is used. The labels on the plate retainer
should face you and the notched corners of the plate and the
autosampler should line up (see Fig. 4).
5.
Close the door. Wait until the autosampler tray finishes its
movement and the indicator light is green.
6.
Assuming the Data Collection Software is as you left it following the
creation of the plate map (see Subheading 3.8, step 10), resume the
process by clicking “Link Plate for Run” at the bottom of the screen
(see Notes 35 and 36; and Fig. 13).
7.
The plate will be automatically linked and should be in the correct
position (A or B). If it is not, click “Switch Plates” to switch
autosampler positions in the software (see Note 37 and Fig. 15).
8.
From this screen, either click “Create Injection List” to preview the
run and modify the injections (see Note 38) or click “Start Run” to
begin running the instrument (see Fig. 15). The indicator light on
the instrument will blink green to indicate that it is running.
Fig. 15 “Load Plate for Run” screen. On the “Load Plate for Run” screen, ensure that your plate
name is appearing under the correct autosampler position. (a) If the plate is listed in the wrong
spot, click the “Switch Plates” button. (b) If the software does not automatically register the
plate, you can usually find it in the “Recent Plates” pane and drag and drop it into the correct
autosampler position. (c) From here you can either click the “Create Injection List” button to
view the injection prior to starting your run, or (d) you can click the “Start Run” button to begin
electrophoresis
3.11 Monitoring Electrophoresis in Progress

1.
The “Monitor Run” screen will appear automatically after
electrophoresis begins. Injections that are currently being analyzed
will be highlighted in green on the plate view and will have a green
arrow symbol in the “Injection” column on the table. This symbol
will change to a blue check mark once the injection is complete. If
the 3500 Data Collection Software detects a problem with the data
(e.g., off scale or low quality), the symbol will be a flag (see Note
39).
2. Once all the injections are complete, the instrument will enter a
pause mode. Examine the data and determine if any samples need
to be re-injected.
3.
If samples need to be re-injected, return to the “Monitor Run”
screen and highlight the wells that need to be re-injected. Click the
“Re-inject” button on the ribbon at the top (see Fig. 16). Select the
“Instrument Protocol Options” (see Note 40). Select “Following all
injections.” Click “Ok.” Click “Resume.”
4.
When finished with all injections, click “Terminate Injection List” to
end the run (see Note 41 and Fig. 16).
Fig. 16 “Monitor Run” screen. Select any samples that need to be re-injected and (a) then click
the “Re-inject” button. (b) You will then need to click the “Resume Run” button. (c) If no re-
injections are necessary, click the “Terminate Injection List” button to end the run
4 Notes
1. These reagents are purchased from Applied Biosystems and
arrive in ready-to-use containers equipped with a radio frequency
identification (RFID) tag in the label that allows the instrument to
track reagent use, expiration date, lot numbers, and serial
numbers [1]. RFID tags should be facing back, toward the
instrument when being installed on the instrument to ensure they
can be read properly [1]. These reagents are necessary for each
run on the 3500, but they do not need to be changed between
each run. Once loaded, many injections can be performed before
the reagents need to be changed.
2.
Reagents cannot be re-installed on an instrument that is different
from its original type. For example, a polymer pouch can be
moved between two different 3500s. However, you cannot take a
pouch off a 3500 and install it on a 3500xL and vice versa. The
RFID tag on the reagents keeps track of the reagent usage and will
be inaccurate if this happens [1].
3.
Both the anode and cathode buffer containers are prefilled with
1X running buffer. While the anode buffer container is a singular
compartment, the cathode buffer container has two separate
compartments. The left side (24 holes) contains the running
buffer needed for electrophoresis, whereas the right side (48
holes) serves as the waste receptacle for the capillary washes that
occur between injections [1].
4.
There is often abundant reagent remaining when the
manufacturer’s expiration date is reached. Reagents can be used
past the manufacturer’s expiration date according to your
laboratory’s guidelines by ignoring the warning notifications [2].
5.
The polymers available for purchase are POP-4™, POP-6™, and
POP-7™. The polymer pouches are ready-to-load and available in
multiple volumes enabling labs to choose the size that best suits
their throughput needs [1].
6. The conditioning reagent is a pre-packaged consumable that is
used to maintain the polymer pump between polymer changes
and during long periods of disuse [1].
7.
High quality formamide is essential to obtaining a quality STR
profile and maintaining the life of the capillary array. With this in
mind, it is highly suggested that Hi-Di Formamide from Applied
Biosystems be used for electrophoresis.
8.
Formamide should be aliquoted into smaller quantities
appropriate for typical run sizes to avoid multiple freeze-thaw
cycles. Thaw the aliquots immediately prior to use.
9.
The spectral calibration standard used will depend on the
amplification kit used by your laboratory [1].
10.
When installing the ABC, lower the container slightly so that the
clear diamond shaped part of the instrument is just barely above
the large section of the container. Raise the container up and fit
the lip of the container into the corresponding groove on the
instrument. Slide the container back into its place.
11.
Gently position the septa to approximately align with the holes of
the CBC, or plate, and let the septa fall into the holes on its own.
Once in place, push down firmly to ensure proper fit. Improperly
aligned septa can cause damage to electrodes, thus preventing
electrophoresis.
12.
Pinching the center part of the CBC makes installation and
removal of the container easier.
13.
The electrodes should be exposed to air for no more than 30 min
during this process, as prolonged air exposure can cause the
polymer to harden, creating a blockage rendering the array
unusable [2].
14.
Used when installing a new pouch of the same lot number [2].
15. A spatial calibration must be performed whenever the capillary is
changed, the instrument is moved, or the detection door/cell is
handled [1]
handled [1].
16.
When performing spatial calibrations, the wizard will fill the array
with polymer so you can choose “no fill” when the wizard
prompts to save on polymer. However, in practice, error messages
can often occur, and this can be corrected or avoided by choosing
the “fill” option.
17.
Optionally, the user can also select “Perform QC Checks” to have
the system check that each capillary is within a specific range for
spacing, peak height, and peak height uniformity.
18.
A spectral calibration should be performed whenever the

capillary is changed, the polymer type is changed, a new dye set is
used, service is performed on the optical components, or there is
an increase in spectral artifacts in the data [1].
19.
If you see a bubble in the polymer pump area but the “Remove
bubbles from the polymer pump” wizard is unsuccessful, try
flushing the water trap using a syringe filled with distilled or
deionized water (see Fig. 2). The method to do so is described in
the 3500 User Manual [1].
20.
You should pre-heat the oven approximately 30 min prior to the
start of your run, which will help avoid any migration issues on
the first injection. Once preheated, the oven will remain at
temperature for 2 h of inactivity before shutting down [1].
21.
The chemistry standard and dye set you choose will be dependent
on the spectral standards used.
22.
When attaching the retainer, attach the side with the two clips
first at an angle and then lower the other side until it clips into
place. The sample plate will only fit in the base in one direction
(the angled corners at A12 should line up). Ensure that the plate is
fully seated to avoid injection issues, such as damage to the ends
of the capillaries [1].
If a capillary fails, “Allow Borrowing” allows the instrument to use
If a capillary fails, Allow Borrowing allows the instrument to use
23. the data from an adjacent capillary. For an 8-capillary instrument,
one borrowing event is allowed; for a 24-capillary instrument, up
to three borrowing events are allowed. If “Allow Borrowing” is not
checked, all capillaries must pass in order for the spectral
calibration to pass [1].
24.
The software will have manufacturer generated templates, assays,
file name conventions, and results groups to use. However, most
laboratories will have developed their own as part of the
instrument’s validation.
25.
Alternatively, you can leave all wells as samples and change this in
your analysis software (e.g., GeneMapper™ ID-X).
26.
The specific ratio of formamide to ILS, as well as which ILS used,
in the master mix will be dependent on the amplification kit
employed. Refer to the kit’s user manual for these instructions. In
most instances, this will be 9 μL of formamide and 1 μL of ILS.
27.
Every capillary in the array is used in each injection. The 3500 has
an 8-capillary array and will inject one column (8 wells) of the
plate with each injection. The 3500xL has a 24-capillary array and
will inject three columns (24 wells) at a time with each injection
[1]. If you do not have formamide in a well that is part of an
injection, air will be injected into the capillary, causing it to dry
out and become unusable. If this happens, you will have to replace
the entire array. Therefore, if you do not have enough samples to
fill an entire injection, you will need to load master mix (or
formamide alone) into the empty wells (see Fig. 14).
28. It is suggested to load master mix into the blank wells of the
injections instead of formamide to allow for an alternate well for a
sample in the event of a pipetting error. If you had loaded
formamide alone into all empty wells of an injection, then none of
those extra wells would be suitable for the sample because they
lack the ILS. Thus, you would need to set up an additional
injection.
29.
For the 3500 (8 capillaries), it is recommended to use one ladder
per every 3 injections; for the 3500xL (24 capillaries), it is
recommended to use one ladder per injection [1].
30.
Load allelic ladders into different capillaries. This ensures that if
there is a problem with a capillary, rendering that ladder
unusable, you can still use the data from the other ladders loaded
in other capillaries.
31.
You can make a denature protocol on your thermal cycler to do
this for you.
32.
Denaturing your samples prior to loading on the instrument
ensures that the DNA does not reanneal and remains single-
stranded [1].
33.
Navigate back to the “Dashboard” via the tabs at the top to check
that the instrument has completed the pre-heat (see Fig. 17). To
return to your run, click the “Workflow” tab at the top.
34.
If the instrument is still pre-heating, you can still load your plate
and start the run. The instrument will wait until the pre-heat is
finished before starting the first injection.
35.
When linking the plate, the software may take a while.
36.
To run a plate that has already been created in the software, go to

the “Load Plates for Run” screen via the navigation pane. In the
appropriate autosampler position, click “Link,” search for the
plate name and click “Ok.” Alternatively, if the plate appears in the
“Recent Plates” window on the right of this screen, simply drag
and drop to the correct position (see Fig. 15).
37.
Be sure to unlink any plates that are not loaded on the instrument,
or that are loaded but do not need to be run.
You can modify an injection by moving it up or down on the
You can modify an injection by moving it up or down on the
38.
injection list, or by deleting it from the run. This allows you to run
injections in order of priority [2].
39.
Just because there is a flag, it does not mean that the data is not
usable. Upload the data into your analysis software (e.g.,
GeneMapper™ ID-X) before making any decisions as to next steps.
40.
“Reuse the existing protocol” is typically selected.
41.
Although the software has a re-injection button, it can only be
used while the original plate setup is running. If you terminate the
run and then decide to re-inject samples after, you will need to
create a new plate map in the software. The name of the plate will
need to be different in order to avoid overwriting your data. You
can do this by adding “_2” to the end of the plate name, for
example [2].
Fig. 17 Oven pre-heat from the dashboard. (a) Prior to beginning your run, click the “Star Pre-
Heat” button in the “Pre-Heat the Oven” panel to bring the oven up to the temperature required
for electrophoresis. (b) Check to ensure that the oven turned on. (c) You can also check what
the current oven temperature is in this area to ensure that the pre-heat has completed (see
Note 34). (d) Finally, to navigate between the Dashboard and Workflow during plate set up, use
the tabs at the top
References
1. Thermo Fisher Scientific (2010) Applied Biosystems 3500/3500xL Genetic Analyzer User
Guide, Revision C. Available via Thermo Fisher Scientific. https://tools.thermofisher.com/
content/sfs/manuals/4401661.pdf. Accessed 29 April 2022
2. Abernathy J (2018) 3500 Genetic Analyzer install training. Jefferson Parish Regional DNA
Laboratory, 10 October 2018
https://doi.org/10.1007/978-1-0716-3295-6_19
19. Likelihood Ratio Calculation Using

LRmix Studio
Megan M. Foley1
Megan M. Foley
Abstract
LRmix Studio performs statistical analyses on forensic casework
samples by calculating a likelihood ratio (LR) following a semi-
continuous, unrestricted approach. The software utilizes a basic
probabilistic model allowing the comparison of two alternative
hypotheses regarding the evidence profile to include known and/or
unknown contributors, for a maximum of a 4-person mixture. Other
statistical factors that are included in this model are the incorporation
of multiple probability of drop-out values, probability of drop-in,
a correction factor for population substructure, assumed contributor
inclusion, and inclusion of an unknown relative in the defense
hypothesis. A range of plausible probability of drop-out values can be
calculated for various contributors and hypotheses based on a Monte
Carlo probability method and included in the likelihood ratio
calculation. The software also includes several ways to test the validity
and robustness of the probabilistic model. A sensitivity analysis can be
performed by calculating likelihood ratios for the given profile against a
range of drop-out values. Additionally, a non-contributor test can be
performed on the crime scene sample and the chosen LR parameters to
test the robustness of the model. This can give a point of comparison of
the likelihood ratio generated for the person of interest (POI) compared
to “random man” profiles generated from uploaded allelic frequencies.
Finally, the analysis can be printed in a well-structured and user-
friendly report that includes all analysis parameters. Within this
chapter, the reader will learn the steps to calculate a likelihood ratio
using the semi-continuous software, LRmix Studio. Additional tools
supplied through the software will also be explained and demonstrated.
Key words Likelihood ratio – LRmix Studio – Mixture interpretation –

Forensic statistical analysis – Forensic genetics – Probability of drop-
out – Probabilistic modeling
1 Introduction
1.1 Background
Current interpretation of DNA profiles generated from forensic
casework includes the calculation of a statistic in order to give weight
to an inclusion of a person of interest in comparison to an evidence
profile [1, 2]. For mixture interpretations, the likelihood ratio (LR) is
the preferred method [3]. This approach compares the likelihood of
observing the evidence DNA profile generated given two competing,
mutually exclusive hypotheses, often written as:
where Pr(E|H1) = the probability of the DNA profile given H1 and

Pr(E|H2) = the probability of the DNA profile given H2.
An example of two competing hypotheses for a mixture profile is:
H1 = The DNA originated from the victim and suspect.
H2 = The DNA originated from the victim and one unknown,
unrelated individual.
The resulting value gives weight to the hypothesis the data supports
more. If the LR value is >1, the DNA evidence supports the H1
hypothesis. If the LR value is <1, the DNA evidence supports the H2
hypothesis [3, 4].
In comparison to more historically used binary approaches (e.g., the
Random Man Not Excluded (RMNE) method), likelihood ratios are
more informative and are able to process more challenging sample
types that contain multiple indistinguishable contributors and/or are
generated from low template DNA samples [5]. With complex or low-
level DNA mixtures, common interpretation occurrences like stochastic
effects, allele sharing, degradation, or inhibition can lead to uncertainty
of inclusion of an individual. To accurately interpret these complex
profiles, parameters such as allelic drop-out or drop-in must be
considered. Allelic drop-out occurs when one allele, or the entire locus,
falls below the analytical or limit of detection threshold due to low copy
number and stochastic effects. Drop-in occurs when an allele is typed in
a genetic profile that did not come from the crime scene and its origin
cannot be explained in the competing hypothesis [3, 6]. Binary methods
mostly consider whether alleles are present or not and, therefore, do
not use all of the information that can be observed in a profile. Instead,
these methods may just omit loci where these stochastic effects are
observed, which leads to an underestimation of the weight of the
evidence [3, 7]. By including probabilistic modeling, likelihood ratios
are able to analyze a sample while taking into consideration varying
levels of these occurrences [8–10].
1.2 Likelihood Ratio Calculations Using LRmix Studio

Various software programs have been developed to calculate likelihood
ratios for DNA profiles utilizing different modeling approaches [11–14].
LRmix Studio—a free, downloadable, open-source system—performs
semi-continuous/unrestricted likelihood ratio calculations. This
software is designed for autosomal STR profiles, single source up to
four contributor mixtures. The LRmix Studio software approach allows
for the removal of the inclusion versus exclusion determination step
when comparing a reference profile to the evidence sample [6, 15, 16].
The basic exploratory LR model assumes that each locus is in Hardy
Weinberg and linkage equilibrium, which allows basic genotypic
frequency calculations to be used at each locus and multiplication of
each locus to generate the overall genotype likelihood ratio. The
calculation considers all possible contributing genotypes of an
unknown individual, including an allele that has dropped out due to
stochastic effects [6, 17]. The probabilistic model incorporates
probability of drop-in (pDI) and probability of drop-out (pDO) that can
be varied for different contributor’s and hypotheses [16–18]. Replicate
amplifications of a single extract can be incorporated into the software
for analysis. Developers validated this tool for up to five replicates,
comparing across three reference profiles, using a joint probability
approach [19, 20].
The software performs qualitative continuous modeling or semi-
continuous modeling. Therefore, the software assesses the alleles
present in a qualitative way, considering all possible genotype
combinations equally, and does not include peak heights into the
modeling [6, 21]. The software incorporates a variety of parameters
that allow for exploratory analysis including:
Number of contributors (NoC) for both hypotheses.
Varying NoC between the two hypotheses (e.g., a total of two NoC in
H1 versus a total of three NoC in H2).
Consideration of known, assumed, and unknown contributors for
both hypotheses.
Varying probability of drop-out values for different contributors and
hypotheses.
Incorporation of probability of drop-in.
Incorporation of an adjustable theta value to adjust for population
substructure uncertainty.
Incorporation of an adjustable rare allele frequency when the allele is
not observed in the uploaded allelic frequency database.
Inclusion of a related unknown individual in the defense hypothesis.
– The different relationship types that can be incorporated include:
parent/child, siblings, half-sibling, grandparent/grandchild,
uncle/aunt/nephew/niece, or cousins [18, 20].
1.3 Additional Analyses Available in LRmix Studio

The software includes a sensitivity analysis that can be used to estimate
the probability of drop-out and evaluate the model used to generate the
overall likelihood ratio. For the sensitivity analysis feature, the
likelihood ratio parameters set are used to plot the log10(LR) when the
pDO varies between set values, defaulted from 0 to 0.99. This can be
evaluated for different contributors or for the profile as a whole.
Sensitivity analysis can also be separated out into individual loci for a
more in-depth evaluation. The range for the likelihood ratio overall and
the individual likelihoods for the two hypotheses are shown separately.
When a model fits the parameters chosen, the curves generated should
be generally flat throughout the entire range of pDO showing that these
plausible pDOs do not have a substantial effect on the resulting LR
value. If the opposite is observed, the model chosen by the user should
be evaluated and readjusted [20].
The sensitivity feature also calculates a probability of drop-out to
use for the LR calculation using a Monte Carlo (MC) simulation
approach. A range of drop-out values, defaulted from 0 to 0.99, is
available. The number of iterations can be changed per the user’s
discretion. This model is a qualitative estimator of the drop-out
probability of the whole profile, based on the average numbers of
alleles observed in the profile. By viewing the number of alleles per
profile, the model can also take into consideration allele sharing [6].
The model is based on work described by developer’s research from
Gill and Curran. A random sampling of the crime-sample alleles is
generated with each MC iteration, while varying levels of drop-out
probabilities are applied. The purpose of this method is to see which
drop-out probabilities in the given range lead to mixtures with the
same amount of alleles as the profile in question. The process simulates
a given number of mixtures that have identical properties to the profile
in question. This generates an empirical distribution and highlights the
most likely probability of drop-out range [5, 17, 18]. A probability of
drop-out can be determined per contributor, for the profile as a whole,
or for the prosecution or defense hypotheses. The drop-in probability
can also be adjusted during this simulation for evaluation in a similar
format [20].
The non-contributor tool demonstrates the robustness of the
calculated likelihood ratio [4, 16]. The software generates a set amount
of random DNA profiles based on random sampling of the allelic
frequencies included in the analyses. These random profiles take the
place of the person of interest in the hypothesis as a “random,
unrelated man” and a likelihood ratio is generated for each profile. The
LR generated in the case sample is compared to values generated from
the random profiles, as a performance test to put the LR value into
perspective for the analyst or jury members. The maximum LR
calculated by a random individual is used as a direct comparison.
Additionally, 1%, 50%, and 99% percentile ranges are shown of all of
the LRs generated. The results display how many of the simulated
profiles generated LRs greater than the casework analysis, as well as
how many generated a log10(LR) greater than one. The number of LRs
greater than one can act as a false positive error rate. For more complex
samples—e.g., those that contain more contributors or have a higher
level of drop-out—it is more likely to obtain a false positive where a
simulated individual generates an LR supporting inclusion [16, 20].
2 Materials
1.
Reference DNA Profile(s).
2.
Allelic frequency tables.
3.
Unknown/question DNA profile(s).
4.
Computer with Windows operating system, Microsoft® Excel®, Java
(version >8), and internet access (see Note 1).
3 Methods
Before using this software, ensure that the laboratory has properly
validated the program. Certain parameters required to calculate a
likelihood ratio are based off of the laboratories’ validation including:
allelic drop-in (per amplification kit) and the method used to calculate
probability of drop-out. The appropriate allelic frequency files should
be downloaded and properly formatted. Additionally, ensure that Java
has been downloaded.
3.1 Preparation of DNA Profile Files

1.
Download LRmix Studio from https://github.com/smartrank/
lrmixstudio/releases. Once on the webpage, determine the latest
version (see Note 2). Click the file under the appropriate version,
“lrmixstudio-VERSION-CommunityEdition-distribution.zip” to
download. For the example-only file, download “example.zip”. For
the replicate example-only file, download
“Replicates.example.LRmix.Studio.zip”.
2.
The .zip file will be downloaded onto the computer. Move the zip
file to the appropriate location on the desktop and extract the zip
file. This folder can be moved to the laboratory’s recommended
location (see Note 3).
3.
Ensure that java is installed on the computer. To download, go to
https://www.java.com/download/ie_manual.jsp ad find the
correct file to download based on the computer type (see Note 1).
4.
If entering the sample alleles manually, skip to Subheading 3.1,
step 10. If using files for the profile upload, follow these steps (see
Subheading 3.1, steps 4–9). To prepare the unknown/question
sample profile file(s) for upload to LRmix Studio, begin by
opening the “example” folder from within the zip file downloaded
from GitHub and open the “sample.csv” file (see Notes 4 and 5).
5.
The top columns should be labeled “SampleName”, “Marker”,
“Allele1”, “Allele2” up to “Allele8.” Do not edit the column headers
(see Fig. 1).
6.
Change the sample name “Rep1” under “SampleName” to reflect
the evidence sample identifier used during analysis. If performing
replicate analysis, add the numerical value after the sample name.
This can be typed in for each row or typed in the row of the first
locus of the replicate, followed by highlighting that cell and
copying/pasting (or using the fill down function) to apply the
same name to all rows corresponding to that replicate (see Note
6).
7. The “Marker” column may need to be updated from the example
based on the STR panel targeted during genotyping Ensure that
based on the STR panel targeted during genotyping. Ensure that
there are no spaces or characters other than letters, numbers,
hyphens, or underscores (see Note 7).
8.
Alleles can be manually entered into the appropriate locus or
exported from the analysis software used by the laboratory. Enter
all called alleles into the appropriate locus from smallest to
largest from left to right. A maximum of eight alleles can be added
to account for a 4-person mixture. Each cell should contain one
allele only. If only one allele is detected at a locus, enter the allele
only once. Additionally, all stutter artifacts should be removed
before analysis. LRmix Studio will treat a stutter allele as a true
allele. Double check all entries for accuracy before uploading into
the LRmix software (see Note 8).
9.
Save the spreadsheet as a .csv (comma separated values) file. A
small window appears warning that some features are
incompatible with “.csv” and asks for permission to keep the
workbook in this format. Click “Yes.” Close out of the Excel file. A
second pop-up appears; click “Don’t Save.” Save all profiles in a
folder labeled with the case number. The software will use the
folder name to automatically fill out sample information when the
file is loaded.
10.
Download and prepare allelic frequency tables. For this example,
allelic frequencies were downloaded from NIST; https://strbase.
nist.gov/NISTpop.htm, and “Excel file of 1036 revised Allele
Frequencies” was chosen. Each population should be saved as a
separate .csv file. Only transfer the loci, allele numbers, and the
allelic frequencies. The additional information in the downloaded
Excel is not necessary and may cause errors in the LRmix analysis.
Before saving the final .csv, ensure that all loci names are identical
to what is used in the sample and reference files.
11. Prepare reference sample profile document(s) for upload to
LRmix Studio (see Note 9). Within the zip file that can be
downloaded from GitHub, example .csv files have been provided
by the developers. Open the “example” folder and the .csv file that
is labeled as “suspect.csv.”
12.
The top columns should be labeled “SampleName”, “Marker”,
“Allele1”, “Allele2”. Do not edit the column headers. Repeat the file
preparation steps used to prepare the question sample files (see
Subheading 3.1, steps 6–7). When entering homozygous alleles,
enter the allele twice. Once under “Allele1” and under “Allele2”
(see Note 10).
13.
Save the spreadsheet as a .csv (comma separated values) file. A

small window appears warning that some features are
incompatible with “.csv” and asks for permission to keep the
workbook in this format. Click “Yes.” Close out the Excel file. A
second pop-up appears, click “Don’t Save.”
Fig. 1 Example .csv file layout in Excel. Row 1 contains specific column headers recognized by
LRmix Studio. Verify that “Marker” names and allele values are accurate before uploading
3.2 Set Up of LRmix Studio for Statistical Analysis

1.
Open the LRmix Studio software from the unzipped folder (see
Note 11) by clicking the “lrmixstudio-VERSION-
CommunityEdition” (.jar file).
2.
The first tab that opens in the start-up window is the “Sample
Files” tab (see Fig. 2).
3.
Click the “Load from file…” button on the far right (see “i.” in Fig.
2). It opens a window. Navigate to the appropriate
unknown/question .csv file set up (see Subheading 3.1, steps 4–
9). Alternatively, the sample can be added manually by clicking
the “Add replicate” box (see “ii.” in Fig. 2) and manually enter the
same name, along with its alleles at each locus. If analyzing
replicates, ensure that the appropriate samples are checked as
“Active” in the top window (see “iv.” in Fig. 2). Any samples that
should not be analyzed, uncheck “Active.” The list of loci appears
in a random order compared to any allelic frequency tables used.
4.
The box next to the right of the red “Case Number” should
automatically fill in with the case number if provided in the
uploaded sample file. It can be manually edited by the user if
necessary (see “iii.” in Fig. 2). If this is not done, the software will
not continue to the “Reference Files” tab.
5. Additional actions from the “Sample Files” tab include: “Restore
session from Log”—Whenever an analysis is completed, a log file
is produced and automatically saved to the computer. To locate
the log file, return to the LRmix Studio folder, unless a specific
location is specified during installation. A new folder is created
under the case number. The log files contain text files with all
settings and results of the previous analysis. These files can be
uploaded to restore previous analyses so that the analysis can be
re-performed, or modified, if necessary. “Restart”—Restarts the
software, which clears the previous run. A new run can be set up.
Previous analyses are saved in the “log” folder
Previous analyses are saved in the log folder.
6.
Once a sample has been added, the alleles are visible in the
“Locus” portion of the screen (see “v.” in Fig. 2) and the sample
appears in the top screen. Additionally, the tab labeled “Reference
Files” is now available to select.
7.
Click on the tab labeled “Reference Files” that is now available.
Click “Load from file…” (see “i” in Fig. 3). It opens a window.
Navigate to the appropriate reference sample .csv file(s)
previously set up (see Subheading 3.1, steps 11–13) and select
the appropriate .csv file(s) for the reference(s) to be run. Multiple
.csv files may be added at the same time if there are multiple
references being compared to the question sample (see Note 9).
8.
To add the samples manually, click “Add Profile…” (see “ii.” in Fig.
3). Before continuing to the next step, check that the references
uploaded are meant to be used during analysis (see “iii.” in Fig. 3).
The LR is affected if multiple references are present regardless of
whether the sample is checked in the “Analysis” tab. The software
assumes the individual is a non-contributor (see Note 12).
9.
Once a sample has been added, the alleles are visible in the
“Locus” portion of the screen (see “iv.” in Fig. 3) and the sample
appears in the top screen, checked as active (“iii.”). Additionally,
all remaining tabs are visible with the exception of the “Reports”
tab.
10.
Click on the next tab on the top labeled “Profile Summary”. Here
the user can view different formats of allele sharing between
reference and question profiles.
11. Under the “Select” column (see “i.” in Fig. 4), uncheck any loci
where there are no alleles in either the question or reference
sample, or which contain a “0” (see Note 13) in the “Distinct
Alleles” column (see “ii.” in Fig. 4). By unchecking the box, the
locus is excluded from the LR calculation (see Note 14).
Additionally, the Distinct Alleles column can be used to determine
the minimum number of contributors, if not determined using an
f
alternative method. If using the maximum allele count method,
the locus with the most amount of alleles can be divided by two to
determine the minimum number of contributors.
12.
This page can be printed in the format chosen by the laboratory to
include the emphasis of various information including (see “iii.” in
Fig. 4): “Alleles in the replicate that are not present in the
reference profiles” emphasizes alleles that may be coming from an
unknown contributor or from the workflow process. “Alleles in
the reference profiles that are not present in the replicate”
emphasizes location of potential allelic drop-out in the question
sample. “Matching alleles in the replicate and [reference sample]”
emphasizes potential allele sharing in contributors, indicating a
possible biological relationship. Emphasis can occur by color,
bold, italics, or underlined based on what is checked on the right-
hand side of the screen (see “iv.” in Fig. 4).
Fig. 2 The “Samples Files” tab in LRmix Studio. This tab is used to upload unknown/evidence
and replicate profiles. (i) Load a previously prepared sample file. (ii) Add a replicate DNA
profile. (iii) Case Number. (iv) Displays profiles added to the software and allows user to
choose which profiles should be active in the calculation. (v) Displays loci and alleles once a
profile has been uploaded or manually entered
Fig. 3 The “Reference Files” tab in LRmix Studio. This tab is used to upload reference profiles.
(i) Load a previously prepared reference file. (ii) Manually add a reference profile. (iii) Displays
profiles added to the software and allows user to choose which profiles should be active in the
calculation. (iv) Displays loci and alleles once a profile has been uploaded or manually entered
Fig. 4 The “Profile Summary” tab in LRmix Studio. This tab is used to determine which loci to
include in the LR calculation and minimum number of contributors. (i) Select/Deselect loci for
inclusion in the LR calculation. (ii) Distinct Allele column can be used to determine minimum
number of contributors. (iii) Formatting options. (iv) Font options
3.3 Probability of Drop-Out Calculation

1. In order to calculate the pDO, the LR hypotheses must first be
filled out. Click the next tab labeled “Analysis”. If including any
contributors under either hypothesis, check the “Contributor” box
to the left of the corresponding “ID” under the “Prosecution
Hypothesis” and “Defense Hypothesis” sections (see “i.” and “ii.”,
respectively, in Fig. 5). If no contributors are being assumed under
the defense hypothesis, there should be no checked boxes. Set the
“Unknown Contributors” under both the prosecution and defense
hypotheses by clicking the arrow buttons (see “iii.” and “iv.,”
respectively, in Fig. 5).
2.
In the “Parameters” section, click the “…” box to the right of “Allele
Frequencies” (see “v.” in Fig. 5). Navigate to the saved allelic
frequency documents (.csv files) used by the laboratory (see
Subheading 3.1, step 10). Choose the appropriate population
frequencies and click “Open”.
3.
Click on the “Sensitivity Analysis” tab at the top. Within this tab,
click the “Drop-out Estimation Settings” tab halfway down the
screen (see “i.” in Fig. 6).
4.
Drop-out can be determined for different combinations of the
contributors included (knowns/assumed or unknowns) by
checking the boxes next to the appropriate contributor file (see
“ii.” In Fig. 6). As an example, include all contributors. Make sure
that all contributors are checked.
5.
If assuming a known contributor like a victim, and there is no
evidence of drop-out seen in the profile, uncheck the contributor
box for the victim. These contributors must be unchecked if they
are fixed in the hypothesis and no allelic drop-out was observed in
the profile. Change the “Drop-In” value to the appropriate value
based on validation or “0.01” as a default (see “iii.” in Fig. 6) (see
Note 15). The various settings can be changed by using the up
and down arrows until the value reaches the intended number.
For this example, all values are left at default besides “Drop-In”;
“Drop-Out variation”: “0” to “0.99” in “99” steps. “Iterations”:
“1000.”
6.
Next, click the “Run Drop-out Estimation for [X] alleles” button
(see Note 16) on the right side of the screen (see “iv.” in Fig. 6). If
an error appears stating “drop-out estimation resulted in no
matching attempts under prosecution,” check that the number of
contributors is correct in each hypothesis in the “Analysis” tab. If
they are as expected, re-evaluate the profile as a whole for
number of contributors.
Once the analysis is completed a range of drop out estimation
7. Once the analysis is completed, a range of drop-out estimation
values are generated (see “v.” in Fig. 6). For this example, the
highest value in the range, 0.39, is used (see Note 17). The drop-
out estimation analysis must be performed with every allele
frequency database used for generation of the likelihood ratio (see
Note 18).
8.
Return to the analysis tab to set-up of the likelihood ratio
hypotheses and calculation. If not performed previously, define
the defense and prosecution hypotheses—including number of
contributors (maximum is four), known and unknown
contributors, probability of drop-out (see Subheading 3.2, steps
1–8 above for an example method).
9.
In the two hypotheses boxes (see “i.” and “ii.,” respectively, in Fig.
5), ensure that all known contributors to be used in the
Prosecution Hypothesis (HP) and Defense Hypothesis (HD) have a
checkmark. Set the probability drop-out based on the sensitivity
analysis performed by either typing it in or using the up and down
arrows. For this example, the same number is used in all places
where “Drop-Out Probability” is entered (see Fig. 5). If varying the
drop-out depending on contributors, etc., ensure that the correct
pDO is entered for each section. If an individual is set as a known,
a “0” drop-out probability value can be used.
10.
The software has the ability to calculate if one of the unknowns is
a relative in the defense hypothesis. Check the “One of the
unknowns is a relative” box in the Defense Hypothesis section (see
“vi.” in Fig. 5) and fill out the appropriate relationship choice to
the correct contributor. Options for relationship type include,
parent/child, sibling, half-sibling, grandparent/grandchild,
uncle/nephew, and cousin.
11.
Ensure that the number of contributors (NoC) remains the same
from before the sensitivity analysis. The NoC should be
established prior to any reference sample comparisons. If the NoC
changes, the probability of drop-out should be recalculated.
12. Ensure that the appropriate allelic frequency file in the calculation
13. is loaded (see Note 19).
In the parameters section (see “vii.” in Fig. 5), change the “Drop-in
Probability” to “0.01” or the laboratories validated value.
14.
Update the Theta value and the rare allele frequency value to use
in the calculation if an allele is not present in the allelic frequency
database used (see Note 20). Leave the “Theta Value” at “0.01,”
and the “Rare Allele Frequency” at “0.001.” The “Max Threads”
value relates to the speed and performance of the calculation.
Leave at default (see Note 21).
15.
Click “Run” (see “viii.” in Fig. 5). A value appears in the box under
“Overall Likelihood Ratio” (see Note 22). To the left of this box, the
user can view the likelihood ratios calculated at each locus. An LR
value >1 supports the H1 hypothesis. An LR value <1 supports the
H2 hypothesis.
Fig. 5 The “Analysis” tab in LRmix Studio. This tab is used to set the model parameters and
calculate the likelihood ratio. (i) Prosecution Hypothesis Parameters Box. (ii) Defense
Hypothesis Parameters Box. (iii) Unknown Contributor for prosecution hypothesis. (iv)
Unknown Contributor for defense hypothesis. (v) Click to upload or change allelic frequency
table. (vi) Options to include a relative in the defense hypothesis. (vii) Change the drop-in
probability, rare allele frequency, and theta value. viii. Calculate a likelihood ratio
Fig. 6 The “Sensitivity Analysis” tab in LRmix Studio to determine dropout. The “Dropout
Estimation Settings” tab is used to determine plausible probability of drop-out(s) to use for the
LR model. (i) “Dropout Estimation” tab. (ii) Check which profiles should be included in the
drop-out analysis. (iii) Change Drop-in. (iv) Click to start analysis. (v) Results of the sensitivity
analysis
3.4 Additional Analyses in LRmix Studio

1.
A sensitivity analysis should accompany every likelihood ratio
calculated to test the sensitivity of the parameters chosen for this
calculation. Click the tab labeled “Sensitivity Analysis.” This is the
same tab used to calculate pDO.
2. First, determine if the contributors should have the same
probability of drop-out or if one should have a varied drop-out
probability during the sensitivity analysis performed. Any
contributors left unchecked will remain at a consistant probability
of drop-out during the analysis (see “i.” in Fig. 7).
3.
Do not change the value in the box next to “Set drop-out of select
profiles to” during the sensitivity analysis. This should remain as
“0” (see “ii.” in Fig. 7).
4.
In the “Sensitivity Analysis Settings” tab on the bottom half of the
screen, check the following parameters and change if necessary:
“Drop-out variation”: “0” to “0.99” in “99”, “Steps at locus”: “All
Loci” (see Note 23), “Drop-In”: “0.01”, and “Theta”: “0.01”.
5.
Click the “Run” button with a green start sign (see “iii.” in Fig. 7).
The run time varies depending on number of contributors and
complexity of the DNA profile.
6.
If an error message stating: “The Sensitivity Analysis did not
result in any numerical results. All LRs were either 0, Infinity or
not representable as a number. Please check your hypothesis.”
appears, check that the number of contributors is correct in each
hypothesis on the “Analysis” tab. If they are as expected, re-
evaluate the profile as a whole for number of contributors.
7.
The results display the resulting log10(LR) values for the range of
pDOs set for the different analyses, separated by color. To zoom
in/out of sections, right click on the plot. To view different
analyses, check the appropriate option from the list on the right
(see “iv.” in Fig. 7).
8.
A non-contributor test should accompany every likelihood ratio
calculated to give weight to the resulting LR when analyzed with
simulated unknown contributors. Open the tab labeled “Non-
contributor Test”. Select the “Person of Interest” (see “i.” in Fig. 8)
that the user would like to replace with random profiles by
checking the box next to the appropriate contributor.
9. Set the iterations (see “ii.” in Fig. 8) based on the likelihood ratio
generated under the “Analysis” tab. For the example in this
document, iterations would be changed to 62,000, rounded to the
nearest 1000 (see Note 24) If the likelihood ratio generated is
nearest 1000 (see Note 24). If the likelihood ratio generated is
>1,000,000, a max of 1,000,000 can be calculated. If the likelihood
ratio is <1000, perform 1000 iterations.
10.
Click “Run” (see “iii.” in Fig. 8) to start the calculation. This can
take several minutes up to several hours depending on the
complexity of the mixture and how many iterations are being
tested.
11.
The log10(LR) generated during the analysis with the profile of

interest is displayed in red (see “iv.” in Fig. 8). The remaining gray
bars display the minimum (“v.”), maximum (“ix.”), 1% (“vi.”), 50%
(“vii.”), and 99% (“viii.”) percentiles of the calculated values for
the randomly generated comparison profile (see Fig. 8). Within
the text, the software also counts how many LRs generated were
greater than one (“x.”) and how many LRs generated were greater
than the profile of interest LR (“xi.”).
12.
Ensure that both the drop-in and drop-out values are filled in
appropriately in the “Analysis” tab. If any of the values are set to
zero, no results are obtained from the non-contributor test.
13.
Repeat this process for each allelic frequency database used in
analysis.
Fig. 7 The “Sensitivity Analysis” tab in LRmix Studio. The “Sensitivity Analysis Settings” tab is
used to evaluate the probabilistic model and determine the sensitivity of the likelihood ratio
over a range of drop-out probabilities. (i) Check which profiles should be included in the
sensitivity analysis. (ii) “Set dropout of selected profiles” setting. (iii) Click to start analysis. (iv)
Choose to view different analyses
Fig. 8 The “Non-contributor Test” tab in LRmix Studio. This tab is used to replace the POI with
randomly generated profiles using the same allelic frequency files and LR parameters to
provide relative robustness of the model and LR generated with the POI. (i) Choose which
reference to compare. (ii) Set the number of iterations to run. (iii) Click to start analysis. (iv)
The log10 (LR) calculated with the chosen reference. (v) The minimum log10 (LR) calculated.
(vi) The 1% percentile log10 (LR) calculated. (vii) The 50% percentile log10 (LR) calculated.
(viii) The 99% percentile log10 (LR) calculated. (ix) The maximum log10 (LR) calculated. (x)
The percentage of LRs greater than zero. (xi) The percentage of LRs greater than the LR
calculated with the reference
3.5 Printing a LRmix Studio Report

1. Open the “Reports” tab. There should be one report for time an
analysis was conducted, i.e., each time the “Run” button was clicked
in the “Analysis” tab, during the current session. See the report(s)
to be exported (multiple reports can be selected for simultaneous
export by using the Ctrl key) (see Note 25).
2.
Click the “Export” button at the bottom of the window (see Fig. 9).
A window appears asking for “Reporting Officer’s remarks to be
included in the report.” Remarks can be added, if desired, or the
box can be left blank. Click “OK” to proceed. Reports are saved as a
.pdf format on the desktop and can be moved into the designated
case folder where the .csv sample profile files were saved. An
example of the first page of a report can be seen in Fig. 10.
Fig. 9 The “Reports” tab in LRmix Studio. This tab is used to export analysis reports
Fig. 10 An example of an exported report. The report will contain all data and analyses
conducted including the likelihood ratio, sensitivity analyses, drop-out analyses, and non-
contributor tests
4 Notes
1.
LRmix Studio does not currently work on Mac computers.
2.
For this example, the latest version is 2.1.5. The latest version is
typically at the top of the page. The “Version” in the .zip file will
change.
3.
Retain all files in the folder in the same locations. If any files are
moved, a Java exception error may occur upon startup.
4.
Within the .zip file that can be downloaded from GitHub, example
.csv files have been provided by the developers. Open the
“example” folder and the .csv file that is labeled as “sample.”
5.
Additionally, GeneMapper® ID-X exported files can be formatted
to be uploaded straight into LRmix Studio. Ensure that the report
template configured in GeneMapper® ID-X matches the example
.csv file.
6.
Check that the alleles associated with these replicates are also
deleted. If only analyzing one profile replicate, delete out the
replicate examples from the template labeled “Rep2” and “Rep3”.
If replicates are being analyzed, one file can be created. Stack the
profiles in the Excel file identical to the example. As long as the
“SampleName” is different between the replicate profiles, the
software recognizes that replicates are being analyzed.
7. Check that the spelling of the loci in the .csv file matches the
spelling of the loci in the allelic frequency tables used, including
any spaces or hyphens. This will depend on the database the
allelic frequencies are downloaded from. Example: “PentaE” and
“Penta E” are not considered the same marker. Capitalization of
letters, however, is not considered by the software. “E” and “e” are
considered the same character.
8.
Peak heights do not need to be included in the file. If they are, the
software ignores the columns.
9.
Author recommends only uploading the references being used in

the analysis. For example, if two suspects are being compared
separately to an unknown sample, upload the references one at a
time and clear the software before performing the second
analysis. If a victim and a suspect are being considered in the
same hypothesis set, upload both at the same time [17].
10.
If only one allele is entered for a homozygous location, LRmix
Studio displays an error window when the reference is loaded.
The warning will ask the user to double check that the entry is
right, and then will automatically add this locus in as a
homozygous.
11.
If an error is received during start-up, verify that Java has been
downloaded and that the file has been extracted. Additionally,
verify that the software file remains in the folder with the other
downloaded documents. These files include code that is required
for proper functioning of the software. The author has also found
that the software is not compatible with Mac computers.
12.
If there is only one allele at a locus, the software triggers a
warning window stating: “At least one locus in [SampleName]
contains only one allele. Do you want to convert these loci to
homozygotic?” Click “Yes” if it is a homozygous location (the allele
is then duplicated and highlighted red, with a note at the bottom
of the software window). Otherwise, click “No” and go back to the
file to fill in the appropriate allele in the .csv file. The author
recommends starting a new analysis and starting over to ensure
that all incorrect profiles have been removed from the analysis.
13. This occurs when there are no alleles detected at a particular
locus.
14.
If a partial profile is used as a comparison profile, loci not present
in the reference must be unchecked within the evidence profile. If
these loci are not unchecked, the LR calculated by LRmix Studio is
inaccurate.
15.
This value should be determined for each laboratory during
internal validation of the software.
16.
The value of alleles (“X”) within this button is based on the
number of alleles in the unknown profile.
17.
The value within the range to be used for analysis should be
determined for each laboratory during internal validation of the
software.
18.
For example, if the laboratory performs statistics for three
populations (each requiring their own allelic frequency database),
such as Caucasian, African American, and Hispanic, the allelic
frequency database in the “Analysis” tab should be changed for
each pDO determination. The lab should then use the pDO in the
LR calculation of the matching allelic frequency database.
19.
If the allelic frequency file is changed, make sure the correct
probability of drop-out is included.
20.
If any of the hypothesis information changes, make sure the
probability of drop-out is recalculated.
21.
For more information on these parameters, see the User Manual
[20].
22.
After an LR has been generated, the user can now view the run log
or print a report.
23.
Analysis can be performed for specific loci if the user would like to
analyze the model at each locus.
24. The goal is to set the iterations close to the resulting LR. This gives
25. more confidence in the model.
Once LRmix Studio is closed, the reports tab is cleared.
References
Testing Laboratories. Available via Federal Bureau of Investigation. https://ucr.fbi.gov/lab/
biometric-analysis/codis/quality-assurance-standards-for-forensic-dna-testing-
laboratories. Accessed 12 Dec 2022
2. SWGDAM (2017) Interpretation Guidelines for Autosomal STR Typing by Forensic DNA
Testing Laboratories. Accessed via SWGDAM. https://www.swgdam.org/_f iles/ugd/
4344b0_3f94c9a6286048c3924c58e2c230e74e.p df. Accessed 12 Dec 2022
3. Gill P, Brenner CH, Buckleton JS et al (2006) DNA commission of the International Society
of Forensic Genetics: recommendations on the interpretation of mixtures. Forensic Sci Int
160:90–101. https://doi.org/10.1016/j.forsciint.2006.04.009
[Crossref][PubMed]
4. Gill P, Curran J, Neumann C et al (2008) Interpretation of complex DNA profiles using

empirical models and a method to measure their robustness. Forensic Sci Int Genet 2:91–
103. https://doi.org/10.1016/j.fsigen.2007.10.160
[Crossref][PubMed]
5. Haned H, Egeland T, Pontier D et al (2011) Estimating drop-out probabilities in forensic

DNA samples: a simulation approach to evaluate different models. Forensic Sci Int Genet
[Crossref][PubMed]
6. Haned H, Slooten K, Gill P (2012) Exploratory data analysis for the interpretation of low
template DNA mixtures. Forensic Sci Int Genet 6:762–774. https://doi.org/10.1016/j.
fsigen.2012.08.008
[Crossref][PubMed]
7. Brenner CH (1997) What’s wrong with the “exclusion probability.” Accessed via https://
www.dna-view.com/exclusn.htm. Accessed 25 Apr 2022
8. Buckleton J, Triggs C (2006) Is the 2p rule always conservative? Forensic Sci Int 159:206–
209. https://doi.org/10.1016/j.forsciint.2005.08.004
[Crossref][PubMed]
9. Gill P, Sparkes B, Buckleton JS (1998) Interpretation of simple mixtures of when artefacts

such as stutters are present—with special reference to multiplex STRs used by the Forensic
Science Service. Forensic Sci Int 95:213–224. https://doi.org/10.1016/S0379-
0738(98)00094-2
[Crossref]
10.
Gill P, Whitaker J, Flaxman C et al (2000) An investigation of the rigor of interpretation
rules for STRs derived from less than 100 pg of DNA. Forensic Sci Int 112:17–40. https://
doi.org/10.1016/s0379-0738(00)00158-4
[Crossref][PubMed]
11. Perlin MW, Legler MM, Spencer CE et al (2011) Validating TrueAllele® DNA mixture
interpretation. J Forensic Sci 56:1430–1447. https://doi.org/10.1111/j.1556-4029.2011.
01859.x
12. Inman K, Rudin N, Cheng K et al (2015) Lab Retriever: a software tool for calculating
likelihood ratios incorporating a probability of drop-out for forensic DNA profiles. BMC
Bioinform 16:298. https://doi.org/10.1186/s12859-015-0740-8
[Crossref]
13. Bright JA, Stevenson KE, Curran JM et al (2015) The variability in likelihood ratios due to
different mechanisms. Forensic Sci Int Genet 14:187–190. https://doi.org/10.1016/j.
fsigen.2014.10.013
[Crossref][PubMed]
14. Benschop CCG, Nijveld A, Duijs FE et al (2019) An assessment of the performance of the
probabilistic genotyping software EuroForMix: trends in likelihood ratios and analysis of
Type I & II errors. Forensic Sci Int Genet 42:31–38. https://doi.org/10.1016/J.FSIGEN.
2019.06.005
[Crossref][PubMed]
15. Clayton TM, Whitaker JP, Sparkes R et al (1998) Analysis and interpretation of mixed
forensic stains using DNA STR profiling. Forensic Sci Int 91:55–70. https://doi.org/10.
1016/s0379-0738(97)00175-8
[Crossref][PubMed]
16. Gill P, Haned H (2013) A new methodological framework to interpret complex DNA profiles
using likelihood ratios. Forensic Sci Int Genet 7:251–263. https://doi.org/10.1016/j.fsigen.
2012.11.002
[Crossref][PubMed]
17. Curran JM, Gill P, Bill MR (2005) Interpretation of repeat measurement DNA evidence
allowing for multiple contributors and population substructure. Forensic Sci Int 148:47–
[Crossref][PubMed]
18. Gill P, Kirkham A, Curran J (2007) LoComatioN: a software tool for the analysis of low copy
number DNA profiles. Forensic Sci Int 166:128–138. https://doi.org/10.1016/j.forsciint.
2006.04.016
[Crossref][PubMed]
19. Buckleton JS, Triggs CM, Walsh SJ (2005) Forensic DNA evidence interpretation. CRC Press
20. Haned H, de Jong J (2016) LRmix Studio 2.1.1 User Manual
21. Coble MD, Buckleton J, Butler JM et al (2016) DNA Commission of the International Society
for Forensic Genetics: recommendations on the validation of software programs
performing biostatistical calculations for forensic genetics applications. Forensic Sci Int
Part VI
Specialized Samples
https://doi.org/10.1007/978-1-0716-3295-6_20
20. Mitochondrial DNA Analysis

Ashley M. Cooley1
Ashley M. Cooley
Email: ashley.cooley@dfs.virginia.gov
Abstract
Mitochondrial DNA (mtDNA) is a 16,569 base pair (bp) circular genome
that is passed from generation to generation through the maternal line.
mtDNA analysis in the context of the forensic science field usually
involves unidentified human remains or missing persons. These cases
tend to have more challenging sample types (e.g., rootless hairs, bone,
blood, and saliva), and mtDNA analysis can be an additional method to
assist in identification efforts. Due to the multifaceted protection of
mtDNA within cells, mtDNA is able to be extracted even in cases of
extreme degradation. mtDNA analysis for forensic science has been
both peer-reviewed in academic journals and has been testified to in
criminal court procedures since the late 1990s, allowing for consistent
and reliable usage in casework. This chapter describes the general
methodology of extracting, amplifying, quantifying, and analyzing an
mtDNA sequence for use in forensic casework, specifically for these
common items of evidence.
Key words Mitochondrial DNA – Forensic science – Forensic DNA

analysis – DNA sequencing – DNA typing – Hair analysis – Bone analysis
1 Introduction
Mitochondrial DNA (mtDNA) is a genome, separate and different from
the nuclear genome, within each cell’s mitochondria, that has a
mutation rate approximately 10 times that of nuclear DNA, which gives
rise to its distinguishing polymorphisms [1–3]. Additionally, mtDNA is
in cells at a higher copy number than nuclear DNA since a single cell
can have multiple mitochondria, but only one nucleus. Forensic nuclear
DNA analysis utilizes short tandem repeat (STR) locations that are
extracted from the DNA strand, amplified, and visualized. Each cell has
two alleles (types) at each STR locus (location) that are inherited from
the mother and the father (e.g., a person may have a 6 and a 7 allele at
the STR locus TH01). Due to the wide range of alleles that can occur at
each locus, a full STR profile (typically consisting of over 20 loci)
developed from a sample can have a statistic that makes it rare in the
human population [1]. In comparison, the mtDNA genome is solely
maternally inherited. Maternal inheritance is particularly helpful for
cases of human identification because a maternal relative’s mtDNA is
rather easy to obtain. However, this means that the mtDNA profile
developed is not unique and can be found more frequently in the
population [1].
Mitochondrial DNA analysis of hair [4–8] and bone [9–18] is
particularly successful in part due to the encapsulation of DNA by the
exterior of the tissue and protection of mtDNA within layers of keratin
(hair) [4–8] and hydroxyapatite (bone) [9–18]. These characteristics
have led to mtDNA becoming a popular yet reliable identification
method for challenged samples. For example, bones that have been
subjected to environmental conditions over time (e.g., UV, humidity,
temperature, and soil conditions) tend to have a lower success rate of
developing a nuclear DNA profile. However, the hydroxyapatite
protecting the mtDNA within the bone can allow for mtDNA to be
obtained. For cases involving hairs, the root of the hair contains a
higher concentration of nuclear DNA, while the shaft contains a higher
concentration of mtDNA. Depending on the length, condition, and
section of the hair that was collected at a crime scene, both nuclear
DNA and mtDNA analysis may occur [4–8].
Mitochondrial DNA analysis relies upon a strategy of multiple
polymerase chain reaction (PCR) amplifications that focus on the
control region (1122 total bp) or smaller regions of interest within the
control region [19, 20]. Primarily for forensic DNA purposes, these
regions of interest have been described as hypervariable region 1
(HV1) (16,024–16,365 bp), hypervariable region 2 (HV2) (73–340 bp),
and hypervariable region 3 (HV3) (438–574 bp), which contain a large
majority of the polymorphisms [1, 21–26]. Primarily, HV1 and HV2
regions are used; HV3 is optional for testing. The control region is not a
coding region, and therefore, mutations (additions, deletions, or
changes to each base pair) can arise without causing any cell failure.
These mutations/polymorphisms allow for limited differentiation
between people and allow us to use mtDNA for purposes. A primer set
strategy of PCR amplification isolates the control region with
overlapping regions by creating specific amplicons that can be
sequenced. After sequencing, analysts will compile the amplicons and
visually verify each base developed.
This sequence data is then compared to the Revised Cambridge
Reference Sequence (rCRS) [27, 28] to produce a summary of the
polymorphisms or differences in sequence from the reference. The
combination of polymorphisms from these sequences is the
mitochondrial haplotype (mitotype) for the sample [21–26, 29]. This
mitotype can then be used to directly compare references from a family
looking for a loved one, or to upload into the National DNA Index
System (NDIS) located within the Combined DNA Index System (CODIS)
to be compared to the DNA database of missing persons and family
reference samples [24].
2 Materials
Prepare all reagents using ultra-pure water (18 MΩ-cm) that has been
autoclaved and ensure purchased reagents are molecular biology-
grade. It is recommended to UV-irradiate all tubes prior to using for
maximum contamination prevention [30].
2.1 General Materials

1.
Centrifuge: Fixed angle rotor, capable of 10,000 × g; rotor must fit
1.5 mL microcentrifuge tubes. Temperature control is not needed.
2. Microcentrifuge tubes: 1.5 mL, screw-top and flip-cap (with
associated spin baskets).
3.
Ultraviolet Crosslinker.
4.
Water, ultra-pure.
5.
Thermal cycler: Capable of hot-start PCR conditions and holding
0.1 mL thin-walled tubes.
6.
0.1 mL thin-walled sterile tubes.
2.2 Extraction
1.
Compound Microscope or Stereomicroscope.
2.
Ultrasonic Cleaner.
3.
Microcon® YM-30 Concentrators [31].
4.
Tissue Grinders.
5.
5% Chelex® 100 in ultra-pure water [32].
6.
1 M Dithiothreitol (DTT): Store at −20 °C.
7.
Absolute Ethanol.
8.
Extraction Buffer: 7.6 mM Tris-HCl, 100 mM NaCl, 10 mM EDTA,
2% sodium dodecyl sulfate (SDS). Store at room temperature.
9.
Isopropanol.
10.
n-Butanol.
11.
25:24:1 Phenol/Chloroform/Isoamyl Alcohol (PCIAA): Store at
4 °C. A fume hood should be utilized when pipetting PCIAA.
12. 20 mg/mL Proteinase K: Store at −20 °C.
13.
Low EDTA TE Buffer (TE−4 Buffer): 10 mM Tris-HCl and 0.1 mM
EDTA; pH 7.5. Store at room temperature.
14.
5% Terg-a-zyme™.
15.
Xylene.
2.3 Amplification
1.
0.625 μg/μL Bovine Serum Albumin (BSA): Store at −20 °C [33].
2.
2.5 mM Deoxynucleotide triphosphate (dNTP) mix: Store at −20 °C.
3.
10X PCR Buffer I with 15 mM MgCl2: Store at −20 °C.
4.
Positive control DNA (HL60): Store at −20 °C.
5.
10 μM Primers: Store at −20 °C (see Subheading 2.4).
6.
5 U/μL Taq Gold™ DNA Polymerase: Store at −20 °C.
2.4 Primer Sequences

1.
F15971 5′ TTA ACT CCA CCA TTA GCA CC 3′.
2.
F15989 5′ CCC AAA GCT AAG ATT CTA AT 3′.
3.
F16190 5′ CCC CAT GCT TAC AAG CAA GT 3′.
4.
R16251 5′ GGA GTT GCA GTT GAT GT 3′.
5.
R16410-m19 5′ GAG GAT GGT GGT CAA GGG A 3′.
6. F15 5′ CAC CCT ATT AAC CAC TCA CG 3′.
7.
F155 5′ TAT TTA TCG CAC CTA CGT TC 3′.
8.
R285 5′ GTT ATG ATG TCT GTG TGG AA 3′.
9.
R389 5′ CTG GTT AGG CTG GTG TTA GG 3′.
10.
R599 5′ TTG AGG AGG TAA GCT ACA TA 3′.
2.5 Product Evaluation

1.
DC power supply.
2.
UV Transilluminator with camera.
3.
Gel beds.
4.
Gel lane combs.
5.
Gel tank, cover and electrodes.
6.
Orbital platform shaker.
7.
10X TAE buffer.
8.
5X Loading buffer.
9.
DNA Molecular Weight Marker XIV.
10.
3:1 agarose.
11.
SYBR® Safe DNA gel stain.
12.
Microtiter plate.
13. 250 mL flat-bottom boiling flask.
2.6 Purification and Sequencing

1.
Speedvac concentrator.
2.
Optical plate, 96 well.
3.
Performa® DTR Gel Filtration Cartridge: Store at 4 °C.
4.
BigDye® dilution buffer [34].
5.
BigDye® Terminator 1.1 Ready Reaction Mix: Store at −20 °C.
6.
dGTP BigDye® Terminator Ready Reaction Mix: Store at −20 °C
[35].
7.
ExoSAP-IT®: Store at −20 °C.
8.
ExoSAP-IT® dilution buffer: 50 mM Tris-HCl, pH 8.0. Store at room
temperature.
9.
Hi-Di™ Formamide: Store at −20 °C.
10.
10 μM Primers: Store at −20 °C (see Subheading 2.4).
2.7 Capillary Electrophoresis

1.
96-well plate retainer and base.
2.
Sequencing Analysis Software v5.2 or higher.
3.
Capillary electrophoresis instrument: Need accompanying
collection software and consumables.
2.8 Sequence Assembly

1.
Sequence Scanner v1.0 or higher.
2.
Sequencher™ software v4.8 or higher [36].
3 Methods
A laboratory coat, gloves, sleeves, and a surgical mask are utilized
during all pre-amplification steps. A laboratory coat and gloves should
be worn during post-amplification steps. Gloves should be changed
frequently (e.g., between samples, when soiled, and after touching
other high-touch surfaces) (see Note 1).
3.1 Chelex® Extraction Method for Reference Bloodstains

[37]
1.
Pipette 1.0 mL ultra-pure water into an appropriately labeled
sterile tube and initiate a reagent blank.
2.
Add an appropriately sized piece (approximately 3 mm × 3 mm) of
blood-stained material (including FTA cards) to the tube.
3.
Vortex at high speed for 10 s.
4.
Incubate at room temperature (or 95 °C for samples on FTA cards)
for a minimum of 15 min, vortexing several times during the
incubation.
5.
Centrifuge for 3 min at approximately 10,000 × g.
6.
Discard all but 20–30 μL of the supernatant, leaving the substrate
and pelleted material in the tube.
7.
Proceed to DNA isolation (see Subheading 3.3, step 1).
3.2 Chelex® Extraction Method for Reference Buccal
Swabs
1.
Using a sterile, disposable scalpel, cut and add an appropriately
sized piece of sample (approximately 1/3 of a swab tip) to the
lower portion of an appropriately labeled sterile tube.
2.
Add 1.0 mL ultra-pure water to the sterile tube and initiate a
reagent blank.
3.
Vortex at high speed for 10 s.
4.
Incubate at room temperature for 30 min.
5.
Centrifuge for 3–15 min at approximately 10,000 × g.
6.
Remove and discard the top 0.5 mL of supernatant.
7.
Transfer the cutting into a spin basket and place the basket into
the tube (see Note 2).
8.
Centrifuge for 3 min at approximately 10,000 × g, remove the
basket.
9.
Remove and discard all but 50 μL of supernatant.
10.
Proceed to DNA isolation (see Subheading 3.3, step 1).
3.3 Chelex® Isolation of DNA

1.
After completing the Chelex extraction for reference samples (see
Subheading 3.1, step 6 or Subheading 3.2, step 9), proceed by
adding 5% Chelex® to a final volume of 200 μL and vortex gently to
re-suspend the pellet (see Note 3).
2.
Incubate at 56 °C for 30 min.
3. Vortex briefly.
4.
Incubate in a boiling water bath for 8 min.
5.
Vortex briefly.
6.
Centrifuge for 3 min at approximately 10,000 × g.
7.
Transfer the supernatant from the Chelex® beads to an
appropriately labeled sterile tube and store at −20 °C (see Note 4).
8.
Proceed to mitochondrial DNA amplification (see Subheading 3.7,
step 1).
3.4 Organic Extraction Method for Loose Hairs

1.
Clean micro tissue grinders with 10% bleach, then ultra-pure
water, then ethanol, and allow to dry completely before use.
2.
Irradiate the micro tissue grinders in the UV crosslinker.
3.
Carefully remove approximately 2 cm of hair shaft material from
the proximal end of the hair and place in an appropriately labeled
sterile tube (see Note 5).
4.
Add 1.0 mL 5% Terg-a-zyme™ solution and place the tube in the
ultrasonic cleaner for 20 min.
5.
Remove the tube from the ultrasonic cleaner and carefully remove
the 5% Terg-a-zyme™ solution.
6.
Repeat the Terg-a-zyme™ wash process three times for a total of
four washes.
7.
Add 1.0 mL absolute ethanol, recap the tube, and gently agitate
several times.
8. Remove the absolute ethanol, add 1.0 mL ultra-pure water, recap
the tube, and gently agitate several times.
9.
Remove the water.
10.
Initiate a reagent blank at this time by adding 187 μL extraction
buffer to a clean, UV-irradiated micro tissue grinder and briefly
simulate grinding.
11.
Transfer the extraction buffer to a labeled sterile tube (this is the
reagent blank).
12.
To the same micro tissue grinder used to create the reagent blank,
add 130 μL extraction buffer and the washed/prepared hair
shaft(s).
13.
Grind until fragments of hair are no longer visible.
14.
Transfer the solution into a labeled sterile tube.
15.
Add an additional 57 μL extraction buffer to the micro tissue
grinder to rinse and transfer it to the tube with the sample.
16.
Add 5 μL Proteinase K and 8 μL DTT, vortex, and pulse spin.
17.
Incubate at 56 °C for a minimum of 2 h and a maximum of 24 h. It
does not need to be vortexed during this incubation time.
18.
Add 200 μL PCIAA, vortex thoroughly, and centrifuge for 2 min at
approximately 10,000 × g.
19.
Transfer the upper aqueous layer to an appropriately labeled
20.
waste container.
21. Repeat extraction with PCIAA until the interface is clean (see Note
7).
22.
To the aqueous layer, add 200 μL n-butanol.
23.
10,000 × g.
24.
Remove and discard the upper n-butanol layer into an
25.
Label a sufficient number of pre-assembled UV irradiated
Microcon® YM-30 concentrators.
26.
Add 300 μL TE−4 buffer to each sample reservoir of the Microcon®
YM-30 concentrators.
27.
Microcon® YM-30 concentrators, avoiding the pipetting of any
residual n-butanol.
28.
Centrifuge the concentrator at a maximum of 1000 × g for 15–
30 min or until the sample has spun through (see Note 8).
29.
Discard the filtrate.
30.
Add 300 μL TE−4 buffer to the sample reservoir of the Microcon®
31.
30 min or until the sample has spun through.
32.
Add 60 μL TE−4 buffer to the filter side of the sample reservoir of
the Microcon® YM-30 concentrators.
33.
Place a retentate cup on the top of each concentrator and briefly
vortex with the retentate cup pointing upward.
34.
Invert each concentrator sample reservoir with its retentate cup
and centrifuge at approximately 10,000 × g for 3 min.
35. Discard the concentrators and measure the volume of the
retentate with a pipette.
36.
Add TE−4 buffer, if necessary, to bring the retentate volume up to
100 μL.
37.
step 1).
3.5 Organic Extraction Method for Bone

See Chapter 6: DNA Extraction of Bone through Demineralization in this
book for this protocol.
3.6 Organic Extraction Method for Bloodstains and Buccal

Swabs
1.
Add an appropriately sized piece (approximately 3 mm × 3 mm)
of blood-stained material (including FTA cards) or approximately
1/3 of a swab tip, in an appropriately labeled sterile tube.
2.
Add to the sample tube and to a separately labeled sterile tube for
the reagent blank: 400 μL extraction buffer and 10 μL Proteinase
K.
3.
Vortex, pulse spin, and incubate at 56 °C for a minimum of 2 h and
a maximum of 24 h. It is not necessary to vortex during
incubation.
4.
Transfer the cutting to a basket and place the basket in the tube
and close the lid. Centrifuge for 3 min at approximately 10,000 × g
to remove the excess liquid from the cutting.
5.
Retain the cutting, if necessary, to be dried and repackaged.
6.
Add 400 μL PCIAA, vortex thoroughly, and centrifuge for 2 min at
approximately 10,000 × g.
7. Transfer the upper aqueous layer to an appropriately labeled
8.
waste container.
9.
If necessary, repeat extraction with PCIAA until the interface is
clean (see Note 7).
10.
To the aqueous layer obtained (see Subheading 3.6, step 7), add
400 μL n-butanol.
11.
10,000 × g.
12.
Remove and discard the upper n-butanol layer into an
13.
Label a sufficient number of pre-assembled UV irradiated
Microcon® YM-30 concentrators.
14.
Add 100 μL TE−4 buffer to each sample reservoir of the Microcon®
15.
Microcon® YM-30 concentrators, avoiding the pipetting of any
residual n-butanol.
16.
30 min or until the sample has spun through (see Note 8).
17.
Discard the filtrate.
18.
Add 400 μL TE−4 buffer to the sample reservoir of the Microcon®
19.
30 min or until the sample has spun through.
20.
Discard the filtrate and repeat the 400 μL TE−4 buffer wash.
Add 60 μL TE−4 buffer to the filter side of the sample reservoir of
4
21. Add 60 μL TE® buffer to the filter side of the sample reservoir of
the Microcon YM-30 concentrator.
22.
Place a retentate cup on the top of each concentrator and briefly
vortex with the retentate cup pointing upward.
23.
Invert each concentrator sample reservoir with its retentate cup
and centrifuge at approximately 10,000 × g for 3 min.
24.
Discard the concentrators and measure the volume of the
retentate with a pipette.
25.
Add TE−4 buffer, if necessary, to bring the retentate volume up to
100 μL.
26.
Transfer the 100 μL of retentate to an appropriately labeled
sterile tube.
27.
step 1).
3.7 Mitochondrial DNA Amplification

1.
After DNA extraction and isolation, prepare an amplification master
mix in a UV irradiated, sterile tube for each of the regions to be
evaluated (see Tables 1 and 2 and Note 9).
2.
Aliquot 40 μL master mix into each appropriately labeled UV
irradiated, sterile, thin-walled PCR tube.
3.
Pipette the sample and control volumes (as appropriate) one at a
time to the corresponding PCR tubes (see Table 3).
4.
Vortex the PCR tubes briefly and pulse spin prior to placing the
tubes in the thermal cycler (see Note 10).
5. Select and start the PCR program on the thermal cycler based on
whether you are amplifying the entire control region or one or
more of the primer set regions (see Table 4).
6.
Proceed to mitochondrial DNA product evaluation (see Subheading
3.8, step 1).
Table 1 Primer pairs for both reference and evidence samples
Targeted primer set Primers used

Primer Set 1 (HV1) F15989/R16251
Primer Set 2 (HV1) F16190/R16410-m19
Control Region (HV1 and HV2) F15971/ R599
Primer pairs are used for both mitochondrial DNA amplification and
sequencing. “F” indicates it is a forward primer, “R” indicates it is a
reverse primer
Table 2 Composition of mtDNA amplification reaction master mix

10X PCR buffer 5 μL
2.5 mM dNTPs 4 μL
0.625 μg/μL BSA 2 μL
Forward primer (10 μM) 2 μL
Reverse primer (10 μM) 2 μL
Taq Gold (5 U/μL) 1 μL
Ultra-pure water 24 μL
Total Volume 40 μL
Numerous components are required for a mtDNA amplification. It is

advised that an “n + 1” strategy be used, where n is the number of
samples (e.g., if you have 16 samples to make a master mix for, make
enough for 17 to allow for pipetting variability)
Table 3 Composition of sample and control input for mtDNA amplification reaction
Component Volume
Amplification negative control 10 μL ultra-pure water
Component Volume
Sample DNA extracts 1–10 μL of sample (qs to 10 μL with ultra-
pure water)
Amplification positive control 10 μL HL60 (200 pg / 10 μL primer sets)
10 μL HL60 (500 pg / 10 μL control region)
Reagent blank volume is equal to the maximum 1–10 μL of the reagent blank (qs to 10 μL
sample volume added with ultra-pure water)
The appropriate addition of water or DNA sample/control is crucial to

maintaining the correct ratio to the master mix added to the tube. qs
(quantum satis) your volume so that 10 μL of water, DNA
sample/control, or a combination of the two are added to make a final
volume of 50 μL
Table 4 Thermal cycler amplification parameters
Control region reaction Primer set reaction

36 cycles of: 94 °C for 30 s, 56 °C for 30 s, 38 cycles of: 94 °C for 20 s, 56 °C for 20 s,
72 °C for 60 s 72 °C for 30 s
72 °C for 7 min 4 °C soak
4 °C soak
Parameters are provided for amplification of either the control region

or one or more of the primer set regions
3.8 Mitochondrial DNA Product Evaluation

1.
Each 3% (w/v) gel contains 1.5 g 3:1 agarose in a 50 mL 1X TAE
buffer (see Note 11).
2.
Measure the volume (50 mL per gel) of 1X TAE buffer with a
graduated cylinder and add to a 250 mL flat-bottom boiling flask.
3.
Slowly add the 1.5 g 3:1 agarose to the flask while swirling the
buffer to avoid clumping of the agarose.
4. Place the weigh boat upside down on the top of the flask to use as
a lid and heat in the microwave oven for approximately 1 min and
30 s on 50% power (see Note 12).
5.
Pulse spin the SYBR® Safe DNA gel stain 10,000X concentrate in a
microcentrifuge.
6.
Add 5 μL of the concentrate to the 50 mL of agarose solution and
place the glass flask on an orbital shaker for approximately
15 min at ~100 rpm to cool the agarose solution enough to handle
it without hand protection.
7.
Assemble the gel bed(s) in either the casting tray or by placing the
gel bed sideways in the electrophoresis tank so that the agarose
solution will not spill out of the bed (see Note 13).
8.
When the flask is cool enough to handle, the agarose gel can be
poured into the prepared gel beds.
9.
Ensure the gel bed is level and pour the molten agarose gel into
the center of the gel bed. Remove any bubbles with a pipette tip.
10.
Place the comb(s) in position and allow the gel to solidify for
approximately 15 min at room temperature.
11.
Once the gel has solidified and the comb(s) have been removed,
the gel is ready to be used (see Note 14).
12.
Ensure the gel tank is situated so that the red (positive) electrode
is farthest from the loading wells.
13.
Load the product gel into the tank and add a sufficient volume of
1X TAE buffer to the tank to cover the product gel at least 1 mm.
14.
Add 4 μL 5X loading buffer to the first well of a microtiter plate for
use with the DNA MW Marker XIV.
15.
Add 2 μL 5X loading buffer into the wells of the microtiter plate to
correspond to the amplified samples that will be loaded into the
product gel.
16. Add 2 μL DNA MW Marker XIV to the first well of the microtiter
plate containing 5X loading buffer.
17.
Add 4 μL of the amplified sample to the appropriate well of the
microtiter plate containing 5X loading buffer. Store the remainder
of the sample at 4 °C.
18.
Load the entire amount of either ladder or sample from the
microtiter plate into the designated well of the gel, continuing
until all of the wells have been loaded.
19.
Place the cover on the gel tank.
20.
Plug the red (positive) electrode into the positive plug of the
power supply; then, plug the black (negative) electrode into the
negative plug of the power supply.
21.
Turn on the power supply and set the voltage to 150 volts.
22.
Run the gel for a minimum of 45 min, or until the loading buffer
moves approximately 4 cm.
23.
When electrophoresis is complete, slide the gel onto the UV
transilluminator and place the digital camera/gel hood over the
transilluminator (see Note 15).
24.
Turn on the UV transilluminator and, while using the macro
setting on the camera, zoom into the gel to take the photo.
25.
Turn the UV transilluminator off and dispose of the gel (see Notes
16 and 17).
26.
Proceed to purification/sequencing of mitochondrial DNA (see
3.9 Enzymatic Purification/Sequencing of Mitochondrial

DNA
1. Prepare a master mix of ExoSAP-IT® and ExoSAP-IT® dilution
buffer (see Table 5).
2.
Add 20 μL of the master mix to each amplification tube previously
created (samples and corresponding controls) (see Subheading
3.7, step 4) to move forward with purification and sequencing.
3.
Briefly vortex and pulse spin the PCR tubes, and then place them
into the thermal cycler.
4.
Select and start the PCR program on the thermal cycler for
enzymatic purification (see Table 6).
5.
While the thermal cycler program is running, prepare a
sequencing reaction master mix for each primer used for
amplification (see Subheading 3.7, step 1) (see Table 7 and Note
18).
6.
Add 7 μL of master mix to each new appropriately labeled sterile
PCR tube.
7.
After the sample(s) have finished in the thermal cycler for
enzymatic purification (see Subheading 3.9, step 4), add the
appropriate volume to the corresponding PCR tubes one at a time
(see Note 19).
8.
Select and start the PCR program on the thermal cycler for cycle
sequencing (see Note 20 and Table 6).
9.
After the sample(s) have finished in the thermal cycler, spin the
Performa® DTR Gel Filtration Cartridges for 1 min at 750 × g.
10.
Transfer the cartridge to the manufacturer-provided 1.5 mL tube
and add the sequenced sample(s) (see Subheading 3.9, step 8) to
the packed column, ensuring that the fluid is placed in the center
of the gel.
11.
Close the cap and spin at 750 × g for 2 min.
12.
Remove and discard the cartridge from each tube.
13. Transfer the sample(s) to a 96 well optical plate.
14.
Spin the plate in a speedvac until dry (approximately 1–2 h).
15.
Pipette 10 μL Hi-Di™ Formamide into any well of the optical plate
that contains the dried sequence product.
16.
Pipette 10 μL Hi-Di™ Formamide into any unused wells of the

plate that will be injected by the instrument (e.g., on the AB
3500xL, three columns are injected at a time, so ensure that
columns are filled with Hi-Di™ Formamide in groups of three).
17.
Place a 96 well septa on the plate and vortex to help re-suspend
the samples.
18.
Pulse spin the plate.
19.
Place the plate onto a plate base and then snap the plate retainer
over the top of the plate, plate septa, and plate base.
20.
Place plate onto the capillary electrophoresis instrument’s
autosampler for analysis (see Note 21).
Table 5 Composition of ExoSAP-IT® master mix
ExoSAP-IT® 1.5 μL
ExoSAP-IT® dilution buffer 18.5 μL

Total Volume 20 μL
It is advised that an “n + 1” strategy be used, where n is the number of

Table 6 Thermal cycler enzymatic purification and cycle sequencing parameters
Enzymatic purification Cycle sequencing
85 °C for 15 min 25 cycles of: 96 °C for 10 s, 50 °C for 5 s, 60 °C for 4 min
4 °C soak 4 °C soak
Parameters are provided for both the enzymatic purification and cycle
sequencing steps
Table 7 Composition of cycle sequencing mtDNA reaction

Primer (10 μM) 1.0 μL
BigDye® Terminator 1.1 RR Mix 3.6 μL
dGTP BigDye® Terminator RR Mix 0.4 μL
BigDye® dilution buffer 2.0 μL
Total Volume 7 μL
It is advised that an “n + 1” strategy be used, where n is the number of

3.10 Sequence Assembly and Analysis

The Sequencher™ software [38] is used to edit and assemble the
sequences developed to produce a contiguous consensus sequence
(contig) (see Fig. 1). The consensus sequence can then be compared to
the Revised Cambridge Reference Sequence (rCRS) to report the
differences to the reference. There are other software available to
purchase that can edit and compile mtDNA sequences (see Fig. 2 and
Note 22).
Fig. 1 Example of a contig using the primer set amplification strategy. Primer sets 1 and 2
comprise the HV1 region, and primer sets 3 and 4 comprise the HV2 region
Fig. 2 Sequencher™ software viewer. The top half shows each individual mtDNA sequence
developed and their overlapping regions. The bottom half shows each nucleotide represented
by different colors (adenine [A] is green, thymine [T] is red, guanine [G] is black, cytosine [C] is
blue). The sequences from the sample are shown in relation to the rCRS
Once sample sequences have been compiled into a contig, contigs

can be compared between evidence and references to evaluate for any
differences. When comparing sequences obtained from samples, only
the regions with a common range will be evaluated. For example, if a
partial sequence (16,024–16,365 and 73–284) is obtained for a sample
of questioned origin (Q) and a full sequence is obtained for the sample
of known origin (K), the comparison will be conducted on positions
16,024–16,365 and 73–284. In addition, sequences before and after the
defined HV1 and HV2 regions will also be used for comparison
purposes, provided this range is common to both samples.
4 Notes
1.
Exceptional care must be taken when performing mtDNA analysis.
Due to the challenging nature of the samples, there is an
extremely high chance of contamination from either the analyst or
other samples in the laboratory. It is not advisable to work on
more than one sample at a time.
2. Alternatively, sterile forceps can be used to remove the cutting(s)
from the water in the tube and squeezed to remove excess water
f ( )
from the cutting(s).
3.
When pipetting Chelex® solutions, the resin beads must be
distributed evenly in solution.
4.
Great care should be taken to avoid pipetting any Chelex® beads
into your final eluate. The beads are clear and translucent. They
should be easy to see in appropriate light.
5.
A stereo or compound microscope may be used in making the
determination of the proximal end of the hair by observing the
root end (if present) or the directionality of the scales of the hair
or hair fragment.
6.
When the PCIAA is added and vortexed into the solution, the DNA
is separated into the aqueous, upper layer. The proteins and lipids
are separated into the organic, lower layer. The point at which
these two layers meet is called the interface, where additional
proteins and debris will lie. It is visible to the naked eye and is
similar to the phenomenon when oil and water are mixed. Care
must be taken not to disturb the layers or to pipette up the
interface to ensure your extract is as clean as possible.
7.
Some samples that are dirtier or have potential contaminants may
need more than one PCIAA extraction. If you notice that the
interface is thick, or that the aqueous, upper layer is not clear, you
may want to repeat this step.
8.
Only spin the concentrator enough so that the sample spins
through but the membrane within the reservoir is still wet. You do
not want to over-dry the membrane or the DNA may bind to the
membrane and prevent the DNA from eluting into your final
solution.
9. An amplification master mix must be made for each pair of
primers you are wanting to amplify. For example, if you are using
a primer set approach, you will need to amplify each of the four
primer sets (and subsequently, make four master mixes) for HV1
and HV2 for full coverage of those regions. The appropriate
forward and reverse primers for each set are listed in Table 1.
forward and reverse primers for each set are listed in Table 1.
10.
Vortexing the PCR tubes ensures that the master mix and sample
are evenly distributed. Pulse spinning the PCR tubes ensures that
all of the liquid is in the bottom of the tubes. Ensure that the lids
are completely closed before placing the tubes into the thermal
cycler and take care to remove all bubbles in solution.
11.
This 50 mL gel can fit into a mini gel electrophoresis system.
Different systems are available through different manufacturers,
and the gel trays can typically fit between 8 and 49 sample wells
on 1–2 combs (row of wells). At least one ladder should be loaded
for each comb for easy comparison between samples.
12.
The gel preparation is ready when all of the agarose has dissolved
into solution. Use caution and hand protection when removing
from the microwave oven—the flask will be extremely hot and the
gel preparation may be boiling.
13.
Two opposite sides of the gel tray will be open ended and have
gaskets. Position the gel tray in the chamber so that the gaskets
are tight against the walls of the buffer chamber so that when the
gel solution is poured in, it will not leak.
14.
If the gel will not be used on the same day of preparation, the gel
and gel bed may be stored in a plastic zip-top bag along with a
moistened wipe and refrigerated at 4 °C. If you are running the gel
now, the gel tray can be rotated 90° in the chamber and the rest of
the 1X TAE buffer can be poured into the buffer chamber filling
1 cm over the top of the solidified gel.
15.
UV light is hazardous and may cause damage to eyes. Ensure
proper safety glasses are in place prior to turning on UV light.
16. Primer set amplification products should show a band around
200–300 bp. Control region amplification products should show a
band around 1000–1500 bp. mtDNA amplification is known to be
difficult, especially for degraded or environmentally compromised
samples. Many different amplifications at different dilutions may
need to be attempted.
17.
At this point, it will be at your discretion to decide how much
product to take forward for cycle sequencing. Keep in mind that
you will want to aim for 5–20 ng of product. The higher the
intensity of the product band, the higher the concentration of the
product. A key for determining intensity is usually included with
the DNA MW Marker XIV ladder you purchase.
18.
You will make a separate master mix for each primer you are
using in the cycle sequencing step (a total of eight master mixes
will be made if you amplified all four primer sets at once).
19.
After determining how much product you want to add, qs

(quantum satis) the remaining volume so that the final reaction
volume is 20 μL.
20.
Samples can be left at 4 °C either in the thermal cycler or in a
refrigerator until you are ready to move on.
21.
See the user guide for the maintenance and operation of your
capillary electrophoresis instrument.
22.
Tutorials and instructions specifically for mtDNA typing using
Sequencher™ can be found on their website (genecodes.com).
Acknowledgments
This work was adapted from and supported by the Virginia Department
of Forensic Science, specifically the Mitochondrial DNA Section [38].
References
1. Butler JM (2005) Mitochondrial DNA analysis. In: Forensic DNA typing: biology, technology,
and genetics of STR markers, 2nd edn. Elsevier, Burlington
2.
Budowle B, Allard MW, Wilson MR et al (2003) Forensic and mitochondrial DNA:
applications, debates, and foundations. Annu Rev Genomics Hum Genet 4:119–141
[Crossref][PubMed]
3. Carracedo A, Bä r W, Lincoln P et al (2000) DNA Commission of the International Society for

Forensic Genetics: guidelines for mitochondrial DNA typing. Forensic Sci Int 110:79–85
[Crossref][PubMed]
4. Linch CA, Whiting DA, Holland MM (2001) Human hair histogenesis for the mitochondrial
DNA forensic scientist. J Forensic Sci 46:844–853
[Crossref][PubMed]
5. Wilson MR, Polanskey D, Butler J et al (1995) Extraction, PCR amplification and sequencing
of mitochondrial DNA from human hair shafts. BioTechniques 18:662–669
[PubMed]
6. Wilson MR, Allard MW, Monson KL et al (2002) Further discussion of the consistent
treatment of length variants in the human mitochondrial DNA control region. Forensic
Science Communications 4(4), Available via the Federal Bureau of Investigation. https://
archivesfbigov/archives/about-us/lab/forensic-science-communications/fsc/oct2002/
wilsonhtm. Accessed 11 July 2022
7. Wilson MR, Allard MW, Monson KL et al (2002) Recommendations for consistent treatment
of length variants in the human mitochondrial DNA control region. Forensic Sci Int 129:35–
42
[Crossref][PubMed]
8. Wilson MR, DiZinno JA, Polanskey D et al (1995) Validation of mitochondrial DNA

sequencing for forensic casework analysis. Int J Legal Med 108:68–74
[Crossref][PubMed]
9. Baubliene J, Daugnora L, Miceikiene I (2003) Evaluation of the DNA extraction method

from ancient animal bones. Ekologija 1:8–11
10. Edson SM, Ross JP, Coble MD et al (2004) Naming the dead—confronting the realities of
rapid identification of degraded skeletal remains. Forensic Sci Rev 16:63–90
[PubMed]
11. Fisher DL, Holland MM, Mitchell LG et al (1993) Extraction, evaluation, and amplification of
DNA from decalcified and undecalcified United States Civil War bone. J Forensic Sci 38:60–
68
[Crossref][PubMed]
12. Hochmeister MN, Budowle B, Borer UV et al (1991) Typing of deoxyribonucleic acid (DNA)
extracted from compact bone from human remains. J Forensic Sci 36:1649–1661
[Crossref][PubMed]
13. Holland MM, Fisher DL, Mitchell LG et al (1993) Mitochondrial DNA sequence analysis of
human skeletal remains: identification of remains from the Vietnam war. J Forensic Sci
38:542–553
[Crossref][PubMed]
14. Holland MM, Parsons TJ (1999) Mitochondrial DNA sequence analysis—validation and use
for forensic casework. Forensic Sci Rev 11:22–50
15.
Loreille OM, Diegoli TM, Irwin JA et al (2007) High efficiency DNA extraction from bone by
total demineralization. Forensic Sci Int 1:191–195
[Crossref]
16. Nelson K, Melton T (2007) Forensic mitochondrial DNA analysis of 116 casework skeletal
samples. J Forensic Sci 52:557–561
[Crossref][PubMed]
17. Pruvost M, Schwarz R, Correia VB et al (2007) Freshly excavated fossil bones are best for
amplification of ancient DNA. Proc Natl Acad Sci U S A 104:739–744
18. Salamon M, Tuross N, Arensburg B et al (2005) Relatively well preserved DNA is present in
the crystal aggregates of fossil bones. Proc Natl Acad Sci U S A 102:13783–13788
19. Gabriel MN, Huffine EF, Ryan JH et al (2001) Improved mtDNA sequence analysis of
forensic remains using a ‘mini-primer set’ amplification strategy. J Forensic Sci 46:247–253
[Crossref][PubMed]
20. Hawes JW, Knudtson KL, Escobar H et al (2006) Evaluation of methods for sequence
analysis of highly repetitive DNA templates. J Biomol Tech 17:138–144
21. Melton T (2004) Mitochondrial DNA heteroplasmy. Forensic Sci Rev 16:268–286
22. Scientific Working Group on DNA Analysis Methods (SWGDAM) (2013) Interpretation
guidelines for mitochondrial DNA analysis by forensic DNA Testing Laboratories. Available
via SWGDAM. http://swgdam.org/SWGDAM%20mtDNA_Interpretation_Guidelines_
APPROVED_073013.pdf. Accessed 13 July 2022
23. Scientific Working Group on DNA Analysis Methods (SWGDAM) (2019) Interpretation
guidelines for mitochondrial DNA analysis by forensic DNA Testing Laboratories. Available
via SWGDAM. https://swgdam.org/publications. Accessed 13 July 2022
24. Scientific Working Group on DNA Analysis Methods (SWGDAM) (2014) Guidelines for
missing persons casework. Available via SWGDAM. http://swgdam.org/publications.
25. Scientific Working Group on DNA Analysis Methods (SWGDAM) (2003) Guidelines for
mitochondrial DNA (mtDNA) nucleotide sequence interpretation. Forensic Sci Commun
5(2). Available via the Federal Bureau of Investigation. https://archives.fbi.gov/archives/
about-us/lab/forensic-science-communications/fsc/april2003/swgdammitodna.htm.
26. Scientific Working Group on DNA Analysis Methods (SWGDAM) (2014) Mitochondrial DNA
nomenclature examples document. Available via SWGDAM. https://swgdam.org/
publications. Accessed 13 July 2022
27.
Anderson S, Bankier AT, Barrell BG et al (1981) Sequence and organization of the human
mitochondrial genome. Nature 290:457–465
[Crossref][PubMed]
28. Andrews RM, Kubacka I, Chinnery P et al (1999) Reanalysis and revision of the Cambridge
Reference Sequence for human mitochondrial DNA. Nat Genet 23:147
[Crossref][PubMed]
29. Tully G, Bä r W, Brinkmann B et al (2001) Considerations by the European DNA Profiling

(EDNAP) group on the working practices, nomenclature and interpretation of
mitochondrial DNA profiles. Forensic Sci Int 124:83–91
[Crossref][PubMed]
30. Tamariz J, Voynarovska K, Prinz M et al (2006) The application of ultraviolet irradiation to

exogenous sources of DNA in plasticware and water for the amplification of low copy
number DNA. J Forensic Sci 51:790–794
[Crossref][PubMed]
31. Millipore Corporation (2005) Microcon® Centrifugal Filter Devices User Guide, Revision M
32. Bio-Rad Laboratories (1996) Chelex® 100 and Chelex® 20 Chelating Ion Exchange Resin,
Instruction Manual, Revision B
33. Kreader C (1996) Relief of amplification inhibition in PCR with bovine serum albumin or
T4 Gene 32 protein. Appl Environ Microbiol 6:1102–1106
[Crossref]
34. Applied Biosystems (2002) ABI Prism® BigDye® Terminator v1.1 Cycle Sequencing Kit
Protocol, Revision A
35. Applied Biosystems (2003) ABI Prism® dGTP BigDye® Terminator Ready Reaction Kit
Protocol, Revision D
36. Gene Codes Corporation (2007) Sequencher™ 4.8 User Manual for Windows
37. Walsh PS, Metzger DA, Higuchi R (1991) Chelex® 100 as a medium for simple extraction of
DNA for PCR-based typing from forensic material. BioTechniques 10:506–513
[PubMed]
38. Virginia Department of Forensic Science (2020) Mitochondrial DNA Section Procedures
Manual. Available via Virginia Department of Forensic Science. https://www.dfs.virginia.
gov/wp-content/uploads/2020/10/212-D100-Mitochondrial-DNA-Section-Procedures-
Manual.pdf. Accessed 1 May 2022
https://doi.org/10.1007/978-1-0716-3295-6_21
21. An Optimized Forensic DNA Analysis

Workflow for Obtaining STR Results
from Archived Latent Fingerprints
April D. Solomon1
(1) Jefferson Parish Sheriff’s Office Regional DNA Laboratory, Harvey,
LA, USA
Abstract
Since the initial introduction of forensic DNA analysis in the 1980s,
advancements have been made within the forensic biology community
that have improved the success rate of obtaining DNA profiles.
Fingerprints that were originally intended for latent examination could
be a potential source of DNA. Archived latent fingerprints contain touch
DNA between an adhesive barrier of tape and a paper substrate. Collect
a DNA sample by separating the tape and paper material, then cut each
substrate into small pieces (approximately 3 mm × 3 mm). Extract DNA
samples using the QIAamp® DNA Investigator Kit (QIAGEN®), a silica-
column based method, and follow the manufacturer’s protocol for
“paper and other similar materials.” Pair it with the Centri-Sep™ spin
column (Thermo Fisher Scientific) concentration method to optimize
the biological workflow for DNA profiling.
Key words Forensic biology – Touch DNA – Archived latent

fingerprints – Short tandem repeats
1 Introduction
DNA analysis on touch DNA was introduced in the late 1990s [1], and
great emphasis is still placed on these low template DNA type samples
[2–7]. Touch DNA is a mixture of sweat gland secretions and
corneocytes that have been transferred to another object [1–3]. If
human DNA can be detected at all, these samples often provide low
quality short tandem repeat (STR) profiles that are difficult to interpret
[5–7]. Nevertheless, they are a common source of evidence in forensic
laboratories due to the advancements that have been made in forensic
biology and STR analysis. Laboratory protocols, therefore, utilize
techniques that are catered for low sources of DNA in order to increase
their success of developing a valuable DNA profile [5–7].
Archived latent fingerprints are not a traditional source of DNA.
Their routine collection began well before the introduction of forensic
DNA analysis because they were initially collected for latent fingerprint
examination. Oftentimes, fingerprints were brushed with powder prior
to being tape-lifted, then affixed to a paper backing card for long-term,
room temperature storage [8–10]. Although not collected specifically
for STR profiling, archived latent fingerprints contain touch DNA
between two protective barriers of tape and paper (see Fig. 1). Studies
have shown the potential to detect DNA from fingerprints [8, 10–12].
Regarding archived latent fingerprints, full STR profiles have been
developed from samples stored up to 28 years [13, 14]. The use of a
silica column-based DNA extraction led to an average detection of
0.45 g of DNA [13], and when paired with a re-purification step using a
gel spin column, improvements greater than 300% were seen in STR
allele detection [14]. Furthermore, limitations were seen in the
detection of secondary contributors so re-purification could assist with
higher quality STR data [14].
Fig. 1 Archived latent fingerprint. Typical archived latent fingerprints have been stored and
protected between tape and paper
Multiple studies have shown improvements in data collection from

the additional use of Centri-Sep™ spin columns [14–16], but pristine
DNA profiles should not be expected. Touch DNA samples are
challenging by nature. They can vary from having undetectable human
DNA levels to low quality profiles involving multiple contributors [4–7].
Mixtures, allelic drop-out, and artifacts are commonplace for DNA
samples in general [4–7]. Performing a DNA analysis method specific to
archived latent fingerprints will not elude such data characteristics, but
they could improve the quality of the data that is obtained [13, 14].
2 Materials
All solutions should be at room temperature and all tubes should be
labeled before performing laboratory procedures. Be sure to wear
personal protective equipment throughout the process and to use
sterilized equipment to maintain the integrity of the sample. Measures
to avoid cross-contamination should always be considered. Discard
waste products responsibly as biohazard products.
2.1 DNA Extraction

1.
Metal forceps (see Note 1).
2.
QIAamp® DNA Investigator Kit: Contains Buffer ATL, Buffer AL,
Buffer AW1, Buffer AW2, Buffer ATE, Carrier RNA (cRNA),
20 mg/mL Proteinase K, QIAamp® MinElute® columns, and 2 mL
collection tubes. Add 25 mL 96–100% ethanol to Buffer AW1 and
30 mL to Buffer AW2, as instructed by the manufacturer to dilute
these buffers prior to use; store at room temperature. Add 310 μL
Buffer ATE to the 1 μg/μL cRNA tube. Mix the components by
shaking the tube several times to achieve a homogenous solution.
Aliquot and store at −20 °C (see Note 2).
3.
96–100% Ethanol.
4. Shaking platform and incubator (see Note 3).
2.2 Re-purification with Centri-Sep™ Spin Columns

1.
Centri-Sep™ spin columns and accompanying collection tubes.
2.
Nuclease-free water.
3 Methods
3.1 DNA Sampling
1.
Outline the fingerprint area to be sampled with a marker on the
surface of the tape (see Note 4). Disassemble the archived latent
fingerprint sample by pulling the adhesive tape away from the
paper (see Note 5).
2.
Using a pair of forceps and scissors, carefully cut the fingerprint
area on the tape into small cuttings, approximately 3 mm × 3 mm,
and place them in a corresponding 1.5 mL microcentrifuge tube
(see Notes 6 and 7). Repeat the cutting process with the paper side
and place the cuttings in a separate 1.5 mL microcentrifuge tube
(see Note 8).
3.2 DNA Extraction with QIAamp DNA Investigator Kit [17]

1.
Add 300 μL Buffer ATL and 20 μL Proteinase K to each sample
tube. Vortex the tubes for at least 10 s.
2.
Incubate on a shaking platform (900 rpm) for at least 1 h at 56 °C
3.
Briefly centrifuge each sample to pool all of the liquid down to the
bottom of the tube (see Note 10). Add 300 μL Buffer AL and 1 μL
cRNA. Vortex the tubes for at least 10 s.
Incubate at 70 °C for 10 min on a shaking platform (900 rpm) (see
gp ( p )(
4. Note 3). Briefly centrifuge the sample tubes prior to adding
150 μL 96–100% ethanol. Vortex the tubes for at least 15 s (see

Note 11).
5.
Briefly centrifuge the sample tubes. Using both the tape and paper
sample tubes, transfer 600 μL of the sample lysate to a
corresponding QIAamp MinElute column.
6.
Centrifuge the sample tubes at 6000 × g for 1 min. Discard the
filtrate and reuse the collection tube. Add up to 450 μL of lysate
from the tape and paper sample tubes to the QIAamp MinElute
column. Centrifuge the sample tubes again at 6000 × g for 1 min.
Repeat this step until all of the lysate is combined into one tube
(see Note 12).
7.
Transfer the QIAamp MinElute column to a new 2 mL collection
tube. Add 500 μL Buffer AW1. Centrifuge the sample tubes at
6000 × g for 1 min.
8.
tube. Add 700 μL Buffer AW2. Centrifuge the sample tubes at
6000 × g for 1 min.
9.
tube. Add 700 μL of 96–100% ethanol. Centrifuge the sample
tubes at 6000 × g for 1 min.
10.
Transfer the QIAamp MinElute columns to a new 2 mL collection
tube. Centrifuge at 20,000 × g for 3 min.
11.
Transfer the QIAamp MinElute column to a new 1.5 mL tube. Open
the sample tube and allow the QIAamp MinElute column to
incubate at room temperature for at least 10 min (see Note 13).
12.
Add 20 μL Buffer ATE. Incubate the samples at room temperature
for 1 min (see Note 14). Centrifuge the tubes at 20,000 × g for
1 min. Use a final elution volume of 20–50 μL.
3.3 Re-purification with Centri-Sep Spin Columns [18]
1.
Label one Centri-Sep spin column for each sample. Tap the spin
column to settle the dry gel. Add 800 μL of nuclease-free water.
Briefly vortex the spin columns for a few seconds then invert them
several times to mix the solution (see Note 15).
2.
Leave the gel to hydrate at room temperature for 2 h (see Note 16).
3.
Tap the spin columns to release any air bubbles. Remove the top
cap first. Remove the bottom cap next to drain the excess water. Let
the Centri-Sep spin column sit for 5 min.
4.
Centrifuge the spin columns for 800 × g for 2 min to get rid of any
excess water. Remove any remaining water with sterile paper
material.
5.
Add the DNA sample extract to the corresponding Centri-Sep spin
column. Transfer the spin column to a 1.5 mL tube and centrifuge it
for 800 × g for 2 min.
6.
Proceed with the remainder of your DNA analysis.
4 Notes
1.
Sharp metal forceps are integral during the sampling process.
Having extra sterilized forceps on hand is highly recommended.
Troublesome adhesive may be handled better with multiple tools.
2.
It is important to add cRNA to low-level DNA samples to assist
with extraction efficiency. cRNA helps to bind DNA to the silica
column during the cleaning stage. It is sensitive to temperature, so
avoid multiple freezing and thawing stages by making single-use
aliquots (approximately 10–20 μL per tube).
3. A shaking platform housed inside an incubator is highly
recommended. A vortex mixer can be used in place of the shaking
platform by agitating the sample throughout the extraction
process.
4.
It is beneficial to apply pressure while outlining the fingerprint
area on top of the tape. This results in an indentation on the paper
substrate and allows you to outline both substrates at once.
5.
If there is a grip of tape folded in on itself, you can use your hands
to peel the tape back from the paper baking. Scalpels and/or
forceps may also be used during this step if the adhesive needs
help from coming off of the paper.
6.
Fine pointed forceps help to tug tape off of the scissors and place
the cuttings into 1.5 mL tubes. The use of two forceps can also be
helpful with troublesome adhesive. Be sure to keep the tape from
folding in on itself and from sticking back to the paper substrate.
7.
Try to place the cuttings of tape in the tube so the sticky side is
exposed.
8.
Separating the adhesive cuttings from the paper cuttings and
placing them in two separate sample tubes ensures the entire
sample is submerged during lysis.
9.
If time allows, overnight incubation is highly recommended.
Archived latent fingerprint samples are likely to be older samples
that could have been stored for years. Additional incubation time,
up to 24 h, will increase the potential of obtaining more DNA.
Periodically agitating the samples could also assist with higher
DNA detection.
10.
Always ensure all of the liquid is sitting at the bottom of the tube
before opening it. Condensation will build during incubation.
11.
Be sure you have a homogenous mixture after adding ethanol and
using the vortex mixer. Vortex for a bit longer if it does not appear
completely mixed.
12. Ensure all of the sample lysate is passing through the membrane
of the QIAamp MinElute column. If the membrane does not
b d f i i l d
appear to be dry after spinning your sample down, you can
centrifuge it again at an increased speed. The paper lysate can
become slurry and remain after centrifugation. If cloudy lysate
remains after spinning the sample down, briefly heat the sample
at 70 °C then repeat centrifugation again.
13.
Ensure the membrane is completely dry. Extend the room
temperature drying period if it is not. You can incubate the
samples for a few minutes at 56 °C to speed the drying process
and to ensure the membrane is dry and ready for the elution step.
14.
The samples can remain at room temperature with the eluent for
a few minutes longer to potentially increase extraction efficiency
of DNA retrieval.
15.
Ensure there are no dry spots in the gel powder before leaving it
to hydrate.
16.
Allowing the gel powder to dry for such a long time creates
smaller pores for the DNA sample to pass through. This should
increase the re-purification efficiency.
References
1. van Oorschot RAH, Jones MK (1997) DNA fingerprints from fingerprints. Nature 387:767.
https://doi.org/10.1038/42838
[Crossref][PubMed]
2. Lowe A, Murray C, Whitaker J et al (2002) The propensity of individuals to deposit DNA

and secondary transfer of low level DNA from individuals to inert surfaces. Forensic Sci Int
129(1):25–34. https://doi.org/10.1016/S0379-0738(02)00207-4
[Crossref][PubMed]
3. Wickenheiser RA (2002) Trace DNA: a review, discussion of theory, and application of the
transfer of trace quantities of DNA through skin contact. J Forensic Sci 47(3):442–450.
https://doi.org/10.1520/JFS15284J
[Crossref][PubMed]
4. Djuric M, Varljen T, Stanojevic A et al (2008) DNA typing from handled items. Forensic Sci
Int Genet 1(1):411–412. https://doi.org/10.1016/j.fsigss.2007.10.161
[Crossref]
5. Templeton J, Ottens R, Paradiso V et al (2013) Genetic profiling from challenging samples—
direct PCR of touch DNA. Forensic Sci Int Genet 4(1):e224–e225. https://doi.org/10.1016/
j.fsigss.2013.10.115
[Crossref]
6. Barbaro A, Cormaci P, Barbaro A (2006) LCN DNA typing from touched objects. Int
Congress Series 1288:553–555. https://doi.org/10.1016/j.ics.2005.09.114
[Crossref]
7. Aditya S, Sharma AK, Bhattacharyya CN et al (2011) Generating STR profile from “Touch
DNA”. J Forensic Legal Med 18(7):295–298. https://doi.org/10.1016/j.jflm.2011.05.007
[Crossref]
8. Van Hoofstat DEO, Deforce DLD, Hubert De Pauw IP et al (1999) DNA typing of fingerprints
using capillary electrophoresis—effect of dactyloscopic powders. Electrophoresis
20(14):2870–2876
[Crossref][PubMed]
9. Lee HC, Palmbach T, Miller MT (2001) Henry Lee’s crime scene handbook, 1st edn.
Academic Press, San Diego
10. Bhoelai B, de Jong BJ, de Puit M et al (2011) Effect of common fingerprint detection
techniques on subsequent STR profiling. Forensic Sci Int 3(1):e429–e430. https://doi.org/
10.1016/j.fsigss.2011.09.076
[Crossref]
11. Thamnurak C, Bunakkharasawat W, Riengrojpitak S et al (2011) DNA typing from

fluorescent powder dusted latent fingerprints. Forensic Sci Int Genet 3(1):e524–e525.
https://doi.org/10.1016/j.fsigss.2011.10.009
[Crossref]
12. Zech WD, Malik N, Thali M (2012) Applicability of DNA analysis on adhesive tape in
forensic casework. J Forensic Sci 57(4):1036–1041. https://doi.org/10.1111/j.1556-4029.
2012.02105.x
[Crossref][PubMed]
13. Solomon AD, Hytinen ME, McClain AM et al (2018) An optimized DNA analysis workflow
for the sampling, extraction, and concentration of DNA obtained from archived latent
fingerprints. J Forensic Sci 63(1):47–57. https://doi.org/10.1111/1556-4029.13504
[Crossref][PubMed]
14. Menchhoff SI, Solomon AD, Cox JO et al (2020) Effects of storage time on DNA profiling
success from archived latent fingerprint samples using an optimised workflow. Forensic Sci
Res 7(1):61–68. https://doi.org/10.1080/20961790.2020.1792079
15. Glenn TC, Schable NA (2005) Isolating microsatellite DNA loci. Methods Enzymol 395:202–
222. https://doi.org/10.1016/S0076-6879(05)95013-1
16.
Weitz S, Ricci LA, Davoren J et al (2009) DNA profiling of skeletal samples from the
disappeared in Latin America. Forensic Sci Int 2(1):245–247. https://doi.org/10.1016/j.
fsigss.2009.08.135
[Crossref]
17. Qiagen (2020) QIAamp® DNA Investigator Handbook. Available via Qiagen. https://www.
qiagen.com/us/resources/resourcedetail?id=26ef8f2c-7c2a-49e6-b2d2-39d4e130b3cc&
lang=en. Accessed 29 April 2022
18. Princeton Separations Inc (2016) Centri-Sep™ Columns. Available via Princeton
Separations Inc. https://www.prinsep.com/sites/prinsep.rpdesign.com/files/Centri-
Sep%20Procedure_0.pdf. Accessed 29 April 2022
https://doi.org/10.1007/978-1-0716-3295-6_22
22. Detection of Latent DNA Using a

DNA Binding Dye
Adrian Linacre1 and Piyamas Petcharoen2
(1) Forensic DNA Technology, College of Science and Engineering,
Flinders University, Adelaide, SA, Australia
(2) Forensic Technology and Innovation Module, School of Biology,
Institute of Science, Suranaree University of Technology, Nakhon
Ratchasima, Thailand
Adrian Linacre
Email: adrian.linacre@flinders.edu.au
Abstract
Latent DNA can be deposited every time a person holds or touches an
item. This “touch DNA” can be crucial evidence if the item is of forensic
significance. Until very recently, there were no means to visualize this
DNA. The advent of using a dye that binds to DNA has opened up this
possibility. The application of the dye is simple to perform, and a mobile
microscope allows rapid visualization of the cellular material, even in
ambient light. The dye can be applied in a solution of either 75%
ethanol or water. As this is a solution-based dye, the application works
best on non-absorbent surfaces.
DNA within cellular material, such as dead skin cells, appears as
green dots under 50X magnification; zooming to 220X magnification
confirms that these are cells. The location and number of these cells can
be photographed allowing a record of the presence of otherwise latent
DNA.
This chapter details the processes involved in the detection of latent
DNA using Diamond™ Nucleic Acid Dye with both control samples (that
act as very effective training samples) and the staining of evidential
items. By developing skills in determining cell locations, a targeted
approach to crime scene collection is now possible.
Key words Corneocytes – Diamond Dye – Latent DNA – Microscopy –

Touch DNA
1 Introduction
Every time a person touches or holds an item, they have the potential to
transfer skin cells. Skin cells are commonly called keratinocytes or
corneocytes and are on the exterior of the dermis. These dead cells
contain variable amounts of chromosomal DNA, as the DNA is degraded
in once living cells by nucleases. The latent cellular material may be
highly informative in a forensic investigation, yet there was, until
recently, no test for this transferred DNA. Taking samples for DNA is
therefore performed “blind” and based on best assumption. The
possibility to visualize DNA within cells using DNA staining dyes allows
a targeted approach [1, 2]. Any such dyes must be: safe to use,
inexpensive, easy to apply, able to permeate cell membranes, usable in
ambient light and not confined to a dark room, stable over time, and
sensitive allowing minimal magnification. Additionally, the dye cannot
inhibit further DNA analyses. These attributes are found in Diamond™
Nucleic Acid Dye (DD) [3]. DD is commercially available from the
Promega Corporation and was designed to stain DNA in an agarose gel.
The use of DD has very recently been shown to detect DNA outside of
gels, as in the case of cellular material deposited on a wide range of
surfaces [1, 2, 4]. A rapid means to determine shedder status [5, 6], and
assess how many corneocytes are needed to generate DNA profiles [7],
has also been reported. This chapter details the use of this dye to stain
DNA within corneocytes allowing the cells deposited by touch to be
visualized, localized, counted, and recorded. The dye can be applied
either to a defined small area by use of a pipette or over a greater area
using a compressed airgun. The use of a mobile hand-held microscope
allows recording cells in ambient light and is possible to do remotely
from a laboratory. An example of the set-up is shown in Fig. 1.
Fig. 1 Dino-Lite microscope set-up. An example of the set-up showing the Dino-Lite digital
microscope connected to an 11” MacBook Air laptop
2 Materials
The list below is of the items and reagents needed. In addition, items
touched by donors are needed to test and gain experience in DD
staining (see Note 1). Ensure that there is full ethics approval prior to
conducting any tests using touched items from known persons. Use of
Type I water for reagent preparation is required.
2.1 Reagents and Supplies

1. Diamond Dye is available from the Promega Corporation and sold
at a concentration of 10,000X. A working solution of 20X is
prepared using 75% ethanol (see Notes 2–4). This working
solution can be stored at room temperature and is stable for up to
4 weeks (the solution can be stored at 4 °C, if preferred). It is best
to keep tubes in the dark or cover with foil to prevent light affecting
the dye.
2.
Glass microscope slides.
3.
DNA-free tape suitable for cell collection.
2.2 Equipment
1.
Compressed airgun.
2.
Dino-Lite microscope equipped with an emission filter of 510 nm
and a blue LED excitation light source 480 nm.
3.
Stand for the microscope: the Dino-Lite RK-10A universal stand is
recommended.
4.
Dino-Lite Software downloaded on to a PC, tablet, or Mac.
5.
Cell counting software available from authors on request.
3 Methods
3.1 Reference Samples
1.
Ask the donor to wash their hands under running water and dry
using a paper towel. Wait for 15 min; during this time, light office
work can be conducted but the donor should refrain from shaking
hands with others or eating and drinking.
2.
After 15 min, the donor should press one part of their hand, usually
the last part of the digit of the finger or thumb of either the left or
right hand, onto a precleaned microscope slide. Medium pressure
should be used: do not place the digit lightly on the slide or press
hard, rather use a pressure in between these two (see Note 5).
3. Pipette ~5 μL of 20X DD solution onto the area where contact was
made. You may need to spread the solution over the area gently
i th i tt ti ( N t 4)
using the pipette tip (see Note 4).
4.
After 10 s, place the slide under the Dino-Lite microscope. Record

the number of cells at 50X magnification (see Fig. 2a as an
example). Cells can also be recorded at 220X (see Fig. 2b as an
example). Viewing cells at 220X can assist in the confirmation of
the morphology (see Note 6). In the top left of the software, there is
a camera icon—click on this to take an image. Images can be named
and stored.
5.
Collect at least five images in representative regions of the stained
slide where cells are present.
6.
If using this approach to determine shedder status [5, 6], then
repeat steps 1–5 but add an additional 30-min time period at step
1. Repeat this process at time points 15 and 30 min at least three
times.
Fig. 2 Cellular material stained with Diamond Dye. Diamond Dye-stained cellular material
within a thumbprint deposited on a glass slide under 50X (left) and 220X (right) magnifications
3.2 Evidential Items

1.
If the item is the size of a credit card, cartridge case, or smaller,
then the use of a pipette may be easiest to apply DD. If the item is
any larger than a credit card, the compressed airgun is the better
option (see Notes 7 and 8).
The DNA within cellular material should be visible to record after
The DNA within cellular material should be visible to record after
2.
10 s, or after the dye has dried completely. If cells are not visible,
then a second application may be performed but do not overspray
(see Note 8).
3.
The Dino-Lite microscope can be attached to a flexible arm to allow
many areas of any item to be searched for cellular material. Images
should be collected at 50X magnification. Collect as many images as
needed to ensure a representative record of the location of cellular
material, or its absence, has been obtained.
4.
Cells can be collected using whichever media (swab or tape) is
favored by the forensic science provider and then images can be
taken from the point of collection. This will provide a record of
before collection and after cell collection.
5.
If the substrate is highly absorbent, then the DD solution may be
absorbed before effective staining. The optimum means to view
cellular material is to apply DNA-free tape (see Note 9). Turn the
tape over to expose the surface that collected the cells and apply
20X DD. Wait for 10 s and place the tape under the microscope.
Cells should be present if they were on the item examined. Collect
images at 50X magnification over representative regions of the
tape. The tape can be examined subsequently for DNA profiling (see
Note 9) [8–10].
6.
If the substrate is three-dimensional when viewed at 50X
magnification such that images of cellular material cannot be
collected, then perform the collection of cells using a DNA-free tape
as outlined in step 5.
7.
The detection of cellular material using DD is based on the contrast
between the background fluorescence of the substrate and the
emission of DD. If these are similar, then autofluorescence may
prevent recording of the cells (see Note 1) [4]. An option is to
perform the tapelift process as outlined in step 5.
8. Following cell collection (see steps 5 and 6), proceed to a direct
amplification procedure to yield an STR DNA profile. Given the low
cell count this is highly recommended over the traditional
cell count, this is highly recommended over the traditional
extraction-quantitation-amplification workflow.
4 Notes
1.
As will be outlined, the application of DD is straightforward and can
be mastered easily. The greater challenge is to gain confidence in
determining whether what appears to be human cells are true cells.
Artifacts with similar fluorescence, such as on fired cartridge cases
or applied in some fingerprint enhancement methods (see Fig. 3)
[11], can complicate human cell identification. The item’s
background also affects stained cell detection. It would be easier to
decide which are cells, or not, if it is possible to have DD staining of
negative control (cleaned items) to compare the item’s background
and cell characteristics (see Fig. 4). Differentiating cells deposited
by touch from artifacts that have similar fluorescence is a skill and
best learned by building up a repository of reference material.
2.
When applying DD using a pipette, make 1 mL by combining 750 μL
100% ethanol, 248 μL water, and 2 μL 10,000X DD. When applying
DD using an airgun, make 20 mL by combining 15 mL 100%
ethanol, 4.96 mL water, and 40 μL 10,000X DD.
3.
The addition of 0.01% Triton-X to DD made in water can help
release cells from the substrate. Triton-X is a surfactant and may
affect the binding of cells and/or DNA [12].
4.
When pipetting onto a small area, DD can be diluted in water rather
than 75% ethanol.
5.
Many of the papers published note that medium pressure was used
by the digit on the substrate to collect reference material [2, 4–6,
10, 11]. This is not easy to quantify without the use of a pressure-
gauge. The authors note that medium pressure is between light
contact, such as lying the digit on the slide, and heavy pressure,
such as pressing firmly onto the slide.
6. It is easiest to see the cells at lower magnification, such as 50X. The
use of higher magnification, such as 220X, can aid in seeing the
g g , , g
morphology to confirm that the fluorescent “green dots” are most
likely cellular.
7.
Pipetting 5 μL of DD onto the back of a 0.22 cartridge case maybe

be sufficient. More volume may be needed if applying to a credit
card or shotgun cartridge case.
8.
Applying DD solution using the compressed airgun requires only
one covering. Initially, it is better to under-spray rather than to
saturate the item, as it is always easier to add more if there is weak
fluorescence [12].
9.
Fabrics are an example of commonly encountered forensically
relevant items. If the fabric is highly absorbent, then the DD
solution may be absorbed too quickly for the dye to bind to the
DNA [4]. If cells are trapped in the mesh of the fabric, then they will
also not be seen easily using the microscope. Autofluorescence and
absorption are the two major drawbacks to the use of this dye. A
simple option is to collect the cells by removal using a standard
DNA-free tape. The side on which the cells are present can be
stained easily and cell numbers recorded. If autofluorescence is a
problem, then the best option may be to use a different dye, in
which case a microscope with fluorescence capability at different
wavelengths will be needed.
Fig. 3 Staining artifacts. Artifacts on a pre-treated fired cartridge with cyanoacrylate fuming
are shown at 50X fired cartridge cases (left) and a pre-treated photo with green-fluorescent
fingerprint enhancement powder (right) at 220X. The white arrows indicate stained cells
among the fluorescent powder
Fig. 4 Comparison to negative controls. DD staining of a negative control (cleaned items)
compared to touched items is recommended, if it is possible, such as Nickle cartridge case (top),
plastic zip-lock bag (middle) at 50X, and silver-gray color credit card (bottom) at 220X. The
artifacts with similar fluorescence were clearly detected on the cleaned credit card
Acknowledgments
Funding for much of this work came from the Attorney General’s
Department of South Australia via Forensic Science SA. We would like
to thank the Development and Promotion of Science and Technology
Talent Project (DPST), Royal Thai Government Scholarship for
supporting Piyamas (Kanokwongnuwut) Petcharoen. We would like to
thank Dr. Elaine Kellett for proofreading the chapter. We would also like
to thank all the volunteers that participated in these studies.
References
1. Haines A, Linacre A (2016) A rapid screening method using DNA binding dyes to determine
whether hair follicles have sufficient DNA for successful profiling. Forensic Sci Int 262:190–
[Crossref][PubMed]
2. Kanokwongnuwut P, Kirkbride P, Linacre A (2018) Latent DNA detection. Forensic Sci Int
[Crossref][PubMed]
3. Haines A, Tobe S, Kobus H et al (2015) Properties of nucleic acid staining dyes used in gel
electrophoresis. Electrophoresis 36(6):941–944. https://doi.org/10.1002/elps.201400496
[Crossref][PubMed]
4. Champion J, Kanokwongnuwut P, van Oorschot R et al (2021) Evaluation of a fluorescent

dye to visualise touch DNA on various substrates. J Forensic Sci 66(4):1435–1442. https://
doi.org/10.1111/1556-4029.14695
[Crossref][PubMed]
5. Kanokwongnuwut P, Martin B, Kirkbride P et al (2018) Shedding light on shedders.

[Crossref][PubMed]
6. Kaesler T, Kirkbride P, Linacre A (2022) DNA deposited in whole thumbprints: a

reproducibility study. Forensic Sci Int Genet 58:102683. https://doi.org/10.1016/j.fsigen.
2022.102683
[Crossref][PubMed]
7. Kanokwongnuwut P, Martin B, Taylor D et al (2021) How many cells are required for
successful DNA profiling? Forensic Sci Int Genet 51:102453–102455. https://doi.org/10.
1016/j.fsigen.2020.102453
[Crossref][PubMed]
8. Haines A, Linacre A (2019) Detection of latent DNA on tapelifts using fluorescent in situ
detection. Aust J Forensic Sci 51(4):455–465. https://doi.org/10.1080/00450618.2017.
1416174
[Crossref]
9. Kanokwongnuwut P, Kirkbride P, Linacre A (2020) An assessment of tapelifts. Forensic Sci

Int Genet 47:102292–102297. https://doi.org/10.1016/j.fsigen.2020.102292
[Crossref][PubMed]
10. Martin B, Taylor D, Linacre A (2022) Exploring tapelifts as a method for dual workflow STR
amplification. Forensic Sci Int Genet 57:102653. https://doi.org/10.1016/j.fsigen.2021.
102653
11.
Kanokwongnuwut P, Kirkbride P, Kobus H et al (2019) Enhancement of fingermarks and
visualizing DNA. Forensic Sci Int 300:99–105. https://doi.org/10.1016/j.forsciint.2019.04.
035
[Crossref][PubMed]
12. Young J, Linacre A (2020) Use of a spray device to locate touch DNA on casework samples. J
Forensic Sci 65(4):1280–1288. https://doi.org/10.1111/1556-4029.14304
[Crossref][PubMed]
https://doi.org/10.1007/978-1-0716-3295-6_23
23. Rapid DNA Profile Development

with Applied Biosystems RapidHIT™ ID
System
Megan M. Foley1
Megan M. Foley
Abstract
The RapidHIT™ ID System by Applied Biosystems allows the generation
of a CODIS compatible STR profile in 90 min. The preloaded cartridges,
fully automated workflow, and user-friendly computer interface allow
for quick and simple single sample processing both in the laboratory
and outside by non-laboratory personnel, like law enforcement officers.
DNA processing utilizes a direct amplification workflow to generate an
STR profile targeting the CODIS or ESS core loci. In conjunction with the
RapidLINK™ Software, the system performs an initial analysis, flagging
any profiles that do not meet single-source full profile parameters.
Additionally, the RapidLINK™ allows for users to manage a multi-
instrument/multi-location Rapid DNA system and view results in real-
time. This gives users off-site the ability to track and even analyze
results. The system allows for rapid reference sample analysis in
locations like booking stations and national or border security agencies
to obtain quick feedback of database hits for investigative leads while
the subject is still in custody. RapidHIT™ ID DNA systems can also be set
up at sites to aid in victim identification during mass disasters. The
following chapter describes the process of generating a forensic DNA
profile using the RapidHIT™ ID instrumentation from start to finish.
Additionally, basic use and analysis using the RapidLINK™ and
GeneMarker™ HID software is included.
Key words Rapid DNA – RapidHIT™ ID – RapidLINK™ – GeneMarker™

HID – Rapid STR Analysis – FBI DISC – GlobalFiler™ Express –
RapidINTEL™ – NGM SElect™ Express
1 Introduction
1.1 Background
The formation of the Rapid DNA Initiative by the FBI in 2006 led to the
introduction, development, and implementation of Rapid DNA in the
USA. The initiative has allowed forensic DNA analysis to assist law
enforcement agencies by generating investigative information without
the aid of a full crime laboratory. One of the Rapid DNA Initiative’s first
goals was to evaluate commercial instruments that were developed to
perform Rapid DNA analysis to generate a Combined DNA Index System
(CODIS) compatible DNA profile within 2 h. This would allow the
profile to be searched in CODIS against submitted genotypes of
unsolved crimes while the arrestee remains in custody [1–3]. The
RapidHIT™ ID System by Applied Biosystems™ is one of the accepted
platforms that performs a Rapid DNA analysis protocol in ~90 min.
Rapid DNA analysis is defined by the FBI Quality Assurance Standards
(QAS) as “the fully automated (hands-free) process of developing a
CODIS acceptable STR profile from a casework reference sample. The
‘swab in—profile out’ process consists of automated extraction,
amplification, separation, detection and allele calling without human
intervention” [4]. The overall goal of this initiative and implementation
is to use Rapid DNA technologies to solve crimes faster by uploading
and searching arrestee profiles against the database while they are still
in custody. This not only helps solve crimes from the past but also helps
prevent future crimes from occurring by separating these individuals
from society before they are given a chance to evade prosecution or
commit additional offenses [1, 5, 6].
The Rapid DNA Act of 2017 was signed to authorize the FBI to begin
setting standards for the use of Rapid DNA instrumentation outside of
the laboratory in decentralized locations like booking stations. Since
the introduction of Rapid DNA to the forensic field, CODIS has expanded
to allow the upload of arrestee Rapid DNA profiles to search NDIS
within 24 h from upload within qualifying states. Currently, these
profiles can be generated within a booking station or an accredited
laboratory, though not yet by law enforcement outside of these
environments. Additionally, references collected for comparison to
casework and processed using Rapid DNA can be uploaded only by an
accredited lab at this time [7]. This helps alleviate the stress that
current forensic laboratories are facing with the ever-growing number
of cases and samples submitted for analysis [6]. The DNA Index of
Special Concern (DISC) has also been developed to contain profiles
generated from evidence samples from unsolved cases of homicides,
sexual assaults, and kidnapping, as well as from terrorist events. Rapid
arrestee profiles can be searched against the DISC index [1, 7].
Additional applications of Rapid DNA include the use at border
crossings, high DNA quantity crime scene samples for investigative lead
generation, bone fragments and relatives of missing persons from mass
disasters, and human trafficking victims [6, 8–12].
The first generation of the instrument, RapidHIT™ 200, was
developed by IntegenX—now a part of Thermo Fisher Scientific—to
develop an STR profile from 1 to 7 samples in 90 min and was validated
for use on casework [8, 13, 14]. The current generation system, the
RapidHIT™ ID System, is made up of the Applied Biosystems™
RapidHIT™ ID instrument and system software, and the RapidLINK™
Software for data management, consumable tracking, and profile
analysis [8, 15, 16]. The instrument allows for the extraction of swabs
or cuttings of bodily fluid stains, and even bone fragments [9]. Each
sample is analyzed using a single-use sample cartridge and a primary
cartridge that contains all reagents and consumables necessary for
short tandem repeat (STR) analysis through capillary electrophoresis
(CE) for 100 samples. Additionally, each sample cartridge contains an
internal size standard for tandem electrophoresis, which allows for
more accurate allele size determination. The hands-on time with the
instrument is minimal. The sample is loaded into the cartridge and
inserted into the instrument. The computer system is a touch screen
that is user-friendly, requiring minimal typing by the user, and includes
several on-screen prompts and visualizations that can be followed for
each step. The instrument can be accessed through a PIN code but also
can be configured for fingerprint and facial recognition logins. The
system allows for a streamlined workflow for reference samples for a
laboratory, but due to its ease of use and automation, non-laboratory
personnel can utilize these instruments in decentralized locations [8,
15, 16].
1.2 STR Profile Generation on the RapidHIT™ ID

Run time on the RapidHIT™ ID instrument is between 90 and 110 min
depending on the analysis type. Samples can be run on three different
cartridge types, including the RapidHIT™ ID ACE GlobalFiler™ Express
(GFE), RapidINTEL™ (RI), or RapidHIT™ ID ACE NGM SElect™ Express
(NGM) sample cartridges [16]. Both the GlobalFiler™ Express and NGM
SElect™ amplification kits allow the targeting of DNA database core loci,
including CODIS and ESS. This allows for increased potential for data
sharing across borders and reduces adventitious matches by targeting
20+ STRs to increase the discrimination power of the panel [5, 17, 18].
The GFE cartridge is optimized for single source buccal swab-like
samples and allows for optimized data thresholds. The NGM cartridge
is optimized for single source buccal swabs and includes a systematic
allelic library. The RI cartridge is intended for casework type samples
(excluding touch DNA, which is not recommended by Thermo Fisher),
as well as single source blood or saliva samples. Run parameters of the
RI cartridge allow for increased sensitivity in order to optimize the data
generated from casework type samples, especially for investigative lead
purposes. The RI run utilizes the same cartridges as the GFE run
targeting GlobalFiler™ STR loci, but modifications have been made in
the processing [16, 19]. See Table 1 for additional parameter
differences between the GFE and RI cartridges. The RI cartridge can
also be used for bone samples. Bone fragments can be collected through
various methods and placed into the sample cartridge for analysis [9].
Table 1 Run parameters of sample cartridges
System GlobalFiler™ Express RapidINTEL™
specification
Validated sample Single source buccal Casework single source blood or saliva
types swabs samples
Lysis buffer volume 500 μL 300 μL

Thermal cycling Initial denaturation: Initial denaturation:
95 °C for 60 s 95 °C for 60 s
28 cycles of: 32 cycles of:
94 °C for 3 s, 94 °C for 3 s,
61 °C for 30 s, 61 °C for 30 s,
61.5 °C for 30 s 61.5 °C for 30 s
Final extension: Final extension:
60 °C for 480 s 60 °C for 480 s
Injection 8 s, 5 kV 8 s, 5 kV
Run time 90 min 95 min
Run parameter comparison between the GlobalFiler™ Express cartridge

and the RapidINTEL™ Cartridge [16, 20, 22]. This table compares the
validated sample types for each cartridge, as well as extraction,
amplification, and electrophoresis parameters
The sample cartridges allow for a single run and contain a slot for
sample introduction. All reagents needed for extraction and
amplification are housed in the sample cartridge. Through the use of
microfluidic technology, the cell lysis reagents are pumped into the
sample chamber for extraction. The primary cartridge contains Prep-N-
Go™ Buffer by Applied Biosystems™, which lyses cells and nuclei to
release the DNA into solution. The sample is heated at 75 °C in 500 μL
of buffer for 10 min. The DNA workflow follows a direct amplification
procedure [8, 20, 21]. The Prep-N-Go™ Buffer is a reagent commonly
used in direct amplification systems and workflows in order to
streamline testing of high quantity samples by eliminating the isolation
and purification steps of extraction and quantitation [6, 20–22]. The
volume of the lysis buffer used for incubation is dependent on the
cartridge type (see Table 1).
Using the microfluidic system, primers and an amplification reagent
mix are added to the lysate. The mixed liquid is pumped to the PCR
chamber of the sample cartridge where amplification occurs.
Components of the amplification are optimized for direct amplification.
Optimization focuses on performing an efficient amplification in the
presence of the inhibitors still present in the sample. There are various
changes that can be made to amplification components for a successful
direct amplification. First, the DNA polymerase can be modified.
Examples of polymerase modifications include enhancing the affinity
for binding to DNA and increasing the tolerance in the presence of
inhibitors. Additionally, alternative polymerases have been developed
to allow faster binding to nucleotides with an increase in accuracy
which results in a decrease in the number of binding events needed for
elongation and a decrease in error rates [23–27]. Adjusting
components or parameters of buffers is another modification that
direct amplification kits can implement [28]. For example, increasing
the pH of buffers can help overcome the presence of inhibitors. One
technology looked at increasing pH of the solution, which led to a
change in the net charge of the protein inhibitors. Because the charges
were more negative, this resulted in weakening or even suppressing the
attraction between the proteins and the negatively charged DNA [29].
Within the PCR chamber is a small paper disc that traps the lysate in
place. The chamber holds about 12 μL, and equal parts of the reaction
and primer mix are added to the sample for amplification [8, 21]. The
GlobalFiler™ Express cartridge targets the following loci: D3S1358,
vWA, D16S539, CSF1PO, TPOX, D8S1179, D21S11, D18S51, D2S441,
D19S433, TH01, FGA, D22S1045, D5S818, D13S317, D7S820, SE33,
D10S1248, D1S1656, D12S391, D2S1338, Amelogenin, DYS391, and Y-
indel [22]. The NGM SElect™ Express cartridge targets the following
loci: D10S1248, vWA, D16S539, D2S1338, Amelogenin, D8S1179,
D21S11, D18S51, D22S1045, D19S433, TH01, FGA, D2S441, D3S1358,
D1S1656, D12S391, and SE33 [30].
The capillary and the gel polymer are housed within the primary
cartridge for capillary electrophoresis. Within the unit, there is a six-
dye detection window in order to capture the dye-labeled amplified
fragments [5, 16]. An internal size standard is contained within the
sample cartridge and is pumped into the PCR chamber with the
amplicon after amplification. The DY632 500 base size standard is run
with each sample to determine the base size of each sample peak, with
the inclusion of additional oligonucleotide fragments for greater
accuracy. Before injection into the capillary, the amplicon/size standard
mix passes through a denaturation zone that is heated to 95 °C to
ensure that single stranded DNA is injected [8]. Allelic ladders are
either processed when a new primary cartridge is installed and added
to an internal ladder library (GFE and RI cartridges) or are compared to
the sample based on an empirical allelic ladder library housed within
the system (NGM). The allelic ladders stored in the system show a
variety of run migrations to account for any migration variables that
can occur during sample runs, which allows for more accurate and
reproducible genotyping results. The variables are based on different
temperatures and gel ages that a sample could be run on to generate an
appropriate model to apply to interpretation [16, 18, 19].
1.3 STR Profile Generation on with the RapidLINK™

Software
After a run has been completed, the instrument performs a primary
analysis on the sample, focusing on the quality of the profile and
passing parameters predetermined by Thermo Fisher through a
multicomponent analysis [8, 15]. The system looks at the genetic profile
for information including peak height ratios, stutter peak percentages,
mixture indicators, etc. to determine a quality score that can be used by
the analyst as a quick review of success of a sample. The primary
analysis employs thresholds per locus using a receiver-operator curve
[8]. Data is viewed on the RapidLINK™ Software, which allows for quick
analysis and review of the DNA profile. The software also acts as an
interface for data management for all instruments within one
laboratory or Rapid DNA department system. The RapidLINK™
Software is embedded with the analysis software GeneMarker™ HID
STR Human Identity Software by SoftGenetics®. GeneMarker™ contains
panels for all three run types with preloaded analysis settings that each
laboratory can validate [16].
The RapidLINK™ Software includes applications for sample
matching, internal database searching, kinship analysis, and familial
searching, and can house an elimination database of staff members. The
sample matching application performs match statistics on two profiles
to determine the likelihood that they are from the same contributor.
Calculations that can be performed are the combined probability of
concurrent alleles using formulas from the American Association of
Blood Bank (AABB) and likelihood ratios at the locus and genotype
level using Identity by Descent formulas with allelic frequencies
published by NIST. Familial matching searches the database for possible
familial relations of a selected sample based on set search parameters.
The kinship application searches and calculates likelihood ratios for
specific relations within the database, including parent-child, sibling,
grandparent-grandchild, cousin, and uncle/aunt-niece/nephew [15].
2 Materials
2.1 Consumables
1.
Sterile cotton swab(s) (see Note 1).
2.
FTA card(s) (see Note 1).
3.
FTA card punch tool and mat.
2.2 RapidHIT™ ID Kits

1.
RapidHIT™ ID Primary Cartridge GlobalFiler™ Express (see Note
2): 100 sample kit. Box 1 contains the Primary Cartridge
(GlobalFiler™ Express 100) and the Utility Cartridge (for primary
cartridge replacement); store at room temperature (15–30 °C). Box
2 contains the Gel Cartridge (for primary cartridge replacement),
the ACE GlobalFiler™ Express control cartridge, and the RapidHIT™
ID ACE GlobalFiler™ Express positive control cartridge; store at 4–
10 °C.
2. RapidHIT™ ID Primary Cartridge NGM SElect™: 100 sample kit. Box
1 contains the Primary Cartridge (NGM SElect™ Express 100) and
the Utility Cartridge (for primary cartridge replacement); store at
room temperature (15–30 °C). Box 2 contains the Gel Cartridge (for
primary cartridge replacement), the NGM control cartridge, and the
NGM Express positive control cartridge; store at 4–10 °C.
3.
Sample Cartridges: Contents are specific to cartridge type. Each kit
type contains 50 sample cartridges, two positive control cartridges,
and two negative control cartridges. The RapidHIT™ ACE
GlobalFiler™ Express Kit, RapidHIT™ ACE NGM SElect™ Express Kit,
or RapidINTEL™ Kit.
2.3 Equipment
1.
RapidHIT™ ID Instrument.
2.
RapidLINK™ Software.
3.
Barcode Scanner: must be compatible with GS2–128, Industrial 2 of
5, Interleaved 2 of 6, Code 128, or Code 39 (see Note 3).
3 Methods
Before beginning the method, ensure that all reagents are within
expiration and that all necessary equipment and consumables are
stocked. Prepare all worksheets with appropriate information, e.g.,
sample names, elution volumes, etc. Hair nets, a face mask, and gloves
must be worn throughout this procedure, changing gloves when
necessary.
3.1 Set-Up of a Sample Run on the RapidHIT™ ID System

1.
Prepare or collect the sample to be analyzed (buccal swabs,
blood/saliva references on FTA cards, fabric cuttings, etc.).
2. Login to the RapidHIT™ System (see Note 4). If the instrument
screen is off, press the circular power button located on the
bottom right side on the front of the instrument (see Fig. 1,
labeled as “i.”). When the instrument has fully turned on, the
button is a blue color. It is green when idle (see Note 5). Tap the
“Lock” screen in the center (see Fig. 2a for a visual of the lock
oc sc ee t e ce te (see g a o a v sua o t e oc
screen). Sign in using the method chosen during configuration
(facial recognition, fingerprint scanning, or PIN). To configure the
sign-in methods, see Subheading 3.5, step 4.
3.
To use the facial recognition, stand in front of the camera at the
top left of the instrument (see Fig. 1, labeled as “ii.”). To use the
fingerprint reader, press the appropriate finger onto the scanner
under the screen (see Fig. 1, labeled as “iii.”). To use the PIN, press
the “Lock” screen and press the keypad icon in the lower part of
the screen and then the pointer icon (hand with an arrow) in the
upper right corner (see Fig. 2b). This allows typing on the screen.
Select the appropriate username from the dropdown and enter
the PIN using the keypad.
4.
Once successfully logged in, the username briefly appears, and
then the screen switches to the “Sample Identification” screen (see
Fig. 2c) (see Note 6).
5.
Fill out the appropriate sample information either through
barcode scanning (see Subheading 3.1, step 6) or manual entering
(see Subheading 3.1, step 7). If the “Sample Identification” screen
has disappeared, click the back arrow button until visible (see
Note 7).
6.
For the scanning method, the barcode present on the sample
packaging can be scanned one of two ways. First, if the laboratory
has a barcode scanner configured, scan the barcode using the
scanner (see Note 3). Second, using the camera in the front left
side of the screen, hold the sample package with the barcode
facing the camera. Once recognized by the instrument, the
barcode is displayed on the instrument.
7.
To manually enter a sample, press the “Sample ID” screen and then
the keypad icon to begin typing. Type the sample ID name or the
barcode on the sample package. Then press “ENTER”. The entered
sample ID name/number is visible on the screen. Verify that this
is correct before continuing (see Note 8).
Remove a sample cartridge from storage and open the small cap
Remove a sample cartridge from storage and open the small cap
8. that opens to the swab chamber. Insert the sample swab to be
processed (cotton tip down) all of the way into the sample
cartridge and close (see Note 9). The screen displays a
visualization of this action (see Fig. 2d). If the sample is a cutting
of a swab, FTA card punch, or other material, place it into the
chamber, and use a sterile clean cotton swab to push it down to
the bottom. Do not remove the swab (see Note 10).
9.
After the sample ID has been loaded, the “Insert Cartridge” (see
Fig. 2e) screen appears with a picture of the sample cartridge and
a white arrow toward the instrument. Load the loaded sample
cartridge, caps toward you and flat side down, into the “Sample
Cartridge Port” above the screen (see Fig. 1, labeled as “iv.”) (see
Note 11). The run begins automatically as soon as the sample
cartridge is inserted correctly.
10.
The run lasts between 90 and 110 min (see Note 12). For the
RapidHIT™ ID ACE GlobalFiler™ Express and NGM SElect™
Express cartridges, the run lasts ~90 min. For the RapidINTEL™
cartridge, the run lasts ~95 min.
11.
The cartridge must remain in the instrument until prompted to be
removed after the run has finished. During the run, a clock shows
the time remaining and automatically stops when finished. The
run stops before the timer reaches “0”.
12.
Once the run is finished, the current “Sample Cartridge” screen is
visible for 30 s only, and then the instrument logs the current user
out of the system. If logged out, log back in before moving on to
the next step.
13. Remove the cartridge from the instrument when the screen is
displaying the “Remove Sample Cartridge” screen, which displays
the cartridge with a white arrow leading away from the
instrument (see Fig. 2f). Pull the cartridge straight out at the same
angle it was inserted (see Note 13). Discard the used cartridge
when finished in an appropriate biohazard container. Retain the
swab if required by the laboratory guidelines (see Note 14).
14.
The “Result” screen appears with the sample name and an
indication of the quality of the results generated (see Table 2).
Press the “DONE” button under the quality status to dismiss. The
software automatically logs out and locks (see Note 15).
Fig. 1 The RapidHIT™ ID System. (i) Power Button; (ii) Camera; (iii) Fingerprint reader; (iv)
Cartridge Port; (v) USB Port. (Reproduced from Ref. [16]. Figure owned by Life Technologies
Fig. 2 Various RapidHIT™ ID screen prompts. (a) Lock screen; (b) Login screen; (c) Sample
Identification screen; (d) Add Sample screen; (e) Insert Sample Cartridge screen; (f) Remove
Sample Cartridge screen; (g) Remove Primary Cartridge; (h) Insert Primary Cartridge.
(Reproduced from Ref. [16]. Figure owned by Life Technologies Corporation, a part of Thermo
under permission)
Table 2 RapidHIT™ ID profile results
RapidHIT™ Definition
ID results
RapidHIT™ Definition
ID results
Green check Profile was generated with no quality flags. The profile can be analyzed in
mark RapidLINK™.
Yellow check Profile was generated with some quality flags or only size standard was
mark detected. The profile can be analyzed in RapidLINK™.
Red “X” No allelic peaks or size standard peaks were observed. No profile was
detected. The profile is not analyzed in RapidLINK™.
RapidHIT™ ID indicates the quality of a profile based on pre-

determined settings. Profile information evaluated includes presence of
alleles, possible presence of a mixture, and size standard results
3.2 Viewing and Exporting the Results in the RapidHIT™ ID

Software
1.
To review the quality results on the RapidHIT™ ID instrument after
the software has been logged out, log back in (see Subheading 3.1,
step 2), and press the menu icon. Once in the menu section, click
the run data icon located on the right side of the top row (icon
contains a folder with a strand of DNA; see Fig. 3). From this
location, the quality status of a run can be viewed along with the
user who performed the run and the date/time of the run.
2.
To export sample data, insert a USB into the USB port located on
the front left side of the bottom of the instrument under the screen
(see Fig. 1, labeled as “v.”). Press the menu icon, followed by the run
data icon. All previous runs and the run statuses are displayed on
the screen. Select the run(s) to be exported. Press the “Export”
button, which automatically transfers a copy of the run file to the
USB device inserted (see Note 16).
3.
All runs can be exported at once if the user signed in has
administrator or supervisor rights.
4.
To sign out, press the back arrow button until the sign-out lock icon
is available. Press the lock icon to sign-out.
Fig. 3 Menu screen highlighting the Primary Cartridge Icon. (1) Primary Cartridge; (2) Run
Data; (3) Settings; (4) Users. (Reproduced from Ref. [16]. Figure owned by Life Technologies
3.3 General Instrument Usage and Maintenance

1.
The instrument must be run, at a minimum, every 7 days. If a run
has not been performed that week, perform a sample cartridge run
(see Subheading 3.1, step 1). This can be done either with a blank
swab or a known control swab for performance check purposes.
2.
Clean the surfaces of the instrument as needed following the
laboratory decontamination procedure.
3.
Clean the screen as needed with a glass cleaner and disposable
laboratory wipe. This should only be performed when the internal
computer is off.
4. Routinely power off the internal computer and restart the system;
this can also be done on an as-needed basis. Press the power
button on the front of the instrument and hold until the computer
switches off. Turn off the main power switch at the back of the
instrument. Let sit for a few minutes. Power on the main switch
first then power on the internal computer (see Note 17)
first, then power on the internal computer (see Note 17).
5.
Periodically check the run statistics of the current primary

cartridge to determine if it needs to be replaced (see Note 17). To
do this, log in and view the “Sample Identification” screen (see
Subheading 3.1, steps 2–4). Select the option to view the remaining
run count of the primary cartridge (see Fig. 2c, bottom middle
icon). If needed, click the back button until displayed. The primary
cartridge and gel need to be replaced if any of the following occur:
the outer circle of the gel volume icon is red, the gel or primary
cartridge has expired, or the number of runs remaining has
reached zero (see Note 18 and Subheading 3.4, step 1).
3.4 Replacing the Primary Cartridge

1.
Replacing the primary cartridge takes ~5 h total, including
control runs.
2.
To change the primary cartridge, prepare the appropriate
reagents and let all components come to room temperature. This
includes a new unexpired primary cartridge (see Note 19), the
provided gel cartridge, the three control cartridges, and the
provided utility cartridge. Once logged in and on the “Sample
Identification” screen (see Subheading 3.1, steps 2–4), open the
“Menu” screen (see Fig. 2c, bottom left icon) and press the
primary cartridge button (see Fig. 3, top middle icon). A pop-up
screen appears prompting the user to confirm: “Do you want to
eject the primary cartridge?” Press “Yes”.
3.
The instrument displays a step-by-step series of prompts with
pictures to instruct the user on the appropriate procedure for
each step (see Fig. 4). Press the number on the screen that is
associated with the current step to see a visualization of the
procedure.
4. Pressing “1” on the screen instructs how to remove the shipping
plug on the check valve of the primary cartridge (see Fig. 5). A
p g p y g ( g )
small arrow can be visualized around the valve on the cartridge
and the plug is white in color next to the gel cartridge slot. Turn
the plug 90 degrees counterclockwise following the direction of
the arrow and remove it from the cartridge. Press “DONE” at the
bottom of the screen once this step has been completed.
5.
Pressing “2” on the screen instructs how to remove another white
shipping plug from the primary cartridge; this is visible toward
the front of the cartridge that leads to the cathode block (see Fig.
5). Unscrew counterclockwise and remove the plug. Press “DONE”
at the bottom of the screen once this step has been completed.
6.
Pressing “3” on the screen instructs how to remove the shipping
plug out of the gel cartridge inlet. This plug should be pulled
straight out. Do not twist as it is removed (see Note 20). Press
“DONE” at the bottom of the screen once this step has been
completed.
7.
Pressing “4” on the screen instructs how to insert the gel cartridge
into the primary cartridge (see Fig. 5). The newly exposed tip of
the gel cartridge should face the inlet on the primary cartridge
with the other end facing the square marker at the top. Do not
twist the cartridge in any direction. The black window of the gel
cartridge should be facing up. An audible click can be heard when
inserted completely. Press “DONE” at the bottom of the screen
once this step has been completed.
8.
Pressing “5” on the screen instructs how to remove the shipping
cover over the capillary from the primary cartridge; this is located
on the back side of the cartridge (see Fig. 5). Press the brackets
inward and remove the cover by slowly raising the end with the
brackets upwards and away from the capillary (see Note 21).
Press “DONE” at the bottom of the screen once this step has been
completed.
9.
The cartridge prep is now complete. A timer starts (~9 min).
During this time, the instrument begins to disengage the used
primary cartridge in the instrument.
10. The next screen shows proper insertion of the utility cartridge
(red label) into the instrument. Remove the utility cartridge from
the packaging. By holding the red part of the cartridge, insert the
utility cartridge so the flat side is down and the red tag is facing
outwards. The utility cartridge is blank and pumps fluids through
the system. This lasts about ~5 min.
11.
About 3 min into the countdown, the screen switches to the
“Remove Primary Cartridge” screen, which displays the cartridge
in blue with a white arrow pointing away from the instrument
(see Fig. 2g). Pull the used primary cartridge out of the bottom of
the instrument by sliding it out. The screen changes to the “Insert
Primary Cartridge” screen, similar to the previous screen but with
the arrow pointing inwards (see Fig. 2h). Before inserting the
primary cartridge, remove the allelic ladder, positive, and negative
control cartridge from the packaging.
12.
To insert the prepared primary cartridge, press the newly
prepared cartridge into the instrument as displayed on the screen.
Press in gently to avoid hitting the capillary on any part of the
instrument. Once fully inserted, the instrument starts a full run
(~90 min).
13.
Once the utility cartridge run is complete, the screen prompts the
user to remove the utility cartridge by displaying the “Remove
Utility Cartridge” screen, with the arrow pointing away from the
instrument.
14.
Next, run the controls—allelic ladder, positive control, and
negative control—as described (see Subheading 3.4, steps 15–
18). The controls are processed like regular samples; therefore,
the screen displays the run status checkmarks when finished (see
Table 2).
15. First, perform an allelic ladder control run (see Note 22). Open
the “Sample ID” screen. Insert the allelic ladder cartridge (see
Note 23). The software immediately assigns the sample ID as
“LADDER” by scanning the associated RFID tag on the cartridge.
Process the allelic ladder (~60 min). Once complete, review the
Process the allelic ladder ( 60 min). Once complete, review the
results; ensure that a green check mark was obtained (see Note
24). Remove the allelic ladder cartridge when prompted by the
instrument through the display of the “Remove Allelic Ladder
Cartridge” screen.
16.
Next, run the positive control cartridge to ensure proper
migration of DNA fragments. Open the “Sample ID” screen. Insert
the positive control cartridge (see Note 23). The software
immediately assigns the sample ID as “POSCTRL” by scanning the
associated RFID tag on the cartridge. Process the positive control
(~90 min). Once complete, review the results; ensure that a green
check mark was obtained (see Note 24). Remove the positive
control cartridge when prompted by the instrument.
17.
Last, run the negative control cartridge to ensure no
contamination has occurred in the system or reagents. Open the
“Sample ID” screen. Insert the negative control cartridge (see Note
23). The software immediately assigns the sample ID as
“NEGCTRL” by scanning the associated RFID tag on the cartridge.
Perform the negative control run (~90 min). Once complete,
review the results; ensure that a green check mark was obtained
(see Note 24). Remove the negative control cartridge when
prompted by the instrument.
18.
Once all three control types have received a green check mark,
dispose of all of the used cartridges appropriately.
Fig. 4 Primary Cartridge Replacement screen prompts displayed on the RapidHIT™ ID. The
display shows the prompt for Step 1 of the replacement procedure to remove the shipping
plugs from the primary cartridge. (Reproduced from Ref. [16]. Figure owned by Life
Technologies Corporation, a part of Thermo Fisher Scientific Inc. (www.thermofisher.com). ©
2023 Thermo Fisher Scientific Inc. Used under permission)
Fig. 5 The primary cartridge. (1) Capillary; (2) Gel Cartridge; (3) Shipping Plug; (4) second
Shipping Plug. (Reproduced from Ref. [16]. Figure owned by Life Technologies Corporation, a
part of Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific
Inc. Used under permission)
3.5 RapidHIT™ ID Software Configuration (Only for

Supervisor and/or Administrator Login)
1.
After logging into the instrument (see Subheading 3.1, steps 2–4),
press the “Menu” icon from the “Sample Identification” screen (see
Fig. 2c, bottom left icon). Once in the menu, click the “Settings” icon
(icon with gear; see Fig. 3, labeled as “3”).
2. The Settings menu offers several items of information (e.g., the
name of the removable drive, if inserted; the IP address of the
RapidLINK™ Software; current data and time; etc.). There are
several settings that can be configured from this menu, including
backup/ restore/recovery options, enabling/disabling the
connection to the RapidLink™ Software, changing the software’s IP
address, providing contact information, allowing for double sample
entry, setting the date and time, etc. Refer to Table 3 to see which
user role has permission to configure specific settings.
3.
Add, delete, or manage users by pressing the “Manage Users” icon

—outline of two people and the settings gear (see Fig. 3, labeled as
“4”) (see Note 25). To add a user, press the add user icon located on
the bottom row on the left (icon contains one person with a plus
sign). Fill out the appropriate information for the user—including
user role (either supervisor, admin, or operator) and name—and
press “ENTER”. The permissions of each user role are described in
Table 3 (see Note 26).
4.
The next screen prompts the user to choose which identification
method (face recognition, fingerprint scan, or password/PIN)
should be prompted during login. To scan the user’s face for the
face recognition option, stand in front of the instrument camera in
the center of the view (see Fig. 1). To configure a user’s fingerprint
for the fingerprint scan option, press the designated finger onto the
finger pad on the front of the instrument (see Fig. 1). The
instrument instructs the user to press the appropriate finger
multiple times until it has been fully captured and stored. To
configure a password/PIN, type in the appropriate PIN (must be six
characters). The instrument prompts the user to enter the PIN
twice.
5.
Additionally, an email or phone number can be added for
messaging from this screen by pressing the icons at the bottom,
“EMAIL ID OR SMS”.
6.
Press the save icon (floppy disc icon). Once the profile has been
saved, a large blue check mark is displayed with the lettering “PIN
SUCCESSFULLY CREATED”. Press “DONE” to close the screen.
7.
Once saved, the user’s profile can be updated by going into the
“Manage Users” menu and choosing the specific user.
8. A user can be deleted from an instrument via the RapidLINK™
Software (see Subheading 3.6, step 22). The instrument must be
connected to the network in order to disable user access to that
particular instrument
particular instrument.
Table 3 The permissions of each user role in the RapidHIT™ ID software
The ability to change/update parameters and information in the

RapidHIT™ ID instrument is based on the role of the user
3.6 Analyzing Samples in RapidLINK™

1.
To open the RapidLINK™ Software, double-click on the DNA icon
on the desktop. The first screen includes a list of the instruments
within the system. From this screen, various information can be
viewed and/or a variety of functions can be performed.
2. To view the instrument list, click the “Instrument” icon—the first
icon at the top of a map with a pin (see Fig. 6, labeled as “i.”). Here,
the different instruments can be managed and viewed in either a
the different instruments can be managed and viewed in either a
list format (default) or a map. Information regarding errors,
temperature, humidity, or connectivity can be reviewed. To
change the default display to a map view from this screen, click
the “Settings” icon (two gears) and select the “Show map view”
checkbox at the bottom of the screen.
3.
From the map, choose a pin based on the location of the
instrument(s) and choose the specific instrument to view. If the
pin is green, all instruments at this site are online, yellow is >51%
are online, red is >51% are offline or inactive, and gray is inactive.
Instruments offline are colored in red. Instrument errors/out-of-
range settings also show next to the appropriate instrument icon
(stethoscope appears).
4.
The user is able to monitor a specific instrument by clicking on
the instrument name through either the list or map format. By
clicking on the “Open screen viewer” icon (top left), the user can
view the live screen of that specific instrument. Click “X” to exit.
5.
To generate a run summary report for this instrument, one of
three report options can be chosen—“Export to PDF”, “Export to
CSV”, or “Custom Report”. Custom report allows the user to select
parameters including runs by instrument and/or user, runs by run
status, runs by location, and runs by date.
6.
To generate an audit report, click the “Audit” icon at the top left of
the screen. This can be printed or saved as a .pdf.
7. To view the DNA profile library results, click the second icon at the
top of a folder with a DNA helix (see Fig. 6, labeled as “ii.”). Here,
the list of runs can be searched or filtered to find the appropriate
run using the filters at the top of the screen, current run status, or
by typing in the run name. Each sample/control has an associated
status for review based on the automatic analysis performed by
GeneMarker™ HID. Only samples with green checks are added to
the database for matching. There are six status possibilities:
“Pass”, “Requires Review”, “Pass with Review”, “Reviewed”, “Fail”,
or “Uploaded to CODIS” (see Fig. 7).
8.
The user is able to view each sample that has been uploaded to
the Match database. By clicking on the “DNA” icon (two DNA
strands in the column next to sample ID), a match report is
generated showing DNA profiles that match the current sample
selected. The report includes information regarding the run and a
likelihood ratio for each locus. The match settings can be adjusted
by pressing the “Settings” icon. Settings that can be adjusted
include minimum number of matching loci, maximum number of
allowed mismatches, minimum stringency match percentages,
and the allelic frequency table used (see Note 27).
9.
The last column of the DNA profile library screen indicates if a
sample has matched a profile stored in the Staff Elimination
Database.
10.
The user can also generate a run summary report for this
instrument within the DNA profile library screen. One of three
report options can be chosen: “Export to PDF”, “Export to CSV”, or
“Custom Report”. Custom report allows the user to select
parameters, including runs by instrument and/or user, runs by
run status, runs by location, and runs by date.
11.
To perform profile matching, click the third icon at the top with
two DNA helices (see Fig. 6, labeled as “iii.”). This function
performs match statistics on two profiles.
12.
To perform familial searching, click the fourth icon at the top with
an outline of three people (see Fig. 6, labeled as “iv.”). From this
application, choose the sample to be searched. To focus the
search, the “Relationship” and “Gender” fields can be updated.
Within the settings, the allelic frequency table and the likelihood
ratio threshold can be specified (see Note 27).
13. To perform kinship analysis, click the fifth icon with a pedigree (see
Fig. 6, labeled as “v.”). From this application, choose the samples to
be compared. Drag the sample into the relation location in the
pedigree on the right side of the screen. Click the “Report” icon at
the bottom of the screen on the left which includes a likelihood
the bottom of the screen on the left, which includes a likelihood
ratio of the comparison and a probability of relationship. Within
the settings, the allelic frequency table can be specified.
14.
To view the staff elimination database, click the last icon of a DNA
helix crossed out (see Fig. 6, labeled as “vi.”). From this
application, match settings can be adjusted in the “Settings” icon.
Settings include minimum number of matching loci, maximum
number of allowed mismatches, high stringency match
percentage, moderate stringency match percentages, likelihood
ratio threshold, and the allelic frequency table used (see Note 27).
15.
To import a profile into the staff elimination database, click the
“Import” icon. Specific formats are needed for .txt and .csv files
(see Subheading 3.6, steps 16 and 17, respectively). Select the file
type the profile is saved as (see Note 28) and click “Open”.
16.
For .txt files, the first line/row includes the column headers. The
first column header must be “NAME”. The remaining column
headers include the locus names (order doesn’t matter). The
second line/row includes the sample name (first column) and
alleles for each locus in the corresponding columns (e.g., 12,13 in
the same cell with no spaces). Homozygous alleles only need to be
entered once, for example, “16”.
17.
For .csv files, the first line/row includes the column headers. The
first column header must be “NAME”. The remaining column
headers include the locus names, but these must be listed twice
for each locus (see Note 29). The second line/row includes the
sample name (first column) and alleles for each locus in the
corresponding columns, with only one allele listed per cell
(homozygous alleles are only typed once).
18.
For profiles generated on the RapidHIT™ ID: Find the appropriate
.xml file in the run folder and click “Open”.
19. To remove a profile, select the profile from the list and click the
“Delete” icon (trash bin).
20.
To view a snapshot of runs performed over the previous 2 weeks,
review the “Runs Per Day” graph at the bottom of the screen (see
Fig. 6, labeled as “vii.”). The value of each bar is the number of
runs performed that day for all instruments on the network. The
color is based on the quality statuses for each run—blue for green
or yellow check marks and red if a red “X” was called. By clicking
on each bar, the user can view the runs per hour.
21.
To view a snapshot of the consumables remaining, review the
“Consumables Remaining” graph at the bottom of the screen (see
Fig. 6, labeled as “viii.”). The number of runs left for each primary
cartridge can be viewed, as well as an estimated date for cartridge
replacement. The estimated date is based on the average usage of
that specific instrument over the past 20 days. The color of the bar
indicates how many runs are remaining—white if >30 runs and
red if ≤30.
22.
To view the status and configuration of each instrument, click on
the “Settings” icon on the left of the screen (see Fig. 6, labeled as
“ix.”). A new window with a list of instruments opens. Click on the
“Instrument” icon to display the instrument details. From here, a
variety of tasks can be completed, including adding an instrument
site, displaying sensor information, editing instrument
information, and/or adding a site location.
23.
To add an instrument to a site (see Note 30), click on the site and
then the plus sign at the bottom of the screen. Enter the
instrument’s serial number, host name, and location. Click “Save”.
Display sensor information of a specific instrument and make an
instrument inactive by clicking on the appropriate box.
Information about an instrument can be edited by clicking the
“Edit” icon (pencil icon). Once the information has been changed,
click “Update” to save the changes.
24. Click the plus sign at the bottom of the screen to add a new
location. The name of the site (“Enter Location field”) and address
or latitude/longitude (see Note 31) must be entered in their
appropriate fields Click “Save”
appropriate fields. Click Save .
25.
To view user settings, click the “User Settings” icon—outline of two
people and the settings gear (see Fig. 6, labeled as “x.”). The user
can visualize all current users and their privileges. To edit a user’s
access, click on the user name and the instrument. Use the arrows
to move instruments into the “Authorized” or “Unauthorized”
boxes (see Note 32).
Fig. 6 The RapidLINK™ home screen. (i) Instrument List; (ii) DNA Profile Library; (iii) Profile
Matching; (iv) Familial Searching; (v) Kinship Matching; (vi) Employee Database; (vii) Runs Per
Day; (viii) Consumables Remaining; (ix) Instrument Details; (x) User Settings. (Reproduced
from Ref. [15]. Figure owned by Life Technologies Corporation, a part of Thermo Fisher
Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc. Used under
permission)
Fig. 7 List of current status options of a RapidHIT™ ID profile in the RapidLINK™ Software.
Pass—passed initial quality review; Requires Review—received a yellow check from the initial
quality review; Pass with Review—analyst passed the sample after review; Reviewed—analyst
applied the setting; Fail—failed RH quality review; Uploaded to CODIS—analyst applied setting.
(Reproduced from Ref. [15]. Figure owned by Life Technologies Corporation, a part of Thermo
under permission)
3.7 Secondary Analysis with GeneMarker™ HID

1.
GeneMarker™ can be opened one of two ways. The first is through
opening the GeneMarker™ HID software. Open the run folder that
has been exported via a network or USB drive. Select the “GM
Analysis” file in the run folder. This automatically opens
GeneMarker™ HID.
2. The second way to open GeneMarker™ is through the RapidLINK™
Software. Open the software. Select the DNA profile library icon
(see Fig. 6, labeled as “ii.”) from the Main Menu. This opens a list of
all runs saved on the instrument the user is logged into. Find the
appropriate run and double-click the sample ID to be analyzed.
This automatically opens GeneMarker™ HID. If the run was
performed on an instrument at a different location open the
performed on an instrument at a different location, open the
managing instrument icon (see Fig. 6, labeled as “i.”), and choose
the appropriate site pin. This generates a list of instruments at
this site. Choose the appropriate instrument, which displays all
runs performed on the chosen instrument. Double-click the
sample ID to be analyzed. This automatically opens GeneMarker™
HID.
3.
When GeneMarker™ HID is opened, the screen displays the raw
electropherogram of the sample ID chosen with overlapping dyes
(see Fig. 8).
4.
Analysis preferences should be updated based on the laboratory’s
validation of the instrument and software before analyzing
samples (see Note 33). Steps to update analysis preference
settings for GlobalFiler™ Express are outlined in Table 4.
5.
To access the analysis preferences, click “View” from the toolbar
and select “Preferences…” from the drop-down. When finished
setting the parameters, click “OK”. Once the analysis preferences
for a particular method have been set, this step should not have to
be performed for future analysis.
6.
Next, the samples can be analyzed. First view the quality flags of a
sample. Click the “Show Chart/Table” icon (see Fig. 8, labeled as
“i.”). The screen displays a table that includes allele calls, base pair
size, relative fluorescent units (RFU) values, and quality reasons
for flags. If viewing the electropherogram, the flagged alleles are
highlighted in yellow. To confirm an allele that has been flagged,
right-click the allele and select “Confirm” (or Ctrl+M) from the
drop-down. The allele is now marked as “E” in the
electropherogram.
7. To review the remaining allele calls, select the icon “Browse by All
Color” (see Fig. 8, labeled as “ii.”) that pictures an EPG with the
dyes separated. At this point, the analyst can toggle between
samples and controls using the up and down arrows on the right
side of the screen. To zoom into a peak, left-click the mouse/pad
and drag the box over the area to be viewed (must go from upper
left to lower right) To zoom out perform the same action but
left to lower right). To zoom out, perform the same action but
from lower right to upper left. View each locus by scrolling the
screen or choose a specific marker using the “Marker” drop-down
menu listed on the toolbar (furthest to the right).
8.
If an artifact is identified, it can be deleted by right-clicking on the
peak and choosing “Delete” from the menu (or the Del button on
the keyboard). At this time, the peak displays with an “X” above
the apex and is displayed as such in the chart/table. Comments
can be added to an allele by the “Edit Comments” in the drop-
down. To edit a peak, right-click and choose “Edit Allele” from the
menu. An “Edit Allele” box appears and information can be
updated. The peak then displays an “E” above the apex and is
displayed as such in the chart/table.
9.
To save edits, open the drop-down list on the right side of the
screen at the top, and choose the correct .fsa file. Close the
window “All Color Browser” by clicking the “X” at the top right
corner of the screen. From the main screen, click the “Save Peak
Table” icon (three icons to the right of the Marker drop-down).
Open the “REQUIRES ANALYST REVIEW” folder within the run
folder. From the “Save as type:” drop-down, choose “Text File
(*.txt)” and click the “GM_Analysis_PeakTable.txt” file. A pop-up
appears asking if the user wants to override the existing file. Click
“Yes”.
10.
To save within GeneMarker™, click “File” from the menu and
choose “Save Project” from the drop-down.
11.
Once a profile has been analyzed, save any edits performed in
GeneMarker™ in the RapidLINK™ Software by clicking the review
status of the specific sample in RapidLINK™. From here, the menu
of all statuses is available (see Subheading 3.6, step 7). Click the
appropriate status from the drop-down and click “Submit”.
12.
Analyze the controls for a run (internal lane standard or allelic
ladder). Click the size calibration icon (see Fig. 8, labeled as “iii.”).
13. To analyze the allelic ladder, first check that an allelic ladder has
b h i G M k ™ d h hi ll li l dd d
been chosen in GeneMarker™ and that this allelic ladder passed
according to the system. If any artifact peaks were detected, they
appear as an “X”.
14.
To analyze the internal lane standard, check that all peaks are
called: 80, 90, 100, 120, 129.8, 135.2, 139.3, 144, 147.8, 151.8,
156, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 320, 340,
360, 380, 390, 400, 410, 420, 425, 430, 440, 450, 475, 490, and
500.
15.
To export a profile for CODIS upload, click “Applications” from the
menu and choose “Export CODIS” from the drop-down. In the next
window, type in the appropriate “Source ORI” and “Destination
ORI” and click “OK”. In the “Save As” window that appears, change
the .xml file name to include the sample ID and click “Save”.
Change the status in RapidLINK™ to “Uploaded to CODIS” (see
16.
To print the electropherogram in the GeneMarker™ HID Report,
choose the sample to print by double-clicking the sample ID in the
list on the left side of the screen. Once selected, there should be a
green check mark next to the selected sample. Choose “Project”
from the toolbar and select “Print Report” from the drop-down.
An existing template can be chosen or a new one created. Click
“OK” to print or save as a PDF.
17.
To close GeneMarker™ HID, choose “File” from the menu and
select “Exit” from the drop-down.
Fig. 8 GeneMarker™ HID initial screen. (i) Show Chart/Table; (ii) Browse by All Color; (iii) Size
Calibration. (Reproduced from Ref. 15. Figure owned by Life Technologies Corporation, a part of
Thermo Fisher Scientific Inc. (www.thermofisher.com). © 2023 Thermo Fisher Scientific Inc.
Used under permission)
Table 4 Example analysis parameter settings for GlobalFiler™ Express in GeneMarker HID
Window Recommended analysis parameters

tab
Start up Check: “Classic” for Run Method, “Show Navigator, and “Show Report”
settings Under Display Settings Set: Decimal Precision to “1” and Font Size to “6”
Under Allele Label Box Check: “Mark Off-Marker as ‘OL’”, “Mark Off-Bin as ‘OB’”,
and “Show All Allele Labels”
Under Chart Settings Box Check: “Max Allele Label Layers”, set to “10”, “Show Loci
Box with Multi-line”
Under Peak Label Box Check: “Size”, “Height”, Position as “Allele Label”, and
“Vertical”
Under Gel Image Uncheck: All boxes
Under Sample Tree Check: “Consider Gender for Flag ‘?’”
Forensic Check: “Mark Deleted/Edited Peaks with Symbols,” and “Auto-Delete Alleles in
settings Virtual Bins in Allelic Ladders”
Set Identifiers as follows: Ladder to “LADDER”, Positive Control to “PC”, and
Negative Control to “NC”
Window Recommended analysis parameters
tab
Report Check: “Automatically Scroll Chart to Alleles When Selected in Report”
settings
Other Under Folder Settings Check: “Each” and “Using Default Folder of Panel, SizeStd,
and Template”
The recommended analysis parameter settings for analyzing samples in

GeneMarker HID are displayed here. Settings are separated out by
window tab
4 Notes
1.
For swabs, the manufacturer recommends Puritan 3” Sterile
Standard Cotton Swab w/ Semi-Flexible Polystyrene Handle for
the GlobalFiler™ Express Cartridge. For FTA cards, the
manufacturer recommends the Whatman™ OmniSwab for the
NGM SElect™ Cartridge. Other sample matrices can be validated.
The listed products were validated by the manufacturer. Examples
that have been tested by external users include 4 N6-FLOQSwab™
samples and the MacroPur™ swab [6].
2.
This cartridge is used for both GlobalFiler™ Express and
RapidINTEL™ runs.
3.
Thermo Fisher must enable barcode scanning on the instrument.
4.
The main power switch located on the back panel should always
be turned on. The gel within the primary cartridge is held at a
constant temp when ON. Do not turn off unless instructed during
maintenance.
5.
The boot-up process takes about 15 min. The instrument is
performing various system primes and checks. Once complete, the
lock screen is available.
6. If this leads to an error message, something may be wrong with
the instrument. Contact Thermo Fisher for troubleshooting with
the error code displayed on the screen
the error code displayed on the screen.
7.
If the screen shows the phrase “The primary cartridge is not
engaged”, there may be an instrumental or cartridge error. Contact
Thermo Fisher for troubleshooting.
8.
The software automatically recognizes the labeling “LADDER”,
“POSCTRL”, and “NEGCTRL”, in either all caps or lowercase as a
control sample. Do not include these phrases within sample
names, otherwise errors occur during analysis. For certain
characters, the software automatically changes to an underscore
(“_”). Specifically, ^ ? % * : | ’ . < > and space. The underscore is
also displayed in the RapidLINK™ Software. Letters always appear
in capitalized format.
9.
If the swab is >3 inches, the handle needs to be snapped or cut
with sterile scissors or a scalpel.
10.
The chamber fills with liquid and the sample may not stay
submerged. The sterile swab helps anchor it to the bottom to
allow for optimal extraction.
11.
If the screen shows the cartridge with a red “X”, the cartridge is
either expired or has been inserted improperly. If the latter,
remove the cartridge and reinsert. If expired, obtain a new
cartridge. All components have an RFID tag that is read by the
instrument that identifies the component, the lot number, and the
expiration date.
12.
If priming of the instrument occurs during this particular run,
expect run times of ~110 min. This does not occur every run.
13.
If the cartridge appears to be stuck, it may still be locked in the
instrument. An admin or supervisor needs to perform a recovery
function (see Subheading 3.4, step 1).
14. Studies have been performed that show reprocessing of the
sample may still yield another profile [5, 6, 8]. Evaluate and
validate if this procedure is to be used.
15.
If the results screen does not appear, the cartridge may have been
removed too early. Insert the cartridge back in the instrument and
repeat the step (see Subheading 3.1, step 14).
16.
If the “Export” button is not visible after the USB device has been
inserted, check that the USB device has been properly inserted.
Remove and reinsert if needed. Additionally, check the
configuration for run deletion. The user is able to choose the
option to delete the run once it has been transferred to the
RapidLINK™ Software through the use of the system’s network,
and it may no longer be available in the RapidHIT™ ID System.
17.
Perform this step on a routine schedule—once a week, biweekly,
or monthly based on the usage of the instrument.
18.
Primary cartridge replacement can only be performed by users
with admin or supervisor privileges. Primary cartridge
maintenance may also need to be performed if there is an
instrument or reagent error.
19.
If the instrument is used for RapidINTEL™ purposes, use a
GlobalFiler™ Express primary cartridge.
20.
Do not remove the foam casing around the gel cartridge. This
remains during insertion into the primary cartridge.
21.
Once this is removed, the capillary is exposed. Handle with care!
22.
If using a RapidINTEL™ Cartridge, run the GFE allelic ladder.
23.
If the screen shows the cartridge with a red “X”, the cartridge is
either expired or has been inserted improperly. If the latter,
remove the cartridge and reinsert. If expired, obtain a new
cartridge.
24. A green check mark means the profile was generated with no
quality flags and expected alleles were detected in the positive
q y g p p
control; no alleles were detected in the negative control; or the
allelic ladder profile was generated with no flags, all expected
alleles were detected, and the ladder has been uploaded to the
instrument’s library for allelic ladders. A red “X” means that the
positive control profile was not as expected (e.g., no profile was
generated, not all alleles were detected, or too many alleles were
detected); alleles were detected in the negative control; or not all
alleles were detected for the allelic ladder. The affected control(s)
must be re-processed; if contamination in the negative control
persists, contact Thermo Fisher.
25.
Must be signed in as an administrator.
26.
If multiple instruments within the laboratory are on the same
network, this procedure adds this user to all instruments
connected.
27.
Settings should be validated and determined for each laboratory
based on the usage of their instruments.
28.
Only .txt, .csv, and .xml CODIS files can be uploaded.
29.
Each allele is listed in a separate cell. Y-specific loci should be
removed from the file.
30.
To perform this action, the instrument must be active and the user
needs the host name of the instrument.
31.
If connected to the network, Google Maps can fill in this
information.
32.
The instrument must be connected to the network. If the user still
has access, repeat this action after confirming connection.
33.
These settings can be used for the GFE runs. The Intel and NGM
runs require different settings based on validation.
References
1. Federal Bureau of Investigation (2022) Rapid DNA. Available via Federal Bureau of
Investigation. https://www.fbi.gov/services/laboratory/biometric-analysis/codis/rapid-
dna. Accessed 21 Apr 2022
2. Hess AS (2015) FBI’s plans for the use of rapid DNA technology in CODIS. Available via
Federal Bureau of Investigation. https://www.fbi.gov/news/testimony/fbis-plans-for-the-
use-of-rapid-dna-technology-in-codis. Accessed 21 Apr 2022
3. Kartasiń ska E, Jurga A (2020) Rapid DNA—a technology for rapid automated DNA profile
analysis based on STR loci polymorphism. Issues Forensic Sci 309(3):33–40. https://doi.
org/10.34836/pk.2020.309.1
[Crossref]
testing laboratories. Available via Federal Bureau of Investigation. https://www.fbi.gov/
file-repository/quality-assurance-standards-for-forensic-dna-testing-laboratories.pdf/
view. Accessed 21 Apr 2022
5. Hennessy LK, Mehendale N, Chear K et al (2014) Developmental validation of the

GlobalFiler® Express kit, a 24-marker STR assay, on the RapidHIT® System. Forensic Sci
Int Genet 13:247–258. https://doi.org/10.1016/j.fsigen.2014.08.011
6. Wiley R, Sage K, LaRue B et al (2017) Internal validation of the RapidHIT® ID System.

[Crossref][PubMed]
7. Federal Bureau of Investigation (2022) Guide to all things rapid DNA, Version 1.0. Available
via Federal Bureau of Investigation. http://www.lsp.org/pdf/FBI_Guide_to_All_Things_
Rapid_DNA_01_27_2022.pdf. Accessed 21 Apr 2022
8. Salceda S, Barican A, Buscaino J et al (2017) Validation of a rapid DNA process with the
RapidHIT® ID System using GlobalFiler® Express chemistry, a platform optimized for
decentralized testing environments. Forensic Sci Int Genet 28:21–34. https://doi.org/10.
1016/j.fsigen.2017.01.005
9. Applied Biosystems (2020) APPLICATION NOTE—RapidHIT ID System: bone sample

processing on the RapidHIT ID System with RapidINTEL cartridges. Available via Thermo
Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/GSD/Application-Notes/
Bone-sample-processing-RapidHIT-ID-system-RapidINTEL-cartridges-application-note.
pdf. Accessed 21 Apr 2022
10. Watherston J, Watson J, Bruce D et al (2022) An in-field evaluation of rapid DNA

instruments for disaster victim identification. Int J Legal Med 136:493–499. https://doi.
org/10.1007/s00414-021-02748-z
[Crossref][PubMed]
11.
Bowman Z, Daniel R, Gerostamoulos D et al (2022) Rapid DNA from a disaster victim
identification perspective: is it a game changer? Forensic Sci Int Genet 58:102684. https://
doi.org/10.1016/j.fsigen.2022.102684
[Crossref][PubMed]
12. Watherston J, McNevin D, Gahan ME et al (2018) Current and emerging tools for the
recovery of genetic information from post mortem samples: new directions for disaster
victim identification. Forensic Sci Int Genet 37:270–282. https://doi.org/10.1016/j.fsigen.
2018.08.016
[Crossref][PubMed]
13. Holland M, Wendt F (2015) Evaluation of the RapidHIT™ 200, an automated human
identification system for STR analysis of single source samples. Forensic Sci Int Genet
[Crossref][PubMed]
14. Date-Chong M, Hudlow WR, Buoncristiani MR (2016) Evaluation of the RapidHIT™ 200 and
RapidHIT GlobalFiler® Express kit for fully automated STR genotyping. Forensic Sci Int
[Crossref][PubMed]
15. Thermo Fisher Scientific (2018) RapidLINK™ Software v1.0 user guide. Available via
Thermo Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/
MAN0018038_RapidLinkSW1_UG.pdf. Accessed 21 Apr 2022
16. Applied Biosystems (2021) RapidHIT™ ID System v1.3.1 user guide. Available via Thermo
Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/
MAN0018938_RapidHIT_ID_System_v1_3_1_UG.pdf. Accessed 21 Apr 2022
17. Gill P, Fereday L, Morling N et al (2006) The evolution of DNA databases—

recommendations for new European STR loci. Forensic Sci Int 156:242–244. https://doi.
org/10.1016/j.forsciint.2005.05.036
[Crossref][PubMed]
18. Shackleton D, Gray N, Ives L et al (2019) Development of RapidHIT® ID using NGMSElect™

Express chemistry for the processing of reference samples within the UK criminal justice
system. Forensic Sci Int 295:179–188. https://doi.org/10.1016/j.forsciint.2018.12.015
[Crossref][PubMed]
19. Applied Biosystems (2019) RapidINTEL™ sample cartridge for blood and saliva samples
validation user bulletin, revision A. Available via Thermo Fisher Scientific. https://assets.
thermofisher.com/TFS-Assets/LSG/manuals/MAN0018979_RapidINTEL_RHIT_v1_1_3_
Validation_UB.pdf. Accessed 21 Apr 2022
20. Gomes C, Martínez-Gó mez J, Díez-Juá rez L et al (2017) Prep-n-Go™: a new and fast
extraction method for forensic blood samples. Forensic Sci Int 6:e265–e266. https://doi.
org/10.1016/j.fsigss.2017.09.089
[Crossref]
21. Applied Biosystems (2014) GlobalFiler™ Express PCR Amplification Kit user guide, revision
G. Available via Thermo Fisher Scientific. https://assets.thermofisher.com/TFS-Assets/
LSG/manuals/4477672_GlobalFilerExpress_UG.pdf. Accessed 21 Apr 2022
22.
Applied Biosystems (2018) AmpFlSTR™ Identifiler™ Direct PCR Amplification Kit user
guide, revision K. Available via Thermo Fisher Scientific. https://assets.thermofisher.com/
TFS-Assets/LSG/manuals/cms_065522.pdf. Accessed 21 Apr 2022
23. Romsos E, Vallone P (2015) Rapid PCR of STR markers: applications to human
identification. Forensic Sci Int Genet 18:90–99. https://doi.org/10.1016/j.fsigen.2015.04.
008
[Crossref][PubMed]
24. Kermekchiev M, Kirilova L, Vail E et al (2009) Mutants of Taq DNA polymerase resistant to
PCR inhibitors allow DNA amplification from whole blood and crude soil samples. Nucleic
Acids Res 37(5):e40. https://doi.org/10.1093/nar/gkn1055
25. Spitaleri S, Piscitello D, di Martino D et al (2004) Experimental procedures comparing the

activity of different Taq polymerases. Forensic Sci Int 146S:S167–S169. https://doi.org/10.
1016/j.forsciint.2004.09.051
[Crossref]
26. Butler J (2012) Advanced topics in forensic DNA typing: methodology. Academic Press
Elsevier, Waltham, MA
27. Verheij S, Harteveld J, Sijen T (2012) A protocol for direct and rapid multiplex PCR
amplification on forensically relevant samples. Forensic Sci Int Genet 6:167–175. https://
doi.org/10.1016/j.fsigen.2011.03.014
[Crossref][PubMed]
28. Yang Y, Kim J, Song Y et al (2007) A novel buffer system, AnyDirect, can improve
polymerase chain reaction from whole blood without DNA isolation. Clin Chim Acta
380:112–117. https://doi.org/10.1016/j.cca.2007.01.019
[Crossref][PubMed]
29. Bu Y, Huang H, Zhou G (2008) Direct polymerase chain reaction (PCR) from human whole
blood and filter-paper-dried blood by using a PCR buffer with a higher pH. Anal Biochem
375:370–372. https://doi.org/10.1016/j.ab.2008.01.010
[Crossref][PubMed]
30. Applied Biosystems (2015) AmpFlSTR® NGM SElect™ PCR Amplification Kit, revision F.
Available via Thermo Fisher Scientific. https://tools.thermofisher.com/content/sfs/
manuals/cms_089008.pdf. Accessed 21 Apr 2022
https://doi.org/10.1007/978-1-0716-3295-6_24
24. Next-Generation Sequencing:

ForenSeq™ DNA Signature Prep Kit with
the Illumina MiSeq FGx
Megan M. Foley1
Megan M. Foley
Abstract
Sequencing forensic DNA samples that are amplified and prepared with
the ForenSeq™ DNA Signature Prep Kit allows for the simultaneous
targeting of forensically relevant STR and SNP markers. The MiSeq™
FGx system allows massively parallel sequencing of these markers in a
single analysis. The library preparation targets autosomal, Y-, and X-
STRs, as well as identity SNPs. The kit can also be used to generate
investigative information regarding the DNA contributor by analyzing
phenotypic SNPs to predict hair color, eye color, and ancestry SNPs.
Through two rounds of amplification, all loci are amplified and
tagged with individualizing barcodes for sequencing capture and
identification. Using bead-based technology, the libraries are purified
by the removal of left-over amplification reagents and then normalized
to ensure equal representation of all samples during sequencing. The
individual libraries are then pooled for insertion into the MiSeq FGx.
The pooled libraries are then added to a pre-packaged cartridge that
contains all reagents necessary for optimal sequencing. Libraries are
captured on a flow cell and undergo bridge amplification for the
generation of individual clusters. Sequencing of each cluster is
performed using a Sequence-By-Synthesis technology. The following
chapter describes the methodology and process of library preparation
of samples using the ForenSeq™ DNA Signature Prep Kit Primer Set A
and B. Once completed, the chapter then focuses on the setup of a
sequencing run on the MiSeq FGx and the sequencing methodology
employed by the instrument.
Key words ForenSeq™ DNA Signature Prep Kit – MiSeq FGx – Forensic
DNA Sequencing – Next Generation Sequencing – Massively Parallel
Sequencing – STR Sequencing – SNP Analysis – Phenotypic SNPs –
Ancestry SNPs
1 Introduction
1.1 Background
Verogen’s ForenSeq™ DNA Signature Prep Kit is one of the first
commercial sequencing assays manufactured for forensic purposes [1,
2]. In tandem with the Illumina MiSeq™ FGx instrument, this system
allows for enhanced multiplexing capabilities by utilizing massively
parallel sequencing (MPS) for common forensic short tandem repeats
(STRs) and a variety of single nucleotide polymorphisms (SNPs) for
analysis of crime scene and reference samples. Two separate data sets
can be generated based on the sample type or a laboratory’s
preference. Primer Set A can be used for identity or kinship purposes. A
total of 58 STRs are targeted, including autosomal (including
Amelogenin), Y-, and X-STRs; and a total of 94 identity SNPs. Primer Set
B is an alternative to set A that can be used for identity purposes—
using the same 152 markers as Set A—and to generate possible
investigative leads based on predicted phenotypic features, including
hair and eye color, as well as predicted ancestral features, using an
additional 78 SNPs (see Tables 1 and 2) [1–4].
Table 1 Primer Set A and Primer Set B locus specifications
Genetic marker type STRs SNPs

Autosomal Y X Identity Ancestral Phenotypic
Genetic marker type STRs SNPs
Autosomal Y X Identity Ancestral Phenotypic
Primer Set A 27 24 7 94 – –
Primer Set B 27 24 7 94 56 22
Displayed is a breakdown of the number of genetic loci per target type

in the Primer Set A and Primer Set B options. Two SNPs are common
between the ancestral and phenotypic groupings
Table 2 ForenSeq™ Signature Prep Kit targeted loci
DNA List of loci

target
Autosomal D1S1656, TPOX, D2S441, D2S1338, D3S1358, D4S2408, FGA, D5S818, CSF1PO,
STR loci D6S1043, D7S8201, D8S1179, D9S1122D10S1248, TH01, vWA, D12S391,
D13S317, Penta E, D16S539, D17S1301, D18S51, D19S433, D20S482, D21S11,
Penta D, D22S10452
Y-STR loci DYF387S1, DYS19, DYS385a-b, DYS389I, DYS389II, DYS390, DYS391, DYS392,
DYS437, DYS438, DYS439, DYS448, DYS460, DYS481, DYS505, DYS522, DYS533,
DYS549, DYS570, DYS576, DYS612, DYS635, DYS643, Y-GATA-H4
X-STR loci DXS10074, DXS10103, DXS10135, DXS7132, DXS7423, DXS8378, HPRTB
Identity rs10495407, rs1294331, rs1413212, rs1490413, rs560681, rs891700,
SNPs rs1109037, rs12997453, rs876724, rs907100, rs993934, rs1355366,
rs1357617, rs2399332, rs4364205, rs6444724, rs1979255, rs2046361,
rs279844, rs6811238, rs13182883, rs159606, rs251934, rs338882, rs717302,
rs13218440, rs1336071, rs214955, rs727811, rs321198, rs6955448, rs737681,
rs917118, rs10092491, rs2056277, rs4606077, rs763869, rs1015250,
rs10776839, rs1360288, rs1463729, rs7041158, rs3780962, rs735155,
rs740598, rs826472, rs964681, rs10488710, rs1498553, rs2076848, rs901398,
rs10773760, rs2107612, rs2111980, rs2269355, rs2920816, rs1058083,
rs1335873, rs1886510, rs354439, rs1454361, rs4530059, rs722290, rs873196,
rs1528460, rs1821380, rs8037429, rs1382387, rs2342747, rs430046,
rs729172, rs740910, rs8078417, rs938283, rs9905977, rs1024116, rs1493232,
rs1736442, rs9951171, rs576261, rs719366, rs1005533, rs1031825,
rs1523537, rs445251, rs221956, rs2830795, rs2831700, rs722098, rs914165,
rs1028528, rs2040411, rs733164, rs987640
DNA List of loci
target
Ancestral rs2814778, rs3737576, rs7554936, rs10497191, rs1834619, rs1876482,
SNPs rs260690, rs3827760, rs6754311, rs798443, rs12498138, rs1919550,
rs1229984, rs3811801, rs4833103, rs7657799, rs7722456, rs870347,
rs16891982, rs192655, rs3823159, rs917115, rs1462906, rs1871534,
rs2196051, rs6990312, rs3814134, rs4918664, rs1079597, rs174570,
rs2238151, rs671, rs1572018, rs2166624, rs7326934, rs7997709, rs9522149,
rs200354, rs12439433, rs1426654, rs1800414, rs735480, rs12913832,
rs459920, rs11652805, rs17642714, rs2593595, rs4411548, rs4471745,
rs2042762, rs3916235, rs4891825, rs7226659, rs7251928, rs310644,
rs2024566
Phenotypic rs28777, rs12203592, rs4959270, rs683, rs1042602, rs1393350, rs12821256,
SNPs rs12896399, rs2402130, rs1800407, N29insA, rs1110400, rs11547464,
rs1805005, rs1805006, rs1805007, rs1805008, rs1805009,
rs201326893_Y152OCH, rs2228479, rs885479, rs2378249
All loci targeted by either Primer Set A and/or B are broken down by
DNA target type [1]
The Verogen system allows for a large increase in the amount of

genetic information that can be gathered from a forensic or reference
sample compared to the typical genetic profile generated from a
megaplex STR kit designed for capillary electrophoresis (CE) detection.
Through current CE procedures, the fragment size of the STR repeat is
reported and utilized for analysis. Sequencing allows forensic analysts
to observe and utilize the entire sequence of the STR repeat, which
allows for the identification of isoalleles. Isoalleles can be observed
when two fragments of DNA have the same length but are different in
sequence. Current CE methods are unable to detect this sequence
variation, making isoalleles indistinguishable from one another on that
detection platform. Additionally, through the identification of isoalleles,
it is possible to separate out stutter fragments that are the same length
as minor contributors with differing sequences. Following current
analysis and interpretation methods, stutter filter percentages and
peak height ratios only indicate the possible stacking of stutter peaks
with low level contributors. Sequencing can allow for further
verification of this occurrence in a profile, which allows for more
accurate DNA interpretation when deducing mixtures or comparing a
reference to a mixture profile [2]. Although not currently used for
forensic casework purposes, the ForenSeq™ kit also has the ability to
sequence flanking regions for identity or comparison purposes in the
future, which also can add additional variability to a profile [5].
Additional benefits of the kit include the ability to sequence the above-
mentioned markers in one analysis, which would require more time,
money, analyses, and sample volume to perform on the CE [6]. Also,
because of the decreased size of the STR fragments, and especially
because of the minimal sizes of the identity SNP markers, more
information can be gathered from a degraded sample [2, 7–10].
1.2 Library Preparation Using the ForenSeq™ DNA

Signature Prep Kit
Sample types that can be processed using the ForenSeq™ kit include
purified extracts that have been previously extracted and quantified,
crude lysates that have undergone a direct quantification process, and
FTA® Card punches. The procedure includes two amplification steps, a
bead-based purification step, a bead-based normalization step, and
pooled library preparation for sequencing. Altogether, it takes around
9 h total of processing and hands on time. The first round of
amplification is similar to CE-based procedures and targets the STRs
and SNPs to be sequenced utilizing oligonucleotide primers that
surround the targeted DNA sequence. The primers contain forward and
reverse tags to identify the amplified strands in later processes. The
second round of amplification additionally enhances these targets and
adds indexed adapters to each sequence that are complementary to the
tag sequence added to the DNA fragments during Amplification 1 [1].
Later in the process, the samples and controls are combined into
one tube as a pooled library. In order to separate out the sequenced
fragments, each sample needs to be uniquely labeled. The reaction for
Amplification 2 includes the addition of two indices, Index 1 (i7) and
Index 2 (i5). Each index fragment contains two parts: a unique index
sequence and a common adapter sequence. The indices are utilized to
provide a unique combination of various i7 and i5 index pairings for
each sample and allow for the sample multiplexing capacity that
sequencing allows. Each index is made up of a unique combination of
eight base pairs. The specific indices link with the sample name during
run setup and act as a unique barcode, which allows the instrument to
identify which sequences belong to each sample and separate data that
belongs to that specific sample. The adapter sequences (120 bp) are
identical on each fragment, regardless of the index portion of the tag,
and are utilized for capture purposes for sequencing on the flow cell.
The unique combination and the sample name are imported into the
sequencing instrument for bioinformatics purposes (see Fig. 1) [1, 11].
Fig. 1 A representation of products from Amplification 1 and 2. The amplicon from

Amplification 1 contains the amplified STR sequence (dark blue), flanking regions (green),
forward and reverse primers (yellow), and the forward and reverse primer tags (orange for i5
and purple for i7). Amplification 2 includes the addition of i5 and i7 Index/Adapter strands.
The i5 indices start with a region complementary to the forward primer tag and the i7 indices
start with a region complementary to the reverse primer tag and binds (orange for i5 and
purple for i7). The next section will contain the unique sequence specific to the index added to
the sample (blue). Lastly, the indices have an i5 and i7 adapter sequence that is complementary
to a stationary oligonucleotide on the flow cell and binds during sequencing
After the second amplification step, samples need to be purified in

order to remove any leftover amplification reagents that interfere with
sequencing (e.g., leftover nucleotides, primers, etc.). The purification
step utilizes magnetic beads that attract and bind to the DNA. The
beads are removed from the solution through the use of a magnetic
stand, leaving the DNA-free supernatant and any leftover reagents,
which are subsequently removed and discarded. The beads are then
washed twice utilizing an ethanol-based wash procedure in order to
ensure a pure sample. After the wash steps have been performed and
all residual ethanol is removed, a resuspension buffer is added to the
samples that release the DNA from the magnetic beads, releasing it
back into the solution. The magnetic stand can be used once again to
draw the beads to the side, but this time the supernatant containing the
DNA can be removed and further processed [1].
This library preparation procedure does not require the
quantification of individual libraries but instead utilizes a DNA
concentration normalization step with beads. Similar to the purification
step, magnetic beads are added at equal concentrations, initially
attracting and binding DNA. The beads for this step have a binding
capacity, which limits the amount of sample added to the flow cell for
sequencing. This is to create a pool of equally represented samples by
limiting the amount of DNA library for larger quantity samples so that
they do not overshadow any lower-level samples. The washing
procedure is performed twice and utilizes a mixture that includes
formamide and 2-mercaptoethanol (aka β-mercaptoethanol) [12]. A
resuspension reagent is added to remove the DNA from the beads and
the DNA is released back into solution. The liquid containing the DNA is
removed for the next step [1].
The last step before preparing the sample for processing is the
pooling of the libraries for sequencing. The number of samples that can
be processed on one flow cell depends on the primer set used and the
size of the flow cell (see Table 8) [1, 13]. Verogen manufactures two
flow cell types that can be utilized in conjunction with the ForenSeq™
kit: the Standard Flow Cell and the Micro Flow Cell. All reagents are
identical between the two flow cell kits and both perform a total of 600
sequencing cycles. The standard flow cell allows for more samples to be
processed at once (up to 96 samples from Primer Set A or 32 samples
from Primer Set B) and takes around 30 h because of the increase in
fluorescence imaging time. The micro flow cell is best for laboratories
that do not intend to have a large amount of samples processed using
sequencing (up to 36 samples from Primer Set A or 12 samples from
Primer Set B), which allows for decreased processing time (reduced by
~6 h) and a decrease in cost per sample [13].
To prepare the pooled libraries for sequencing, it must first undergo
a denaturation process similar to CE-based methods. The pooled
libraries are first diluted out in a hybridization buffer. At this stage, a
sequencing control is added that is used by the instrument’s software
for quality checks and can be used to determine if the run was
successful or may contain errors. Denaturation of DNA occurs through a
heating process and a snap-cool procedure. Once this process is
complete, the sample can be loaded into a sequencing reagent cartridge
and loaded into the instrument. Each cartridge is single use and
contains all necessary reagents required for cluster generation [1, 11].
1.3 Sequencing on the MiSeq FGx™

Sequencing on the Illumina MiSeq FGx™ occurs on a glass flow cell and
can be broken down into multiple stages. The first is bridge-
amplification to form amplified clusters. The flow cell contains
oligonucleotides bound to the bottom. These oligonucleotides are
complementary to the adapters that are attached to each DNA fragment
during the index/adapter addition in Amplification 2. Each fragment
binds to the flow cell through these adapters. The adapter on the
reverse side of the fragment bends over and binds to an additional
oligonucleotide. All DNA fragments are now bound at both ends and
forms an upside-down U shape or a “bridge.” Polymerase enzymes and
nucleotides are flushed through the flow cell. Through the addition of a
primer, each strand is replicated. One adapter on each fragment (the
template and the new amplified strand) will be released and two
identical strands are present. During the next cycle, both strands bend
over to form a new bridge and the amplification repeats. This occurs
over and over again until individual clusters of each amplified product
are formed. Each cluster contains 1000+ of copies of one DNA target for
one unique amplicon. Since we have undergone multiple rounds of
amplification, we expect each unique DNA target to be present in
multiple clusters, which allows for optimal sequencing reads and
results [11].
Next, the amplified clusters are sequenced through a process called
“Sequencing-By-Synthesis” or SBS. A new primer attaches to each
fragment that is once again complementary to the adapter. The
instrument floods the flow cell with a mixture of all four
dideoxynucleotides that are fluorescently labeled with different
molecules based on nucleotide. A blocking agent present will restrict
the addition of another nucleotide to the growing strand, which allows
detection of stretches of the same nucleotide. The instrument then uses
an imaging system to capture the fluorescence of the dye. The
wavelength that is captured by the system indicates which nucleotide
has been added. The imaging process uses various combinations of LED
and filters and occurs multiple times during each cycle. A flow cell is
broken up into different imaging sections, or tiles, and each tile is
imaged separately. The standard flow cell is made up of 19 tiles, while
the micro flow cell has eight, leading to a decrease in processing time
by ~6 h [11, 13]. A deblocking agent is then flooded over the flow cell to
expose the previously attached nucleotide for the next base pair
addition. This occurs over and over until both indices, the flanking
region, the forward and reverse tags, and target regions have been
sequenced. After image analysis, the software performs a series of
bioinformatic analyses that includes base calling, filtering, and
calculating a quality score for each strand. Further analysis on the
genotypes is performed in the ForenSeq™ Universal Analysis Software
for forensic analysis [11, 14].
2 Materials
For pipetting reagents and samples, utilize aerosol-barrier pipette tips.
Any plastics utilized should be RNase/DNase free (microcentrifuge
tubes, conical tubes, reagent reservoirs, etc.). The temperature ranges
for storage indicated for each reagent include: refrigerator (2 to 8 °C),
freezer (−25 to −15 °C), and room temperature (15 to 30 °C).
2.1 Library Preparation

1.
Sample sources: acceptable types of samples for this assay include
purified DNA, crude lysate, or blood/saliva on FTA® Cards (see
Note 1).
2.
Pipettes: multi-channel [8], single channel, and repeater pipettes,
plus corresponding tips (see Note 2).
3.
PCR tubes: 8-tube strips and caps.
4.
96-well 0.3 mL skirted or semi-skirted PCR plates.
5.
96-well storage plates: round well, 0.8 mL; also referred to as a
“midi plate.”
6. Disposable reagent reservoirs for multi-channel pipettes.
7.
Microseal “A” film (see Note 3).

8.
Microseal “B” adhesive seals (see Notes 3).
9.
Index Adapter Replacement Caps.
10.
200 proof (absolute) ethanol: molecular-biology grade.
11.
Water: nuclease-free, molecular-biology grade.
12.
FTA® Card extraction buffer (see Notes 4 and 5).
13.
1X Tris-Borate-EDTA (TBE) buffer (see Note 4).
14.
ForenSeq™ DNA Signature Prep Kit: available as a 96 or 384
reaction kit.
15.
ForenSeq™ DNA Signature Prep Kit—Pre-Amplification 1
Reagents: contains 2800M Control DNA, DNA Primer Mix A
(DPMA), DNA Primer Mix B (DPMB), Enzyme Mix (FEM), and
PCR1 Reaction Mix (PCR1). Store all components in a freezer upon
receipt. 2800M Control DNA can be stored in a refrigerator after
the first use.
16.
ForenSeq™ DNA Signature Prep Kit—Pre-Amplification 2
Reagents: contains PCR2 Reaction Mix, i7 index orange capped
tubes (12 total), i5 index white capped tubes (8 total), and
additional i7/i5 index tube caps. Store all components in a freezer
upon receipt, except the additional tube caps.
17.
ForenSeq™ DNA Signature Prep Kit—Purification Reagents:
contains Resuspension Buffer (RSB) and Sample Purification
Beads (SPB). Store all components in a refrigerator upon receipt.
18. ForenSeq™ DNA Signature Prep Kit—Normalization Reagents:
t i HP3 (2 N N OH) Lib N li ti Additi 1
contains HP3 (2 N NaOH), Library Normalization Additives 1
(LNA1), Library Normalization Beads 1 (LNB1), Library
Normalization Storage Buffer 2 (LNS2), and Library
Normalization Wash 1 (LNW1) (see Note 6). Store all components
in a freezer upon receipt. LNB1, LNS2, and LNW1 can be stored in

a refrigerator after the first use.
19.
ForenSeq™ DNA Signature Prep Kit—Denaturation/Dilute
Reagents: contains Human Sequencing Control (HSC) and MiSeq
FGx™ Reagent Kit (Hybridization Buffer (HT1) and Reagent
Cartridge). Store all components in a freezer upon receipt.
20.
Plate seal applicator.
21.
1.2 mm FTA® Card punching tool (see Note 4).
22.
96-well plate base (see Note 7).
23.
ForenSeq™ Index Plate Fixture.
24.
Magnetic stand (see Note 8).
25.
1.5 mL tube benchtop cooler.
26.
1.5 mL 96-well micro-heating system/heat block.
27.
High-speed thermal mixers (see Note 9).
28.
96-well thermal cycler: must be approved by Verogen (see Table
4).
29.
96-well plate shaker (see Note 9).
2.2 Sequencing Specific Materials

1. MiSeq disposable wash tubes.
2.
Water: nuclease-free, molecular-biology grade.
3.
6% Sodium Hypochlorite.
4.
MiSeq FGx Reagent Kit: This 380-cycle kit comes in two sizes—
standard and micro. The standard kit can process 96 samples with
Primer Set A and 32 samples with Primer Set B; the micro kit can
process 36 samples with Primer Set A and 12 samples with Primer
Set B. Each kit contains Hybridization Buffer (HT1), Reagent
Cartridges, Flow Cell Containers, and SBS Solution (PR2); the first
two components are stored in the freezer, while the latter two are
stored refrigerated.
5.
1.5 mL tube benchtop cooler.
6.
Large volume repeat pipettor (>5 mL) and appropriate tips.
3 Methods
The complete NGS process is a very lengthy procedure; be sure to allot
ample time for each portion of the assay (see Table 3). Before beginning
each section of the method, ensure that all reagents are within
expiration and that all necessary equipment and/or consumables are
stocked. Prepare all worksheets with appropriate information (e.g.,
sample names, assigned index adapters, extract volumes needed,
master mix calculations, etc.). Any extraction controls should be
processed alongside samples. A sequencing amplification positive and
negative control should be prepared. Additionally, a sequencing control
should be added when sequencing the samples. Batch samples with
similar primer targets and sample type (i.e., reference samples, high
quality reference-like samples, and low quantity samples).
Table 3 Time and storage conditions following each step of the NGS process
Process Total time Hands- Okay to pause after completion?
to on
complete time
Amplification 1: amplification 3 h 35 min 15 min Yes, amplification product can be
and tagging of loci targets stored at 2–8 °C for up to 2 days.
Amplification 2: enrichment 1 h 30 min 10 min Yes, amplification product can be
of targets stored at 2–8 °C for up to 7 days.
Sample purification 30 min 15 min Yes, purified samples can be stored at
−25 to −15 °C for up to 1 year.
Sample normalization 1 h 20 min 30 min Yes, normalized samples can be stored
at −25 to −15 °C for up to 30 days.
Pooling of sample libraries 10 min 10 min Yes, pooled samples can be stored at
−25 to −15 °C for up to 30 days.
Denaturation and dilution of 10 min 10 min No, immediately proceed to instrument
pooled libraries setup and performing a run.
Instrument setup and 10 min 10 min N/A
performing a run
The overall process of next-generation sequencing is lengthy. The entire

process can be completed in one day or it can be broken up into smaller
sections. This table outlines where natural breaks occur, whether the
process can be paused after these individual steps, and if so, how to
store the samples before proceeding. If pausing after a step that leaves
the samples in a 96-well format, ensure that the plate is securely sealed
with a Microseal “B” or cap strips
While performing each section, it is crucial to avoid chances of

contamination and decrease pipetting variability between samples.
Pipette tips should be aerosol-resistant and should be changed
between reagents, samples, and rows/columns if using a multi-channel
pipette. With each aspiration using a multi-channel pipette, ensure that
equal volumes of liquid are present in each tip, since some variability
can exist between the channels. Additionally, reagents and consumables
for Amplification 1 should be stored in pre-amplification (pre-amp)
work areas. Preparation for Amplification 1 should also be performed
in pre-amp; all other subsequent steps should be performed in post-
amplification (post-amp) work areas to prevent contamination of pre-
amp areas.
3.1 Library Preparation—Amplification 1: Amplification
and Tagging of Loci Targets
1.
Thaw all necessary Amplification 1 reagents to room temperature
(~30 min for the 2800M standard) (see Note 10).
2.
Label a 96-well plate “FSP” for ForenSeq™ Sample Plate (see
Notes 11 and 12).
3.
Create a thermal cycler program for Amplification 1 (see Tables 4
and 5). The total amplification time is ~3.5 h. Amplification 1 can
be run during the day or overnight depending on the workflow of
the laboratory.
4.
Prepare the samples for purified DNA extracts (see Subheading
3.1, step 5) or FTA® Cards (see Subheading 3.1, steps 6–8). Crude
lysate samples do not require additional preparation.
5.
For purified DNA, the manufacturer recommends a total of 1 ng in
5 μL total human DNA for optimal sequencing results (see Note
1). Using the quantitation values in ng/μL, calculate the
appropriate volume of extract and nuclease-free water required to
create a dilution with a final concentration of 0.2 ng/μL (see Note
13). These prepared samples will be added to the amplification
plate after the master mix has been dispensed (see Subheading
3.1, step 15). Proceed to prepare the positive control (see
6.
For FTA® Card samples, use a single 1.2 mm punch of the dried
stain from the card, ensuring to follow laboratories
decontamination procedures after each punch is taken.
7.
Aliquot 100 μL 1X TBE buffer to each well. Seal the plate with
Microseal “B” or cap strips. Place the 96-well plate on an
appropriately sized rack and shake for 2 min at 1800 rpm.
8. Centrifuge the plate using a plate spinner for 30 s at 1000 × g.
Carefully remove the seal or caps. Remove and discard all
supernatant using a 100 μL multi-channel pipette.
9.
Similar to purified DNA samples, 1 ng of DNA is targeted for the
amplification of the positive control, but the volume allotted is
dependent on the type of sample being processed (see Table 6). To
prepare the positive control, begin by vortexing and pulse
spinning the 2800M Control DNA. If processing purified DNA

and/or FTA® Card samples, dilute 2800M with nuclease-free
water to a final concentration of 0.2 ng/μL. If processing crude
lysate, dilute 2800M to 0.5 ng/μL. The diluted 2800M positive
control will be added to the amplification plate after the master
mix has been dispensed (see Subheading 3.1, step 15).
10.
The composition of the amplification master mix depends on the
type of sample being processed (see Table 6). The volume needed
for each component should be multiplied by the total number of
samples and controls (including extraction reagent blanks, as well
as a positive and negative amplification control), plus an
additional 10% for pipetting error (see Notes 14–16).
11.
Label an appropriately sized microcentrifuge tube (e.g., 1.5 mL or
2.0 mL) as “Master Mix.”
12.
Before pipetting PCR1 or DPMA/B, be sure to vortex these tubes
and pulse spin them to remove any liquid from the cap. Do not
vortex FEM, which is unstable. Instead, using a 100 μL pipette,
pipette the liquid up and down gently to mix before adding the
appropriate amount into the master mix.
13.
Once all components have been added, pipette the master mix to
mix and pulse spin to remove any liquid from the cap.
14.
Add the appropriate master mix volume per well based on the
sample type (see Table 6). Depending on the capabilities of the
lab, the master mix can be distributed into each well multiple
ways (see Note 17).
15. Next, add prepared purified DNA samples (see Subheading 3.1,
step 5) and/or crude lysate samples (if processing), as well as the
p ) / y p ( p g)
amplifications controls, to the corresponding wells of the 96-well
plate already containing master mix; if processing FTA® punches,
these should already have been added (see Subheading 3.1, steps
6–8). Use nuclease-free water for the amplification negative
control. Vortex and pulse spin all samples/controls before
aliquoting. Specific volumes to be added for each are dependent
on the sample type being processed (see Table 6). Once added,
flush the tip to mix (see Note 18).
16.
Seal the plate with a Microseal “A” using a plate seal applicator or
cap strips for amplification (see Note 19). For fewer samples, cap
strips can be utilized or Microseal “A” strips can be cut to fit the
plate. Microseal “B” seals should not be used during thermal
cycling.
17.
Using a plate centrifuge, spin the plate for 30 s at around 1000 × g.
18.
Transfer the plate to the post-amplification area and run the pre-
programmed amplification as defined for Amplification 1 (see
Table 5).
19.
The plate can be left on the thermal cycler overnight. The
expiration of the plate is 2 days. It can be processed immediately
for the second amplification (see Subheading 3.2, step 1) or
stored in a refrigerator (2–8 °C) until ready to proceed. If storing,
remove Microseal “A” and replace with a Microseal “B” or strip
caps. Microseal “B” or strips can be cut to fit the plate.
Table 4 Verogen recommended thermal cyclers and amplification settings
Thermal cycler Ramp mode for Lid temperature Temperature Other notes
amp 1 and 2 settings mode settings
Veriti™ 96-well 4% Heated at a Standard
Thermal Cycler constant temp of
105 °C
ProFlex™ 96-well 0.2 °C per Heated at a None Provided
PCR System second constant temp of
105 °C
Thermal cycler Ramp mode for Lid temperature Temperature Other notes
amp 1 and 2 settings mode settings
GeneAmp PCR 8% Heated 9600 emulation Only supports
System 9700a gold heat block
Bio-Rad 4% Heated at a Calculated

constant temp of
100 °C
Eppendorf® 2% Heated Gradient S,

Simulated tube
Mastercycler®
Pro S
Verify that ramp mode and temperature settings match the listed
thermal cycler type. All thermal cyclers allow for plates and tubes made
of polypropylene, except the Eppendorf® Mastercycler® Pro S, which
only allows for plates
aAlso referred to as the ABI LTI Thermal Cycler 9700
Table 5 Amplification 1 and 2 thermal cycler parameters
Step Amplification 1 Amplification 2

Preheat lid option 100 °C 100 °C
Initial heat 98 °C for 3 min 98 °C for 30 s
PCR cycling 8 cycles of: 15 cycles of:
96 °C for 45 s 98 °C for 20 s
80 °C for 30 s 66 °C for 30 s
54 °C for 2 min* 68 °C for 90 s*
68 °C for 2 min*
PCR cycling 10 cycles of:
96 °C for 30 s
68 °C for 3 min*
Final extension 68 °C for 10 min 68 °C for 10 min
Indefinite hold 10 °C 10 °C
Each step is broken down into temperature, duration, and cycle

numbers. For steps marked with an “*”, ensure the ramping mode
chosen is the appropriate mode for the thermal cycler based on Table 4
Table 6 Composition of Amplification 1 reaction for various sample types for library
preparation
Component Purified DNA Crude lysate FTA® Cards
Samples Controls
DNA input 5.0 μL (1 ng) 2.0 μL FTA® punch 5.0 μL (1 ng)
Master mix total 10.0 μL 13.0 μL 15.0 μL 10.0 μL
PCR1 4.7 μL 4.7 μL 4.7 μL 4.7 μL
FEM 0.3 μL 0.3 μL 0.3 μL 0.3 μL
DPMA or DPMB 5.0 μL 5.0 μL 5.0 μL 5.0 μL
Nuclease-free water – 3.0 μL 5.0 μL –
Total reaction volume 15.0 μL 15.0 μL 15.0 μL 15.0 μL
The composition of the Amplification 1 PCR reaction varies slightly

based upon the sample type being processed, but the overall reaction
volume for all is 15 μL, with a target of 1 ng of DNA for purified DNA
and the positive amplification control
3.2 Library Preparation—Amplification 2: Enrichment of

Targets—Amplification and Attachment of Indices
1.
Thaw all necessary Amplification 2 reagents to room temperature
(~20 min for the adapters) (see Note 10).
2.
Remove the FSP plate from the thermal cycler or refrigerator (if
stored) (see Subheading 3.1, step 19) and allow to come to room
temperature. Cross out any labeling on the plate to ensure no
confusion and relabel the plate as “FSP2” for ForenSeq™ Sample
Plate Amplification 2 (see Notes 11 and 12).
3.
Create a thermal cycler program for Amplification 2 (see Table 4
and Table 5). The total amplification time is ~1 h. Amplification 2
can be run during the day or overnight depending on the
workflow of the laboratory.
4.
Centrifuge the FSP2 plate for 30 s at 1000 × g to remove any liquid
that has gathered on the seal or caps.
To set up the ForenSeq™ Index Plate Fixture begin by vortexing
To set up the ForenSeq™ Index Plate Fixture, begin by vortexing
5.
and pulse spinning the Index 1 (i7) and Index 2 (i5) tubes (see
Note 20).
6.
Place the i7 tubes (orange caps) within the appropriate column
holders (1–12 of a 96-well plate) of the plate fixture and the i5
(white caps) within the appropriate column holders (A–H of a 96-
well plate) of the plate fixture (see Notes 21 and 22).
7.
Gently unscrew each of the i7 caps to the point where it can just
be lifted off but do not remove.
8.
Place the FSP2 plate in the center of the plate fixture (see Note
23). Carefully remove and discard the seal or cap strips.
9.
Once all index tube caps are unscrewed, remove and discard the i7
caps (orange). To decrease the chance of contamination, start on
one side of the plate to remove the caps and work across the row
without reaching over an open tube or plate.
10.
Aspirate 4 μL Index 1 (orange i7) into each row using a multi-
channel pipette. Check all tips after drawing up the liquid to
ensure that equal volumes are present before adding to the wells.
Pipette into the bottom of the well. Dispose of the used tips with
every row. Cap each i7 tube with a new orange cap (see Note 24).
Check that each well has a yellow tint (due to the i7 index
reagent) and appears to contain the same volume, which can be
viewed through the bottom of the plate.
11.
Gently unscrew, remove, and discard the i5 caps (white). To
decrease the chance of contamination, start on one side of the
plate to remove the caps and work across the row without
reaching over an open tube or plate.
12. Aliquot 4 μL Index 2 (white i5) into each column using a multi-
channel pipette. Check all tips after drawing up the liquid to
ensure that equal volumes are present before adding to the wells.
Pipette into the bottom of the wells. Dispose of the used tips with
every column. Cap each i5 tube with a new white cap (see Note
24) Looking at the underside/bottom of the plate check that
24). Looking at the underside/bottom of the plate, check that
each well appears to contain the same volume.
13.
Vortex and pulse spin PCR2. Aliquot 27 μL into each well using a
separate pipette tip for each sample (see Note 25).
14.
Seal the plate with a Microseal “A” using a plate seal applicator or
cap strip for amplification (see Note 19).
15.
Using a plate centrifuge, spin the plate for 30 s at around 1000 × g.
16.
Amplify the plate using the pre-programmed amplification as
defined for Amplification 2 (see Table 5).
17.
The plate can be left on the thermal cycler overnight. The
expiration of the plate is 7 days. It can be processed immediately
to purify the samples (see Subheading 3.3, step 1) or stored in a
refrigerator (2–8 °C) until ready to proceed. If storing, remove
Microseal “A” and replace with a Microseal “B” or cap strips.
3.3 Library Preparation—Sample Purification—Removal

of Left-over Amplification Reagents
1.
Thaw all necessary Purification Reagents to room temperature
(~30 min for both SPB and RSB). Make sure to allow sufficient
time before beginning to allow all contents to thaw and
resolubilize (see Note 10).
2.
Remove the FSP2 plate from the thermal cycler or refrigerator (if
stored) (see Subheading 3.2, step 17) and allow to come to room
temperature.
3.
Label a new midi plate “PBP” for Purification Bead Plate (see Note
12).
4. To prepare the Sample Purification Beads (SPB) and midi plate,
begin by vortexing the beads thoroughly (see Note 26). When
pipetting, aspirate and dispense gently to ensure the appropriate
amount of beads are drawn up/dispensed (see Note 27).
5.
Calculate the volume of SPB based on the number of
samples/controls being processed (see Table 7). Vortex frequently
to ensure equal distribution of beads. Pipette 45 μL into each well
of the PBP midi plate with a single channel or multi-channel.
Ensure that the liquid is dispensed directly into the bottom of the
well with no liquid on the side.
6.
Centrifuge the FSP2 plate for 30 s at 1000 × g to remove any
condensation from the seal or caps.
7.
Using a multi-channel pipette, transfer 45 μL of each
sample/control from the FSP2 plate to the corresponding wells of
the PBP midi plate. Ensure that the liquid is dispensed directly
into the bottom of the well with no liquid on the side (see Note
28). The FSP2 plate will not have enough volume for additional
processing and can be discarded.
8.
Seal the PBP midi plate with a Microseal “B” using a plate sealer
and shake for 2 min at 1800 rpm.
9.
Once shaking is complete, let the plate sit at room temperature for
5 min (no shaking).
10.
Place the PBP midi plate on the magnetic stand. Carefully remove
the seal. Let the plate sit for 2 min or until the liquid is clear and
all beads have gathered toward the magnet. Beads gather in
opposite directions every other row based on where the magnet is
located (see Note 29).
11.
Using a 100 μL multi-channel pipette, remove and discard any
supernatant from each well (see Note 30). To avoid disrupting the
beads, insert the pipette into the opposite side of the beads
(plunger pressed down). Touch the tips to the opposite side at the
top of the well and slowly move the tips downwards until it
reaches the bottom. Once at the bottom, gently straighten the
pipette tip. Lift up gently and slowly aspirate the liquid (see Note
31). Discard the liquid.
Prepare 440 μL fresh 80% ethanol (EtOH) per sample/control in a
Prepare 440 μL fresh 80% ethanol (EtOH) per sample/control in a
12.
15 mL or 50 mL conical tube (see Note 32). Vortex or invert to
mix thoroughly and then pour the ethanol into a reagent reservoir.
13.
While the PBP midi plate remains on the magnetic stand, perform
an EtOH wash two times. Using a multi-channel pipette, add
200 μL 80% EtOH into each well. Let the plate incubate for 30 s on
the magnetic stand. Remove and discard all supernatant with a
multi-channel pipette; use clean tips for each column. Repeat for
the second wash.
14.
Seal the midi plate with a Microseal “B” and centrifuge for 30 s at
1000 × g. This should draw any leftover EtOH to the bottom of the
wells.
15.
Carefully remove the seal and place the PBP midi plate back on
the magnetic stand. Let the plate sit until beads have once again
accumulated toward the magnet.
16.
Remove and discard any leftover liquid from each well using a
20 μL multi-channel pipette. Check that no liquid remains at the
bottom of the plate (see Note 33). If liquid is still present,
individual wells can be targeted using a single-channel pipette.
17.
Invert the Resuspension Buffer (RSB) conical tube a few times and
remove the PBP midi plate from the magnetic stand.
18.
If using a multi-channel pipette to dispense RSB to each sample,
multiply the amount of samples/controls by 58 μL (includes extra
for pipetting error). Pipette this amount of RSB into a reagent
reservoir and then pipette 52.5 μL into each applicable well of the
PBP midi plate. Otherwise, for a small number of
samples/controls, use a single-channel pipette to add 52.5 μL to
each applicable well. Check that each well is holding equal
volumes after the addition.
19. Seal the plate with a Microseal “B” using the plate sealer and
shake for 2 min at 1800 rpm. After 2 min has elapsed, check that
all beads have been resuspended in each well. If not, the shake
may be repeated, or individual wells can be mixed using a pipette.
ay be epeated, o d v dua we s ca be ed us g a p pette
20.
Let sit for 2 min with no shaking. Place the PBP midi plate on the
magnetic stand. Carefully remove the seal. Let sit for 2 min or
until the liquid is clear and all beads have gathered towards the
magnet.
21.
Label a new 96-well plate “PLP” for Purified Library Plate (see
Notes 11 and 12). Using a multi-channel pipette, remove 50 μL of
each sample from the PBP midi plate and transfer to the
corresponding well of the new PLP 96-well plate (see Note 34).
22.
Seal the PLP plate with Microseal “B” or cap strips and centrifuge
for 30 s at 1000 × g.
23.
The expiration of the purification plate is 1 year. It can be
processed immediately to normalize the samples (see Subheading
3.4, step 1) or stored in a freezer (−25 to −15 °C) until ready to
proceed.
Table 7 Volume of SPB needed for sample purification
# Volume of SPB Comments

Samples/controls (μL)
<16 # Use a single-channel pipette to add SPB to each well of
samples/controls the PBP midi plate
× 50
16–96 (# To help facilitate transfer of SPB to the individual
samples/controls wells of the PBP mid plate, equally divide the volume
× 50) + 5 of SPB into a column of 8 wells of a new midi plate or
into an empty column of the midi plate being used (if
applicable). Or the entire volume of SPB can be added
to a reagent reservoir. Use a multi-channel pipette to
transfer the SPB to the wells of the PBP midi plate
>96 (# Add the entire volume of SPB to a reagent reservoir
samples/controls and then use a multi-channel pipette to transfer to the
× 50) + 200 wells of the PBP midi plate
It is essential that the correct volume of SPB is added to each sample

during the sample purification process. As with many routine
laboratory procedures, additional reagent should be included in the
aliquot to account for pipetting error, and in this case, the mode of
delivery to the samples (e.g., single-channel vs multi-channel pipette
with reagent reservoir) also impacts how much overrage to include.
This table serves as a guide for the amount of SPB overrage likely
needed for this procedural step but should be adjusted as needed for
individual practice
3.4 Library Preparation—Sample Normalization—To

Create Equal Sample Representation During Sequencing
1.
Thaw all necessary reagents to room temperature (LNB1 and
LNW1 will take longer than the other reagents, at ~30 min total
for both). Make sure to allow sufficient time before beginning (see
Note 10).
2.
Continue processing the room temperature PLP plate or if stored,
remove from the freezer and allow to come to room temperature
3.
Label a new midi plate “NWP” for Normalized Working Plate (see
Note 12).
4.
To prepare the LNA1/LNB1 master mix, begin by vortexing the
LNB1 beads thoroughly for at least 1 min, and invert at least 5
times every 15 s until beads are aspirated to the master mix tube
(see Notes 26, 27, and 35).
5.
Calculate the volume needed of LNA1 and LNB1 for the master
mix by multiplying the number of samples/controls by 46.8 μL
and 8.5 μL, respectively (these volumes include extra for pipetting
error).
6.
Label an appropriately sized tube as “Master Mix” and add the
calculated volumes of LNA1 and LNB1. When pipetting LNB1,
aspirate and dispense gently to ensure the appropriate volume of
beads is drawn up (see Note 27).
7. Vortex the master mix and invert to thoroughly mix the beads.
Immediately pipette the contents into a reagent reservoir using a
1000 L i ( N t 36)
1000 μL pipette (see Note 36).
8.
Transfer 45 μL master mix into each well of the midi plate using a
100 μL or similar multi-channel pipette (see Notes 35). Ensure
that the liquid is dispensed directly into the bottom of the well
with no liquid on the side (see Note 37). To maintain homogeneity
of the master mix in the reagent reservoir, gently pipette the
remaining master mix up and down a few times in between the
addition of master mix to each column of the midi plate.
9.
Centrifuge the PLP plate for 30 s at 1000 × g to remove any
condensation from the seal or caps.
10.
Place the PLP plate on the magnetic stand. Carefully remove the
seal or caps. Let sit for 2 min or until the liquid is clear and all
beads have gathered towards the magnet (see Note 38).
11.
Using a multi-channel pipette, transfer 20 μL of the samples from
the PLP plate to the corresponding wells of the NWP midi plate.
Ensure that the liquid is dispensed directly into the bottom of the
well with no liquid on the side (see Note 37). Do not discard the
PLP plate. There is enough volume for an additional normalization
process. Re-seal with Microseal “B” or strips caps and place the
PLP plate back into the freezer for storage.
12.
Seal the NWP midi plate with a Microseal “B” using the plate
sealer and shake for 30 min at 1800 rpm.
13.
Preparation of 0.1 N HP3 and the NLP plate can be performed
during the NWP incubation.
14.
To prepare 0.1 N HP3 reagent, begin by calculating the volume
needed of nuclease-free water and HP3 by multiplying the
number of samples/controls by 33.3 μL and 1.8 μL, respectively
(these volumes include extra for pipetting error).
15.
Label an appropriately sized microcentrifuge tube “HP3.”
16. Prepare 0.1 N HP3 using the calculated reagent volumes. To mix,
invert the tube several times. Set aside the 0.1 N HP3 until ready
ve t t e tube seve a t es Set as de t e 0 N 3 u t eady
to add it to the NWP plate after the LNW1 washes (see Subheading
3.4, step 31).
17.
Label a new 96-well plate “NLP” for Normalization Library Plate
18.
To prepare the NLP plate, begin by inverting the LNS2 tube
several times. Aliquot 30 μL LNS2 into the appropriate wells of
the NLP plate. This can be performed with a repeater pipette, if
available. Cover the wells with a Microseal “B” or strip caps to
reduce contamination risk and set the plate aside until the NWP
plate is ready for transfer to the NLP plate (see Subheading 3.4,
step 35).
19.
Once the 30-min shaking incubation of the NWP plate is complete,
immediately place the NWP midi plate on the magnetic stand.
Carefully remove the seal. Let sit for 2 min or until the liquid is
clear and all beads have gathered towards the magnet (see Note
39). Beads gather in opposite directions every other row based on
where the magnet is located.
20.
Using a 100 μL or similar multi-channel pipette, remove and
discard any supernatant from each well (see Note 30).
21.
Take the plate off of the magnetic stand and set on a flat surface.
22.
Aliquot 100 μL LNW1 per sample/control into a reagent reservoir
(this includes enough for two washes and includes extra for
pipetting error).
23.
Using a 100 μL multi-channel pipette, add 45 μL LNW1 into each
well of the NWP midi plate. The plate should not be on the
magnetic stand. Retain the remaining LNW1 in the reagent
reservoir for the second wash.
24.
Seal the NWP midi plate with a Microseal “B” using a plate sealer
and shake for 5 min at 1800 rpm.
O h ki i l t i di t l l th NWP idi l t
25. Once shaking is complete, immediately place the NWP midi plate
on the magnetic stand. Carefully remove the seal. Let sit for 2 min
or until the liquid is clear and all beads have gathered toward the
magnet (see Note 39).
26.
Using a 100 μL multi-channel pipette, remove and discard any
supernatant from each well (see Note 30). Remove the plate from
the magnetic stand.
27.
Perform a second wash with LNW1 (see Subheading 3.4, steps
23–26).
28.
Once two washes have been performed, remove the plate from the
magnetic stand, seal the NWP midi plate with a Microseal “B”
using a plate sealer, and centrifuge for 30 s at 1000 × g. This
should draw any leftover liquid to the bottom of the wells.
29.
Carefully remove the seal and place the NWP midi plate back on
the magnetic stand. Let sit for 2 min or until the liquid is clear and
all beads have gathered toward the magnet (see Note 39).
30.
Remove and discard any leftover liquid from each well using a
20 μL multi-channel pipette. Check that no liquid remains at the
bottom of the plate (see Note 33). If liquid is still present,
individual wells can be targeted using a single-channel pipette.
31.
Invert the prepared 0.1 N HP3 tube a few times and remove the
NWP midi plate from the magnetic stand.
32.
Dispense 32 μL 0.1 N HP3 into each well of the NWP midi plate.
Check that each well is holding equal volumes after pipetting. If
using a multi-channel pipette, the 0.1 N HP3 can be dispensed into
a reagent reservoir and then added to the NWP plate.
33.
Seal the NWP midi plate with a Microseal “B” using a plate sealer
and shake for 5 min at 1800 rpm. After 5 min has elapsed, check
that all beads have been resuspended in each well. If not, the
shake step can be repeated, or individual wells can be mixed using
a pipette.
34. Place the NWP midi plate on the magnetic stand. Carefully remove
the seal. Let sit for 2 min or until the liquid is clear and all beads
have gathered towards the magnet (see Note 39).
35.
Remove the cover from the NLP plate that has been set aside.
Using a multi-channel pipette, remove 30 μL of each sample from
the NWP midi plate and transfer to the corresponding wells of the
NLP plate (see Note 34). Mix using the pipette.
36.
Seal the NLP plate with a Microseal “B” using a plate sealer or cap
strips and centrifuge for 30 s at 1000 × g.
37.
The expiration of the normalized plate is 30 days. It can be
processed immediately to pool the sample libraries (see
Subheading 3.5, step 1) or stored in a freezer (−25 to −15 °C)
until ready to proceed.
3.5 Library Preparation—Pooling of Sample Libraries

1.
Continue processing the room temperature NLP plate or if stored,
remove from the freezer and allow to come to room temperature
2.
Determine the maximum number of samples that can be sequenced
based on the primer set and the flow cell used (see Table 8 and
Note 40).
3.
If processing a small sample number of samples/controls from the
NLP plate, label a single 1.5 mL microcentrifuge as “PNL” for Pooled
Normalized Libraries (see Note 12). For a large number of
samples/controls, label a single 8-tube strip instead.
4.
Vortex and centrifuge the NLP plate for 30 s at 1000 × g to remove
any condensation from the seal or caps.
5. Place the NLP plate on the magnetic stand. Carefully remove the
seal. Let sit for 2 min or until the liquid is clear and all beads have
gathered toward the magnet (see Note 41). Beads gather in
opposite directions every other row based on where the magnet is
located.
ocated
6.
Aliquot 5 μL of each sample into the labeled PNL tube/8-tube strip,
changing tips between each sample/row. If sequencing a small
number of samples, all samples are added to the single 1.5 mL tube
using a single-channel pipette. If sequencing a larger number of
samples, use a multi-channel pipette to transfer one column of
samples from the NLP plate at a time to the 8-tube strip, repeating
for each column into the same strip. This will effectively transfer all
samples from a single row of the NLP into the corresponding tube
of the 8-tube strip. Lastly, combine each tube in the strip into a final
1.5 mL microcentrifuge tube.
7.
Vortex the PNL tube and pulse spin.
8.
Do not discard the NLP plate. There is enough volume for
additional sequencing. Re-seal and place the NLP plate back into
the freezer for storage.
9.
The expiration of PNL tube/tube-strip is 30 days. It can be
processed immediately to denature and dilute the pooled libraries
(see Subheading 3.6, step 1) or stored in a freezer (−25 to −15 °C)
until ready to proceed.
Table 8 Maximum number of samples for each flow cell kit
Flow cell Primer Set A Primer Set B

Micro flow cell kit 36 12
Standard flow cell kit 96 32
The standard flow cell and micro flow cell kits each allow a separate
maximum number of samples depending on the primer set used
3.6 Denaturation and Dilution of Pooled Libraries and

Cartridge Loading for Sequencing
1. Thaw the denaturation/dilution reagents (~90 min for the
Reagent Cartridge, but less for HT1 and HSC). Remove the MiSeq
FGx™ Reagent Kit from the freezer; wait to thaw the HSC (see
Subheading 3.6, step 3). Remove the HT1 box from the underside
of the handle of the reagent cartridge and set it aside to thaw at
room temperature. Fill an appropriately sized container with
room temperature water and place the reagent cartridge in the
water for ~90 min to thaw (see Notes 42 and 43).
2.
Set the micro-heating system/heat block to 96 °C. This step can
take some time depending on the system. Let the system heat
while the reagents are thawing.
3.
During the remaining ~15 min needed to thaw the reagent
cartridge, remove the HSC (and PNL tube/tube strip, if stored
from Subheading 3.5, step 9) from the freezer and allow to thaw
to room temperature.
4.
Before continuing, ensure that all reagents are thawed and there
are no ice chunks visible within the reagent cartridge. Once
completely thawed, remove the cartridge from the water bath and
tap it on the bench to remove water droplets from the surface of
the cartridge. Make sure that the base is dry and that no water has
pooled on the top of the cartridge.
5.
If a benchtop cooler or ice bucket is not available, prepare an ice
water bath at this time by mixing 1 part nuclease-free water and 3
parts ice.
6.
Label a 1.5 mL microcentrifuge tube as “HSC” for Human
Sequencing Control.
7.
Vortex and pulse spin the HSC tube from the kit. Add 2 μL HSC,
2 μL HP3, and 36 μL nuclease-free water to the newly labeled HSC
tube (see Note 44). Vortex the prepared HSC tube and centrifuge
briefly. Let stand at room temperature for 5 min.
8.
While the HSC is incubating, label a 1.5 mL microcentrifuge tube
as “DNL” for Denatured Normalized Libraries and transfer 591 μL
HT1 (hybridization buffer) to the DNL tube.
9. Vortex and pulse spin the PNL tube to remove liquid from the cap.
Transfer 7 μL of the PNL to the DNL tube. Flush the tip to mix. Do
not discard the PNL tube. There is enough volume left for
not discard the PNL tube. There is enough volume left for
additional sequencing. Place the PNL tube back in the freezer for
storage.
10.
After the HSC is done incubating, transfer 4 μL to the DNL tube.
Flush the tip to mix and pulse spin. Incubate for 2 min on the
preheated micro-heating system set at 96 °C (see Note 45).
11.
After incubation, invert the DNL tube several times and
immediately place it into the benchtop cooler, ice bucket, or
prepared water bath to snap-cool (see Note 46). Incubate for
5 min.
12.
During the snap-cool, prepare the reagent cartridge for loading.
Invert the cartridge gently 10 times in order to mix the reagents
within. Tap the cartridge on a counter gently to remove bubbles
and water from the outside of the cartridge. Inspect wells 1, 2, and
4 to make sure they are thoroughly mixed. Using an empty
1000 μL pipette tip, pierce the foil of the well labeled 17. This is to
prevent sample loss during the addition of the denatured
libraries. Well 17 is highlighted in a deep orange color and is
labeled “Load Samples.”
13.
After the snap-cool incubation, remove all contents from the
bottom of the tube with a pipette set to 600 μL (see Note 47).
Slowly (to avoid air bubbles) load all contents into the reagent
cartridge in the marked well “17”. Once loaded, gently tap the
cartridge to ensure all liquid is at the bottom.
14.
Immediately proceed to instrument setup and loading (see
3.7 Instrument Setup and Performing a Run

1.
Login to the ForenSeq™ Universal Analysis Software (UAS) and
click “Create New Run”. The next screen prompts to choose
“Standard” or “Micro”. Choose the appropriate option and click
“BEGIN”.
Type in the Run Name in the white box under “Run” on the left
yp
2.
side of the screen (see Note 12). A run description can be added
in the box under “Description” in the middle of the screen. This is
not required to save the run. Choose “Forensic Application” from
the drop-down menu in the box under “Application” on the right
side of the screen.
3.
Add samples to the run manually (see Subheading 3.7, step 4),
using a tab-delimited (.txt) import file (see Subheading 3.7, steps
5–15), or to an existing run file (see Subheading 3.7, step 16).
4.
To manually add samples, click the “ADD NEW SAMPLES” button
in blue under the “Name” box. Fill in the “Sample Name” and
“Project Name” fields. A “Sample Description” may be chosen but
is not required. Choose the appropriate “i7 Index”, “i5 Index”,
“Sample Type”, and “Primer Mix” from the respective drop-down
menus. Once complete, click the “+ ADD NEW SAMPLE” blue box
at the right side of the screen. Complete this action for each
sample (see Note 48). Click the blue “Save Run” button at the
bottom of the screen. Continue to prepare the instrument for the
sequencing run (see Subheading 3.7, step 17).
5.
To import a pre-filled samples file, begin by creating a tab
delimited (.txt) file using an application such as Microsoft® Excel®
(Excel). In the first row, enter the following row headers exactly in
the specified cell: “SampleName” (A1); “Project” (B1); “i7Index”
(C1); “i5Index” (D1); “SampleType” (E1); “SampleDescription”
(F1); and “MixType” (G1) (see Fig. 2; Notes 49 and 50).
6.
In column A, type the user-defined sample/control names.
7.
In column B, type the user-defined same project name for each
sample/control.
8.
In column C, type the appropriate i7 Index for each
sample/control, choosing from: “R701”, “R702”, “R703”, “R704”,
“R705”, “R706”, “R707”, “R708”, “R709”, “R710”, “R711”, or “R712”
(see Note 50).
In column D type the appropriate i5 Index for each
In column D, type the appropriate i5 Index for each
9.
sample/control, choosing from: “A501”, “A502”, “A503”, “A504”,
“A505”, “A506”, “A507”, or “A508” (see Note 50).
10.
In column E, type the appropriate sample type for each
sample/control, choosing from: “Positive Amplification Control”,
“Negative Amplification Control”, “Sample”, or “Reagent Blank”
(see Note 50).
11.
In column F, type the user-defined sample descriptions. These are
not required.
12.
In column G, type the appropriate primer mix for each
sample/control, choosing from “A” or “B” (see Note 50).
13.
After completing the appropriate information for each sample,
save the Excel file as a tab-delimited (*.txt) file for upload.
14.
To import the file, return to the UAS software and click “IMPORT
SAMPLES” directly under the “Name” box. Either drag the .txt file
into the box labeled “DROP FILES TO UPLOAD”, or click on the box,
navigate to the appropriate .txt file, and click “Open”.
15.
Review the information and edit any errors. Click the blue “Save
Run” button at the bottom of the screen. Continue to prepare the
instrument for the sequencing run (see Subheading 3.7, step 17).
16.
To add to an existing sample run, click the “Add Existing Samples”
button and type in the sample name to add or the project name of
the previous run to find the sample. Fill in the remaining
information as described for manual input (see Subheading 3.7,
step 4). Click the blue “Save Run” button at the bottom of the
screen. Continue to prepare the instrument for the sequencing
run (see Subheading 3.7, step 17).
17. Select “Sequence” from the home screen on the MiSeq FGx. Next,
select “Forensic Genomics”. The next screen requires the correct
run folder to be chosen. Click the arrow and a list of loaded runs
are available (see Note 51). Choose the correct run file and click
“Next”, which initiates a sequence of prompts explained below.
, q p p p
18.
Remove the flow cell from the liquid storage container with
forceps or drain some of the liquid and manually remove it
wearing a glove. Rinse the flow cell with nuclease-free water to
remove the storage buffer salts. Dry the flow cell using a lint-free
wipe. Make sure the entire flow cell is dry. This may require very
careful drying between the glass and plastic areas (see Note 52).
Once it is dried, an alcohol wipe can be used to clean the glass of
the flow cell. Inspect the flow cell to ensure there is no remaining
lint or streaks on the surface. If the gasket has moved, gently push
it back into place.
19.
Load the flow cell by following the software prompts. Open the
flow cell compartment and gently push the white flow cell latch
release button, which opens the flow cell latch. The flow cell
should be at the top. The notched side of the flow cell should be at
the upper right. Close the compartment door. An audible click
occurs when the latch is secure. Click “Next”.
20.
Load the PR2 bottle following the software prompts. Open the
door to the reagent compartment under the screen. Lift up the
sipper handle. Remove any bottles currently on the instrument in
the PR2 bottle location and replace with a fresh bottle of PR2:
invert the new PR2 bottle to mix, remove the lid, and insert. If
needed, empty the waste bottle into a biohazard bin and place it
back into the instrument. Pull the handle to bring the sipper back
down. Click “Next”.
21.
Load the loaded reagent cartridge following the software
prompts. Lower the reagent chiller door and insert the loaded
cartridge. Slide the cartridge on the bottom of the tray until it
stops. The handle of the cartridge should be pointed outwards.
Close both the reagent chiller door and the reagent compartment
door. Click “Next”.
22. The next screen asks to confirm the run name and type of run that
will be performed. Check this information and click “Next” if
everything is correct. The next screen displays a list of run
parameters and performs a run pre-check. Once all parameters
p p p p
have been tested and are in working order, the “Start Run” button
is available. Click “Start Run” to begin.
23.
Basic run parameters can be monitored during the run from the
“Sequencing” screen, including run progress, fluorescence
intensity, quality information, as well as current actions and
temperatures of the instrument and components. The run can also
be stopped and paused from this window [14].
24.
After a run is completed, a post-wash option is available on the
screen. Complete a wash immediately after the sequencing is
complete for the best maintenance of the instrument (see
Fig. 2 UAS sample file. Displayed is an example of a pre-filled sample file for upload into the
UAS software
3.8 Perform a Post-Run Wash

1.
After a run is completed, leave the used flow cell in the instrument
for the wash run, which is required to complete the wash.
2.
Prepare a 1:30 dilution of 6% sodium hypochlorite. Vortex to mix.
In a MiSeq wash tube, further dilute the 1:30 to prepare 1000 μL of
0.01% sodium hypochlorite solution. Pipette to mix using a
1000 μL pipette.
3. To load the wash tray, use a large volume repeater pipette to add
6 mL nuclease-free water to each well, except to well 17 (Sample
Well). Insert the prepared MiSeq wash tube with 0.01% sodium
) p p q %
hypochlorite into well 17 of the wash tray. The tube should be flush
with the lip of the well in the tray.
4.
Fill an empty PR2 bottle with 350 μL nuclease-free water.
5.
Return to the instrument. Click “Start Wash” (see Note 53). Wait a
few seconds before opening any doors. The instrument raises the
sippers in the used cartridge.
6.
Wait until the sippers are fully raised (see Note 54) and replace the
used run cartridge with the prepared wash cartridge (see
Subheading 3.8, step 3) by opening both the reagent compartment
and reagent chiller doors. Close the chiller door after the wash
cartridge is completely inserted. Lift up the handle to the sippers
on the right side. The wash bottle will replace the leftover PR2
reagent bottle from the run. Remove the previous PR2 bottle and
replace it with the wash bottle (see Subheading 3.8, step 4). Empty
the waste bottle into a biohazard bin and place it back into the
instrument. Lower the sipper handle back down and close all
doors.
7.
Click “Next” and allow the wash to complete. It lasts about 30 min.
8.
Once the wash run is complete, leave all consumables within the
instrument, including the wash containers, until the next run is
performed.
9.
During storage, the wash tray should always be cleaned and turned
upside down to decrease the chance of mold growth in the tray.
4 Notes
1.
DNA concentration must be known for purified DNA before
beginning this process. Quantify the amount of total human DNA
using validated qPCR or fluorometric-based assays.
The size of tip depends on the brand of pipettes utilized; ensure
The size of tip depends on the brand of pipettes utilized; ensure
2.
that the appropriately sized tips are used. It is also best to match
up the brands of pipette tips and pipettes. Using unmatched tips
can cause changes in the volume pipetted/aspirated.
3.
Verogen recommends Bio-Rad brand.
4.
Only needed for FTA® Card processing.
5.
Examples include QuickExtract DNA Extraction Solution or
SwabSolution Kit.
6.
Normalization reagents are hazardous. Both formamide and 2-
mercaptoethanol are used. Handle with caution and dispose of
properly.
7.
Author uses a ThermoFisher MicroAmp™ Splash-Free 96-Well
Base.
8.
Author uses a magnetic stand for a 96-well plate.
9.
The laboratory can purchase a unit that also is able to heat
samples at the same time. Manufacturers recommend BioShake iQ
or BioShake XP.
10.
Make sure to allow sufficient time before beginning to allow all
contents to thaw and resolubilize. This is especially important for
the SPB and LNB1 tubes and may affect the binding of DNA to the
beads if thawing is incomplete. For LNA1, reagents may crystallize
during storage. Vortex thoroughly and check that there are no
crystals present. If present, let thaw further and vortex again.
Crystals can be best seen if the tube is held up to a light.
11.
If processing one column of samples (eight, including all controls),
this step can be performed using an 8-tube strip and
accompanying 8-cap strip. Ensure that the laboratory has a pulse
spinner or microcentrifuge that can fit 8-tube strips.
12. Follow the labeling/naming system for the laboratory. An example
labeling system can include the plate/tube type (or analyst
labeling system can include the plate/tube type (or analyst
initials) and process date. For example, “FSP_011022,” using a
two-digit month, two-digit date, and two-digit year. For storage
and organization purposes, write the expiration date of the plate,
if applicable.
13.
If the sample concentration is <0.2 ng/μL, then obtaining 1 ng of

DNA in a volume of 5 μL is not possible. The sample could be
concentrated if such a method is validated. Otherwise, only use a
maximum allowable volume (5 μL) for the amplification reaction.
14.
If processing different types of samples together, e.g., DNA
extracts and FTA® Cards, two separate master mixes should be
made. Make sure that the tubes are labeled appropriately in order
to decrease any chance of confusion.
15.
It is possible to prepare a batch of Primer Set A and Primer Set B
samples together, but they must be sequenced separately. There
are specific run and analysis parameters for each primer set.
16.
A minimum of six samples (including reagent blank or other
controls laboratory uses), positive amplification control, and
negative amplification control (eight total) should be processed.
This is to ensure that the volumes of reagents for the master mix
are large enough to reduce pipetting inaccuracies due to small
volumes.
17.
Use of a single-channel pipette is recommended for ≤8 samples.
Use of a repeater or multi-channel pipette is recommended for >8
samples, in which case the master mix should be equally
distributed into an 8-tube strip and dispensed into each column of
the 96-well amplification plate. Author recommends utilizing a
new pipette tip for each well to ensure an even distribution.
18.
Flush the tip by pipetting the liquid up and down into the tip,
gently, to avoid saturating the barrier.
19. To seal Microseal “A,” push with enough pressure to ensure that
the plate has been thoroughly sealed, but not too much pressure
the plate has been thoroughly sealed, but not too much pressure
that the seal is no longer viable. A clear shadow outline should be
visible around each well. If the seal is not flush with each well due
to overpressure, gently remove and apply a new seal.
20.
These tubes are narrower than the average microcentrifuge tube.
It helps to place empty 1.7 or 2.0 mL microcentrifuge tubes into
the pulse spinner (caps removed/cut off at the hinge) and place
the index tubes inside these empty tubes.
21.
The order and number of the indices used depends on the number
of samples being sequenced. This should be determined before
library prep.
22.
The author recommends keeping track of the volume of each

index and rotating out the i5 and i7 indices throughout different
runs.
23.
The FSP2 plate is not secured within the ForenSeq™ Index Plate
Fixture. The plate can be placed in a plate holder during pipetting
to better stabilize.
24.
New caps are used for each assay to ensure that no contamination
occurs between index tubes. If sequencing smaller batches, the kit
does not contain enough caps and additional caps should be
purchased.
25.
To avoid air bubbles, pipette PCR2 slowly. For >8 samples, PCR2
can be distributed into an 8-tube strip and dispensed using a
multi-channel pipette. For ≤8 samples, use a single-channel
pipette.
26.
During storage, the SPB/LNB1 beads accumulate at the bottom of
the tube. During vortexing, it helps to invert the tube multiple
times and re-vortex to unclump.
27. When pipetting into the midi plate, the SPB or LNB1 may require
additional mixing if the beads have not been in use; this ensures
homogeneity.
homogeneity.
28.
This must be done in order to ensure that all leftover
amplification reagents have been removed.
29.
This step may last longer than 2 min. If at any point beads are
drawn up into the pipette tips inadvertently, dispense the liquid
back into the appropriate wells and let sit for approximately 2 min
to rebind.
30.
Ensure that all liquid has been removed to allow for sufficient
washing and sample transfer later in the process.
31.
Ensure that there is a space between the tip and the bottom;
otherwise, not all liquid is removed. Barely lift up the pipette tip
to make sure there is space to draw up all of the liquid. To avoid
interacting with the beads, insert the pipette to the opposite side
of the beads (plunger down). Touch the tips to the opposite side at
the top of the well and slowly move the tips downwards until it
reaches the bottom. Once at the bottom, gently straighten the
pipette tip. Lift up gently and slowly to aspirate the liquid.
32.
Prepare fresh 80% EtOH for every preparation to ensure optimal
results. The formula contains overage.
33.
It is crucial that no liquid remains. Otherwise, the sample is
diluted and less than optimal results may be obtained.
34.
Author has observed beads sticking to the side of the pipette tips
at this point during this transfer step. It has not been shown to
have an impact on the amount of DNA template sequenced,
although no published research has been performed at this time
to verify.
35.
It is crucial that an equal amount of beads are added to each
sample so that each sample has an equal representation in the
pooled library. Too many beads added can lead to an
overabundance of reads generated for that sample, and too little
can lead to a decreased read count.
36. It is important to use a pipette tip with a larger bore size so that
all beads are transferred.
37.
This must be done in order to ensure that all beads are available
for the DNA to bind.
38.
This is to remove any beads remaining from the purification step
from the supernatant.
39.
This step tends to clear faster than the purification step and does
not always require the full 2 min.
40.
It is recommended to include the sequencing amplification
positive and negative controls on each run performed, even if
previously sequenced on a different run. If an error has occurred
during the sequencing process, and a positive and negative
control were not included, the ability to appropriately
troubleshoot is lessened, as well as the assistance that Verogen
can provide in determining the reason for the problem.
41.
This is to remove any beads from the supernatant that are
remaining from the normalization step.
42.
Denaturation and dilution of the pooled libraries should occur the
day of the sequencing run. Once this section is complete, the
loaded cartridge must be immediately processed on the
instrument to avoid instrument and sequencing errors.
43.
The water does not have to be nuclease-free and should not go
above the “Fill Line” on the cartridge once it is placed in the bath.
Author recommends drawing a line on the container to the
appropriate fill line during the first thaw for future uses.
Alternatively, the reagent cartridge can be thawed in the
refrigerator, which will take ~5–6 h. Once the cartridge is thawed,
it can sit on ice or at room temperature for up to 6 h, but it is best
practice to load the sample immediately.
44. Do not begin this step until the heating system is up to
temperature. Once this step begins, the subsequent steps are
timed.
45.
Once the sequencing run has started, the HSC tube can be
discarded. The manufacturers advise against storage and repeated
use of this reagent, as it can lead to less-than-optimal results.
46.
Remove the cooler from the freezer right before use. The
temperature should be −25 to −15 °C. If removed too early, the
temperature may be too warm, and incomplete denaturation may
occur.
47.
Do not remove any of the contents that may have condensed at
the top of the DNL tube during the cooling step. Incomplete
denaturation/dilution may have occurred and leads to less-than-
optimal results.
48.
Each sample is added to a growing list at the bottom of the screen.
If the initial sample setup was done incorrectly, the indices,
sample type, and/or primer mix type can be fixed using the
appropriate drop-down menus.
49.
The author finds this is easiest to set up in Excel.
50.
This must be exact, otherwise the instrument does not recognize
the content.
51.
The instrument only displays runs that have not been completed.
52.
The author has found the easiest way to do this is to work from
the underside of the flow cell and slide the edge of the wipe up to
the area to dry. Capillary action pulls the liquid out from under the
edge onto the wipe. Use extra care around the port gasket.
53.
This option becomes available after a sequencing run has been
completed.
54.
For an indication that the sippers are fully raised, the noise will
stop and the action on the screen disappears.
References
1. Verogen (2022) ForenSeq DNA Signature Prep Kit reference guide. Available via Verogen.
https://verogen.com/wp-content/uploads/2022/01/forenseq-dna-signature-prep-
reference-guide-PCR1-vd2018005-d.pdf. Accessed 31 March 2022
2. Xavier C, Parson W (2017) Evaluation of the Illumina ForenSeq™ DNA Signature Prep Kit—
MPS forensic application for the MiSeq FGx™ benchtop sequencer. Forensic Sci Int Genet
[Crossref][PubMed]
3. Jä ger A, Alvarez M, Davis C et al (2017) Developmental validation of the MiSeq FGx Forensic
Genomics System for targeted next generation sequencing in forensic DNA casework and
database laboratories. Forensic Sci Int Genet 28:52–70. https://doi.org/10.1016/j.fsigen.
2017.01.011
[Crossref][PubMed]
4. Moreno L, Galusha M, Just R (2018) A closer look at Verogen’s Forenseq™ DNA Signature
Prep Kit autosomal and Y-STR data for streamlined analysis of routine reference samples.
Electrophoresis 39:2685–2693. https://doi.org/10.1002/elps.201800087
[Crossref][PubMed]
5. Churchill J, Novroski N, King J et al (2017) Population and performance analyses of four

major populations with Illumina’s FGx Forensic Genomics System. Forensic Sci Int Genet
[Crossref][PubMed]
6. Kö cher S, Mü ller P, Berger B et al (2018) Inter-laboratory validation study of the ForenSeq™

DNA Signature Prep Kit. Forensic Sci Int Genet 36:77–85. https://doi.org/10.1016/j.fsigen.
2018.05.007
[Crossref][PubMed]
7. Gettings K, Kiesler K, Vallone P (2015) Performance of a next generation sequencing SNP

assay on degraded DNA. Forensic Sci Int Genet 19:1–9. https://doi.org/10.1016/j.fsigen.
2015.04.010
[Crossref][PubMed]
8. Fattorini P, Previderé C, Carboni I et al (2017) Performance of the ForenSeq™ DNA

Signature Prep Kit on highly degraded samples. Electrophoresis 38:1163–1174. https://
doi.org/10.1002/elps.201600290
[Crossref][PubMed]
9. Bornman D, Hester M, Schuetter J et al (2012) Short-read, high-throughput sequencing

technology for STR genotyping. Biotech Rapid Dispatches 2012:1–6
10. Sharma V, van der Plaat DA, Liu Y et al (2020) Analyzing degraded DNA and challenging
samples using the ForenSeq™ DNA Signature Prep Kit. Sci Justice 60:243–252. https://doi.
org/10.1016/j.scijus.2019.11.004
[Crossref][PubMed]
11.
Verogen (2021) MiSeq FGx Sequencing System reference guide (VD2018006). Available via
Verogen. https://verogen.com/wp-content/uploads/2021/02/miseq-fgx-system-
reference-guide-vd2018006-f.pdf. Accessed 31 Mar 2022
12. Verogen (2017) Library Normalization Wash 1 safety data sheet, revision A. Available via
Verogen. https://verogen.com/wp-content/uploads/2020/06/LP-LNW1-VD2020017-A.
pdf. Accessed 31 Mar 2022
13. Verogen (2021) Introducing the MiSeq FGx Reagent Micro Kit for forensics technical note
(VD2018016). Available via Verogen. https://verogen.com/wp-content/uploads/2021/02/
introducing-miseq-fgx-reagent-micro-kit-technical-note-vd2018016-b.pdf. Accessed 31
Mar 2022
14. Verogen (2018) ForenSeq™ Universal Analysis Software guide. Available via Verogen.
https://verogen.com/wp-content/uploads/2018/08/ForenSeq-Univ-Analysis-SW-Guide-
VD2018007-A.pdf. Accessed 31 Mar 2022
Index
A
Agarose gel 130–147, 342, 360
Alu repeats 149–173
Amplification 3, 4, 11–13, 15–17, 19, 35, 37, 55, 114, 116, 121, 123–
125, 131, 144, 149–159, 161–164, 166–173, 176, 177, 182, 185–187,
189, 191, 195, 200, 204, 207–212, 214, 216–225, 228–237, 241–251,
253–262, 264–280, 286, 301, 303, 311, 332, 334, 340–342, 345–347,
368, 370, 371, 400, 401, 405–410, 420, 423–426
Ancestry SNPs 398, 399
Applied Biosystems 4, 37–39, 53–80, 149, 150, 152, 168, 170, 175–
188, 190, 235, 241–251, 264, 265, 275, 285–305, 367–394
Archived latent fingerprints 351–356
AutoMate Express™ 36, 39, 53–80
Automation 36, 37, 84, 369
B
Blood 8, 18, 36, 38–44, 46, 55, 56, 60, 61, 63–65, 67, 75, 80, 84–87, 91,
119–123, 208, 216, 219, 223, 228, 232, 235, 255, 257–259, 261, 368,
370, 372, 373, 403
Bone analysis 332
Bone extraction 64, 93–102, 337
Buccal cells 119–125, 222, 235, 266
C
Capillary array 265, 267, 286, 289, 291, 292, 301
Capillary electrophoresis (CE) 3, 9, 12, 19, 35, 236, 243, 247, 257, 259,
260, 263–280, 285–305, 335, 344, 348, 369, 398
ChargeSwitch® Forensic DNA Purification Kit 36, 38, 265, 266, 272,
273
CODIS loci 11, 208, 253, 254
Combined DNA Index System (CODIS) 207, 208, 242, 332, 367, 368,
385, 386, 391, 394
Contamination 4–9, 14–16, 30, 36, 40, 47–49, 54, 57, 65, 67, 69, 77, 78,
80, 83, 84, 90, 95, 113, 116, 125, 132, 153, 167, 169, 178, 182, 184, 216,
217, 219, 220, 222, 223, 232, 233, 243–245, 248, 250, 254, 262, 279,
333, 346, 382, 394, 406, 410, 415, 424
Controls 4, 8–12, 18, 19, 24, 30, 40, 41, 43, 46, 54, 60–65, 67–69, 76,
77, 85, 87–89, 105, 119, 120, 132, 134–136, 139, 140, 144, 145, 152,
153, 156, 157, 159, 160, 166–170, 176, 179, 182, 190–193, 195, 197,
200, 202, 209, 210, 212, 214, 216–225, 228, 230–234, 237, 238, 242,
243, 245–250, 254–262, 267, 268, 270, 278, 294, 297, 332–334, 340–
342, 347, 363, 365, 372, 373, 377, 378, 381, 382, 385, 389–391, 394,
400, 402, 404–415, 417, 418, 420, 423, 424, 426
Corneocytes 351, 359, 360
D
Degradation index 186, 187
Demineralization 93–102, 337
Diamond™ Nucleic Acid Dye (DD) 360–365
Differential extraction 24, 35, 46, 61, 103–116
Direct amplification 19, 208, 210–212, 214, 216–221, 223–225, 227,
229–235, 237, 254, 255, 257–259, 264, 265, 363, 370, 371
DNA 3, 23, 35, 53, 83, 93, 103, 120, 129, 149, 175, 189, 207, 227, 241,
253, 264, 285, 307, 331, 351, 359, 367, 397
DNA amplification 207–224, 227, 231, 296, 336, 338–340
DNA analysis 3–19, 24, 35, 38, 93, 120, 175, 207, 244, 254, 331–348,
351–356, 367, 368
DNA degradation 101, 144, 189
DNA extraction 3, 9, 17, 31, 35–50, 53–80, 83–91, 93, 94, 101, 104,
106, 120, 263–280, 337, 340, 352, 353, 423
DNA IQ™ System 36–38, 40–43, 105
DNA migration 130, 145
DNA polymerase 150, 152, 176, 190, 198, 242, 254, 257, 334, 370
DNA purification 29, 83, 103–116, 119–125, 273
DNA quantification/quantitation 9–11, 19, 31, 37, 42, 43, 45, 65, 72,
175–188, 236
DNA typing 348
E
Epithelial cells 31, 103, 124
Ethanol precipitation 23–32
Extraction 4, 9–13, 17–19, 25, 26, 30, 35–44, 46, 47, 49, 54–65, 67, 68,
71–80, 83, 85–91, 93–102, 105–108, 110, 111, 114, 124, 132, 135, 140,
141, 147, 173, 191, 222, 236, 246, 249, 250, 261, 264, 267, 268, 278,
333, 335–337, 339, 346, 355, 356, 368, 370, 393, 403, 405, 408
F
Fast PCR 263–280
FBI DISC 368
ForenSeq™ DNA Signature Prep Kit 397, 400, 403, 404
Forensic biology 18, 95, 351
Forensic DNA 3–19, 24, 35, 36, 38, 39, 53–80, 207, 244, 245, 332, 351–
356, 367
Forensic DNA analysis 3–19, 24, 35, 38, 207, 244, 351–356, 367
Forensic DNA sequencing 397–427
Forensic Science 95, 105, 211, 212, 362
Fragment analysis 231–233, 235, 274, 285, 286, 295
FTA® Cards 19, 119–125, 223, 235, 400, 403, 404, 407, 408, 423
FTA® Indicating Cards 120, 121, 223, 235
G
GelRed® Nucleic Acid Stain 131, 133, 143
GeneMarker™ HID 372, 385, 389, 391, 392
3500 Genetic Analyzer 285–305
3500xL Genetic Analyzer 285
Genetic Analyzer 265–267, 274, 276, 277, 280, 285
GlobalFiler™ 241–251, 265, 269, 271, 274, 368
GlobalFiler™ Express (GFE) 244, 368, 370–373, 376, 389, 390, 393,
394
H
Hair analysis 332
I
Investigator 24plex GO! 261
Investigator 24plex QS 253–262
K
KAPA2G™ Multiplex Mix 264, 266, 270
L
Latent DNA 359–365
Likelihood ratio (LR) 307–311, 316–323, 325, 327, 385–387
Locus 190, 208, 242, 308, 309, 312, 315, 316, 320, 321, 326, 327, 331,
372, 385, 387, 390, 398
Low volume amplification 264, 265, 267, 272
LRmix Studio 307–309, 311, 312, 314, 315, 317–319, 321–324, 326,
327
M
MagAttract Suspension G 84, 85
Massively parallel sequencing (MPS) 266, 270, 272, 273, 397
Microcon® centrifugal filter purification 23–32
Microscopy 31, 32, 112, 333, 346, 360–362, 364
MiSeq FGx 401, 404, 405, 417, 420
Mitochondrial DNA (mtDNA) 5, 331–348
Mixture interpretation 227
Molecular sieve 130
Multiplex 208, 242, 253, 264, 266, 270
N
Next generation sequencing (NGS) 5, 405
NGM SElect™ Express 368, 371–373, 376
Normalized extraction 264, 265, 267–270, 272, 278
O
Organic extraction 23–32, 35, 36, 106–109, 113, 336–339
P
Paramagnetic resin 36–38
Personal protective equipment (PPE) 4, 5, 18, 30, 40, 84, 95, 122, 143,
178, 222, 229, 245, 255, 267, 352
Phenol 23, 25, 28, 95, 97, 113, 114, 333, 337, 339
Phenotypic SNPs 399
Polymerase chain reaction (PCR) 5, 10, 11, 13, 15–17, 19, 23–25, 28,
35, 37, 47, 55, 59, 65, 84, 104, 106, 107, 113, 114, 116, 129, 144, 149,
151, 152, 157, 159, 171, 176–180, 185, 189, 190, 193–195, 198–200,
203, 204, 207, 210, 212, 214, 216–224, 227–236, 241–251, 253–266,
268–272, 274, 278, 286, 332–334, 340, 342, 344, 347, 370, 371, 403,
406–408
PowerPlex® Fusion 207–224, 269, 271, 274
PowerPlex® Y23 227, 228, 230–234, 269, 271, 274
PowerUp™ SYBR® Green Master Mix 149–173
Precautions 4–12, 24, 40, 105, 121, 143, 245, 250, 267
PrepFiler™ 53–80
PrepFiler™ BTA 53, 58–60, 63, 70, 76
PrepFiler Express™ 56, 57, 59, 67, 68
PrepFiler Express™ BTA 53, 59
Probabilistic modeling 308
Probability of drop-in (pDI) 309
Probability of drop-out (pDO) 309–311, 317, 319–321, 327
Promega DNA IQ™ System 103–116
Q
QIAamp DNA Blood Mini Kit 38, 40–42, 46
QIAamp DNA Investigator Kit 38, 40–43, 353, 354
QIAamp DNA Mini Kit 38, 40–42, 46
QIAGEN BioSprint® 96 (BioSprint® workstation) 83–91
Quality assurance 4, 9, 17–19, 24, 46, 129, 149, 264, 368
Quality control 6, 18, 24, 244
Quality sensors (QS) markers 253, 254
Quantification 3, 9, 10, 13, 19, 31, 37, 129, 130, 140, 144, 150–152,
164, 167, 168, 172, 175–188, 191–193, 195–197, 203, 236, 255, 261,
265, 277, 278, 400, 401
Quantifiler Trio 176, 180
Quantitation 4, 10, 11, 19, 42, 43, 45, 55, 65, 72, 77, 78, 91, 109, 110,
156, 175–188, 191, 195, 204, 250, 269, 272, 370, 407
Quantitative gel electrophoresis 129–147
Quantitative PCR (qPCR) 10, 11, 37, 116, 131, 149–173, 176–178, 189,
193, 420
R
Rapid DNA 4, 367–394
RapidHIT™ 367–394
RapidINTEL™ 368, 370, 373, 376, 389, 393
RapidLINK™ 368, 370, 372, 373, 377, 379, 383–389, 391, 393
Rapid STR analysis 369
7500 Real-Time PCR System 149, 152, 154, 176, 190
Real-time qPCR 190
S
Saliva 5, 40–43, 61, 67, 119–125, 368, 370, 373, 403
SDS software 152, 155–157, 161, 166, 167, 170, 171
Sexual assault evidence 190
Short tandem repeat (STR) 3, 5, 12, 37, 116, 124, 125, 149, 189, 207,
208, 227, 242, 253–255, 258, 259, 262, 312, 331, 351–356, 363, 368,
369, 372, 398, 399, 401
Silica 36–39, 47–49, 55, 56, 85, 352, 355
Single nucleotide polymorphism (SNP) 399
SNP analysis 397
Spermatozoa 103, 104
Standard curve 10, 151, 155, 156, 158, 162–164, 167, 171, 172, 177,
178, 181–183, 185, 186, 191, 192, 195, 197, 200, 201, 203, 204
STR amplification 11–12, 37, 116, 120–124, 165, 173, 263–280
STR profiles 11, 12, 19, 35, 55, 124, 125, 149, 165, 204, 253, 264, 265,
267, 274, 276–278, 280, 301, 308, 331, 352, 368–372
STR sequencing 242, 401
SYBR® Green I dye 150–152, 166
T
Thermo Fisher Scientific 57, 58, 66, 69–71, 74, 141, 146, 160, 161, 164,
368, 374, 375, 378–380, 384, 386, 389
Touch DNA 40–43, 61, 80, 351, 352, 368
Y
Yield gel 130, 139, 141
Y-STR 152, 208, 227, 242, 253, 399

Catherine Cupples Connon (Editor) - Forensic DNA Analysis - Methods and Protocols (Methods in Molecula

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Catherine Cupples Connon (Editor) - Forensic DNA Analysis - Methods and Protocols (Methods in Molecula

Uploaded by

Copyright:

Available Formats

Volume 2685

Methods in Molecular Biology

For further volumes: http://​www.​springer.​com/​series/​7651

Forensic DNA Analysis

ISSN 1064-3745 e-ISSN 1940-6029

© The Editor(s) (if applicable) and The Author(s), under exclusive

The use of general descriptive names, registered names, trademarks,

This Humana imprint is published by the registered company Springer

Catherine Cupples Connon

1. Forensic DNA Analysis: An Overview

Catherine Cupples Connon

3 Routine Guidance for DNA Processing

3.2 DNA Extraction and Purification

3.4 STR Amplification

3.5 STR Profile Detection

Reagent Resistivity (MΩ- Conductivity Total organic Heterotrophic

A partial summary of the properties used to classify water by the

Type II water is highly pure—but not as pure as Type I (see Table 1)

Distilled water (aka dH2O) is produced via distillation, which is the

4.2 Tris-EDTA (TE) Buffer Versus Water

5. Connon CC, LeFebvre AK, Benjamin RC (2016) Development of a normalized extraction to

14. Wikipedia (2022) Purified water. Available via Wikipedia. https://​en.​wikipedia.​org/​wiki/​

2. Organic Extraction of Nucleic Acids

Key words Forensic science – DNA extraction – Organic extraction –

3.2 Sample Preparation and Lysis: Tissue Samples

Proceed to Organic Isolation of DNA (see Subheading 3.6, step 1).

3.3 Sample Preparation and Lysis: Bones

3.4 Sample Preparation and Lysis: Teeth

3.5 Sample Preparation and Lysis: Differential Procedure

3.6 Organic Isolation of DNA

3.7 Microcon Purification

3.8 Ethanol Precipitation Purification

2. Zeugin JA, Hartley JL (1985) Ethanol precipitation of DNA. BRL-focus 7:1–2

3. Manual Silica-Based DNA Extractions

Catherine Cupples Connon

Key words DNA extraction – DNA IQ System – QIAamp DNA Blood

Kit Manual Automated

BioSprint® DNA Blood Kit – – BioSprint® 96 – ✓

ChargeSwitch® Forensic DNA – – iPrep™ Purification – ✓

DNA IQ™ System – ✓ Maxwell® 16 – ✓

EZ1 & 2® DNA Investigator Kit – – EZ1® series – ✓

PrepFiler® Forensic DNA – – AutoMate Express™ – ✓

QIAamp® DNA Blood Mini Kit ✓ – QIAcube® ✓ –

QIAamp® DNA Mini Kit ✓ – QIAcube® ✓ –

QIAamp® DNA Investigator Kit ✓ – QIAcube® ✓ –

Numerous silica-based extraction chemistries have been commercially

The first criticism of the silica bead-based extraction methods was

1.2 Silica DNA Extraction Chemistry

2.1 DNA Extraction via QIAamp® DNA Blood Mini Kit or

2.2 DNA Extraction via QIAamp® DNA Investigator Kit

3.1 Extraction of Reference Blood or Buccal Samples Using

Each silica-based extraction begins with an incubation to facilitate lysis.

3.2 Extraction of Blood, Buccal, Saliva, or Touch DNA

3.3 Extraction of Blood, Buccal, Saliva, or Touch DNA

96–100% ethanol, whereas Promega specifies 95–100%; the

Use of a thermomixer set to 900 rpm during the initial incubation

5. QIAGEN (2012) BioSprint® 96 DNA handbook. Available via Qiagen. https://​

7. Invitrogen Corporation (2005) ChargeSwitch® Forensic DNA Purification Kits Instruction

8. Invitrogen Corporation (2007) iPrep™ Purification Instrument user manual, Version B,

4. Applied Biosystems™ PrepFiler™

Key words DNA Extraction – PrepFiler™ – PrepFiler™ BTA – PrepFiler

1.2 Sample Lysis

1.3 DNA Isolation and Purification

For further volumes: http://www.springer.com/series/7651

14. Wikipedia (2022) Purified water. Available via Wikipedia. https://en.wikipedia.org/wiki/

5. QIAGEN (2012) BioSprint® 96 DNA handbook. Available via Qiagen. https://