Article

Microbial metabolite enhances immunotherapy

efficacy by modulating T cell stemness in pan-cancer
Graphical abstract Authors
Dingjiacheng Jia, Qiwen Wang,
Yadong Qi, ..., Yuhao Wang, Shujie Chen,
Liangjing Wang

Correspondence
chenshujie77@zju.edu.cn (S.C.),
wangljzju@zju.edu.cn (L.W.)

In brief
L. johnsonii and C. sporogenes
collaborate to produce indole-3-
propionic acid, which modulates CD8+
T cell stemness by increasing H3K27
acetylation at the Tcf7 super-enhancer,
thereby enhancing the anti-tumor effect
of immune checkpoint blockade in pan-
cancer.

Highlights
d L. johnsonii enhances ICB efficacy via CD8+ T cells

d L. johnsonii cooperates with C. sporogenes to produce IPA

d IPA activates progenitor exhausted CD8+ T cells by H3K27

acetylation modification

d IPA improves ICB responsiveness at the pan-cancer level

Jia et al., 2024, Cell 187, 1651–1665

March 28, 2024 ª 2024 Elsevier Inc.
https://doi.org/10.1016/j.cell.2024.02.022 ll
 ll

Article
Microbial metabolite enhances
immunotherapy efficacy
by modulating T cell stemness in pan-cancer
Dingjiacheng Jia,1,2,11 Qiwen Wang,2,3,11 Yadong Qi,1,2,11 Yao Jiang,1,2,11 Jiamin He,2,3,11 Yifeng Lin,1,2 Yong Sun,1,2
Jilei Xu,2,3 Wenwen Chen,1,2 Lina Fan,1,2 Ruochen Yan,2,3 Wang Zhang,5 Guohong Ren,6 Chaochao Xu,1,2 Qiwei Ge,1,2
Lan Wang,2,3 Wei Liu,7 Fei Xu,8 Pin Wu,9 Yuhao Wang,10 Shujie Chen,2,3,4,* and Liangjing Wang1,2,4,12,*
1Department of Gastroenterology, Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang Province
310058, China
2Institution of Gastroenterology, Zhejiang University, Hangzhou, Zhejiang Province 310058, China
3Department of Gastroenterology, Sir Run Run Shaw Hospital, Zhejiang University, Hangzhou, Zhejiang Province 310058, China
4Cancer Center, Zhejiang University, Hangzhou, Zhejiang Province 310001, China
5Department of Infectious Diseases, Sir Run Run Shaw Hospital, Zhejiang University, Hangzhou, Zhejiang Province 310058, China
6Department of Breast Surgery, Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang Province

310058, China
7Institute of Plant Protection and Microbiology, Zhejiang Academy of Agriculture Sciences, Hangzhou, Zhejiang Province 310021, China
8Institute of Pharmaceutical Biotechnology and Department of Gastroenterology, Second Affiliated Hospital of Zhejiang University School of

Medicine, Hangzhou, Zhejiang Province 310058, China

9Department of Thoracic Surgery, Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang Province

310058, China
10Institute of Translational Medicine, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310029, China
11These authors contributed equally
12Lead contact

*Correspondence: chenshujie77@zju.edu.cn (S.C.), wangljzju@zju.edu.cn (L.W.)

https://doi.org/10.1016/j.cell.2024.02.022

SUMMARY

The immune checkpoint blockade (ICB) response in human cancers is closely linked to the gut microbiota.
Here, we report that the abundance of commensal Lactobacillus johnsonii is positively correlated with the
responsiveness of ICB. Supplementation with Lactobacillus johnsonii or tryptophan-derived metabolite
indole-3-propionic acid (IPA) enhances the efficacy of CD8+ T cell-mediated aPD-1 immunotherapy. Mech-
anistically, Lactobacillus johnsonii collaborates with Clostridium sporogenes to produce IPA. IPA modulates
the stemness program of CD8+ T cells and facilitates the generation of progenitor exhausted CD8+ T cells
(Tpex) by increasing H3K27 acetylation at the super-enhancer region of Tcf7. IPA improves ICB responsive-
ness at the pan-cancer level, including melanoma, breast cancer, and colorectal cancer. Collectively, our
findings identify a microbial metabolite-immune regulatory pathway and suggest a potential microbial-based
adjuvant approach to improve the responsiveness of immunotherapy.

INTRODUCTION Infiltrating T cells in the tumor microenvironment play a key

Gut microbiota is one of the major environmental factors that
affects the efficacy of immune checkpoint blockade (ICB).1,2
The composition of the gut microbiota differs in patients,3
and fecal microbiota transplantation (FMT) has been shown
to improve ICB responsiveness.4 Specific strains, such as
Lactobacillus rhamnosus GG,5 Bifidobacterium breve,6 and
Fusobacterium nucleatum,7 have been found to improve
the efficacy of ICB therapy by modulating the innate and
adaptive immune response processes. However, specific
bacterial components and detailed underlying mechanisms
remain elusive.
role in ICB therapy.8 Multiple CD8+ T cell subsets have been re-
vealed to influence anti-tumor response.9 Recent studies have
shown that progenitor exhausted CD8+ T cells (Tpex), which are
characterized by high expression of the transcription factor
T cell factor 1 (TCF-1, encoded by TCF7), are the main subset
responding to anti-programmed cell death protein 1 antibody
(aPD-1) immunotherapy.10–14 Tpex cells exhibiting stemness
characteristics demonstrate the ability to self-renew, proliferate,
and differentiate into effector CD8+ T cells (Teff) to limit tumori-
genesis.15 Moreover, the expression level of TCF7 could be
served as a positive prognostic indicator for patients treated
with ICB.16 Because a clear correlation between the deficiency

Cell 187, 1651–1665, March 28, 2024 ª 2024 Elsevier Inc. 1651
 ll
Article

A B

C D

E F G

H I J

Figure 1. L. johnsonii sensitizes aPD-1 immunotherapy by activating tumor-infiltrating CD8+ T cells

(A) Schematic diagram showing the process of aPD-1 immunotherapy in the subcutaneous Mc38 xenograft tumor model.
(B) Subcutaneous Mc38 tumor volume changes (mm3) in mice that were responsive (responder) or poorly responsive (poor-responder) to aPD-1 immunotherapy.
n = 5 mice per group.
(C) Schematic diagram showing the process of fecal microbiota transplantation.
(D) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with antibiotics (Abx) and transplanted with responder microbiota (R-recipient) or poor-
responder microbiota (PR-recipient). n = 6 mice per group.
(E) Principal co-ordinates analysis (PCoA) of 16S rRNA sequencing of fecal samples from responder mice and poor-responder mice at the operational taxonomic
unit (OTU) level. n = 5 mice per group.
(F) Community barplot analysis of 16S rRNA sequencing of fecal samples from responder mice and poor-responder mice at the genus level. n = 5 mice per group.
(G) Wilcoxon rank-sum test bar plot of 16S rRNA sequencing of fecal samples from responder mice and poor-responder mice at the species level. n = 5 mice
per group.
(H) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with IgG isotype control antibody, aPD-1 antibody, L. johnsonii, or L. johnsonii combined
with aPD-1 antibody. n = 7 mice per group.
(I and J) CD8+ T cell frequencies in subcutaneous Mc38 tumors. Representative flow cytometry plots are shown in (I), and combined data are shown in (J). n = 7
mice per group.

(legend continued on next page)

1652 Cell 187, 1651–1665, March 28, 2024


Article
of Tcf7 and a disrupted balance of the gut microbiota has been
observed in mice,17 further investigation is needed to determine
whether the gut microbiota and its metabolites could regulate
the stemness program of CD8+ T cells.
In this study, we discovered that the abundance of commensal
Lactobacillus johnsonii (L. johnsonii) is positively associated with
the proportion of Tpex cells, as well as improved the responsive-
ness to ICB. The tryptophan metabolite indole-3-propionic acid
(IPA), derived from L. johnsonii, could enhance H3K27 acetyla-
tion at the super-enhancer (SE) of Tcf7 gene and thus promote
the differentiation of CD8+ T cells into Tpex cells. Importantly,
we found that the synthesis of IPA requires cooperation between
L. johnsonii and another symbiotic bacterium, Clostridium spor-
ogenes (C. sporogenes, C. s). Overall, our findings point to a mi-
crobial-based adjuvant approach to improve the effectiveness of
immunotherapy.
RESULTS
L. johnsonii sensitizes aPD-1 immunotherapy by
activating tumor-infiltrating CD8+ T cells
When mice are given the same dose of aPD-1, their tumor
growth could exhibit either a good or poor response, similar to
what is observed in clinical practice.18–20 Using the Mc38 cell
line (high microsatellite instability, MSI-H),21,22 we modeled
aPD-1 therapy for colorectal cancer (CRC) and divided the
mice into two groups, namely, the ‘‘poor-responder’’ group
and the ‘‘responder’’ group, based on tumor volume
(Figures 1A and 1B). We then separately transplanted feces
from each group into recipient mice that were pretreated with an-
tibiotics (Abx) (Figure 1C). Mice transplanted with the poor-
responder feces (PR-recipient) showed lower responsiveness
to aPD-1 therapy than mice transplanted with the responder
feces (R-recipient) (Figure 1D), suggesting that the gut micro-
biota has a direct impact on the reactivity of ICB therapy.
We then performed metagenomics and 16S ribosomal RNA
(rRNA) sequencing on feces from both the poor-responder and
the responder mice to compare the microbial communities.
There were differences in b-diversity observed through principal
co-ordinates analysis (PCoA) (Figures 1E and S1A). Colony
composition analysis at the genus level revealed a decrease in
the abundance of Lactobacillus in the poor-responder group
(Figures 1F, S1B, and S1C). At the species level, L. johnsonii
was found to be the most prevalent (Figure 1G). We confirmed
that the lower abundance of L. johnsonii in the poor-responder
group negatively correlated with tumorigenesis (Figures S1D
and S1E). Apcmin/+ or azoxymethane (AOM)/dextran sodium sul-
fate (DSS)-induced CRC mice also showed decreased
L. johnsonii colonization (Figures S1F and S1G). Likewise,
compared with adjacent normal tissues, the abundance of
L. johnsonii was significantly lower in human CRC tissues (Fig-
ure S1H) and negatively correlated with the advanced stage of
human CRC (Figure S1I).
(B), (D), and (H) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. (G) represents mean ± SD analyzed
by Wilcoxon rank-sum test without multiple testing. (J) represents mean ± SEM analyzed by one-way ANOVA with Sidak’s correction for multiple com-
parisons. Data are representative of three independent experiments. 16S rRNA, 16S ribosomal RNA; L. j, L. johnsonii. *p < 0.05, **p < 0.01. See also
Figure S1.
ll
We isolated a strain of L. johnsonii and explored its functional
role. Oral administration of L. johnsonii enhanced the response
to aPD-1 therapy in Mc38 tumor (Figure 1H). CD8+ T cells,
which are the main immune effector cells for anti-tumor
response,23 were found to increase in frequency after oral
administration of L. johnsonii (Figures 1I and 1J). This increase
was accompanied by the release of cytokines from Teff such
as interferon (IFN)-g and tumor necrosis factor alpha (TNF-a)
(Figures S1J and S1K).
L. johnsonii promotes ICB responsiveness via
tryptophan metabolism
To explore whether such a function was attributed to L. johnsonii
itself or its secreted products, we administered mice with
L. johnsonii that had been high-temperature inactivated (heated
group), ultrasonic disrupted (ultrasound group), the original me-
dium (de Man, Rogosa, and Sharpe [MRS] group), and the con-
ditional medium (CM) (Lj. CM group) in addition to live
L. johnsonii. Interestingly, only Lj. CM group (Lj. CM + aPD-1)
had a comparable immunotherapeutic effect to live L. johnsonii
group (L. j + aPD-1), indicating that the antitumor effect of
L. johnsonii was primarily through the molecules secreted by
the bacteria (Figures 2A and 2B).
Plasma liquid chromatography-tandem mass spectrometry
(LC-MS/MS) analysis revealed distinct differences in the metab-
olite composition between the aPD-1 alone group and the
live L. johnsonii group (L. j + aPD-1) (Figure 2C). The live
L. johnsonii group showed a significant enrichment of the ‘‘tryp-
tophan metabolism’’ pathway (Figure 2D). We then confirmed
the necessity of tryptophan in L. johnsonii-promoted ICB
responsiveness by subjecting mice to a tryptophan deficiency
diet (Trpneg diet).24 As expected, L. johnsonii did not enhance
the effectiveness of aPD-1 therapy or increase the frequency
CD8+ T cells when tryptophan substrates were absent
(Figures 2E–2G).
L. johnsonii-derived IPA promotes ICB responsiveness
via CD8+ T cells
We examined the plasma tryptophan-related metabolites that
were upregulated by L. johnsonii and found that IPA exhibited
a most pronounced increase (Figure 3A). IPA, an indole analog
that is specifically produced by the gut microbiota,25,26 has
been shown to promote axonal regeneration27 and protect
against radiation toxicity.28 Consistent with L. johnsonii adminis-
tration, mice transplanted with feces from the responder group
showed higher plasma IPA levels (Figures 3B, S2A, and S2B).
However, supplementation with L. johnsonii did not increase
plasma IPA levels in mice that were fed with Trpneg diet
(Figures 3C and S2C).
We then explored the potential impact of IPA on tumor immu-
notherapy. Administering 60 mg/kg/day of IPA through gavage
could enhance the effectiveness of aPD-1 and increase plasma
or intratumoral IPA levels (Figures 3D and S2D–S2G). Similar
Cell 187, 1651–1665, March 28, 2024 1653
 ll
Article

A B

C D

E F G

Figure 2. L. johnsonii promotes ICB responsiveness via tryptophan metabolism

(A and B) Representative images (A) and volume changes (mm3) (B) of subcutaneous Mc38 tumors from mice treated with IgG control antibody, aPD-1 antibody
(aPD-1), aPD-1 antibody combined with live L. johnsonii (L. j + aPD-1), MRS medium (MRS + aPD-1), L. johnsonii conditional medium (Lj.CM + aPD-1), heat-
inactivated L. johnsonii (heated + aPD-1), or ultrasonicated L. johnsonii (ultrasound + aPD-1). n = 7 mice per group.
(C) Principal component analysis (PCA) of plasma metabolites identified by LC-MS/MS in mice treated with aPD-1 and mice treated with both L. johnsonii and
aPD-1. n = 6 mice per group.
(D) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of differentially enriched plasma metabolites in mice treated with aPD-1 versus mice
treated with both L. johnsonii and aPD-1. n = 6 mice per group.
(E) Subcutaneous Mc38 tumor volume changes (mm3) in mice fed a tryptophan deficient (Trpneg) diet and treated with aPD-1 antibody or aPD-1 in combination
with L. johnsonii. n = 7 mice per group.
(F and G) CD8+ T cell frequencies in subcutaneous Mc38 tumors. Representative flow cytometry plots are shown in (F), and combined data are shown in (G). n = 7
mice per group.
(B) and (E) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. (G) represents mean ± SEM analyzed by
unpaired t test. Data are representative of three independent experiments. L. j, L. johnsonii; MRS, de Man, Rogosa, and Sharpe medium; CM, conditional
medium; Trpneg diet, tryptophan deficiency diet. ns, not significant, *p < 0.05, **p < 0.01.

enhancement could also be achieved by direct intratumoral in-
jection (i.m.) of 5 mM IPA (Figures S2H and S2I). IPA supplemen-
tation increased the frequency of infiltrating CD8+ T cells and the
production of their effector cytokines in tumors (Figures 3E–3G
and S2Q). However, no significant alterations were observed
for natural killer (NK) cells, B cells, dendritic cells, and macro-
phages (Figures S2J–S2P).
To determine whether the immunotherapeutic effect is depen-
dent on T cell response, L. johnsonii or IPA was administered to
Rag1
/
mice. Notably, both treatments failed to reduce tumor

1654 Cell 187, 1651–1665, March 28, 2024

 ll
Article

A B C

D E F

G H I J

K L

Figure 3. L. johnsonii-derived IPA promotes ICB responsiveness via CD8+ T cells

(A) Heatmap showing the enrichment of tryptophan-related plasma metabolites in mice treated with aPD-1 or aPD-1 in combination with L. johnsonii. n = 6 mice
per group.
(B) LC-MS/MS identification of the abundance of plasma IPA in R-recipient mice and PR-recipient mice. n = 6 mice per group.
(C) LC-MS/MS identification of the abundance of plasma IPA in mice fed a Trpneg diet and treated with aPD-1 or aPD-1 in combination with L. johnsonii. n = 7 mice
per group.
(D) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with aPD-1 or aPD-1 combined with L. johnsonii (L. j + aPD-1) or IPA (IPA + aPD-1). n = 7
mice per group.
(E and F) CD8+ T cell frequencies in subcutaneous Mc38 tumors. Representative flow cytometry plots are shown in (E), and combined data are shown in (F). n = 7
mice per group.
(G) IFN-g+ CD8+ T cell frequencies in subcutaneous Mc38 tumor analyzed by flow cytometry. n = 7 mice per group.
(H) Subcutaneous Mc38 tumor volume changes (mm3) in Rag1
/
mice treated with aPD-1 or aPD-1 combined with L. johnsonii or IPA. n = 6 mice per group.
(I) Subcutaneous Mc38 tumor volume changes (mm3) in Rag1
/
mice treated with IgG isotype control antibody, aPD-1, IPA, or both IPA and aPD-1. n = 5 mice
per group.
(J) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with aPD-1 or aPD-1 combined with L. johnsonii or IPA, and in mice treated with both aCD8
and aPD-1 antibody and along with either L. johnsonii or IPA. n = 7 mice per group.

(legend continued on next page)

Cell 187, 1651–1665, March 28, 2024 1655

 ll
growth (Figures 3H and 3I). Moreover, treating mice with CD8
neutralizing antibody abrogated the antitumor effect of both
L. johnsonii and IPA (Figure 3J). We conjectured that CD8+
T cells treated with IPA could be maintained in an activated state
and confirmed this by adoptively transferring pretreated CD8+
T cells or B cells to Rag1
/
mice (Figure 3K). Mice receiving
IPA-pretreated CD8+ T cells (IPA T) showed better aPD-1
responsiveness compared with mice receiving IPA-untreated
CD8+ T cells (wild-type [WT] T). However, mice that received
both B cells and CD8+ T cells pretreated with IPA (IPA B + T)
showed no better tumor inhibitory effect compared with the
IPA T group (Figure 3L). Together, these findings indicate that
L. johnsonii-derived metabolite IPA is dependent on CD8+
T cells to promote the responsiveness to ICB therapy.
IPA sustains CD8+ T cells response by promoting
Tpex cells
CD8+ T cells consist of various subsets of cells that have distinct
functions and work collaboratively to regulate the immune micro-
environment of tumors.8,29 To further reveal the role of IPA on
CD8+ T cell subsets, we performed single-cell RNA sequencing
(scRNA-seq), single-cell T cell receptor sequencing (scTCR-
seq), and single-cell assay for targeting accessible-chromatin
with high-throughput sequencing (scATAC-seq) on CD8+ T cells
sorted from tumors in mice that have been treated with either
aPD-1 alone (WT group) or combination with IPA (IPA group) (Fig-
ure 4A). To exclude the interference of macrophages, neutrophils,
and fibroblasts (Figures S3A–S3C), we performed the uniform
manifold approximation and projection (UMAP) analysis to obtain
relatively pure CD8+ T cells (Figure S3D). We identified 13 cell clus-
ters and 10 CD8+ T cell subsets: naive (Lef1hi, Sellhi, and Ccr7hi),
progenitor exhausted CD8+ T cells (Tpex, Tcf7hi and Pdcd1hi), acti-
vated (Cd69hi and Isg15hi), Teff (Prf1hi, Gzmbhi, and Klrd1hi), natural
killer T cells (NKT, Cd160hi and Xcl1hi), Trbv3hi, Cotl1hi, Bcl2hi,
Mki67hi, and Mcm3hi (Figures 4B and S3E–S3H).
IPA treatment reduced naive CD8+ T cells but increased Tpex
cells and Teff cells in tumors (Figure 4C). To comprehensively
map immune cell function,30,31 we performed VISION analysis
to project the total score of the Gene Ontology (GO) biological
process gene sets and calculate the average signature score
for each cluster (Figure 4D). ‘‘GO_ALPHA_BETA_T_CELL_DIF-
FERENTIATION’’ was enriched in 9 of 13 cell clusters after IPA
treatment, particularly in Tpex cells (Figures 4E–4G). Also,
‘‘GO_ALPHA_BETA_T_CELL_ACTIVATION’’ was enriched in 7
of 13 cell clusters after IPA treatment, particularly in Teff cells
(Figures S3I–S3K). In addition, IPA treatment could increase
the proportion of TCF-1+ stem-like CD8+ T cells in ex vivo culture
(Figures 4H, 4I, and S4E) and in tumor-draining lymph node
(TDLN) or spleen (Figures S4A–S4D). Because Tcf7 expression
marks the activation of Tpex cells, we knocked out Tcf7 in mice
(K) Schematic diagram showing the adoptive cell transfer (ACT) process. Donor mice were treated with aPD-1 or aPD-1 combined with IPA. B cells or (and) CD8+
T cells from the donor mice were adoptively transferred to the recipient mice (Rag1
/
) as indicated.
(L) Subcutaneous Mc38 tumor volume changes (mm3) in the recipient mice. n = 5 mice per group.
(D), (H)–(J), and (L) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. (F) and (G) represent mean ± SEM
analyzed by one-way ANOVA with Sidak’s correction for multiple comparisons. Data are representative of three independent experiments. L. j, L. johnsonii; IPA,
indole-3-propionic acid; FMT, fecal microbiota transplantation; Trpneg diet, tryptophan deficiency diet; ACT, adoptive cell transfer; WT, wild type. ns, not sig-
nificant, *p < 0.05, **p < 0.01, ****p < 0.0001. See also Figure S2.
1656 Cell 187, 1651–1665, March 28, 2024
Article
(Tcf7
/
) and found that IPA only enhanced the efficacy of immu-
notherapy in WT littermates but not in Tcf7
/
mice (Figure 4J).
Collectively, these findings suggest that IPA exerts its immuno-
therapy-enhancing effects by elevating Tpex cells in tumors.
To further examine the differentiation route of CD8+ T cells af-
ter IPA treatment, we performed trajectory analysis of four clas-
sical subsets of CD8+ T cells. Monocle analysis revealed that
naive CD8+ T cells developed into Tpex cells and activated
CD8+ T cells and Teff cells step by step (Figure 4K). This differen-
tiation process was enhanced by IPA treatment as a higher fre-
quency of Tpex cells was enriched during the late stage of devel-
opment (Figures S4F and S4G). Using scTCR-seq, we identified
clonotypes between WT group and IPA group (Figure S4H). The
subsets of CD8+ T cells shared TCR profiles and underwent
clonal expansion with each other. The predominant TCR clono-
types in Teff cells primarily originated from the Tpex cells, and IPA
treatment increased the proportion of conservative transmission
(Figures 4L and 4M). In short, IPA increased the frequency of Tpex
cells in the tumor microenvironment and promoted their differen-
tiation to Teff cells to enhance ICB responsiveness.
IPA activates Tpex cells by modifying the H3K27
acetylation of Tcf7 gene at its SE region
Tpex cells are mainly regulated by histone modifications,32–34 we
sought to explore whether IPA activates Tpex cells through histone
remodeling of Tcf7 gene. We mapped the results of scRNA-seq to
scATAC-seq and identified 10 common CD8+ T cell subsets
(Figures 5A, S5A, and S5B). Consistent with scRNA-seq results,
IPA treatment increased the proportions of Tpex cells and Teff cells
(Figure 5B). Further differential peak analysis revealed that open
chromatin regions of Tpex cells were mainly enriched in the pro-
moter and distal intergenic regions (Figure S5C), and IPA treat-
ment increased the chromatin opening of Tcf7 gene at its super-
enhancer (SE) region (Figures 5C and 5J). In addition, we noticed
that IPA treatment primarily enhanced histone acetylation but not
histone methylation in Tpex cells (Figures 5D and S5D), suggesting
that IPA may activate Tpex cells by modifying the histones of Tcf7
gene at its SE through acetylation.
Nucleosome, the basic unit of chromatin, is an octamer
composed of four core histones (H2A, H2B, H3, and H4).35
scRNA-seq analysis revealed that histone H3 acetylation was
most significantly enriched in Tpex cells after IPA treatment
(Figures 5E, S5E, and S5F). We performed western blot analysis
with antibodies specific to common histone modifications,
including H2AK5ac,36 H2BK5ac,37 H3K27ac, and H4K20me1,38
to validate this result. Consistently, only H3K27ac exhibited a
dose-dependent increase in response to IPA, along with an in-
crease in TCF-1 expression (Figure 5F). Moreover, we performed
chromatin immunoprecipitation (ChIP), cleavage under targets
and release using nuclease (CUT&RUN), and cleavage under
 ll
Article

A B C D

E F G

H I J L

K M

Figure 4. IPA sustains CD8+ T cells response by promoting Tpex cells

(A) Schematic diagram showing the process of single-cell RNA sequencing (scRNA-seq), single-cell TCR sequencing (scTCR-seq), and single-cell assay for
targeting accessible-chromatin with high-throughput sequencing (scATAC-seq).
(B) Single-cell RNA sequencing and UMAP clustering of sorted CD8+ T cells from mice treated with aPD-1 and mice treated with both aPD-1 and IPA.
(C) Stacked bar charts showing the percentage of each identified cell type in sorted CD8+ T cells from mice treated with aPD-1 (WT, n = 2) or both aPD-1 and IPA
(IPA, n = 2).
(D) Schematic diagram showing the process of VISION-based analysis.
(E) Representative UMAP plot showing the distribution of progenitor exhausted CD8+ T cells (highlighted in blue) in WT and IPA mice.
(F) Scatter plot showing the average signature score for GO_ALPHA_BETA_T_CELL_DIFFERENTIATION gene sets of each cell cluster in WT (n = 2) and IPA
(n = 2) mice.
(G) Violin plot (left) and ECDF plot (right) of VISION enrichment score for GO_ALPHA_BETA_T_CELL_DIFFERENTIATION gene sets of the progenitor exhausted
CD8+ T cell cluster in WT and IPA mice.
(H) Schematic diagram showing the process of ex vivo culture of CD8+ T cells.
(I) Representative histogram (left) and combined mean fluorescence intensity (MFI) (right) of TCF-1 expression measured by flow cytometry for PD-1+ CD8+ T cells
treated with DMSO or IPA. CD8+ T cells were purified from lymph nodes or spleen of mice.

(legend continued on next page)

Cell 187, 1651–1665, March 28, 2024 1657

 ll
Article

targets and tagmentation (CUT&Tag) on H3K27ac in sorted CD8+
T cells. Results confirmed that IPA treatment increases H3K27
acetylation at the SE of Tcf7 gene (Figures 5G–5J).39
Taken together, above results prove that IPA promotes the
stemness program of CD8+ T cells by modifying the H3K27 acet-
ylation of Tcf7 gene at its SE region.
L. johnsonii cooperates with C. sporogenes to
produce IPA
Tryptophan could be metabolized by the gut microbiota into
indole-3-pyruvate acid (IPYA), indole-3-lactic acid (ILA), indole-
3-acrylic acid (IA), and IPA in a sequential manner,26,40 but how
L. johnsonii metabolizes tryptophan to produce IPA remains
elusive. Surprisingly, we were unable to detect IPA or IA in the su-
pernatant of the CM after culturing L. johnsonii. However, ILA
was detected in the CM. This suggests that L. johnsonii could
only metabolize tryptophan into ILA and not further into IA or
IPA (Figures 6A, 6B, and S6A).
To confirm that ILA lacks the ability to enhance ICB respon-
siveness if it is not further converted to IPA by gut microbes,
we administered either ILA or IPA to Mc38 tumor-bearing
mice. As expected, when ILA was given to mice receiving Abx
pretreatment, it did not improve the efficacy of aPD-1 therapy
and no longer raised plasma IPA levels, which were in contrast
to IPA administration group (Figures 6C, 6D, and S6B). Similarly,
intraperitoneal injection of ILA, which avoids further catabolism
by gut microbiota,41 did not improve aPD-1 effectiveness or in-
crease plasma IPA (Figures 6E, 6F, and S6C). These findings
lead to the hypothesis that L. johnsonii requires collaboration
with other commensal microbes to produce IPA.
Because C. sporogenes is known to convert ILA to IPA,42,43 and
oral gavage of L. johnsonii increased the fecal abundance of
C. sporogenes (Figure S6D), we selected it as a representative
bacterium and tested our hypothesis in germ-free mice (Figure 6G).
In comparison with single-bacteria (L. johnsonii or C. sporogenes)
administration, mixed administration of L. johnsonii and
C. sporogenes further enhanced efficacy of aPD-1 (Figure 6H).
LC-MS/MS analysis verified that L. johnsonii alone was unable to
increase plasma IPA, despite being able to produce large amounts
of ILA. In contrast, C. sporogenes or mixture of L. johnsonii and
C. sporogenes significantly increased plasma IPA (Figures 6I and
S6E). These results confirmed that ILA produced by L. johnsonii
needs to be further metabolized to IPA by C. sporogenes in order
to enhance the efficacy of immunotherapy.
We then proceeded to explore how L. johnsonii produces ILA.
We performed whole-genome sequencing for our isolated
L. johnsonii and used the protein basic local alignment search
tool (BLAST) to search for sequences that were similar to fldH,
a gene from C. sporogenes that encodes a key enzyme for con-
verting tryptophan to ILA25 (Figure 6J). We found that ldhA, a
gene present in the genome of L. johnsonii that encodes a 337
amino acid D-2-hydroxyacid dehydrogenase, may be essential
for L. johnsonii to produce ILA (Figure S6F). The secondary struc-
ture of the ldhA-encoded enzyme was predicted by 3D modeling
(Figure S6G). To test the function of this enzyme, we transformed
a ldhA expressional vector into E. coli (E. c-ldhA) and induced
protein expression (Figure S6H). Administration with E. c-ldhA
to Mc38 tumor-bearing mice increased plasma IPA levels and
improved aPD-1 reactivity (Figures 6K, 6L, and S6I), confirming
that L. johnsonii relies on ldhA to encode enzyme for ILA
production.
IPA promotes ICB responsiveness in pan-cancer and
CRC-derived organoids
We then tested whether microbiota-derived IPA improves the
responsiveness of ICB therapy at the pan-cancer level. IPA
effectively promoted the efficacy of aPD-1 immunotherapy
(Figures 7A and 7C) and increased the frequency of infiltrating
CD8+ T cells and the expression of TCF-1 (Figures 7B, 7D,
S7A, and S7B) in both breast cancer and melanoma transplant-
able tumor model. We also verified the sensitizing effect of IPA
for immunotherapy in mammary fat pad orthotopic implantation
model, murine mammary tumor virus-polymavirus middle T anti-
gen (MMTV-PyMT) spontaneous breast cancer model,44,45 and
cecum orthotopic implantation model (Figures 7E–7I, S7C, and
S7D). Immunofluorescence staining verified that IPA treatment
increased the infiltration of Tpex cells in the tumor microenviron-
ment of breast cancer, melanoma, and CRC (Figures 7J and 7K).
We further investigated whether IPA could act on human
CD8+ T cells to improve the responsiveness of ICB therapy.
In fresh CRC tissues, although the majority of CD8+ T cells in
the tumor microenvironment are TIM-3+ PD-1+ terminally ex-
hausted cells, there is also a specific proportion of Tpex cells
present (Figures S7G and S7H). Considering the limitation of
preserving immune cells in the tumor microenvironment using
conventional patient-derived organoids (PDOs),46 we estab-
lished an air-liquid interface (ALI)-PDOs system. This system
contains a more complete immune microenvironment and addi-
tional matrix components, allowing for a more accurate repre-
sentation of immunotherapy47,48 (Figure 7L). Both IPA-treated
and mock-treated PDOs successfully preserved the CRC struc-
tures (Figure 7M). IPA-treated PDOs exhibited increased the

(J) Tumor volume changes (mm3) of Tcf7
/
mice and WT littermate control. Both mice were treated with either aPD-1 or aPD-1 combined with IPA. n = 5 mice
per group.
(K) Pseudotime trajectory for CD8+ T cells from all samples in a two-dimensional state-space defined by monocle 2. The degree of color represented pseudotime
(left), and the colors represent different identified T cell subsets (right).
(L) Interconnectivity chord diagrams for common TCRs shared between CD8+ T cell subsets in WT and IPA-treated samples (top) and Venn diagrams for the
number of sharing the same CDR3 (paired TCRa and TCRb chains) amino acid sequences between the progenitor exhausted CD8+ T cell subset and the effector
CD8+ T cell subset in WT and IPA treated samples (bottom).
(M) Clonal density plot across the CD8+ T cell subsets at WT and IPA treated samples. UMAPs color-coded for annotated T cell subset clusters.
(G) represents VISION enrichment score analyzed by Wilcoxon rank-sum test. (I) represents mean ± SEM analyzed by unpaired t test. (J) represents mean ± SEM
analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. Data are representative of three independent experiments or biological replicates.
ECDF, empirical cumulative distribution function; IPA, indole-3-propionic acid; UMAP, uniform manifold approximation and projection; WT, wild type. ns, not
significant, *p < 0.05, **p < 0.01. See also Figures S3 and S4.

1658 Cell 187, 1651–1665, March 28, 2024

 ll
Article

A B C

D E

F G H

I
J

Figure 5. IPA activates Tpex cells by modifying the H3K27 acetylation of Tcf7 gene at its SE region
(A) scATAC-seq and UMAP clustering of sorted CD8+ T cells from mice treated with aPD-1 (WT) and mice treated with both aPD-1 and IPA (IPA).
(B) Stacked bar charts showing the percentage of each identified cell type in sorted CD8+ T cells from WT (n = 2) and IPA (n = 2) mice.
(C) Heatmap showing the peak locations with differential chromatin accessibility between progenitor exhausted CD8+ T cell clusters from WT (n = 2) and IPA (n =
2) mice.
(D) Violin plot (left) and ECDF plot (right) of VISION enrichment score for ‘‘GO_POSITIVE_REGULATION_OF_HISTONE_ACETYLATION’’ gene sets of progenitor
exhausted CD8+ T cell clusters from WT (n = 2) and IPA (n = 2) mice.
(E) Violin plot (left) and ECDF plot (right) of VISION enrichment score for ‘‘GO_HISTONE_H3_ACETYLATION’’ gene sets of progenitor exhausted CD8+ T cell
clusters from WT (n = 2) and IPA (n = 2) mice.

(legend continued on next page)

Cell 187, 1651–1665, March 28, 2024 1659

 ll
Article

infiltration of CD8+ T cells (Figures S7E and S7F) and elevated
the expression of Teff cells effector proteins (Figure 7N). Collec-
tively, these results demonstrate that modulating the stemness
program of CD8+ T cells through microbiota-derived IPA may
be a promising approach to reinforce the effectiveness of tumor
ICB therapy in clinical settings.
DISCUSSION
stemness program of CD8+ T cells and promote the differentia-
tion of Tpex cells by increasing H3K27 acetylation level at the
SE of Tcf7 gene.
In conclusion, our study establishes that L. johnsonii can boost
the therapeutic efficacy of ICB by increasing the synthesis of IPA
and enhancing Tpex cell activity. L. johnsonii and bacterial-
derived IPA may potentially serve as an effective drug adjuvant
for patients receiving personalized cancer immunotherapy.

In this study, we found that L. johnsonii, a commensal bacterium Limitations of the study
in the intestine, can enhance the efficacy of ICB therapy mainly There are several limitations to our study. The exact mechanisms
by increasing the synthesis of tryptophan-derived metabolite by which IPA induces acetylation modifications need to be
IPA. Many metabolites derived from bacteria cannot be synthe- further investigated. The role of ldhA enzyme in the production
sized by a single bacterium alone but require participation of of ILA by L. johnsonii could be better confirmed by genetic engi-
other microbes. Recent studies have reported that C. scindens neering. Whether IPA can be used as a stemness regulator of
collaborates with its closely related strains to transform primary CD8+ T cells for adjuvant immunotherapy needs to be validated
bile acids into secondary bile acids.49 Bacteroides collaborates in larger clinical cohorts. Additionally, improving IPA bioavail-
in a relaying manner with Lactobacillus plantarum to metabolize ability to increase intratumoral concentration is another potential
host tyrosine.50 We present an additional example in which future research direction.
L. johnsonii requires collaboration with C. sporogenes to convert
dietary tryptophan into IPA. STAR+METHODS
A variety of tryptophan-indole metabolites derived from bacte-
ria, including ILA, IA, IPA, indole-3-acetic acid (IAA), and indole- Detailed methods are provided in the online version of this paper
3-acetamide (IAM), have been shown to have a wide range of and include the following:
biological effects.26,51 IPA, specifically, could improve athero-
sclerosis,52 mitigate radiotoxicity,28 and prolong the posttrau- d KEY RESOURCES TABLE
matic survival time.53 The impact of IPA on modulating cancer d RESOURCE AVAILABILITY
immunotherapy has not been reported. In this study, B Lead contact
we discovered that IPA mainly promotes the infiltration of B Materials availability
CD8+ T cells into tumors and activates Tpex cells during immuno- B Data and code availability
therapy. Dodd and colleagues found that mutant C. sporogenes d EXPERIMENTAL MODEL AND STUDY PARTICIPANT
unable to produce IPA colonized germ-free mice could affect in- DETAILS
testinal permeability and increase the number of memory T cells B Cell lines
in peripheral blood.25 The interactions between the bacteria and B Microbe strains
host immunity may regulate the intestinal barrier, and this mech- B Human participants
anism needs to be further explored. B Animals
A number of studies have reported that the responses to d METHOD DETAILS
anti-PD-1 are mediated by Tpex cells, which rely on the reactiva- B Tumor models and treatments
tion of the stemness program of CD8+ T cells for their differenti- B Fecal microbiota transplantation
ation.10,11 Several strategies, including activation of IFN gene B Adoptive cell transfer therapy
signaling pathway,54 elevation of extracellular potassium B Heterologous expression of ldhA
levels,55 and overexpression of c-Myb56 have been shown to +
B Ex vivo CD8 T cells differentiation
reprogram the stemness of therapeutic CD8+ T cells. Our study B ChIP-qPCR assay and analysis
revealed that microbiota-derived IPA is able to modulate the B CUT & RUN assay and analysis

(F) Western blot of TCF-1, H2AK5ac, H2BK5ac, H3K27ac, H4K20me1, histone H2A, histone H2B, histone H3, and histone H4 in CD8+ T cells cultured with or
without IPA (0, 5, 500 mM).
(G) ChIP-qPCR detection of H3K27 acetylation at the super-enhancer locus of Tcf7 in CD8+ T cells cultured with or without IPA. n = 3 biological replicates
per group.
(H) CUT&RUN-qPCR detection of H3K27 acetylation at the super-enhancer locus of Tcf7 in CD8+ T cells cultured with or without IPA. n = 4 biological replicates
per group.
(I) CUT&Tag sequencing analysis of H3K27 acetylation of CD8+ T cells cultured with or without IPA. H3K27ac peaks were shown in the upper panels. n = 6
biological replicates per group.
(J) Representative illustration of genomic binding patterns analyzed by scATAC-seq (n = 2 per group), H3K27ac-seq (n = 6 per group), or scRNA-seq (n = 2 per
group) at the genomic loci of Tcf7 under conditions as indicated. Black dashed lines indicate the peaks with differential intensity. Tcf7 gene region is highlighted in
pink. Tcf7 super-enhancer region is highlighted in blue.
(D) and (E) represent VISION enrichment score analyzed by Wilcoxon rank-sum test. (G) represents mean ± SD analyzed by two-tail ratio paired t test.
(H) represents CUT&RUN-qPCR analyzed by two-tail ratio paired t test. Data are representative of 3–6 independent experiments or biological replicates. IPA,
indole-3-propionic acid; SE, super-enhancer. ***p < 0.001. See also Figure S5.

1660 Cell 187, 1651–1665, March 28, 2024

 ll
Article

A C D

B E F

G H I

J K L

Figure 6. L. johnsonii cooperates with C. sporogenes to produce IPA

(A) LC-MS/MS identification of IPA in MRS medium and the supernatant of L. johnsonii conditioned medium (Lj. CM). n = 6 independent experiments.
(B) LC-MS/MS identification of ILA between in MRS medium and the supernatant of Lj.CM. n = 6 independent experiments.
(C) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with aPD-1, aPD-1 combined with IPA or ILA, or aPD-1 combined with both ILA and
antibiotics (Abx). n = 6 mice per group.
(D) LC-MS/MS identification of plasma IPA from mice treated as indicated. n = 6 mice per group.
(E) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with aPD-1 or aPD-1 combined with either ILA or IPA by intraperitoneal injection. n = 6 mice
per group.
(F) LC-MS/MS identification of plasma IPA from mice treated as indicated. n = 6 mice per group.
(G) Schematic diagram of showing the process of aPD-1 immunotherapy on germ-free mice.
(H) Subcutaneous Mc38 tumor volume changes (mm3) in germ-free mice monocolonized with L. johnsonii or (and) C. sporogenes and treated with aPD-1. n = 7
mice per group.
(I) LC-MS/MS identification of plasma IPA from germ-free mice treated as indicated. n = 7 mice per group.
(J) Schematic diagram showing the process of protein BLAST and overexpression of ldhA in E. coli.
(K) Subcutaneous Mc38 tumor volume changes (mm3) in mice treated with aPD-1, or aPD-1 combined with E. coli or E. c-ldhA. n = 7 mice per group.
(L) LC-MS/MS identification of plasma IPA from mice treated as indicated. n = 7 mice per group.
(C), (E), (H), and (K) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. Data are representative of three
independent experiments. ILA, indole-3-lactic acid; IPA, indole-3-propionic acid; Abx, antibiotics; L. j, L. johnsonii; C. s, C. sporogenes. ns, not significant,
*p < 0.05, ****p < 0.0001. See also Figure S6.

Cell 187, 1651–1665, March 28, 2024 1661

 ll
Article

A B C D

E F G H I

J K

L M

Figure 7. IPA promotes ICB responsiveness in pan-cancer and CRC-derived organoids

(A) Tumor volume (mm3) changes of transplantable 4T1 breast tumors in mice treated with IgG isotype control, IPA, aPD-1, or both IPA and aPD-1. n = 7 mice
per group.
(B) Flow cytometry analysis of the mean fluorescence intensity (MFI) for TCF-1 in CD8+ T cells isolated from 4T1 breast tumors. n = 7 mice per group.
(C) Tumor volume (mm3) changes of transplantable B16-F10 melanoma in mice treated with IgG isotype control, IPA, aPD-1, or both IPA and aPD-1. n = 7 mice
per group.
(D) Flow cytometry analysis of the mean fluorescence intensity (MFI) of TCF-1 in CD8+ T cells isolated from B16-F10 melanoma. n = 7 mice per group.
(E) Tumor volume (mm3) changes of 4T1 orthotopic breast tumors in mice treated with aPD-1 or aPD-1 in combination with IPA. n = 7 mice per group.
(F) Flow cytometry analysis of the mean fluorescence intensity (MFI) of TCF-1 in CD8+ T cells isolated from 4T1 orthotopic breast tumors. n = 7 mice per group.
(G) Survival curves for MMTV-PyMT mice treated with aPD-1 or aPD-1 in combination with IPA. n = 10 mice per group.

(legend continued on next page)

1662 Cell 187, 1651–1665, March 28, 2024

 ll
Article
B CUT & Tag assay and analysis 2. Jiang, Y., Jia, D., Sun, Y., Ding, N., and Wang, L. (2023). Microbiota: A key
B Air-liquid interface PDOs factor affecting and regulating the efficacy of immunotherapy. Clin. Transl.
B Flow cytometry analysis Med. 13, e1508.

B Metabolomic analysis
B 16S rRNA sequencing
B Shotgun metagenomic sequencing
B Single-cell RNA and TCR sequencing
B Single-cell ATAC sequencing
B Quantitative real-time PCR
d QUANTIFICATION AND STATISTICAL ANALYSIS
ACKNOWLEDGMENTS
The authors would like to express their gratitude to all colleagues who contrib-
uted to this work, in particular Prof. Jianmin Si, Prof. Di Wang, Prof. Yongqun
Zhu, Prof. Lie Wang, Dr. Dong Cen (Zhejiang University), and Prof. Zheng
Kuang (Carnegie Mellon University). Thanks to Yanwei Li (the Core Facilities,
Zhejiang University School of Medicine) and Zhanglian He (Biomedical
Research Center, Sir Run Run Shaw Hospital, Zhejiang University) for tech-
nical support in flow cytometry. Thanks to Zhongjing Zhou and Yi Teng (Zhe-
jiang Academy of Agricultural Sciences) for technical support in LC-MS/MS
analysis. This project was financially supported by the National Foundation
of Natural Science of China (82273269, 82072623 to Liangjing Wang;
82270573 to S.C.), the Key program of Natural Science Foundation of Zhejiang
Province (LZ22H160002 to Liangjing Wang), and the National Key Research
and Development Program of China (2022YFC2505100 to Liangjing Wang).
AUTHOR CONTRIBUTIONS
Conceptualization, Liangjing Wang and S.C.; methodology, D.J., Q.W., Y.Q.,
Y.J., and J.H.; software, Y.Q. and Q.W.; formal analysis, D.J., Q.W., Y.Q.,
Y.J., and J.H.; investigation, Y.L., Y.S., J.X., W.C., L.F., R.Y., C.X., and Q.G.;
resources, W.Z., G.R., Lan Wang, W.L., F.X., and P.W.; writing – original draft,
D.J.; writing – review & editing, Liangjing Wang, S.C., and Y.W.; funding acqui-
sition, Liangjing Wang and S.C.; supervision, Liangjing Wang.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: May 16, 2023
Revised: December 31, 2023
Accepted: February 20, 2024
Published: March 14, 2024
3. Wang, F., He, M.M., Yao, Y.C., Zhao, X., Wang, Z.Q., Jin, Y., Luo, H.Y., Li,
J.B., Wang, F.H., Qiu, M.Z., et al. (2021). Regorafenib plus toripalimab in
patients with metastatic colorectal cancer: a phase Ib/II clinical trial and
gut microbiome analysis. Cell Rep. Med. 2, 100383.
4. Davar, D., Dzutsev, A.K., McCulloch, J.A., Rodrigues, R.R., Chauvin, J.M.,
Morrison, R.M., Deblasio, R.N., Menna, C., Ding, Q., Pagliano, O., et al.
(2021). Fecal microbiota transplant overcomes resistance to anti-PD-1
therapy in melanoma patients. Science 371, 595–602.
5. Si, W., Liang, H., Bugno, J., Xu, Q., Ding, X., Yang, K., Fu, Y., Weichsel-
baum, R.R., Zhao, X., and Wang, L. (2022). Lactobacillus rhamnosus GG
induces cGAS/STING- dependent type I interferon and improves
response to immune checkpoint blockade. Gut 71, 521–533.
6. Bessell, C.A., Isser, A., Havel, J.J., Lee, S., Bell, D.R., Hickey, J.W., Chai-
sawangwong, W., Glick Bieler, J., Srivastava, R., Kuo, F., et al. (2020).
Commensal bacteria stimulate antitumor responses via T cell cross-reac-
tivity. JCI Insight 5, e135597.
7. Gao, Y., Bi, D., Xie, R., Li, M., Guo, J., Liu, H., Guo, X., Fang, J., Ding, T.,
Zhu, H., et al. (2021). Fusobacterium nucleatum enhances the efficacy of
PD-L1 blockade in colorectal cancer. Signal Transduct. Target. Ther.
6, 398.
8. Paijens, S.T., Vledder, A., de Bruyn, M., and Nijman, H.W. (2021). Tumor-
infiltrating lymphocytes in the immunotherapy era. Cell. Mol. Immunol. 18,
842–859.
9. St Paul, M., and Ohashi, P.S. (2020). The Roles of CD8(+) T Cell Subsets in
Antitumor Immunity. Trends Cell Biol. 30, 695–704.
10. Miller, B.C., Sen, D.R., Al Abosy, R., Bi, K., Virkud, Y.V., LaFleur, M.W.,
Yates, K.B., Lako, A., Felt, K., Naik, G.S., et al. (2019). Subsets of ex-
hausted CD8(+) T cells differentially mediate tumor control and respond
to checkpoint blockade. Nat. Immunol. 20, 326–336.
11. Siddiqui, I., Schaeuble, K., Chennupati, V., Fuertes Marraco, S.A., Cal-
deron-Copete, S., Pais Ferreira, D., Carmona, S.J., Scarpellino, L., Gfeller,
D., Pradervand, S., et al. (2019). Intratumoral Tcf1(+)PD-1(+)CD8(+) T Cells
with Stem-like Properties Promote Tumor Control in Response to Vaccina-
tion and Checkpoint Blockade Immunotherapy. Immunity 50, 195–
211.e110.
12. Beltra, J.C., Manne, S., Abdel-Hakeem, M.S., Kurachi, M., Giles, J.R.,
Chen, Z., Casella, V., Ngiow, S.F., Khan, O., Huang, Y.J., et al. (2020).
Developmental Relationships of Four Exhausted CD8(+) T Cell Subsets
Reveals Underlying Transcriptional and Epigenetic Landscape Control
Mechanisms. Immunity 52, 825–841.e828.

REFERENCES
1. Fernandes, M.R., Aggarwal, P., Costa, R.G.F., Cole, A.M., and Trinchieri,
G. (2022). Targeting the gut microbiota for cancer therapy. Nat. Rev. Can-
cer 22, 703–722.
13. Zhao, X., Shan, Q., and Xue, H.H. (2022). TCF1 in T cell immunity: a broad-
ened frontier. Nat. Rev. Immunol. 22, 147–157.
14. Rahim, M.K., Okholm, T.L.H., Jones, K.B., McCarthy, E.E., Liu, C.C., Yee,
J.L., Tamaki, S.J., Marquez, D.M., Tenvooren, I., Wai, K., et al. (2023). Dy-
namic CD8(+) T cell responses to cancer immunotherapy in human

(H) Tumor volume (mm3) of Mc38 orthotopic tumors in mice treated with aPD-1 or aPD-1 in combination with IPA. n = 5 mice per group.
(I) Flow cytometry analysis of the mean fluorescence intensity (MFI) of TCF-1 in CD8+ T cells isolated from Mc38 orthotopic tumors. n = 5 mice per group.
(J) Frequency of breast cancer, melanoma, and colorectal cancer TCF-1+ CD8+ cells to DAPI+ cells in two groups of (Figure 7K). n = 6 mice per group.
(K) Representative images showing immunofluorescence staining of CD8 (red), TCF-1 (green), and DAPI (blue) in breast cancer, melanoma, and colorectal cancer
samples from mice treated with or without IPA (scale bars, 20 mm). n = 6 mice per group.
(L) Schematic diagram showing the process of air-liquid interface CRC PDOs.
(M) H&E staining of fresh human CRC biopsy (upper, scale bars, 200 mm) and PDOs after treatment (lower, scale bars, 200 mm). n = 5 patients.
(N) qPCR analysis of PRF1, GZMB, and IFNG expression in ALI-PDOs treated with or without IPA treatment. n = 3 patients.
(A), (C), and (E) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. (B) and (D) represent mean ± SEM analyzed
by one-way ANOVA with Sidak’s correction for multiple comparisons. (F), (I), and (J) represent mean ± SEM analyzed by unpaired t test. (G) represents survival
curves analyzed by log-rank test. (H) represents mean ± SEM analyzed by unpaired t test with Welch’s correction. (N) represents mean ± SD analyzed by two-tail
ratio paired t test. Data are representative of three independent experiments. IPA, indole-3-propionic acid; CRC, colorectal cancer. ns, not significant, *p < 0.05,
**p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S7.

Cell 187, 1651–1665, March 28, 2024 1663

 ll
regional lymph nodes are disrupted in metastatic lymph nodes. Cell 186,
1127–1143.e1118.
15. Escobar, G., Mangani, D., and Anderson, A.C. (2020). T cell factor 1: A
master regulator of the T cell response in disease. Sci. Immunol. 5,
eabb9726.
16. Sade-Feldman, M., Yizhak, K., Bjorgaard, S.L., Ray, J.P., de Boer, C.G.,
Jenkins, R.W., Lieb, D.J., Chen, J.H., Frederick, D.T., Barzily-Rokni, M.,
et al. (2018). Defining T Cell States Associated with Response to Check-
point Immunotherapy in Melanoma. Cell 175, 998–1013.e20.
17. Yu, G., Wang, F., You, M., Xu, T., Shao, C., Liu, Y., Liu, R., Deng, M., Qi, Z.,
Wang, Z., et al. (2020). TCF-1 deficiency influences the composition of in-
testinal microbiota and enhances susceptibility to colonic inflammation.
Protein Cell 11, 380–386.
18. Cercek, A., Lumish, M., Sinopoli, J., Weiss, J., Shia, J., Lamendola-Essel,
M., El Dika, I.H., Segal, N., Shcherba, M., Sugarman, R., et al. (2022). PD-1
Blockade in Mismatch Repair-Deficient, Locally Advanced Rectal Cancer.
N. Engl. J. Med. 386, 2363–2376.
19. Sivan, A., Corrales, L., Hubert, N., Williams, J.B., Aquino-Michaels, K.,
Earley, Z.M., Benyamin, F.W., Lei, Y.M., Jabri, B., Alegre, M.L., et al.
(2015). Commensal Bifidobacterium promotes antitumor immunity and fa-
cilitates anti-PD-L1 efficacy. Science 350, 1084–1089.
20. Iida, N., Dzutsev, A., Stewart, C.A., Smith, L., Bouladoux, N., Weingarten,
R.A., Molina, D.A., Salcedo, R., Back, T., Cramer, S., et al. (2013).
Commensal bacteria control cancer response to therapy by modulating
the tumor microenvironment. Science 342, 967–970.
21. Bao, Y., Zhai, J., Chen, H., Wong, C.C., Liang, C., Ding, Y., Huang, D., Gou,
H., Chen, D., Pan, Y., et al. (2023). Targeting m(6)A reader YTHDF1 aug-
ments antitumour immunity and boosts anti-PD-1 efficacy in colorectal
cancer. Gut 72, 1497–1509.
22. Olson, B., Li, Y., Lin, Y., Liu, E.T., and Patnaik, A. (2018). Mouse Models for
Cancer Immunotherapy Research. Cancer Discov. 8, 1358–1365.
23. Pauken, K.E., Torchia, J.A., Chaudhri, A., Sharpe, A.H., and Freeman, G.J.
(2021). Emerging concepts in PD-1 checkpoint biology. Semin. Immunol.
52, 101480.
24. Hezaveh, K., Shinde, R.S., Klötgen, A., Halaby, M.J., Lamorte, S., Ciudad,
M.T., Quevedo, R., Neufeld, L., Liu, Z.Q., Jin, R., et al. (2022). Tryptophan-
derived microbial metabolites activate the aryl hydrocarbon receptor in tu-
mor-associated macrophages to suppress anti-tumor immunity. Immunity
55, 324–340.e8.
25. Dodd, D., Spitzer, M.H., Van Treuren, W., Merrill, B.D., Hryckowian, A.J.,
Higginbottom, S.K., Le, A., Cowan, T.M., Nolan, G.P., Fischbach, M.A.,
and Sonnenburg, J.L. (2017). A gut bacterial pathway metabolizes aro-
matic amino acids into nine circulating metabolites. Nature 551, 648–652.
26. Agus, A., Planchais, J., and Sokol, H. (2018). Gut Microbiota Regulation of
Tryptophan Metabolism in Health and Disease. Cell Host Microbe 23,
716–724.
27. Serger, E., Luengo-Gutierrez, L., Chadwick, J.S., Kong, G., Zhou, L.,
Crawford, G., Danzi, M.C., Myridakis, A., Brandis, A., Bello, A.T., et al.
(2022). The gut metabolite indole-3 propionate promotes nerve regenera-
tion and repair. Nature 607, 585–592.
28. Xiao, H.W., Cui, M., Li, Y., Dong, J.L., Zhang, S.Q., Zhu, C.C., Jiang, M.,
Zhu, T., Wang, B., Wang, H.C., and Fan, S.J. (2020). Gut microbiota-
derived indole 3-propionic acid protects against radiation toxicity via re-
taining acyl-CoA-binding protein. Microbiome 8, 69.
29. Belk, J.A., Daniel, B., and Satpathy, A.T. (2022). Epigenetic regulation of
T cell exhaustion. Nat. Immunol. 23, 848–860.
30. DeTomaso, D., Jones, M.G., Subramaniam, M., Ashuach, T., Ye, C.J., and
Yosef, N. (2019). Functional interpretation of single cell similarity maps.
Nat. Commun. 10, 4376.
31. Ringel, A.E., Drijvers, J.M., Baker, G.J., Catozzi, A., Garcı́a-Cañaveras,
J.C., Gassaway, B.M., Miller, B.C., Juneja, V.R., Nguyen, T.H., Joshi, S.,
et al. (2020). Obesity Shapes Metabolism in the Tumor Microenvironment
to Suppress Anti-Tumor Immunity. Cell 183, 1848–1866.e26.
1664 Cell 187, 1651–1665, March 28, 2024
Article
32. Dose, M., Emmanuel, A.O., Chaumeil, J., Zhang, J., Sun, T., Germar, K.,
Aghajani, K., Davis, E.M., Keerthivasan, S., Bredemeyer, A.L., et al.
(2014). b-Catenin induces T-cell transformation by promoting genomic
instability. Proc. Natl. Acad. Sci. USA 111, 391–396.
33. Raghu, D., Xue, H.H., and Mielke, L.A. (2019). Control of Lymphocyte Fate,
Infection, and Tumor Immunity by TCF-1. Trends Immunol. 40, 1149–1162.
34. Feng, Q., Liu, Z., Yu, X., Huang, T., Chen, J., Wang, J., Wilhelm, J., Li, S.,
Song, J., Li, W., et al. (2022). Lactate increases stemness of CD8 + T cells
to augment anti-tumor immunity. Nat. Commun. 13, 4981.
35. Talbert, P.B., and Henikoff, S. (2010). Histone variants–ancient wrap art-
ists of the epigenome. Nat. Rev. Mol. Cell Biol. 11, 264–275.
36. Singh, P., Cho, J., Tsai, S.Y., Rivas, G.E., Larson, G.P., and Szabó, P.E.
(2010). Coordinated allele-specific histone acetylation at the differentially
methylated regions of imprinted genes. Nucleic Acids Res. 38, 7974–7990.
37. George, S., Gaddelapati, S.C., and Palli, S.R. (2019). Histone deacetylase
1 suppresses Krüppel homolog 1 gene expression and influences juvenile
hormone action in Tribolium castaneum. Proc. Natl. Acad. Sci. USA 116,
17759–17764.
38. Brejc, K., Bian, Q., Uzawa, S., Wheeler, B.S., Anderson, E.C., King, D.S.,
Kranzusch, P.J., Preston, C.G., and Meyer, B.J. (2017). Dynamic Control
of X Chromosome Conformation and Repression by a Histone H4K20 De-
methylase. Cell 171, 85–102.e23.
39. He, B., Xing, S., Chen, C., Gao, P., Teng, L., Shan, Q., Gullicksrud, J.A.,
Martin, M.D., Yu, S., Harty, J.T., et al. (2016). CD8(+) T Cells Utilize Highly
Dynamic Enhancer Repertoires and Regulatory Circuitry in Response to
Infections. Immunity 45, 1341–1354.
40. Wlodarska, M., Luo, C., Kolde, R., d’Hennezel, E., Annand, J.W., Heim,
C.E., Krastel, P., Schmitt, E.K., Omar, A.S., Creasey, E.A., et al. (2017). In-
doleacrylic Acid Produced by Commensal Peptostreptococcus Species
Suppresses Inflammation. Cell Host Microbe 22, 25–37.e6.
41. Wu, C., Zhao, Y., Zhang, Y., Yang, Y., Su, W., Yang, Y., Sun, L., Zhang, F.,
Yu, J., Wang, Y., et al. (2022). Gut microbiota specifically mediates the
anti-hypercholesterolemic effect of berberine (BBR) and facilitates to pre-
dict BBR’s cholesterol-decreasing efficacy in patients. J. Adv. Res. 37,
197–208.
42. Wikoff, W.R., Anfora, A.T., Liu, J., Schultz, P.G., Lesley, S.A., Peters, E.C.,
and Siuzdak, G. (2009). Metabolomics analysis reveals large effects of gut
microflora on mammalian blood metabolites. Proc. Natl. Acad. Sci. USA
106, 3698–3703.
43. Liu, Y., Chen, H., Van Treuren, W., Hou, B.H., Higginbottom, S.K., and
Dodd, D. (2022). Clostridium sporogenes uses reductive Stickland meta-
bolism in the gut to generate ATP and produce circulating metabolites.
Nat. Microbiol. 7, 695–706.
44. Schmittnaegel, M., Rigamonti, N., Kadioglu, E., Cassará, A., Wyser Rmili,
C., Kiialainen, A., Kienast, Y., Mueller, H.J., Ooi, C.H., Laoui, D., and De
Palma, M. (2017). Dual angiopoietin-2 and VEGFA inhibition elicits anti-
tumor immunity that is enhanced by PD-1 checkpoint blockade. Sci.
Transl. Med. 9, eaak9670.
45. Zhang, C., Yue, C., Herrmann, A., Song, J., Egelston, C., Wang, T., Zhang,
Z., Li, W., Lee, H., Aftabizadeh, M., et al. (2020). STAT3 Activation-Induced
Fatty Acid Oxidation in CD8(+) T Effector Cells Is Critical for Obesity-
Promoted Breast Tumor Growth. Cell Metab. 31, 148–161.e145.
46. van de Wetering, M., Francies, H.E., Francis, J.M., Bounova, G., Iorio, F.,
Pronk, A., van Houdt, W., van Gorp, J., Taylor-Weiner, A., Kester, L., et al.
(2015). Prospective derivation of a living organoid biobank of colorectal
cancer patients. Cell 161, 933–945.
47. Neal, J.T., Li, X., Zhu, J., Giangarra, V., Grzeskowiak, C.L., Ju, J., Liu, I.H.,
Chiou, S.H., Salahudeen, A.A., Smith, A.R., et al. (2018). Organoid
Modeling of the Tumor Immune Microenvironment. Cell 175, 1972–
1988.e16.
48. Chen, S., Cui, W., Chi, Z., Xiao, Q., Hu, T., Ye, Q., Zhu, K., Yu, W., Wang, Z.,
Yu, C., et al. (2022). Tumor-associated macrophages are shaped by intra-
tumoral high potassium via Kir2.1. Cell Metab. 34, 1843–1859.e11.

Article
49. Paik, D., Yao, L., Zhang, Y., Bae, S., D’Agostino, G.D., Zhang, M., Kim, E.,
Franzosa, E.A., Avila-Pacheco, J., Bisanz, J.E., et al. (2022). Human gut
bacteria produce T(H)17-modulating bile acid metabolites. Nature 603,
907–912.
50. Needham, B.D., Funabashi, M., Adame, M.D., Wang, Z., Boktor, J.C., Ha-
ney, J., Wu, W.L., Rabut, C., Ladinsky, M.S., Hwang, S.J., et al. (2022). A
gut-derived metabolite alters brain activity and anxiety behaviour in mice.
Nature 602, 647–653.
51. Agus, A., Clément, K., and Sokol, H. (2021). Gut microbiota-derived me-
tabolites as central regulators in metabolic disorders. Gut 70, 1174–1182.
52. Xue, H., Chen, X., Yu, C., Deng, Y., Zhang, Y., Chen, S., Chen, X., Chen, K.,
Yang, Y., and Ling, W. (2022). Gut Microbially Produced Indole-3-
Propionic Acid Inhibits Atherosclerosis by Promoting Reverse Cholesterol
Transport and Its Deficiency Is Causally Related to Atherosclerotic Cardio-
vascular Disease. Circ. Res. 131, 404–420.
53. Cao, B., Zhao, R.Y., Li, H.H., Xu, X.M., Cui, H., Deng, H., Chen, L., and Wei,
B. (2022). Oral administration of asparagine and 3-indolepropionic acid
prolongs survival time of rats with traumatic colon injury. Mil. Med Res
9, 37.
54. Li, W., Lu, L., Lu, J., Wang, X., Yang, C., Jin, J., Wu, L., Hong, X., Li, F., Cao,
D., et al. (2020). cGAS-STING-mediated DNA sensing maintains CD8(+)
T cell stemness and promotes antitumor T cell therapy. Sci. Transl. Med.
12, eaay9013.
55. Vodnala, S.K., Eil, R., Kishton, R.J., Sukumar, M., Yamamoto, T.N., Ha,
N.H., Lee, P.H., Shin, M., Patel, S.J., Yu, Z., et al. (2019). T cell stemness
and dysfunction in tumors are triggered by a common mechanism. Sci-
ence 363, eaau0135.
56. Gautam, S., Fioravanti, J., Zhu, W., Le Gall, J.B., Brohawn, P., Lacey, N.E.,
Hu, J., Hocker, J.D., Hawk, N.V., Kapoor, V., et al. (2019). The transcription
factor c-Myb regulates CD8(+) T cell stemness and antitumor immunity.
Nat. Immunol. 20, 337–349.
57. Stuart, T., Butler, A., Hoffman, P., Hafemeister, C., Papalexi, E., Mauck,
W.M., 3rd, Hao, Y., Stoeckius, M., Smibert, P., and Satija, R. (2019).
Comprehensive Integration of Single-Cell Data. Cell 177, 1888–1902.e21.
ll
58. Borcherding, N., Bormann, N.L., and Kraus, G. (2020). scRepertoire: An
R-based toolkit for single-cell immune receptor analysis. F1000Res 9, 47.
59. Qiu, X., Mao, Q., Tang, Y., Wang, L., Chawla, R., Pliner, H.A., and Trapnell,
C. (2017). Reversed graph embedding resolves complex single-cell trajec-
tories. Nat. Methods 14, 979–982.
60. Vasimuddin, M., Misra, S., Li, H., and Aluru, S. (2019). Efficient
Architecture-Aware Acceleration of BWA-MEM for Multicore Systems.
2019 IEEE International Parallel and Distributed Processing Sympo-
sium (IPDPS).
61. Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein,
B.E., Nusbaum, C., Myers, R.M., Brown, M., Li, W., and Liu, X.S. (2008).
Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137.
62. Jia, D.J., Wang, Q.W., Hu, Y.Y., He, J.M., Ge, Q.W., Qi, Y.D., Chen, L.Y.,
Zhang, Y., Fan, L.N., Lin, Y.F., et al. (2022). Lactobacillus johnsonii allevi-
ates colitis by TLR1/2-STAT3 mediated CD206(+) macrophages(IL-10)
activation. Gut Microbes 14, 2145843.
63. Long, X., Wong, C.C., Tong, L., Chu, E.S.H., Ho Szeto, C., Go, M.Y.Y.,
Coker, O.O., Chan, A.W.H., Chan, F.K.L., Sung, J.J.Y., and Yu, J.
(2019). Peptostreptococcus anaerobius promotes colorectal carcinogen-
esis and modulates tumour immunity. Nat. Microbiol. 4, 2319–2330.
64. Guo, H., Chou, W.C., Lai, Y., Liang, K., Tam, J.W., Brickey, W.J., Chen, L.,
Montgomery, N.D., Li, X., Bohannon, L.M., et al. (2020). Multi-omics ana-
lyses of radiation survivors identify radioprotective microbes and metabo-
lites. Science 370, eaay9097.
65. Vaena, S., Chakraborty, P., Lee, H.G., Janneh, A.H., Kassir, M.F., Beeson,
G., Hedley, Z., Yalcinkaya, A., Sofi, M.H., Li, H., et al. (2021). Aging-depen-
dent mitochondrial dysfunction mediated by ceramide signaling inhibits
antitumor T cell response. Cell Rep. 35, 109076.
66. Higashimura, Y., Takagi, T., Naito, Y., Uchiyama, K., Mizushima, K., Ta-
naka, M., Hamaguchi, M., and Itoh, Y. (2020). Zinc Deficiency Activates
the IL-23/Th17 Axis to Aggravate Experimental Colitis in Mice. J. Crohns
Colitis 14, 856–866.
Cell 187, 1651–1665, March 28, 2024 1665
 ll
Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
InVivoMAb rat IgG2a isotype control (Rat, Clone 2A3) BioXcell Cat# BE0089; RRID: AB_1107769
InVivoMAb anti-mouse PD-1 (CD279) BioXcell Cat# BE0273; RRID: AB_2687796
(Rat, Clone 29F.1A12)
InVivoMAb anti-mouse CD8a (Rat, Clone 53-6.7) BioXcell Cat# BE0004-1; RRID: AB_1107671
Anti-mouse CD45 (Cell sorting) (Rat, Clone30-F11), BD Biosciences Cat# 561869; RRID: AB_394003
PerCP-Cy5.5 conjugated
Anti-mouse CD3 (Cell sorting) (Rat, Clone 17A2), BioLegend Cat# 100203; RRID: AB_312660
FITC conjugated
Anti-mouse CD8a (Cell sorting) (Rat, Clone 53-6.7), BioLegend Cat# 100714; RRID: AB_312753
APC/Cyanine7 conjugated
Anti-mouse/human TCF-1 (Flow cytometry) (Mouse, BD Biosciences Cat# 566692; RRID: AB_2869822
Clone S33-966), BV421 conjugated
Mouse IgG1, k Isotype Control (Flow cytometry) BD Biosciences Cat# 562438; RRID: AB_11207319
(Mouse, Clone X40), BV421 conjugated
Anti-mouse CD45 (Flow cytometry) BioLegend Cat# 103128; RRID: AB_493715
(Rat, Clone 30-F11), Alexa Fluor 700 conjugated
Anti-mouse CD3e (Flow cytometry) (Armenian BD Biosciences Cat# 551163; RRID: AB_394082
Hamster, Clone 145-2C11)
PerCP-Cy5.5 conjugated
Anti-mouse CD4 (Flow cytometry) BD Biosciences Cat# 563151; RRID: AB_2687549
(Rat, Clone RM4-5), BV605 conjugated
Anti-mouse CD8a (Flow cytometry) BD Biosciences Cat# 561967; RRID: AB_396769
(Rat, Clone 53-6.7), APC-Cy7 conjugated
Anti-mouse NK1.1 (Flow cytometry) BioLegend Cat# 108745; RRID: AB_2563286
(Mouse, Clone PK136), BV711 conjugated
Anti-mouse CD45R/B220 (Flow cytometry) BioLegend Cat# 103236; RRID: AB_893354
(Rat, Clone RA3-6B2),
PerCP-Cy5.5 conjugated
Anti-mouse Ly-6G (Flow cytometry) BioLegend Cat# 127648; RRID: AB_2566319
(Rat, Clone 1A8),
PE/Dazzle 594 conjugated
Anti-mouse CD11c (Flow cytometry) BioLegend Cat# 117318; RRID: AB_493568
(Armenian Hamster, Clone N418),
PE/Cyanine7 conjugated
Anti-mouse I-A/I-E (Flow cytometry) (Rat, Clone BD Biosciences Cat# 557000; RRID: AB_396546
M5/114.15.2), PE conjugated
Anti-mouse F4/80 (Flow cytometry) (Rat, Clone BioLegend Cat# 123132; RRID: AB_11203717
BM8), BV421 conjugated
Anti-mouse CD11b (Flow cytometry) BioLegend Cat# 101257; RRID: AB_2565431
(Rat, Clone M1/70), BV605 conjugated
Anti-mouse PD-1 (Flow cytometry) BioLegend Cat# 135213; RRID: AB_10689633
(Rat, Clone 29F.1A12), FITC conjugated
Anti-mouse TNF-a (Flow cytometry) BioLegend Cat# 506346; RRID: AB_2565955
(Rat, Clone MP6-XT22),
PE/Dazzle 594 conjugated
Anti-mouse IFN-g (Flow cytometry) BioLegend Cat# 505830; RRID: AB_2563105
(Rat, Clone XMG1.2),
BV421 conjugated
(Continued on next page)

e1 Cell 187, 1651–1665.e1–e9, March 28, 2024

 ll
Article

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Anti-human CD45 (Flow cytometry) BioLegend Cat# 304006; RRID: AB_314394
(Mouse, Clone HI30),
FITC conjugated
Anti-human CD3 (Flow cytometry) BD Biosciences Cat# 560835; RRID: AB_2033956
(Mouse, Clone UCHT1),
PerCP-Cy5.5 conjugated
Anti-human CD8a (Flow cytometry) BioLegend Cat# 300911; RRID: AB_314115
(Mouse, Clone HIT8a),
APC conjugated
Anti-human TIM-3 (Flow cytometry) BD Biosciences Cat# 563422; RRID: AB_2716866
(Mouse, Clone 7D3)
PE conjugated
Anti-human PD-1 (Flow cytometry) BD Biosciences Cat# 563245; RRID: AB_2738091
(Mouse, Clone EH12.1)
BV605 conjugated
anti-human PD-1 Antibody (nivolumab, ALI-PDOs) Bristol Myers Squibb N/A
Ultra-LEAF Purified anti-human CD3 BioLegend Cat# 317326; RRID: AB_11150592
Antibody (ALI-PDOs) (Mouse, Clone OKT3)
Ultra-LEAF Purified anti-human CD28 Antibody BioLegend Cat# 302934; RRID: AB_11148949
(ALI-PDOs) (Mouse, Clone CD28.2)
Ultra-LEAF Purified anti-mouse CD3 Antibody BioLegend Cat# 100239; RRID: AB_2810313
(Cell activation) (Rat, Clone 17A2)
Ultra-LEAF Purified anti-mouse CD28 Antibody BioLegend Cat# 102115; RRID: AB_11150408
(Cell activation) (Syrian Hamster, Clone 37.51)
Acetyl-Histone H2A-K5 Rabbit pAb (western blot) ABclonal Cat# A15620; RRID: AB_2763027
Histone H2A Rabbit mAb (western blot) ABclonal Cat# A3692; RRID: AB_2863118
(Clone ARC2072)
Acetyl-Histone H2B-K5 Rabbit pAb (western blot) ABclonal Cat# A15621; RRID: AB_2763028
Histone H2B Rabbit mAb (western blot) ABclonal Cat# A19812
(Clone ARC2337)
MonoMethyl-Histone H4-K20 Rabbit ABclonal Cat# A2370; RRID: AB_2764330
pAb (western blot)
Histone H4 Rabbit pAb (western blot) ABclonal Cat# A1131; RRID: AB_2758500
Histone H3 Rabbit pAb (western blot) ABclonal Cat# A2348; RRID: AB_2631273
TCF-1/TCF7 (C63D9) Rabbit mAb (western blot, Cell Signaling Technology Cat# 2203S
Immunofluorescence)
Acetyl-Histone H3-K27 Rabbit mAb (CUT & Tag, ABclonal Cat# A22264
CUT & RUN, ChIP, western blot) (clone ARC54943)
CD8 Antibody (Immunofluorescence) Hubei BIOSSCI Biotech Co., LTD Cat# za-0508
TruStain FcX (anti-mouse CD16/32) Antibody BioLegend Cat# 101320; RRID: AB_1574975
(Fc block) (Rat, clone 93)
Bacterial and virus strains
Lactobacillus johnsonii This paper N/A
Clostridium sporogenes ATCC Cat# 11437
E. coli BL21 (DE3) Yeasen Biotechnology Cat# 11804ES80
Biological samples
Colorectal cancer tumor tissues and Sir Run Run Shaw Hospital, Zhejiang N/A
adjacent normal tissues University School of Medicine
Feces from healthy individuals and adenoma Sir Run Run Shaw Hospital, Zhejiang N/A
and colorectal cancer patients University School of Medicine
(Continued on next page)

Cell 187, 1651–1665.e1–e9, March 28, 2024 e2

 ll
Article

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins
De Man, Rogosa and Sharpe (MRS) Medium hopebio, China Cat# HB0384-5
Reinforced Clostridium Medium (RCM) hopebio, China Cat# HB0316
Luria broth (LB) medium Sangon Biotech, China Cat# A507002
Ampicillin meilunbio, China Cat# MB1507
Metronidazole meilunbio, China Cat# MB2200
Neomycin meilunbio, China Cat# MB1716
Vancomycin meilunbio, China Cat# MB1260
Matrigel Yeasen Biotechnology Cat# 40183ES10
Penicillin-Streptomycin Gibco Cat# 15140122
Fetal Bovine Serum Gibco Cat# 10437028
7-AAD Viability Staining Solution (Cell sorting) BioLegend Cat# 420404
Isopropyl-b-d-thiogalactoside (IPTG) Selleck Cat# S6826
Recombinant Mouse IL-2 Protein (Cell activation) BioLegend Cat# 575404
Recombinant Human IL-2 Protein (ALI-PDOs) ABclonal Cat# RP01039
Indole-3-propionic acid (IPA) Sigma Cat# V900491
Indole-3-lactic acid (ILA) Bide Pharmatech Ltd. Cat# BD13033
Collagenase IV Worthington Cat# LS004189
Fixable viability Stain 510 (Flow cytometry) BD Biosciences Cat# 564406; RRID: AB_2869572
FluoroFix Buffer BioLegend Cat# 422101
Intracellular Staining Permeabilization Wash Buffer BioLegend Cat# 421002
Transcription Factor Staining Buffer Invitrogen Cat# 00-5523-00
Cell Activation Cocktail with Brefeldin A BioLegend Cat# 423303
Solution A ((Cellmatrix I-A) Nitta Gelatin N/A
Solution B (103 concentrated sterile culture Sigma-Aldrich Cat# D8900
medium, Ham’s F-12)
Organoid Medium (ALI-PDOs) Shanghai Bioheb Biomed Cat# I-ALI-OC-Medium-20221011
Technology Co., Ltd.
Critical commercial assays
MojoSort Mouse CD8 T Cell Isolation Kit BioLegend Cat# 480035
MojoSort Mouse Pan B Cell Isolation Kit BioLegend Cat# 480051
ChIP Assay kit Thermo Scientific Cat# 26156
Hyperactive pG-MNase CUT&RUN Vazyme Cat# HD101
Assay Kit for PCR/qPCR
Hyperactive Universal CUT&Tag Vazyme Cat# TD904
Assay Kit for Illumina Pro
TruePrep Index Kit V2 for Illumina Vazyme Cat# TD202
TIANamp Stool DNA Kit TIANGEN Cat# DP328-02
TIANamp Genomic DNA Kit TIANGEN Cat# DP304-02
ABScript III RT Master Mix ABclonal Cat# RK20429
SYBR Green Fast qPCR Mix ABclonal Cat# RK21203
SteadyPure RNA extraction kit Accurate Biology Cat# AG21017
Deposited data
Raw sequencing data: scATAC-seq This paper PRJCA023433 GSA: CRA014884
Raw sequencing data: scTCR-seq This paper PRJCA023433 GSA: CRA014885
Raw sequencing data: scRNA-seq This paper PRJCA023433 GSA: CRA014886
Experimental models: Cell lines
Mus: Mc38 BMCR Cat# 1101MOU-PUMC000523
Mus: B16-F10 ATCC Cat# CRL-6475
Mus: 4T1 ATCC Cat# CRL-2539
(Continued on next page)

e3 Cell 187, 1651–1665.e1–e9, March 28, 2024

 ll
Article

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Experimental models: Organisms/strains
Mouse: C57BL/6J Shanghai SLAC Laboratory Animals N/A
Mouse: BALB/c Shanghai SLAC Laboratory Animals N/A
Mouse: Germ-Free: C57BL/6JGpt GemPharmatech Co., Ltd. Strain NO. N000295
Mouse: Rag1-/-: C57BL/6JGpt-Rag1em1Cd3259/Gpt GemPharmatech Co., Ltd. Strain NO. T004753
Mouse: Tcf7-/-: C57BL/6Smoc-Tcf7em1Smoc Shanghai Model Organisms Center, Inc. Strain NO. NM-KO-190688
Mouse: C57BL/6-JMMTV-PyMT Cyagen Biosciences Inc. Strain NO.C001212
Oligonucleotides
Lactobacillus johnsonii forward: TsingkeBiotechnologyCo., Ltd. N/A
TCGAGCGAGCTTGCCTAGATGA
Lactobacillus johnsonii reverse: TsingkeBiotechnologyCo., Ltd. N/A
TCCGGACAACGCTTGCCACC
Clostridium sporogenes forward: TsingkeBiotechnologyCo., Ltd. N/A
AAGCTTCCTTCGGGAAGTGG
Clostridium sporogenes reverse: TsingkeBiotechnologyCo., Ltd. N/A
CCTTTCGGAAGGCTATCCCC
Universal Eubacteria 16S forward: TsingkeBiotechnologyCo., Ltd. N/A
CGGCAACGAGCGCAACCC
Universal Eubacteria 16S reverse: TsingkeBiotechnologyCo., Ltd. N/A
CCATTGTAGCACGTGTGTAGCC
Mouse b-actin forward: TsingkeBiotechnologyCo., Ltd. N/A
ACACCCGCCACCAGTTCGC
Mouse b-actin reverse: TsingkeBiotechnologyCo., Ltd. N/A
ATGGGGTACTTCAGGGTCAGGATA
Mouse Tcf7 SE forward: TsingkeBiotechnologyCo., Ltd. N/A
GGTTGTCTGGAGGTCAGTGG
Mouse Tcf7 SE reverse: TsingkeBiotechnologyCo., Ltd. N/A
GAACTTGCTCATCCCAGCA
Human PRF1 forward: TsingkeBiotechnologyCo., Ltd. N/A
GTGGGACAATAACAACCCCAT
Human PRF1 reverse: TsingkeBiotechnologyCo., Ltd. N/A
TGGCATGATAGCGGAATTTTAGG
Human GZMB forward: TsingkeBiotechnologyCo., Ltd. N/A
TGGGGGACCCAGAGATTAAAA
Human GZMB reverse: TsingkeBiotechnologyCo., Ltd. N/A
TTTCGTCCATAGGAGACAATGC
Human IFNG forward: TsingkeBiotechnologyCo., Ltd. N/A
TCGGTAACTGACTTGAATGTCCA
Human IFNG reverse: TsingkeBiotechnologyCo., Ltd. N/A
TCGCTTCCCTGTTTTAGCTGC
Human b-ACTIN forward: TsingkeBiotechnologyCo., Ltd. N/A
AGAGCTACGAGCTGCCTGAC
Human b-ACTIN reverse: TsingkeBiotechnologyCo., Ltd. N/A
AGCACTGTGTTGGCGTACAG
Software and algorithms
GraphPad Prism software 9.0 GraphPad Software, Inc. https://graphpad.com/scientificsoftware/
prism/
FlowJo-10.4 Tree Star Inc. https://www.flowjo.com/solutions/flowjo
BD FACSDiva 9.0.1 BD Biosciences https://www.bdbiosciences.com/en-us/
products/software/instrument-software/
bd-facsdiva-software
Cell Ranger-7.0.0 10 X Genomics http://10xgenomics.com/
(Continued on next page)

Cell 187, 1651–1665.e1–e9, March 28, 2024 e4

 ll
Article

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
30
VISION-3.0.1 DeTomaso et al. https://github.com/YosefLab/VISION
Seurat-4.1.1 Stuart et al.57 https://satijalab.org/seurat/
scRepertoire 2.0.0 Borcherding et al.58 https://doi.org/10.12688/
f1000research.22139.2
Monocle 2/Monocle 3 Qiu et al.59 http://cole-trapnell-lab.github.io/
monocle-release/docs/
BWA-0.7.12 Vasimuddin et al.60 https://github.com/lh3/bwa
Macs2-2.1.0 Zhang et al.61 https://github.com/macs3-project/MACS
Bedtools-2.30.0 Quinlan laboratory https://bedtools.readthedocs.io/
bcl2fastq-5.0.1 Illumina, Inc. https://support.illumina.com/sequencing/
sequencing_software/bcl2fastq-
conversion-software.html
RStudio Server RStudio, PBC https://www.rstudio.com/products/
R-4.1.2 R-project https://www.r-project.org/
Other
70 mm cell strainer biosharp Cat# BS-70-XBS
MojoSort Magnet BioLegend Cat# 480019
Millicell dish Millipore Cat# PICM01250
Amino acid control feed (2 g/kg L-tryptophan) Readydietech Co., Ltd. N/A
Tryptophan-free feed (0 g/kg L-tryptophan) Readydietech Co., Ltd. N/A

RESOURCE AVAILABILITY

Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Liangjing
Wang (wangljzju@zju.edu.cn).

Materials availability
Mouse and microbial strains used in this study are available from the lead contact upon request.

Data and code availability

d The raw sequencing data that support the findings of this study are deposited (PRJCA023433, https://ngdc.cncb.ac.cn/) under
the supervision and control of the Genome Sequence Archive of the Beijing Institute of Genomics, Chinese Academy of Sci-
ences, under the accession number: CRA014884, CRA014885, CRA014886 (accessible at GSA, https://ngdc.cncb.ac.cn/
gsa/). Publicly available databases and software used in this work are noted in the STAR Methods and the key resources table.
d This paper does not report original code.
d Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell lines
All cell lines were described in the key resources table. A 10 % fetal bovine serum (Gibco, 10437028) and 1 % penicillin/streptomycin
solution (Gibco, 15140122) were used to culture the cells. They were kept at 37  C in a humidified atmosphere containing 5 % CO2.

Microbe strains
All microbe strains were described in the key resources table. Referring to our previous method,62 Lactobacillus johnsonii was iso-
lated independently and verified using 16S rRNA sequencing (V4 sequences). The complete genome sequence was commissioned
to Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The bacteria were cultured in MRS medium (hopebio, HB0384-5) at 37

C for 24 h. To get high-temperature inactivated Lactobacillus johnsonii, the bacteria were heated in the 100  C metal bath for 2 h. To
get ultrasonic broken Lactobacillus johnsonii, the bacteria were lysed using the Fisher Scientific Model 50 Sonic Dismembrator. The

e5 Cell 187, 1651–1665.e1–e9, March 28, 2024

 ll
Article

conditions of ultrasonic fragmentation were 300 w, 20 s start-up and 10 s pause, 20 min. As a representative bacterium for IPA
production, Clostridium sporogenes was purchased from ATCC (ATCC 11437) and cultured in RCM (hopebio, HB0316) under an
atmosphere of 10 % CO2, 10 % H2 and 80 % N2 for 72 h at 37  C.

Human participants
Tissue samples from 92 patients with CRC (Cohort 1), fecal samples from 67 healthy control, 40 patients with colon adenoma, 108
patients with CRC (Cohort 2) were obtained. After surgical resection, CRC tissue samples and their adjacent normal mucosa were
immediately frozen in liquid nitrogen and stored at -80  C. Fresh CRC tissues from 10 patients using for ALI-PDOs or flow cytometry
were obtained. The patients were without antibiotics and probiotics in the past one month. Informed consent was obtained from all
participants, and the experimental protocol was approved by the Clinical Research Ethics Committee of Sir Run Run Shaw Hospital,
Zhejiang University School of Medicine (20211103-35).

Animals
All experiments used mice were described in the key resources table. Unless otherwise stated, 6-8 weeks males or females were
used in all experiments; no significant sex-dependent differences were found in the experiments reported. They were under specific
pathogen-free (SPF) environment, water and food were provided adequately. The temperature was constant, and a 12 h circadian
rhythm was maintained every day. All animals were done under the guidelines of the Animal Experimentation Ethics Committee of the
Second Affiliated Hospital of Zhejiang University School of Medicine (AIRB-2022-0336), Zhejiang Chinese Medical University
(20221212-07, 20230918-14) and IACUC of GemPharmatech (GPTAP20231010-3). For the germ-free mice model, feces were micro-
biologically tested weekly to confirm sterility or specific microbial colonization status.

METHOD DETAILS

Tumor models and treatments

Antibiotics (Abx) treatment was performed to normalize the gut microbiota in animal experiments. Mice were given 0.2 g/L Ampicillin
(meilunbio, MB1507), 0.2 g/L Metronidazole (meilunbio, MB2200), 0.2 g/L Neomycin (meilunbio, MB1716) and 0.1 g/L Vancomycin
(meilunbio, MB11260) quadruple antibiotics for one week.63 For transplantable tumor models, 106 Mc38, 105 B16-F10, 105 4T1 and
Matrigel (Yeasen Biotechnology, 40183ES10) were co-injected into the loose subcutaneous tissues of the mice back, 100 ml of cell
suspension each mouse. For orthotopic tumor models, 4T1 or Mc38 were implanted into the mammary fat pad or the cecum respec-
tively. On the 8th, 11th, and 14th days, each mouse was intraperitoneally injected with 100 mg of IgG isotype control antibody
(BioXcell, BE0089) or aPD-1 antibody (BioXcell, BE0273) for immunotherapy. Transgenic MMTV-PyMT mice (Cyagen Biosciences
Inc., C001212) at 16 weeks were used as an autochthonous breast cancer model for survival experiments. Each mouse was given
100 mg aPD-1 antibody for immunotherapy every three days and removed from the study as soon as an individual tumor reached a
volume of 1000 mm3.44 For CD8+ T cells neutralization experiments, 200 mg of aCD8 antibody (BioXcell, BE0004-1) were delivered
by intraperitoneal injection, once every three days. For bacterial treatment, each mouse was given 200 ml of PBS per day by
gavage containing 109 CFU of bacteria. For metabolites treatment, each mouse was gavaged at a dose of 60 mg/kg (or at concen-
tration gradients as indicated) per day.28 In some experiments, ILA (Bide Pharmatech Ltd., BD13033) and IPA (Sigma, V900491) were
administered by intraperitoneal or intratumoral injection.

Fecal microbiota transplantation

Referring to published studies,64 fresh feces from Responder Donors (n=5) and Poor-responder Donors (n=5) mice were collected
and resuspended in sterile PBS solution at a ratio of 40 mg/ml. Subsequently, grinding beads were added to the mixture and filtered
through a 70 mm cell strainer (Biosharp, BS-70-XBS). 10 % volume of glycerol was added to the fecal suspension, and it was sub
packaged and frozen at -80 C. For each Abx-treated mouse, 200 ml of fecal suspension was orally administered three times
each week.

Adoptive cell transfer therapy

Referring to previous work,65,66 mice were sacrificed to separate tumor-draining lymph nodes or spleen, and cell clumps were
removed by grinding and filtering. After PBS washing and cells counting, cells were resuspended in culture medium. CD8+ T cells
or B cells were collected by magnetic cell separation system as the manufacturer’s protocol (BioLegend, 480019, 480035,
480051). The sorted cells were counted. 106 CD8+ T cells, 106 B cells, or 106 CD8+ T cells and 106 B cells were transferred into
per Rag1-/- mice by tail vein injection.

Heterologous expression of ldhA

Standard molecular cloning techniques were used to clone the DNA fragments encoding full-length ldhA into the pRSFDuet vector.
After overexpression of ldhA in E. coli BL21 (Yeasen Biotechnology, 11804ES80), the bacteria were grown at 37  C to an OD600 of
0.6. Afterwards, ldhA protein expression was induced with 200 mM IPTG (Selleck, S6826) for 6 h at 37  C. E. coli and ldhA-overex-
pressing E. coli (E. c-ldhA) were incubated in LB medium (Sangon Biotech, A507002) for 24 h at 37  C.

Cell 187, 1651–1665.e1–e9, March 28, 2024 e6

 ll
Article

Ex vivo CD8+ T cells differentiation

CD8+ T cells were purified from lymph nodes or spleen of mice using MojoSort Mouse CD8 T cell Isolation Kit (BioLegend, 480035).
Purified CD8+ T cells were activated with aCD3 (5 mg/ml, BioLegend, 100239), aCD28 (5 mg/ml, BioLegend, 102115) and 50 U/ml Il-2
(BioLegend, 575404). In specific experiments, CD8+ T cells were treated with 0, 5 mM or 500 mM IPA for 48 h. For flow cytometry, CD8+
T cells were stained with anti-CD8, anti-PD-1 and anti-TCF-1 antibodies (BD Biosciences, 561967, 566692, BioLegend, 135213).
For western blot, total protein from CD8+ T cells was extracted and blocked with anti-TCF-1, anti-H2AK5ac, anti-H2BK5ac,
anti-H3K27ac, anti-H4K20me1 antibodies (Cell Signaling Technology, 2203S, ABclonal, A15620, A15621, A22264, A2370) at 4  C
overnight. Histone H2A, H2B, H3 and H4 (ABclonal, A3692, A19812, A2348, A1131) served as the loading controls.

ChIP-qPCR assay and analysis

ChIP was conducted following the manufacturer’s protocol (Thermo Scientific, 26156). Briefly, PBS or 500 mM IPA-treated CD8+
T cells were cross-linked with 1 % formaldehyde at room temperature for 10 min, which was terminated by Glycine Solution. After
centrifugation, the acquired pellet was lysed by the indicated lysis buffer with a protease inhibitor cocktail. Then the extracted
genomic DNA was digested enzymatically to achieve DNA fragmentation using micrococcal nuclease. Transfer 5 ml of the superna-
tant containing the digested chromatin to a 1.5 ml tube and store at -20  C as the 10 % total input sample from one ChIP. Then the
samples were subjected to immunoprecipitation at 4  C overnight with anti-H3K27ac (ABclonal, A22264). Add 20 ml ChIP Grade
Protein A/G Plus Agarose to each IP and incubate for 1 h at 4  C on a rocking platform. After resin incubation, the precipitated pro-
tein-DNA complexes were eluted, reversal of crosslinking, DNA clean-up and subjected to qPCR.

CUT & RUN assay and analysis

CUT & RUN assay was conducted following the manufacturer’s protocol (Vazyme, HD101). Briefly, PBS or 500 mM IPA-treated CD8+
T cells were incubated with ConA Beads Pro at room temperature for 10 min, anti-H3K27ac antibody (1:50, ABclonal, A22264) was
added and rotated at room temperature for 2 h, then washed twice, added pG-MNase Enzyme and incubated at 4  C for 1 h, then
washed twice, Cacl2 was added and incubated for 1 h on ice, added stop buffer and incubated at 37  C for 30 min. DNA was ex-
tracted and qPCR was used to detect the acetylation of Tcf7 SE. Spike in DNA derived from the lDNA of E. coli was used for uniform
correction.

CUT & Tag assay and analysis

PBS or 500 mM IPA-treated CD8+ T cells were collected with six replicates per group for CUT & Tag assay (Vazyme, TD904). The
sequencing process was commissioned to chi-biomedicine (Guangdong, China). Briefly, CD8+ T cells were resuspended with
wash buffer, incubated with bead, incubated with primary anti-H3K27ac antibody (1:50, ABclonal, A22264) and incubated with sec-
ondary antibodies. Then the samples were incubated with Hyperactive pA/G-Transposon Pro, fragmented with Mgcl2. The DNA was
extracted and PCR amplification was performed using indexing primers (Vazyme, TD202). CUT & Tag library was purified and as-
sessed on the Agilent Bioanalyzer 2100 system. The clustering of the index-coded samples was performed on a cBot Cluster Gen-
eration System and the library preparations were sequenced on the Illumina Novaseq platform with 150 bp paired-end reads.
Sequencing data was further processed by bioinformatics pipelines including raw data cleaning (removing containing, low-quality
reads), reference mm10 mouse genome mapping (MAPQ >=13), peak calling (with the q-value threshold of 0.05), peak annotation
(ChIPseeker) and different peak analysis (fold change of RPM >= 2). Bam files were visualized using IGV.

Air-liquid interface PDOs

Referring to previous work,47,48 air-liquid interface patient-derived organoids (ALI-PDOs) were established. Briefly, fresh human CRC
tissues were clipped in pre-chilled PBS and washed in medium containing antibiotics. Collagen cocktail solution was constructed by
mixing Solution A (Nitta Gelatin), Solution B (Sigma-Aldrich, D8900) and Solution C (Sterile reconstitution buffer containing 2.2 g
NaHCO3 in 100 ml of 0.05 N NaOH and 200 mM HEPES) at a ratio of 8:1:1 on ice, and 300 ml of collagen cocktail solution was added
to the Millicell dish (Millipore, PICM01250) to form the bottom gel layer, which was then solidified at 37  C for 30 min. The excised
tumor tissues were then resuspended with a further 300 ml of collagen cocktail solution and added to the top of the pre-solidified
gel layer. 12-well plates were filled with outer wells supplemented with organoid medium (Shanghai Bioheb Biomed Technology
Co., Ltd., I-ALI-OC-Medium-20221011). On this basis, additional 50 U/ml human recombinant IL-2 protein (Abclonal, RP01039)
and 5 mg/ml human anti-CD3/CD28 antibody (BioLegend, 317326, 302934) were added for the transient culture of T cells. On top
of the above medium, 10 mg/ml aPD-1 antibody (nivolumab, Bristol Myers Squibb) was added at the same time. 5 mM IPA or equal
amounts of DMSO (Mock) were added every 2 days. The external medium was changed every 2 days. For immunofluorescence, after
about 7 days of culture, the up-layer gel was removed with forceps and paraffin-embedded tissue were stained with anti-CD8 anti-
body (1:4000, Hubei BIOSSCI Biotech Co., LTD, za-0508), anti-TCF-1 antibody (1:50, Cell Signaling Technology, 2203S).

Flow cytometry analysis

At the end of modeling, the subcutaneous tumors were collected and quickly immersed in cold medium. After cutting them into 1 mm
pieces, collagenase IV (Worthington, LS004189) was added for 30 min to further digest. The tumor-draining lymph node and spleen
were gently grounded and filtered through a 70 mm cell strainer (biosharp, BS-70-XBS). Splenocytes were resuspended in RBC Lysis

e7 Cell 187, 1651–1665.e1–e9, March 28, 2024

 ll
Article

buffer and incubated for 15 minutes at 4  C. Then, 1 3 106 cells were incubated with 1 mg of anti-CD16/32 antibody (BioLegend,
101320) for 10 min to block non-specific binding of immunoglobulin to the Fc receptors. Then, cells were stained for live cells (BD
Biosciences, 564406) for 30 minutes. Afterwards, the appropriate amount of pre-diluted fluorescent labeled antibody (BioLegend,
103128, 108745, 103236, 127648, 117318, 123132, 101257, 135213, BD Biosciences, 551163, 563151, 561967, 557000) was added
to each tube as recommended by the manufacturer. Cells were incubated in the 4  C refrigerator for 30 min and fixed with Fixation
Buffer (BioLegend, 422101) for 30 min at room temperature. After washing, the membranes were ruptured (BioLegend, 421002) and
intracellular fluorescent antibodies were added to each tube and incubated for 30 min at room temperature. The effectors IFN-g and
TNF-a (BioLegend, 505830, 506346) were detected by adding 2 ml Activation Cocktails (BioLegend, 423303) to 1 ml of cell suspen-
sion and incubating for 6 h at 37  C. For TCF-1 staining, cells were incubated with Fixation work solution for 40 minutes at room tem-
perature, washed with Transcription Factor Staining Buffer (Invitrogen, 00-5523-00), and stained with antibody (BD Biosciences,
566692) for 40 minutes at room temperature.

Metabolomic analysis
For plasma samples, 5-10 times the volume of pre-cooled methanol was added to plasma, vortexed, and shaken, and incubated for
1 h at -20  C. After centrifuging samples for 10 min at 14,000 g, the supernatant was collected and centrifuged again repeatedly. The
supernatant was filtered and tested.42 For culture supernatant samples, after centrifuging for 10 min at 14,000 g to remove the or-
ganisms and impurities, the supernatant was acidified to pH=2.5 using hydrochloric acid and extracted twice with a double volume of
ethyl acetate. Then, air-dried and redissolved in one-tenth volume of methanol. The supernatant was filtered and assayed.
For Untargeted LC-MS/MS, prepared plasma samples as described above. The supernatant was commissioned to Majorbio Bio-
Pharm Technology Co. Ltd. (Shanghai, China). Briefly, metabolites were detected on the Thermo UHPLC-Q Exactive system. The
analytical conditions follow: buffer A was 95 % ddH2O plus 5 % acetonitrile (containing 0.1 % formic acid) and buffer B was 47.5
% acetonitrile with 47.5 % isopropanol and 5 % ddH2O (containing 0.1 % formic acid). The gradient conditions were as follows: Pos-
itive ion mode: 0 to 3 min, gradient to 20 % buffer B; 3 to 4.5 min, gradient to 35 % buffer B; 4.5 to 5 min, gradient to 100 % buffer B; 5
to 6.3 min, 100 % buffer B; 6.3 to 6.4 min, gradient to 0 % buffer B; 6.4 to 8 min, 0 % buffer B. Negative ion mode: 0 to 1.5 min, gradient
to 5 % buffer B; 1.5 to 2 min, gradient to 10 % buffer B; 2 to 4.5 min, gradient to 30 % buffer B; 4.5 to 5 min, gradient to 100 % buffer B;
5 to 6.3 min, 100 % buffer B; 6.3 to 6.4 min, gradient to 0 % buffer B; 6.4 to 8 min, 0 % buffer B. The flow rate was 0.40 ml/min. HMDB
(http://www.hmdb.ca/) and Metlin (https://metlin.scripps.edu/) were used to match the mass spectrometry data. On the basis of the
KEGG database, metabolic enrichment and pathway analysis were performed on the differential metabolites.
IPYA, ILA, IA and IPA were detected as described above. Metabolites were detected on the 5500 QTRAP triple quadrupole mass
spectrometer (SCIEX, Framingham, MA, USA). The analytical conditions follow: buffer A was ddH2O plus 0.1 % formic acid and buffer
B was acetonitrile plus 0.1 % formic acid. The gradient conditions were as follows: 0 to 1 min, 5 % buffer B; 1 to 7 min, gradient to 95
% buffer B; 7 to 10 min, 95% buffer B; 10 to 13 min, gradient to 5 % buffer B; 13 to 14 min, 5 % buffer B. The flow rate was 0.40 ml/min.

16S rRNA sequencing

Feces from both ‘Responder’ (n=5) and ‘Poor-responder’ (n=5) groups of mice were collected. Genomic DNA from fecal samples was
extracted and tested for concentration and purity using electrophoresis and NanoDrop 2000. The subsequent library construction
and sequencing process was commissioned to Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). Briefly, full-length
PCR amplification of the 16S rRNA gene was performed using 27F (5’-AGRGTTYGATYMTGGCTCAG-30 ) and 1492R (50 -RGY
TACCTTGTTACGACTT-30 ) primers, followed by library construction and sequencing. UPARSE 7.1 was used to cluster the
sequencing results into operational taxonomic units (OTUs), with 97 % sequence similarity and chimeras were removed. Taxonomic
annotation of OTUs using the RDP classifier ratio against the Silva 16S rRNA gene database with a 70 % confidence threshold. The
similarity of microbial community structure between samples was examined using PCoA based on the Bray-Curtis distance
algorithm.

Shotgun metagenomic sequencing

Total genomic DNA was extracted from both ‘Responder’ (n=5) and ‘Poor-responder’ (n=5) groups of feces with the PF Mag-Bind
Stool DNA Kit according to the manufacturer’s instructions. The subsequent library construction and sequencing process was
commissioned to Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). Briefly, DNA extract was fragmented to an average
size of about 400 bp for paired-end library construction. The paired-end library was constructed using NEXTFLE Rapid DNA-Seq.
Paired-end sequencing was performed on Illumina Novaseq 6000 (Illumina Inc., San Diego, CA, USA) according to the manufac-
turer’s instructions. Metagenome sequencing data was further processed by bioinformatics pipelines on the online platform of Ma-
jorbio Cloud Platform (www.majorbio.com) with data quality-filtering (length<50 bp or with a quality value <20 or having N bases),
assembly, genomic contamination elimination and taxonomic compositions identification.

Single-cell RNA and TCR sequencing

To perform single-cell RNA sequencing analysis, we treated mice under each treatment condition (WT (aPD-1) and IPA-treated
(IPA+aPD-1), n=2 biological replicates/group). Flow sorting was used to obtain tumor-infiltrating CD8+ T cells (BD Biosciences,
561869, BioLegend, 420404, 100203, 100714) and cell suspensions were dissociated and loaded into the 10x Chromium instrument.

Cell 187, 1651–1665.e1–e9, March 28, 2024 e8

 ll
Article

After library construction, the NovaSeq 6000 sequencing platform was used for RNA sequencing and a sequencing depth of 20,000
reads per cell was required. Illumina bcl2fastq software was used to demultiplex and convert the sequencing data into FASTQ format
files. TCR library construction and TCR V(D)J targeted enrichment were performed with the Chromium Single Cell V(D)J Enrichment
Kit (10x Genomics) according to the manufacturer’s user guide. For dimension reduction, clustering, and analysis of the scRNA-seq
data, the Cell Ranger output was loaded into Seurat.57 All cells were filtered by quality control conditions (Expression of all genes was
detected in at least 3 cells, with the number of genes expressed in a single cell between 500 and 5000, the number of UMIs greater
than or equal to 500, and the ratio of mitochondrial gene expression less than 25 %). The filtered cells were analyzed by UMAP
downscaling using R software to obtain visualization results. Using the scRepertoire (v.2.0.0) package,58 sample-specific consensus
annotation files were consolidated into a list of TCR sequencing results and then integrated with the Seurat object for visualization.
Enrichment analysis was performed by Vision package (v2.1.0).30 Monocle 3 was applied to perform trajectory analysis.59 The other
Single Cell Data Analysis was performed using the OmicStudio tools created by LC-BIO Co., Ltd (Hangzhou, China) at https://www.
omicstudio.cn/cell.

Single-cell ATAC sequencing

To perform single-cell ATAC-seq, we treated mice under each treatment condition (WT (aPD-1) and IPA-treated (IPA+aPD-1), n=2
biological replicates/group). Flow sorting was used to obtain tumor-infiltrating CD8+ T cells (BD Biosciences, 561869, BioLegend,
420404, 100203, 100714) and cell suspensions were dissociated and loaded into the 10x Chromium instrument. Single-cell
ATAC-seq libraries were prepared according to the Chromium Single Cell ATAC Library Kit from 10x Genomics following the man-
ufacturer’s instructions. 10x Genomics Cell Ranger ATAC pipeline (version 2.1.0) was used for scATAC-seq analyses of alignment,
deduplication, and identification of transposase cut sites (https://support.10xgenomics.com/). The trimmed read-pairs are aligned to
a specified reference using BWA-MEM with default Parameters.60 Fragments were identified as read pairs with mapping quality
(MAPQ)>30. Reads were counted across the genome, using 500-bp bins (tiles) to generate a genome-wide tile-count-matrix. Latent
semantic indexing (LSI), Louvain clustering and Harmorny algorithm were applied. Gene activity scores were computed as the
summed local accessibility of promoter-associated count-tiles in the proximity of each gene, using a distance-weighted accessibility
model. Finally, the above-weighted sum was multiplied by the aggregated Tn5 insertions in each tile. Gene scores were then scaled
to 10,000 counts and log2-normalized. To enhance the visual interpretation of gene activity scores, smoothing was applied using the
MAGIC algorithm. Downstream bioinformatics pipelines analysis was conducted with R (R version 4.1.2) package ArchR (version
1.0.2) and Seurat (version 4.1.1). ScATAC-seq cluster was identified by gene activity scores and scRNA-seq gene expression.
MACS2 was applied to identify a robust merged peak.61 Then peaks were annotated according to their respective genomic position
(promoter, intronic, exonic, distal etc). Differential accessibility analysis between cells was performed to identify celltype-specific and
condition-specific marker peaks (|Log2FC| > 0.5 and p-value < 0.01).

Quantitative real-time PCR

Bacterial DNA was extracted from mouse and human feces using the TIANGEN Fecal Kit (TIANGEN, DP328-02) and bacterial
genomic DNA from human tumor and adjacent normal mucosa using the TIANGEN DNA Kit (TIANGEN, DP304-02). RNA from
ALI-PDOs was extracted using the SteadyPure RNA extraction kit (Accurate Biology, AG21017) and reverse transcribed using
ABScript III RT Master Mix (ABclonal, RK20429). qPCR was performed in Light Cycler 480 real-time PCR system (Roche) using
SYBR Green Fast qPCR Mix (ABclonal, RK21203). cDNA was amplified by PCR under the following conditions: 95  C for 3 min,
followed by 45 cycles of 95  C for 5 s and 60  C for 30 s. The specific Primer sequences were listed in the key resources table.
The universal Eubacteria 16S or b-ACTIN was used as internal reference genes.

QUANTIFICATION AND STATISTICAL ANALYSIS

GraphPad Prism was used for all statistical analyses. The experiments were designed to use a minimum of 3 samples/replicates
per experiment or per group. Representative immunofluorescent staining, LC-MS/MS and flow cytometry images are presented.
Each experiment was repeated in triplicate independently. The data are expressed as the mean ± standard deviation (SD) or
mean ± standard error of mean (SEM). Differences between groups were analyzed by two-tail ratio paired t test, unpaired t test, Wil-
coxon rank-sum test, Mann Whitney test, one-way ANOVA with Sidak’s correction for multiple comparisons, two-way ANOVA with
Sidak’s correction for multiple comparisons, Spearman correlation analysis and log-rank test. Statistically significant were P
values < 0.05.

e9 Cell 187, 1651–1665.e1–e9, March 28, 2024

 ll
Article

Supplemental figures

Figure S1. L. johnsonii reduces in colorectal cancer and is related to ICB responsiveness through activating IFN-g+ and TNF-a+ CD8+ T cells,
related to Figure 1
(A) Principal co-ordinates analysis (PCoA) of fecal metagenomics sequencing from responsive (responder) mice or poorly responsive (poor-responder) mice at
the OTU level. n = 5 mice per group.
(B) Community barplot analysis of metagenomics sequencing of fecal samples from responder mice and poor-responder mice at the genus level. n = 5 mice
per group.
(C) Wilcoxon rank-sum test bar plot of fecal metagenomics sequencing from responder mice and poor-responder mice at the species level.
(D) The L. johnsonii abundance of feces from mice between responder mice and poor-responder mice. n = 5 mice per group.
(E) The correlation of tumor volume and the abundance of L. johnsonii between responder mice and poor-responder mice were analyzed. n = 5 mice per group.
(F) The L. johnsonii abundance of feces from mice with Apcmin/+ model (n = 10) and WT control (n = 5).
(G) The L. johnsonii abundance of feces from mice with AOM/DSS-induced CRC model (n = 5) and WT control (n = 5).
(H) The L. johnsonii abundance of colon tissues of tumor and adjacent normal mucosa. n = 92 individual patients.
(I) The L. johnsonii abundance of feces from healthy control (n = 67), colon adenoma patients (n = 40), different stage CRC patients (n = 108, 0-IV tumor node
metastasis, TNM classifications).

(legend continued on next page)

 ll
Article

(J and K) The frequencies of IFN-g+ CD8+ T cells (J) and TNF-a+ CD8+ T cells (K) from Mc38 tumor in four groups. The effectors IFN-g and TNF-a were detected by
adding 2 ml activation cocktails to 1 ml of cell suspension and incubating for 6 h at 37 C. n = 7 mice per group.
(C) represents mean ± SD analyzed by Wilcoxon rank-sum test without multiple testing. (D), (F), and (G) represent mean ± SEM analyzed by unpaired t test.
(E) represents correlation analyzed by Spearman correlation analysis. (H) represents individual patients analyzed by two-tail ratio paired t test. (I)–(K) represent
mean ± SEM analyzed by one-way ANOVA with Sidak’s correction for multiple comparisons. Data are representative of three independent experiments. L. j,
L. johnsonii; WT, wild type; AOM/DSS, azoxymethane/dextran sodium sulfate; CRC, colorectal cancer. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
 ll
Article

Figure S2. L. johnsonii and its metabolite, IPA, sensitize aPD-1 immunotherapy, and affect associated immunocytes, related to Figure 3
(A) LC-MS/MS identification of the standard 1,000 ng/ml IPYA (202.2/174.1), 100 ng/ml ILA (206.2/118.1), 100 ng/ml IA (188.1/115.2), and 100 ng/ml IPA
(190.2/130.2).
(legend continued on next page)
 ll
Article

(B) Concentration of plasma IPA in two groups were tested by LC-MS/MS. n = 6 mice per group.
(C) Concentration of plasma IPA in two groups were tested by LC-MS/MS. n = 7 mice per group.
(D and E) Schematic diagram (D) and Tumor volume (E) of aPD-1 antibody-treated Mc38 tumor-bearing mice, combined with L. johnsonii (L. j + aPD-1) or IPA
(IPA + aPD-1) at the time of checkpoint blockade treatment. n = 6 mice per group.
(F) Tumor volume of Mc38 tumor-bearing mice treated with aPD-1 antibody alone (aPD-1), different concentration of IPA (6, 60, and 300 mg/kg/day, respectively)
combined with aPD-1 antibody. n = 7 mice per group.
(G) Concentration of plasma (left) and intratumoral (right) IPA in four groups were tested by LC-MS/MS. n = 7 mice per group.
(H and I) Schematic diagram (H) and tumor volume (I) of Mc38 tumor-bearing mice treated with aPD-1 antibody alone (aPD-1), 5 mM IPA and aPD-1 antibody
(5 mM + aPD-1), and 50 mM IPA and aPD-1 antibody (50 mM + aPD-1). n = 7 mice per group.
(J–Q) Frequencies of NK cells (J), IFN-g+ NK cells (K), TNF-a+ NK cells (L), B cells (M), dendritic cells (N), macrophages (O), CD4+ T cells (P), and TNF-a+ CD8+
T cells (Q) from Mc38 tumor in three groups were tested by multicolor flow cytometry. The effectors IFN-g and TNF-a were detected by adding 2 ml activation
cocktails to 1 ml of cell suspension and incubating for 6 h at 37 C. n = 7 mice per group.
(B) and (C) represent mean ± SEM analyzed by unpaired t test. (E), (F), and (I) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for
multiple comparisons. (G) and (J)–(Q) represent mean ± SEM analyzed by one-way ANOVA with Sidak’s correction for multiple comparisons. Data are repre-
sentative of three independent experiments. IPYA, indole-3-pyruvate acid; ILA, indole-3-lactic acid; IA, indole-3-acrylic acid; IPA, indole-3-propionic acid; L. j,
L. johnsonii; FMT, fecal microbiota transplantation; Trpneg diet, tryptophan deficiency diet. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
 ll
Article

Figure S3. Single-cell RNA sequencing analysis shows IPA promotes the differentiation of CD8+ T cells by upregulating progenitor ex-
hausted CD8+ T cells, related to Figure 4
(A) UMAP plot clustering from WT (n = 2, aPD-1 group) and IPA (n = 2, IPA + aPD-1 group).
(B) UMAP plot clustering of CD8+ T cells, macrophages, neutrophils, and fibroblasts from WT (n = 2) and IPA (n = 2) groups.
(C) Dot plot of signature genes of CD8+ T cells, macrophages, neutrophils, and fibroblasts clusters.
(D) UMAP plot clustering of CD8+ T cells from WT (n = 2, aPD-1 group) and IPA (n = 2, IPA + aPD-1 group).
(E) UMAP plot showing the 13 cell clusters the expression of each CD8+ T cell clusters markers.
(F) UMAP plot showing the expression of Pdcd1 in each CD8+ T cell clusters.
(G) Dot plot of the expression of Pdcd1 of the progenitor exhausted CD8+ T cells between WT (n = 2) and IPA (n = 2) groups.
(H) UMAP clustering with cell annotation between WT (n = 2) and IPA (n = 2) groups.

(legend continued on next page)

 ll
Article

(I) UMAP plot showing the effector CD8+ T cells between WT (n = 2) and IPA (n = 2) groups.
(J) Scatterplots showing the average signature score for GO_ALPHA_BETA_T_CELL_ACTIVATION gene sets of each cluster in WT (n = 2) and IPA (n = 2) groups.
(K) Violin plot (left) and ECDF plot (right) of VISION enrichment score for GO_ALPHA_BETA_T_CELL_ACTIVATION gene sets of the effector CD8+ T cells cluster.
(K) represents VISION enrichment score analyzed by Wilcoxon rank-sum test. IPA, indole-3-propionic acid; UMAP, uniform manifold approximation and pro-
jection; WT, wild type.
 ll
Article

Figure S4. Flow cytometry analysis, monocle analysis, and single-cell TCR sequencing analysis are performed on CD8+ T cells after IPA
treatment, related to Figure 4
(A and C) Frequencies of CD8+ T cells from Mc38 tumor-draining lymph node (TDLN, A) and spleen (C) treated with aPD-1 antibody alone (aPD-1) or combined IPA
and aPD-1 antibody (IPA + aPD-1). n = 7 mice per group.
(B and D) Mean fluorescence intensity (MFI) summary of TCF-1 expression on the CD8+ T cells from TDLN (B) and spleen (D) treated with aPD-1 antibody alone
(aPD-1) or combined IPA and aPD-1 antibody (IPA + aPD-1). n = 7 mice per group.
(E) Gating strategy of TCF-1+ PD-1+ CD8+ T cells for multicolor flow cytometry after ex vivo culture. CD8+ T cells were purified from lymph nodes or spleen of mice.
(F) Pseudotime trajectory for CD8+ T cells between WT and IPA in a two-dimensional state-space defined by monocle 2, colored by different groups.
(G) Pseudotime trajectory for CD8+ T cells between WT and IPA in a two-dimensional state-space defined by monocle 3, the degree of color represented
pseudotime (left), and the colors represent different identified T cell subsets (right).
(H) Relative abundance of the different clonotype groups based on the frequency of clonotype in WT and IPA-treated samples. Clone size classes are defined by
frequency in sample according to the shown thresholds.
(A)–(D) represent mean ± SEM analyzed by unpaired t test. Data are representative of three independent experiments. IPA, indole-3-propionic acid; MFI, mean
fluorescence intensity; TDLN, tumor-draining lymph node; UMAP, uniform manifold approximation and projection; WT, wild type. ns, not significant,
*p < 0.05, **p < 0.01.
 ll
Article

Figure S5. IPA affects chromosome accessibility in progenitor exhausted CD8+ T cells, related to Figure 5
(A) UMAP plot showing the mapping CD8+ T cells between scRNA-seq (n = 2 biological replicates/group) and scATAC-seq (n = 2 biological replicates/group).
(B) UMAP plot showing the expression of each CD8+ T cell clusters markers of scATAC-seq.
(C) Proportions of significantly differential peaks location of the each CD8+ T cell clusters between WT (n = 2) and IPA (n = 2) groups.
(D–F) Violin plot (left) and ECDF plot (right) of VISION enrichment score for ‘‘GO_HISTONE_METHYLATION,’’ ‘‘GO_HISTONE_H2A_ACETYLATION,’’ ‘‘GO_
HISTONE_H4_ACETYLATION’’ gene sets of the progenitor exhausted CD8+ T cells cluster.
(D)–(F) represent VISION enrichment score analyzed by Wilcoxon rank-sum test. IPA, indole-3-propionic acid; WT, wild type.
 ll
Article

Figure S6. The cooperation of L. johnsonii with D-2-hydroxyacid dehydrogenase and C. sporogenes promotes IPA production, related to
Figure 6
(A) Concentration of supernatant ILA, IA, and IPA between MRS and Lj. CM. n = 6 independent experiments.
(B) Concentration of plasma IPA in four groups were tested by LC-MS/MS. n = 6 mice per group.
(C) Concentration of plasma IPA in three groups were tested by LC-MS/MS. n = 6 mice per group.
(legend continued on next page)
 ll
Article

(D) Bacteria genomic DNA was extracted from feces between aPD-1 and L. j + aPD-1 groups. The abundance of C. sporogenes was tested by qPCR. n = 7 mice
per group.
(E) LC-MS/MS identification of plasma ILA and IPA in four groups. n = 7 mice per group.
(F) The amino acid sequences of D-2-hydroxyacid dehydrogenase encoded by ldhA of L. johnsonii. The ATG start codon and TAA stop codon are highlighted.
(G) 3-dimensional structures of D-2-hydroxyacid dehydrogenase were modeled by SWISS-MODEL.
(H) LC-MS/MS identification of supernatant ILA between E. c and E. c-ldhA. n = 6 independent experiments.
(I) Concentration of plasma IPA in three groups were tested by LC-MS/MS. n = 7 mice per group.
(A) represents mean ± SD analyzed by Mann-Whitney analysis. (B), (C), (E), and (I) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for
multiple comparisons. (D) and (H) represent mean ± SEM analyzed by unpaired t test. Data are representative of three independent experiments. MRS, de Man,
Rogosa, and Sharpe medium; CM, conditional medium; Abx, antibiotics; ILA, indole-3-lactic acid; IPA, indole-3-propionic acid; L. j, L. johnsonii; C. s, C.
sporogenes. ns, not significant, *p < 0.05, **p < 0.01, ****p < 0.0001.
 ll
Article

Figure S7. IPA modulates ICB responsiveness in pan-cancer and CRC-derived organoids, related to Figure 7
(A) The frequencies of CD8+ T cells of mouse 4T1 transplantable tumor model treated with IgG control antibody, IPA, aPD-1 antibody alone (aPD-1), or combined
IPA and aPD-1 antibody (IPA + aPD-1). n = 7 mice per group.
(B) The frequencies of CD8+ T cells of mouse B16-F10 transplantable tumor model treated with IgG control antibody, IPA, aPD-1 antibody alone (aPD-1), or
combined IPA and aPD-1 antibody (IPA + aPD-1). n = 7 mice per group.
(C) The frequencies of CD8+ T cells of mouse mammary fat pad 4T1 orthotopic implantation model treated with aPD-1 antibody alone (aPD-1) or combined IPA
and aPD-1 antibody (IPA + aPD-1). n = 7 mice per group.
(D) The frequencies of CD8+ T cells of mouse cecum Mc38 orthotopic implantation model treated with aPD-1 antibody alone (aPD-1) or combined IPA and aPD-1
antibody (IPA + aPD-1). n = 5 mice per group.

(legend continued on next page)

 ll
Article

(E) Representative images showing immunofluorescence staining of CD8 (red) and DAPI (blue) in ALI-PDOs treated with or without IPA (scale bars, 20 mm). n = 5
patients.
(F) Frequency of CD8+ cells in DAPI+ cells from two groups. n = 5 patients.
(G) Gating strategy of TCF-1+ PD-1+ progenitor exhausted CD8+ T cells for multicolor flow cytometry from clinical CRC patients.
(H) Fluorescence minus one (FMO) control of TCF-1.
(A) and (B) represent mean ± SEM analyzed by two-way ANOVA with Sidak’s correction for multiple comparisons. (C) and (D) represent mean ± SEM analyzed by
Mann-Whitney analysis. (F) represents mean ± SEM analyzed by unpaired t test. Data are representative of three independent experiments. IPA, indole-3-
propionic acid; ALI-PDO, air-liquid interface patient-derived organoid. *p < 0.05, **p < 0.01, ****p < 0.0001.