Cell Migration in Three Dimensions 1st

Edition Coert Margadant (Editor)

Visit to download the full and correct content document:
https://ebookmeta.com/product/cell-migration-in-three-dimensions-1st-edition-coert-m
argadant-editor/
More products digital (pdf, epub, mobi) instant
download maybe you interests ...

Fourier Restriction for Hypersurfaces in Three

Dimensions and Newton Polyhedra AM 194 Annals of
Mathematics Studies 194 1st Edition Isroil A. Ikromov

https://ebookmeta.com/product/fourier-restriction-for-
hypersurfaces-in-three-dimensions-and-newton-polyhedra-
am-194-annals-of-mathematics-studies-194-1st-edition-isroil-a-
ikromov/

Educational Assessment in a Time of Reform Standards

and Standard Setting for Excellence in Education 1st
Edition Coert Loock

https://ebookmeta.com/product/educational-assessment-in-a-time-
of-reform-standards-and-standard-setting-for-excellence-in-
education-1st-edition-coert-loock/

In-cell NMR Spectroscopy: From Molecular Sciences to

Cell Biology (ISSN) 1st Edition Yutaka Ito (Editor)

https://ebookmeta.com/product/in-cell-nmr-spectroscopy-from-
molecular-sciences-to-cell-biology-issn-1st-edition-yutaka-ito-
editor/

Mechanisms in Cell Physiology Michele Mazzanti

https://ebookmeta.com/product/mechanisms-in-cell-physiology-
michele-mazzanti/
Mechanotransduction Cell Signaling to Cell Response 1st
Edition Paul Sundaram

https://ebookmeta.com/product/mechanotransduction-cell-signaling-
to-cell-response-1st-edition-paul-sundaram/

New Dimensions in Photo Processes 5th Edition Laura

Blacklow

https://ebookmeta.com/product/new-dimensions-in-photo-
processes-5th-edition-laura-blacklow/

Bioreactors in Stem Cell Biology Kursad Turksen

https://ebookmeta.com/product/bioreactors-in-stem-cell-biology-
kursad-turksen/

Spiritual Dimensions in the Music of Edmund Rubbra 1st

Edition Lucinda Cradduck

https://ebookmeta.com/product/spiritual-dimensions-in-the-music-
of-edmund-rubbra-1st-edition-lucinda-cradduck/

Gaussian Measures in Finite and Infinite Dimensions 1st

Edition Daniel W. Stroock

https://ebookmeta.com/product/gaussian-measures-in-finite-and-
infinite-dimensions-1st-edition-daniel-w-stroock/
Methods in
Molecular Biology 2608

Coert Margadant Editor

Cell Migration
in Three
Dimensions
METHODS IN MOLECULAR BIOLOGY

Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, UK

For further volumes:

http://www.springer.com/series/7651
For over 35 years, biological scientists have come to rely on the research protocols and
methodologies in the critically acclaimed Methods in Molecular Biology series. The series was
the first to introduce the step-by-step protocols approach that has become the standard in all
biomedical protocol publishing. Each protocol is provided in readily-reproducible step-by-
step fashion, opening with an introductory overview, a list of the materials and reagents
needed to complete the experiment, and followed by a detailed procedure that is supported
with a helpful notes section offering tips and tricks of the trade as well as troubleshooting
advice. These hallmark features were introduced by series editor Dr. John Walker and
constitute the key ingredient in each and every volume of the Methods in Molecular Biology
series. Tested and trusted, comprehensive and reliable, all protocols from the series are
indexed in PubMed.
Cell Migration in Three
Dimensions

Edited by

Coert Margadant
Department of Medical Oncology, Cancer Center Amsterdam,
Amsterdam University Medical Center, Amsterdam, The Netherlands
Editor
Coert Margadant
Department of Medical Oncology
Cancer Center Amsterdam
Amsterdam University Medical Center
Amsterdam, The Netherlands

ISSN 1064-3745 ISSN 1940-6029 (electronic)

Methods in Molecular Biology
ISBN 978-1-0716-2886-7 ISBN 978-1-0716-2887-4 (eBook)
https://doi.org/10.1007/978-1-0716-2887-4
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part
of Springer Nature 2023
7 chapters are licensed under the terms of the Creative Commons Attribution 4.0 International License (http://
creativecommons.org/licenses/by/4.0/). For further details see license information in the chapter.
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part
of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and
retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter
developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply,
even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations
and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been
made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer
Nature.
The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.
Preface

This book constitutes 24 chapters that are written by experts in the field and detail methods
to investigate cell migration, organized into 4 major themes; (1) the cell biology of cell
migration, (2) developmental model systems to assess cell migration during morphogenesis,
(3) cell migration in cancers and the tumor micro-environment, and (4) blood vessel formation
and interactions.
Several chapters address how to examine important molecular mechanisms underlying
cell migration, including the dynamic regulation of integrins, focal adhesions, and filopodia,
as well as the spatiotemporal control of mRNA translation and protein synthesis during
migration. Furthermore, protocols are included for the study of extracellular vesicle release,
as well as confined cell migration and nuclear deformation. Other chapters focus on methods
to visualize and quantitatively assess cell migration during morphogenetic and/or develop-
mental processes in Drosophila, zebrafish, and mice, or on aspects of cancer, such as
migration patterns within tumors and the invasive behavior of tumor organoids and spher-
oids, including metabolism, leader-follower cell hierarchy, and matrix degradation. Finally,
several chapters are dedicated to the study of blood vessels and their formation. These cover
the imaging of endothelial cell dynamics during angiogenesis, endothelial/pericyte interac-
tions in microfluidic systems, and in vivo approaches in zebrafish and mice to analyze
vascular morphogenesis, leukocyte extravasation, and blood vessel ingrowth into tumors.
Altogether, this is a unique and excellent collection of state-of-the-art methods and
protocols to interrogate cell migration in a wide variety of different contexts and model
organisms, as well as advanced image analysis and quantitative assessment of a diverse array
of parameters related to cell migration. As such, this book will serve as a landmark edition of
cell migration protocols and will provide a solid foundation for scientists of different
disciplines to investigate cell migration in biological processes.

Amsterdam, The Netherlands Coert Margadant

v
Contents

Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
1 Cell Migration in Three Dimensions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Coert Margadant

PART I THE CELL BIOLOGY OF CELL MIGRATION

2 Use of Ecto-Tagged Integrins to Monitor Integrin Exocytosis

and Endocytosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Clotilde Huet-Calderwood, Felix Rivera-Molina,
Derek Toomre, and David A. Calderwood
3 Probing the ER-Focal Adhesion Link During Cell Migration. . . . . . . . . . . . . . . . . 39
Noemi A. Guadagno and Cinzia Progida
4 Mapping the Localization of Proteins Within Filopodia
Using FiloMap . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
Guillaume Jacquemet
5 Extended Methods for 2D Confinement. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Juan M. Garcı́a-Arcos, Kevin Gateau,
Larisa Venkova, and Matthieu Piel
6 Visualization of Exosome Release and Uptake During Cell Migration
Using the Live Imaging Reporter pHluorin_M153R-CD63. . . . . . . . . . . . . . . . . . 83
Bong H. Sung and Alissa M. Weaver
7 Approaches to Determine Nuclear Shape in Cells During Migration
Through Collagen Matrices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Martin Svoren, Elena Camerini, Merijn van Erp,
Feng Wei Yang, Gert-Jan Bakker, and Katarina Wolf

PART II DEVELOPMENTAL MODEL SYSTEMS TO ASSESS CELL

MIGRATION DURING MORPHOGENESIS
8 Dissecting Collective Cell Behavior in Migrating Testis
Myotubes in Drosophila . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
Maik C. Bischoff and Sven Bogdan
9 Whole-Mount In Situ Hybridization for Detection of Migrating
Zebrafish Endodermal Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Antonius L. van Boxtel
10 Live-Imaging Analysis of Epithelial Zippering During Mouse
Neural Tube Closure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
Matteo A. Molè, Gabriel L. Galea, and Andrew J. Copp

vii
viii Contents

11 Time-Lapse Imaging and Morphometric Analysis of Tracheal

Development in Drosophila . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
Sofia J. Araújo and Marta Llimargas
12 A Guide Toward Multi-scale and Quantitative Branching Analysis
in the Mammary Gland . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
Edouard Hannezo and Colinda L. G. J. Scheele
13 Analysis of Integrin-Dependent Melanoblast Migration
During Development. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207
Amanda Haage and Guy Tanentzapf

PART III CELL MIGRATION IN CANCERS AND THE TUMOR MICROENVIRONMENT

14 Invadopodia Methods: Detection of Invadopodia Formation

and Activity in Cancer Cells Using Reconstituted 2D and 3D
Collagen-Based Matrices. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
David Remy, Anne-Sophie Macé, Philippe Chavrier,
and Pedro Monteiro
15 Analysis of Energy-Driven Leader-Follower Hierarchy During
Collective Cancer Cell Invasion. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Jian Zhang and Cynthia A. Reinhart-King
16 Visualizing and Quantifying mRNA Localization at the Invasive
Front of 3D Cancer Spheroids. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 263
Konstadinos Moissoglu, Stephen J. Lockett, and Stavroula Mili
17 Multimodal Techniques to Study Tumor Growth, Basement
Membrane Breaching, and Invasion in 3D Matrices . . . . . . . . . . . . . . . . . . . . . . . . . 281
Daan Smits and Antoine A. Khalil
18 Analysis of Collective Migration Patterns Within Tumors . . . . . . . . . . . . . . . . . . . . 305
Ralitza Staneva and Andrew G. Clark
19 An In Vivo Model to Study Cell Migration in XYZ-T Dimension
Followed by Whole-Mount Re-evaluation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 325
Ann L. B. Seynhaeve and Timo L. M. ten Hagen

PART IV BLOOD VESSEL FORMATION AND INTERACTIONS

20 Angiogenesis Invasion Assay to Study Endothelial Cell Invasion

and Sprouting Behavior. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 345
Yuechao Dong, Florian Alonso, Tiya Jahjah,
Isabelle Fremaux, and Elisabeth Génot
21 Live-Cell Labeling and Artificial Intelligence Approaches
for High-Resolution XYZT Imaging of Cytoskeletal Dynamics
During Collective Cell Migration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 365
Maxime Cammeraat, Marko Popovic, Wendy Stam,
and Coert Margadant
 Contents ix

22 Analysis of mRNA Subcellular Distribution in Collective

Cell Migration. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 389
Joshua J. Bradbury, Holly E. Lovegrove, Marta Giralt-Pujol,
and Shane P. Herbert
23 A Bioengineered Model for Studying Vascular-Pericyte Interactions
of the Placenta. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 409
Marta Cherubini and Kristina Haase
24 Analysis of Vascular Morphogenesis in Zebrafish . . . . . . . . . . . . . . . . . . . . . . . . . . . . 425
Marvin Hubert and Wiebke Herzog
25 Analysis of Monocyte Recruitment During Inflammation
by Intravital Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 453
Jose M. Gonzalez-Granado, Alberto Del Monte-Monge,
Laura Piqueras, Vicente Andres, and Cristina Rius

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 469
Contributors

FLORIAN ALONSO • University Bordeaux, INSERM, Centre de Recherche cardio-thoracique

de Bordeaux, U1045, Bordeaux, France
VICENTE ANDRES • Centro Nacional de Investigaciones Cardiovasculares (CNIC), Madrid,
Spain; CIBER de Enfermedades Cardiovasculares (CIBERCV), Madrid, Spain
SOFIA J. ARAÚJO • Department of Genetics, Microbiology and Statistics, School of Biology,
University of Barcelona (UB), Barcelona, Spain; Institute of Biomedicine, University of
Barcelona (IBUB), Barcelona, Spain
GERT-JAN BAKKER • Department of Cell Biology, Radboud University Medical Center,
Nijmegen, the Netherlands
MAIK C. BISCHOFF • Department of Molecular Cell Physiology, Institute of Physiology and
Pathophysiology, Philipps-University Marburg, Marburg, Germany
SVEN BOGDAN • Department of Molecular Cell Physiology, Institute of Physiology and
Pathophysiology, Philipps-University Marburg, Marburg, Germany
JOSHUA J. BRADBURY • Faculty of Biology, Medicine and Health, University of Manchester,
Manchester, UK
DAVID A. CALDERWOOD • Departments of Pharmacology, Yale University School of Medicine,
Yale University, New Haven, CT, USA; Departments of Cell Biology, Yale University
School of Medicine, Yale University, New Haven, CT, USA
ELENA CAMERINI • Department of Cell Biology, Radboud University Medical Center,
Nijmegen, the Netherlands
MAXIME CAMMERAAT • Department of Medical Oncology, Cancer Center Amsterdam,
Amsterdam University Medical Center, Amsterdam, The Netherlands
PHILIPPE CHAVRIER • Institut Curie, CNRS UMR144, PSL Research University, Research
Center, Actin and Membrane Dynamics Laboratory, Paris, France
MARTA CHERUBINI • European Molecular Biology Laboratory (EMBL), Barcelona, Spain
ANDREW G. CLARK • University of Stuttgart, Institute of Cell Biology and Immunology,
Stuttgart, Germany; University of Stuttgart, Stuttgart Research Center Systems Biology,
Stuttgart, Germany; University of Tübingen, Center for Personalized Medicine, Tübingen,
Germany
ANDREW J. COPP • Newlife Birth Defects Research Centre, Great Ormond Street Institute of
Child Health, University College London, London, UK
ALBERTO DEL MONTE-MONGE • Centro Nacional de Investigaciones Cardiovasculares
(CNIC), Madrid, Spain; CIBER de Enfermedades Cardiovasculares (CIBERCV),
Madrid, Spain
YUECHAO DONG • University Bordeaux, INSERM, Centre de Recherche cardio-thoracique de
Bordeaux, U1045, Bordeaux, France
ISABELLE FREMAUX • University Bordeaux, INSERM, Centre de Recherche cardio-thoracique
de Bordeaux, U1045, Bordeaux, France
GABRIEL L. GALEA • Newlife Birth Defects Research Centre, Great Ormond Street Institute of
Child Health, University College London, London, UK; Comparative Bioveterinary
Sciences, Royal Veterinary College, London, UK

xi
xii Contributors

JUAN M. GARCÍA-ARCOS • Institut Pierre Gilles de Gennes, PSL Research University, Paris,
France; Current affiliation, Department of Biochemistry and Swiss National Centre of
Competence in Research, Chemical Biology, University of Geneva, Geneva, Switzerland
KEVIN GATEAU • Institut Pierre Gilles de Gennes, PSL Research University, Paris, France;
Ecole Normale Supérieure Paris-Saclay, Gif-sur-Yvette, France
ELISABETH GÉNOT • University Bordeaux, INSERM, Centre de Recherche cardio-thoracique
de Bordeaux, U1045, Bordeaux, France
MARTA GIRALT-PUJOL • Faculty of Biology, Medicine and Health, University of Manchester,
Manchester, UK
JOSE M. GONZALEZ-GRANADO • Department of Immunology, Ophthamology and ENT,
School of Medicine, Universidad Complutense de Madrid, Madrid, Spain; Centro Nacional
de Investigaciones Cardiovasculares (CNIC), Madrid, Spain; CIBER de Enfermedades
Cardiovasculares (CIBERCV), Madrid, Spain; LamImSys Lab, Instituto de Investigaci
on
Sanitaria Hospital 12 de Octubre (imas12), Madrid, Spain
NOEMI A. GUADAGNO • Department of Biosciences, University of Oslo, Oslo, Norway
AMANDA HAAGE • Department of Biomedical Sciences, University of North Dakota, Grand
Forks, ND, USA
KRISTINA HAASE • European Molecular Biology Laboratory (EMBL), Barcelona, Spain
EDOUARD HANNEZO • Institute of Science and Technology Austria (IST), Klosterneuburg,
Austria
SHANE P. HERBERT • Faculty of Biology, Medicine and Health, University of Manchester,
Manchester, UK
WIEBKE HERZOG • Friedrich-Alexander Universit€ a t Erlangen-Nürnberg, Division of
Developmental Biology, Erlangen, Germany; Cells-in-Motion Cluster of Excellence (EXC
1003 – CiM), University of Muenster, Muenster, Germany; Max Planck Institute for
Molecular Biomedicine, Muenster, Germany
MARVIN HUBERT • Friedrich-Alexander Universit€ a t Erlangen-Nürnberg, Division of
Developmental Biology, Erlangen, Germany; University of Muenster, Muenster, Germany;
Cells-in-Motion Cluster of Excellence (EXC 1003 – CiM), University of Muenster,
Muenster, Germany
CLOTILDE HUET-CALDERWOOD • Departments of Pharmacology, Yale University School of
Medicine, Yale University, New Haven, CT, USA
GUILLAUME JACQUEMET • Turku Bioscience Centre, University of Turku and Åbo Akademi
University, Turku, Finland; Faculty of Science and Engineering, Biosciences, Åbo Akademi
University, Turku, Finland; Turku Bioimaging, University of Turku and Åbo Akademi
University, Turku, Finland; InFLAMES Research Flagship Center, Åbo Akademi
University, Turku, Finland
TIYA JAHJAH • University Bordeaux, INSERM, Centre de Recherche cardio-thoracique de
Bordeaux, U1045, Bordeaux, France
ANTOINE A. KHALIL • Center for Molecular Medicine (CMM), University Medical Center
Utrecht, Utrecht, The Netherlands
MARTA LLIMARGAS • Institute of Molecular Biology of Barcelona (IBMB), CSIC, Parc
Cientı́fic de Barcelona, Barcelona, Spain
STEPHEN J. LOCKETT • Optical Microscopy and Analysis Laboratory, Cancer Research
Technology Program, Frederick National Laboratory for Cancer Research, Leidos
Biomedical Research Inc. for the National Cancer Institute, NIH, Frederick, MD, USA
HOLLY E. LOVEGROVE • Faculty of Biology, Medicine and Health, University of Manchester,
Manchester, UK
 Contributors xiii

ANNE-SOPHIE MACÉ • Institut Curie, PSL Research University, Cell and Tissue Imaging
Facility (PICT-IBiSA), Paris, France
COERT MARGADANT • Department of Medical Oncology, Cancer Center Amsterdam,
Amsterdam University Medical Center, Amsterdam, The Netherlands
STAVROULA MILI • Laboratory of Cellular and Molecular Biology, Center for Cancer
Research, National Cancer Institute, NIH, Bethesda, MD, USA
KONSTADINOS MOISSOGLU • Laboratory of Cellular and Molecular Biology, Center for
Cancer Research, National Cancer Institute, NIH, Bethesda, MD, USA
MATTEO A. MOLÈ • Newlife Birth Defects Research Centre, Great Ormond Street Institute of
Child Health, University College London, London, UK; Babraham Institute, Cambridge,
UK
PEDRO MONTEIRO • Institut Curie, CNRS UMR144, PSL Research University, Research
Center, Actin and Membrane Dynamics Laboratory, Paris, France
MATTHIEU PIEL • Institut Pierre Gilles de Gennes, PSL Research University, Paris, France
LAURA PIQUERAS • Institute of Health Research-INCLIVA, Valencia, Spain; Department of
Pharmacology, University of Valencia, Valencia, Spain
MARKO POPOVIC • Department of Molecular Cell Biology and Immunology, Amsterdam
University Medical Centers, Amsterdam, The Netherlands
CINZIA PROGIDA • Department of Biosciences, University of Oslo, Oslo, Norway
CYNTHIA A. REINHART-KING • Department of Biomedical Engineering, Vanderbilt
University, Nashville, TN, USA
DAVID REMY • Institut Curie, CNRS UMR144, PSL Research University, Research Center,
Actin and Membrane Dynamics Laboratory, Paris, France
CRISTINA RIUS • CIBER de Enfermedades Cardiovasculares (CIBERCV), Madrid, Spain;
LamImSys Lab, Instituto de Investigaci
on Sanitaria Hospital 12 de Octubre (imas12),
Madrid, Spain; UISYS Research Unit, University of Valencia, Valencia, Spain;
Department of History of Science and Information Science, School of Medicine and
Dentistry, University of Valencia, Valencia, Spain
FELIX RIVERA-MOLINA • Departments of Cell Biology, Yale University School of Medicine,
Yale University, New Haven, CT, USA
COLINDA L. G. J. SCHEELE • VIB Center for Cancer Biology, Leuven, Belgium; Department
of Oncology, KU Leuven, Leuven, Belgium
ANN L. B. SEYNHAEVE • Laboratory Experimental Oncology, Department of Pathology,
Erasmus MC, Rotterdam, the Netherlands
DAAN SMITS • Center for Molecular Medicine (CMM), University Medical Center Utrecht,
Utrecht, The Netherlands; Department of Cell Biology, Radboudumc, Nijmegen, The
Netherlands
WENDY STAM • Department of Medical Oncology, Cancer Center Amsterdam, Amsterdam
University Medical Centers, Amsterdam, The Netherlands
RALITZA STANEVA • CNRS, UMR 144 – Cell Biology and Cancer, Institut Curie, PSL
Research University, Paris, France; CNRS UMR 3738, Department of Developmental and
Stem Cell Biology, Institut Pasteur, Université de Paris, Paris, France
BONG H. SUNG • Department of Cell and Developmental Biology, Vanderbilt University
School of Medicine, Nashville, TN, USA
MARTIN SVOREN • Department of Cell Biology, Radboud University Medical Center,
Nijmegen, the Netherlands
GUY TANENTZAPF • Department of Cellular and Physiological Sciences, University of British
Columbia, Vancouver, BC, Canada
xiv Contributors

TIMO L. M. TEN HAGEN • Laboratory Experimental Oncology, Department of Pathology,

Erasmus MC, Rotterdam, the Netherlands
DEREK TOOMRE • Departments of Cell Biology, Yale University School of Medicine, Yale
University, New Haven, CT, USA
ANTONIUS L. VAN BOXTEL • Developmental, Stem Cell and Cancer Biology, Swammerdam
Institute for Life Sciences, University of Amsterdam, Amsterdam, the Netherlands
MERIJN VAN ERP • Department of Cell Biology, Radboud University Medical Center,
Nijmegen, the Netherlands
LARISA VENKOVA • Institut Pierre Gilles de Gennes, PSL Research University, Paris, France;
Current affiliation, Institute of Biochemistry and Cellular Genetics, UMR 5095, CNRS,
University of Bordeaux, Bordeaux, France
KATARINA WOLF • Department of Cell Biology, Radboud University Medical Center,
Nijmegen, the Netherlands
FENG WEI YANG • Department of Mathematics, School of Mathematical and Physical Sciences,
University of Sussex, Brighton, Falmer, UK
JIAN ZHANG • Department of Biomedical Engineering, Vanderbilt University, Nashville,
TN, USA
 Chapter 1

Cell Migration in Three Dimensions

Coert Margadant

Abstract
Cell migration plays an essential role in many pathophysiological processes, including embryonic develop-
ment, wound healing, immunity, and cancer invasion, and is therefore a widely studied phenomenon in
many different fields from basic cell biology to regenerative medicine. During the past decades, a multitude
of increasingly complex methods have been developed to study cell migration. Here we compile a series of
current state-of-the-art methods and protocols to investigate cell migration in a variety of model systems
ranging from cells, organoids, tissue explants, and microfluidic systems to Drosophila, zebrafish, and mice.
Together they cover processes as diverse as nuclear deformation, energy consumption, endocytic traffick-
ing, and matrix degradation, as well as tumor vascularization and cancer cell invasion, sprouting angiogen-
esis, and leukocyte extravasation. Furthermore, methods to study developmental processes such as neural
tube closure, germ layer specification, and branching morphogenesis are included, as well as scripts for the
automated analysis of several aspects of cell migration. Together, this book constitutes a unique collection
of methods of prime importance to those interested in the analysis of cell migration.

Key words Caenorhabditis elegans, Cancer invasion, Cell migration, Development, Drosophila mela-
nogaster, Extracellular matrix, Integrins, Intravital imaging, Organoids, Zebrafish

1 Cell Migration in Health and Disease

Cell migration is crucial for the normal physiology of both unicel-

lular and multicellular organisms. In humans, cell migration plays a
key role during morphogenesis, development, sprouting angiogen-
esis, wound healing, and immune surveillance, as well as in several
pathological processes such as carcinoma invasion or immune cell
infiltration in autoimmune and inflammatory disorders. Cells have
evolved several strategies to migrate, each of which adapted to
specific needs and microenvironments (Fig. 1). For instance, indi-
vidual cells can move through dense extracellular matrix (ECM) by
secreting proteases that degrade matrix proteins, which is common
for fibroblasts, but also by “pushing and squeezing” in a
proteolysis-independent manner [1–3]. The latter type of migra-
tion is reminiscent of amoeboid migration and is frequently

Coert Margadant (ed.), Cell Migration in Three Dimensions,

Methods in Molecular Biology, vol. 2608, https://doi.org/10.1007/978-1-0716-2887-4_1,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

1
2 Coert Margadant

Fig. 1 Cell migration strategies in health and disease. Cells have developed a variety of migratory strategies,
from mesenchymal/proteolytic and amoeboid/non-proteolytic single-cell migration (a) to collective cell
migration of epithelia on a 2D surface (b). Cell migration is crucial for a wide range of pathophysiological
processes, including leukocyte extravasation and interstitial migration (c), the formation of new blood vessels
by sprouting angiogenesis and tumor vascularization (d, e), cancer invasion and metastasis (f), and the
formation of branched organs including the mammary glands, lungs, and kidneys by branching morphogene-
sis (g)

adopted by leukocytes, which transmigrate across blood vessel walls

and subsequently move into interstitial tissue to reach infectious
pathogens (Fig. 1) [3]. In addition to these single-cell strategies,
many cells move as a collective, sometimes on flat, nearly
two-dimensional (2D) surfaces (for instance, epithelial and endo-
thelial cell sheets during wound healing or development) [4, 5],
but mostly in a three-dimensional (3D) environment (endothelial
cell strands during sprouting angiogenesis, carcinoma cell collec-
tives during invasive growth) (Fig. 1).

2 Regulation of Cell Migration

All migration modes require the concerted efforts of an array of

factors, including pro- and anti-migratory signaling molecules from
the cellular microenvironment, the cell-surface receptors that rec-
ognize them, and the intracellular machinery that transduces these
signals into dynamic morphological changes necessary for move-
ment. These include cellular protrusions such as filopodia and
lamellipodia, which are driven by actin polymerization and/or
branching under the control of the Rho GTPases Cdc42 and
Rac1, respectively [6–9]. In turn, cell retraction is promoted by
actomyosin-generated contractility, under the control of RhoA
[10, 11]. A major regulator of cell migration is the ECM, an
 Cell Migration in Three Dimensions 3

extensive network of proteins providing adhesion, structural sup-

port, and direction to migrating cells. The topology of ECM fibers
is crucial for cell migration [12], and their density and stiffness
stimulate the formation of adhesive contacts and actin
cytoskeleton-based intracellular tension [13]. Furthermore, these
properties determine for some cell types whether they will move as
single cells or rather in a multicellular fashion [14]. The ECM is
also a reservoir of many different growth factors, which can be
sensed by migrating cells in order to activate relevant signaling
pathways. During migration, cells actively reorganize the ECM,
and they can form “tracks” that guide directional migration of
other cells, as occurs in cancer, where cancer-associated fibroblasts
remodel the matrix to promote tumor cell migration [15, 16].
Both the mechanical and biochemical properties of the ECM
are sensed by integrins, a family of 24 αβ heterodimeric transmem-
brane receptors that dynamically interact with ECM proteins
including fibronectin, collagens, and laminins while they connect
intracellularly to actin filaments and signaling pathways
[17, 18]. Integrin-ligand binding is essential for a range of pro-
cesses involving cell adhesion and migration, including hemostasis,
immunity, wound healing, and development [19, 20] and drives
the formation of subcellular structures connected to actin, includ-
ing focal adhesions (which are important for signal transduction),
filopodia, podosomes, and invadopodia [17, 21–23]. The latter
two are collectively also known as invadosomes and are degradative
structures that release proteases to dissolve and/or remodel the
ECM or basement membrane proteins used for invasive migration
of several cell types including cancer cells and sprouting endothelial
cells [23, 24]. In contrast to these adhesion- and ECM
degradation-dependent modes of migration, the amoeboid migra-
tion mode employed by leukocytes and some cancer cells does not
require integrins or proteases but is rather driven by “pushing”
through tight pores, either via actin polymerization or asymmetric
intracellular pressure [3, 12, 25]. As the nucleus is the stiffest and
less flexible organelle of the cell, this strategy requires dramatic
nuclear deformations [26], which is why neutrophil nuclei are
lobulated. Nevertheless, migration through confined spaces in the
absence of matrix degradation is not without risk, as it often leads
to nuclear envelope rupture and DNA damage [27, 28].
Many cell types migrate as a collective and therefore require
intercellular adhesion, which is predominantly mediated by the
cadherin family of transmembrane receptors [1]. Much like integ-
rins, cadherins also regulate actin cytoskeletal organization,
through spatiotemporally controlled activation of Rho GTPases
[2]. In turn, Rho GTPases affect both integrin- and cadherin-
dependent adhesion complexes, and a tight balance between the
activities of individual Rho GTPases, specifically RhoA and Rac1, is
crucial as it determines individual versus collective cell migration, as
4 Coert Margadant

well as cell polarity and directionality [29, 30]. This has been
established in a range of different contexts including endothelial
and epithelial cells, invasive tumor explants and organoids, and
developing glands [8, 9, 31–38]. Furthermore, differences in the
Rac1/RhoA balance in individual cells are important for the hier-
archy between “leaders” and “followers” in cell collectives
[39, 40]. The specification of leader and follower cells (such as
the tip and stalk cells in endothelial sprouts) is an essential hallmark
of collective cell migration and is achieved by intercellular differ-
ences in the activation of certain signaling pathways and gene
expression patterns [41, 42]. Leaders and followers also show
differences in energy requirement and consumption, and differ-
ences in cellular energy levels and metabolism contribute to
leader-follower cell transitions [13, 43, 44]. In many systems, the
leader cells are responsible for “pathfinding” and are mainly dedi-
cated to migration, while the following cells migrate and prolifer-
ate. In this way, cell migration is tightly balanced with proliferation
and also differentiation, in particular, during complex processes
such as branching morphogenesis (the development of branched
organs such as the kidneys, lungs, and mammary glands) [45, 46].
Regardless of the migratory strategy that cells follow, the
dynamic subcellular (re)distribution and turnover of cell-surface
receptors and associated proteins during cell migration requires
an extensive intracellular system that is dedicated to protein trans-
port. Integrins and growth factor receptors are actively internalized
from the cell surface and redistributed by endosomes and in turn
also regulate trafficking pathways themselves [47–49]. Receptor
trafficking and turnover have firmly emerged as essential mechan-
isms to drive signaling, cell shape changes, and leader/follower cell
hierarchy during cell migration [38, 48, 50–53] and are regulated
by protein networks on endosomes that are recruited by Rab
GTPases [53–57]. Several Rab GTPases are also important for the
structural integrity and movement of organelles, while others reg-
ulate the release of extracellular vesicles as a means of cell-cell
communication [58–60]. Intriguingly, for some Rabs it has
recently become apparent that they are synthesized at very specific
locations in the cell due to local accumulation of their mRNAs,
indicating tight spatiotemporal control of mRNA translation for
promigratory proteins [61, 62].
Altogether, many distinct mechanisms cooperate to ensure the
proper regulation of cell motility, and the study of these mechan-
isms is essential for the understanding of many biological processes.
In addition, this knowledge aids to either block migration in path-
ological conditions or stimulate it as a therapeutic means, for
instance, to promote tissue regeneration and healing after injury.
 Cell Migration in Three Dimensions 5

3 Model Systems to Investigate Cell Migration

Because of its essential function in a variety of biological processes,

there is widespread interest in cell migration in several different
fields including developmental biology, immunology, cancer biol-
ogy, vascular biology, wound healing, and regenerative medicine.
As a consequence, cell migration has been studied in a vast array of
model systems over the past decades, from cell lines on 2D sub-
strates in vitro to co-culture systems and organoids in 3D environ-
ments. In addition, a wide range of organisms are being used as
in vivo model systems, each with specific advantages (Fig. 2).

Fig. 2 Commonly used in vivo model systems to study aspects of cell migration. (a) Dictyostelium discoideum
is a highly plastic organism that switches rapidly between a unicellular, amoeboid-like state and a multicel-
lular, aggregate state, both of which are highly migratory. (b) In Caenorhabditis elegans, formation of the
gonads is guided by distal tip cells, while a tube from the uterus to the vulva is formed by “anchor cell”
invasive migration. (c) In Drosophila melanogaster, models for collective cell migration include trachea
development in larvae, “border cell” migration in the developing egg chambers of female adults, and testes
myotube migration during metamorphosis. (d) Xenopus laevis and (e) Danio rerio embryos are used to study
morphogenetic movements and germ layer specification during early development. In addition, zebrafish
larvae constitute an excellent model system for migration of the lateral line primordium and vascular
morphogenesis, while adult fish are also employed to study leukocyte and cancer cell migration. (f) In Mus
musculus, several developmental processes are now being visualized in embryos ex utero, while retinal
angiogenesis is studied in newborns. Finally, a variety of migratory processes are investigated in adults,
including leukocyte transmigration, angiogenesis, wound healing, and cancer invasion. NCC, neural crest
cells; PGC, primordial germ cells
6 Coert Margadant

The slime mold or social amoeba Dictyostelium discoideum is a

highly plastic organism that switches rapidly between a unicellular,
amoeboid-like state and a multicellular, aggregate state that is
induced by starvation (Fig. 2). As both states migrate in response
to chemical signals (chemotaxis) via highly conserved mechanisms,
they are attractive models for single-cell and collective cell motility,
even more so given the short life cycle of Dictyostelium and its
genetic tractability [63].
In the nematode Caenorhabditis elegans, formation of the
reproductive system is guided by leader cells called “distal tip
cells”, which follow a U-shaped migration path that determines
the size and shape of the gonads. As defects in gonadal appearance
are easily identified, this system has been used for forward genetic
and RNAi screens, resulting in the identification of many regulators
of migration [64]. At a later stage during C. elegans development, a
tube is formed from the uterus to the vulva to enable egg laying,
which is controlled by a so-called “anchor cell” (Fig. 2). This cell
breaches the basement membrane that separates uterine and vulval
cells to initiate invasive migration and is therefore studied as an
in vivo model for basement membrane invasion as occurs in malig-
nant tumors [64].
The fruit fly Drosophila melanogaster is also frequently
employed to model specific modes of cell migration. In Drosophila
larvae, the development of the respiratory (tracheal) system encom-
passes all hallmarks of branching morphogenesis in humans, includ-
ing leader/follower cell specification, branching, migration, and
lumen formation, and is thus relevant for the study of branched
tubular organs such as the lungs, mammary glands, and vascular
system [45, 65, 66]. Trachea development can be followed by live
fluorescent imaging which, aided by the relative ease of genetic
manipulation in Drosophila, permits the identification and detailed
study of critical determinants of this process. A distinct collective
cell migration event in Drosophila is the migration of testis nascent
myotubes, which occurs during metamorphosis and is character-
ized by abundant filopodia formation [67]. Finally, in the egg
chambers of adult female fruit fly ovaries, a cluster of six to eight
so-called “border cells” collectively invades neighboring cells and
then migrates from the anterior tip to the border of the oocyte in
response to growth factors (Fig. 2) [1]. This process recapitulates
many hallmarks of collective migration in humans during develop-
ment or cancer metastasis and, like the abovementioned processes,
can be studied in detail using live fluorescent imaging [68, 69].
Higher organisms that are commonly employed to study cell
migration in vivo are the African clawed frog Xenopus laevis and the
zebrafish Danio rerio. Because embryos of these animals develop
outside the body, are obtained in large numbers, and are easily
manipulated by microinjection, they are ideal model systems to
study morphogenetic movements and germ layer specification
 Cell Migration in Three Dimensions 7

during early development [70]. Later events studied in these

embryos include the migration of primordial germ cells, the pre-
cursors of sperm and eggs, and, in particular, neural crest cells, a
multipotent stem cell population found in vertebrates that travels
large distances during development to give rise to many different
cell types [71, 72]. Neural crest cell migration has gained a lot of
attention since defects in this process underlie a variety of disorders,
collectively called neurocristopathies. Furthermore, neural crest
cells constitute an example of a “loose” cell collective that maintains
weak intercellular adhesion and partially undergoes epithelial-to-
mesenchymal transition (EMT), which is also a hallmark of migrat-
ing cells during wound healing, branching morphogenesis, and
cancer progression [73]. Zebrafish embryos (larvae) furthermore
constitute an excellent model system for the study of vascular
morphogenesis during development and allow for detailed investi-
gation at high resolution of endothelial single-cell dynamics by live
imaging [74–76]. Zebrafish larvae are also used to study transen-
dothelial migration of leukocytes and the migration and extravasa-
tion of clusters of tumor cells from the bloodstream
[77, 78]. Finally, the migration of the fish-specific lateral line pri-
mordium is a particularly powerful model to study the dynamics
and mechanisms underlying collective cell migration at the single-
cell level [79].
Mice have been the most widely used mammalian system for
the study of cell migration. While on average the generation and
maintenance of mutants or animals with genetically encoded fluo-
rescent labels is more laborious, time-consuming, and costly in
mice than in aforementioned model systems, the primary advantage
of mice is that they better approach the organization and complex-
ity of human tissues and organs. Although challenges associated
with deep tissue imaging and movements of living tissue during live
acquisition remain, ex vivo culture and imaging of mouse tissues
and even whole mouse embryos now enable the investigation of a
variety of developmental events including mesoderm migration and
neural tube closure [80–82]. The postnatal retina is a popular
model system in newborn mice for the imaging of sprouting angio-
genesis [83], while adult mice are used for the study of phenomena
as diverse as leukocyte transmigration and interstitial migration,
tissue remodeling and regeneration, cell fate decisions, tumor
angiogenesis and invasion, branching morphogenesis, and wound
healing [84–87].

4 Developments and Advances in the Cell Migration Field

A vast array of methods has been developed in the past 50 years to

study cell migration. Classic in vitro approaches include scratch
assays to mimic collective cell migration during wound healing
and single-cell migration assays using cells cultured on 2D tissue
8 Coert Margadant

culture substrates coated with ECM proteins. While these assays

have identified many important factors and mechanisms in cell
motility, migration over 2D surfaces occurs only in specific condi-
tions in the body, and most migrating cell types encounter a 3D
environment in vivo. Cell morphology, the organization of the
cytoskeleton, and integrin-dependent adhesive structures are all
very different in 3D compared to 2D, as a result of differences in
matrix composition, topology, density, and stiffness [88]. Although
many of the identified key players in 2D are still to some extent
important for 3D migration of certain cell types, it is now also clear
that cells in 3D environments have a much more flexible approach
to migration and can adopt a variety of strategies [3]. An early
model for 3D migration is the Boyden chamber in which cells
migrate through filter pores, which can be covered by a gel of
ECM proteins to mimic invasive migration, or a monolayer of
cells to investigate transmigration [89]. Subsequent advances in
cell culture and imaging have allowed the study of cells, tissue
explants, spheroids, and organoids in increasingly complex 3D
environments consisting of ECM proteins such as collagen, fibrin,
and fibronectin, as well as native cell-derived matrices and hydro-
gels with embedded growth factors or stiffness gradients [90–
94]. Extensive use of these approaches has yielded invaluable
insights into leader-follower cell hierarchy and communication,
cell-cell adhesive interactions during collective cell migration, and
invasive migration of a variety of cell types in complex environments
[13, 95, 96]. Furthermore, micropatterning and microfabrication
techniques have greatly advanced our understanding of how matrix
topology and environmental confinement affect cell migration
[97, 98], while matrices containing microbeads have been instru-
mental in the mechanotransduction field to assess the physical
forces exerted by migrating cells using traction force
microscopy [99].
Because of its highly dynamic nature and the fact that cells can
move using different strategies, cell migration is only fully appre-
ciated by time-lapse microscopy. This approach enables quantitative
analysis of several parameters of migration including velocity and
directionality and can be implemented for high-throughput screen-
ing of drug or RNAi libraries [54, 100]. More detailed analysis of
processes with fast dynamics or the behavior of single cells, pro-
teins, and subcellular compartments during cell migration requires
the expression of fluorescent proteins as markers or live-cell labeling
techniques using fluorescent probes. Matrix remodeling and pro-
cessing can be studied using labeled ECM proteins or by label-free
microscopy techniques such as second and third harmonic genera-
tion to visualize collagen fibers [101, 102]. Excitingly, recent
developments include the use of pH-dependent fluorescent tags
which can mark endocytic and exocytic events such as the internali-
zation of cell-surface receptors and their subsequent trafficking
 Cell Migration in Three Dimensions 9

through the endolysosomal system or the release of extracellular

vesicles [59, 103, 104]. Furthermore, optogenetics approaches
have now been developed that allow spatiotemporal control of
protein and cell behavior with great precision using light, opening
up a wide range of possibilities for the study and manipulation of
cell migration in real time [40].
Despite these advances, prolonged live-cell fluorescence imag-
ing at high resolution still imposes difficulties related to bleaching
effects or phototoxicity, especially in dense 3D environments and
when imaging multiple channels, large z-stacks, and at short inter-
vals. It is also becoming increasingly important to develop bioin-
formatic tools and scripts for automated tracking and quantitative
analysis of dynamic cell behavior in complex environments. Given
the complexity of tissues, another long-standing issue has been to
recreate pathophysiologically relevant conditions in vitro. To
address this, many sophisticated methods and model systems have
emerged in recent years including microfluidic and organ-on-a-
chip systems, which faithfully recapitulate several aspects of the
in vivo cellular microenvironment [97, 105–107]. Furthermore,
great progress has been made in the culture of mouse embryos ex
utero, which now enables high-resolution live-cell imaging of mor-
phogenetic events in living mouse tissues during development
[80, 82, 108, 109]. Finally, the rise of intravital microscopy has
greatly advanced the visualization of dynamic cell migration events
in vivo and is being used to capture a variety of processes including
leukocyte extravasation, tumor vascularization, and tumor invasion
and metastasis [84, 85, 110].
Together, these advanced model systems and techniques will
continue to generate exciting new insights into the regulatory
mechanisms that drive cell migration in a wide range of pathophys-
iological processes in the future.

References

1. Scarpa E, Mayor R (2016) Collective cell 3268–3281. https://doi.org/10.1101/gad.

migration in development. J Cell Biol 212:
143–155. https://doi.org/10.1083/jcb.
201508047
2. Friedl P, Mayor R (2017) Tuning collective
cell migration by cell-cell junction regulation.
Cold Spring Harb Perspect Biol 9:4
3. Yamada KM, Sixt M (2019) Mechanisms of
3D cell migration. Nat Rev Mol Cell Biol 20:
738–752. https://doi.org/10.1038/s41580
4. Hamm M, Kirchmaier B, Herzog W (2016)
Sema3d controls collective endothelial cell
migration by distinct mechanisms via Nrp1
and PlxnD1. J Cell Biol 215:415–430
5. Vitorino P, Meyer T (2008) Modular control
of endothelial sheet migration. Genes Dev 22:
1725808
6. Svitkina T (2018) The actin cytoskeleton and
actin-based motility. Cold Spring Harb Per-
spect Biol 10:a018267
7. Lawson CD, Burridge K (2014) The on-off
relationship of rho and Rac during integrin-
mediated adhesion and cell migration. Small
GTPases 5:e27958
8. Sanz-Moreno V, Gadea G, Ahn J, Paterson H,
Marra P, Pinner S, Sahai E, Marshall C (2008)
Rac activation and inactivation control plas-
ticity of tumor cell movement. Cell 135:510–
523
9. Pankov R, Endo Y, Even-Ram S, Araki M,
Clark K, Cukierman E, Matsumoto K,
10 Coert Margadant
Yamada K (2005) A Rac switch regulates ran-
dom versus directionally persistent cell migra-
tion. J Cell Biol 170:793–802
10. Worthylake RA, Burridge K (2003) RhoA and
ROCK promote migration by limiting mem-
brane protrusions. J Biol Chem 278:13578–
13584. https://doi.org/10.1074/jbc.
M211584200
11. Ridley A (2015) Rho GTPase signalling in cell
migration. Curr Opin Cell Biol 36:103–112
12. Reversat A, Gaertner F, Merrin J, Stopp J,
Tasciyan S, Aguilera J, de Vries I,
Hauschild R, Hons M, Piel M, Callan-Jones A,
Voituriez R, Sixt M (2020) Cellular locomo-
tion using environmental topography. Nature
582:582–585. https://doi.org/10.1038/
s41586-020-2283-z
13. Zhang J, Goliwas KF, Wang W, Taufalele PV,
Bordeleau F, Reinhart-King CA (2019) Ener-
getic regulation of coordinated leader–fol-
lower dynamics during collective invasion of
breast cancer cells. Proc Natl Acad Sci U S A
116:7867–7872. https://doi.org/10.1073/
pnas.1809964116
14. Trappmann B, Baker BM, Polacheck WJ,
Choi CK, Burdick JA, Chen CS (2017)
Matrix degradability controls multicellularity
of 3D cell migration. Nat Commun 8:1–8.
https://doi.org/10.1038/s41467-017-
00418-6
15. Gopal S, Veracini L, Grall D, Butori C,
Schaub S, Audebert S, Camoin L,
Baudelet E, Adwanska A, Beghelli-De La For-
est Divonne S, Violette SM, Weinreb PH,
Rekima S, Ilie M, Sudaka A, Hofman P, Van
Obberghen-Schilling E (2017) Fibronectin-
guided migration of carcinoma collectives.
Nat Commun:8. https://doi.org/10.1038/
NCOMMS14105
16. Sanz-Moreno V, Gaggioli C, Yeo M,
Albrengues J, Wallberg F, Viros A,
Hooper S, Mitter R, Féral CC, Cook M,
Larkin J, Marais R, Meneguzzi G, Sahai E,
Marshall CJ (2011) ROCK and JAK1 signal-
ing cooperate to control Actomyosin contrac-
tility in tumor cells and stroma. Cancer Cell
20:229–245. https://doi.org/10.1016/j.ccr.
2011.06.018
17. Humphries J, Chastney M, Askari J, Humph-
ries M (2019) Signal transduction via integrin
adhesion complexes. Curr Opin Cell Biol 56:
14–21
18. Gauthier NC, Roca-Cusachs P (2018)
Mechanosensing at integrin-mediated cell–
matrix adhesions: from molecular to
integrated mechanisms. Curr Opin Cell Biol
50:20–26. https://doi.org/10.1016/j.ceb.
2017.12.014
19. Winograd-Katz SE, Fassler R, Geiger B, Leg-
ate KR (2014) The integrin adhesome: from
genes and proteins to human disease. Nat Rev
Mol Cell Biol 15:273–288
20. Nolte MA, Margadant C (2020) Activation
and suppression of hematopoietic integrins
in hemostasis and immunity. Blood 135:7–
16. https://doi.org/10.1182/blood.
2019003336
21. Burridge K (2017) Focal adhesions: a per-
sonal perspective on a half century of prog-
ress. FEBS J 284:3355–3361. https://doi.
org/10.1111/febs.14195
22. Jacquemet G, Hamidi H, Ivaska J (2015)
Filopodia in cell adhesion, 3D migration and
cancer cell invasion. Curr Opin Cell Biol 36:
23–31. https://doi.org/10.1016/j.ceb.
2015.06.007
23. Cambi A, Chavrier P (2021) Tissue remodel-
ing by invadosomes. Fac Rev 10. https://doi.
org/10.12703/r/10-39
24. Spuul P, Daubon T, Pitter B, Alonso F,
Fremaux I, Kramer I, Montanez E, Genot E
(2016) VEGF-A/notch-induced Podosomes
Proteolyse basement membrane collagen-IV
during retinal sprouting angiogenesis. Cell
Rep 17:484–500. https://doi.org/10.
1016/j.celrep.2016.09.016
25. Liu YJ, Le Berre M, Lautenschlaeger F,
Maiuri P, Callan-Jones A, Heuzé M,
Takaki T, Voituriez R, Piel M (2015) Confine-
ment and low adhesion induce fast amoeboid
migration of slow mesenchymal cells. Cell
160:659–672. https://doi.org/10.1016/j.
cell.2015.01.007
26. McGregor AL, Hsia C-R, Lammerding J
(2016) Squish and squeeze-the nucleus as a
physical barrier during migration in confined
environments. Curr Opin Cell Biol 40:32–40
27. Denais CM, Gilbert RM, Isermann P, McGre-
gor AL, Te Lindert M, Weigelin B, Davidson
PM, Friedl P, Wolf K, Lammerding J (2016)
Nuclear envelope rupture and repair during
cancer cell migration. Science 352:353–358.
https://doi.org/10.1126/science.aad7297
28. Raab M, Gentili M, De Belly H, Thiam HR,
Vargas P, Jimenez AJ, Lautenschlaeger F,
Voituriez R, Lennon-Duménil AM,
Manel N, Piel M (2016) ESCRT III repairs
nuclear envelope ruptures during cell migra-
tion to limit DNA damage and cell death.
Science 352:359–362. https://doi.org/10.
1126/science.aad7611
29. McCormack J, Welsh NJ, Braga VM (2013)
Cycling around cell-cell adhesion with rho
GTPase regulators. J Cell Sci 126:379–391

30. Zegers MM, Friedl P (2014) Rho GTPases in
collective cell migration. Small GTPases 5:
e28997
31. van der Bijl I, Nawaz K, Kazlauskaite U, van
Stalborch A-M, Tol S, Orgaz AJ, van den
Bout I, Reinhard NR, Sonnenberg A, Marga-
dant C (2020) Reciprocal integrin/integrin
antagonism through kindlin-2 and rho
GTPases regulates cell cohesion and collective
migration. Matrix Biol 93:60–78. https://
doi.org/10.1016/j.matbio.2020.05.005
32. White DP, Caswell PT, Norman JC (2007)
alphavbeta3 and and alpha5beta1 integrin
recycling pathways dictate downstream rho
kinase signaling to regulate persistent cell
migration. J Cell Biol 177:515–525
33. Gjorevski N, Piotrowski AS, Varner VD, Nel-
son CM (2015) Dynamic tensile forces drive
collective cell migration through three-
dimensional extracellular matrices. Sci Rep 5:
11458
34. Ewald AJ, Brenot A, Duong M, Chan BS,
Werb Z (2008) Collective epithelial migration
and cell rearrangements drive mammary
branching morphogenesis. Dev Cell 14:570–
581
35. Libanje F, Raingeaud J, Luan R, Thomas Z,
Zajac O, Veiga J, Marisa L, Adam J, Boige V,
Malka D, Goéré D, Hall A, Soazec J, Prall F,
Gelli M, Dartigues P, Jaulin F (2019) ROCK2
inhibition triggers the collective invasion of
colorectal adenocarcinomas. EMBO J 38:
e99299
36. de Rooij J, Kerstens A, Danuser G, Schwartz
MA, Waterman-Storer CM (2005) Integrin-
dependent actomyosin contraction regulates
epithelial cell scattering. J Cell Biol 171:
153–164
37. Gimond C, van Der Flier A, van Delft S,
Brakebusch C, Kuikman I, Collard JG,
F€assler R, Sonnenberg A (1999) Induction
of cell scattering by expression of beta1-
integrins in beta1-deficient epithelial cells
requires activation of members of the rho
family of GTPases and downregulation of cad-
herin and catenin function. J Cell Biol 147:
1325–1340
38. Margadant C, Kreft M, de Groot DJ, Norman
JC, Sonnenberg A (2012) Distinct roles of
Talin and kindlin in regulating integrin
alpha5beta1 function and trafficking. Curr
Biol 22:1554–1563
39. Gaggioli C, Hooper S, Hidalgo-Carcedo C,
Grosse R, Marshall J, Harrington K, Sahai E
(2007) Fibroblast-led collective invasion of
carcinoma cells with differing roles for
RhoGTPases in leading and following cells.
Nat Cell Biol 9:1392–1400
Cell Migration in Three Dimensions 11
40. Wang X, He L, Wu Y, Hahn K, Montell D
(2010) Light-mediated activation reveals a
key role for Rac in collective guidance of cell
movement in vivo. Nat Cell Biol 12:591–597.
https://doi.org/10.1038/ncb2061.Light-
mediated
41. Haeger A, Wolf K, Zegers MM, Friedl P
(2015) Collective cell migration: guidance
principles and hierarchies. Trends Cell Biol
25:556–566
42. Eilken HM, Adams RH (2010) Dynamics of
endothelial cell behavior in sprouting angio-
genesis. Curr Opin Cell Biol 22:617–625
43. Pasut A, Becker LM, Cuypers A, Carmeliet P
(2021) Endothelial cell plasticity at the single-
cell level. Angiogenesis 24:311–326. https://
doi.org/10.1007/s10456-021-09797-3
44. De Bock K, Georgiadou M, Schoors S,
Kuchnio A, Wong BW, Cauwenberghs S,
Eelen G, Segura I, Cruys B, Bifari F,
Decimo I, Blanco R, Wyns S,
Vangindertael J, Rocha S, Collins RT,
Munck S, Daelemans D, Imamura H,
Devlieger R, Rider M, Van Veldhoven PP,
Schuit F, Bartrons R, Hofkens J, Fraisl P,
Telang S, DeBerardinis RJ, Schoonjans L,
Vinckier S, Chesney J, Gerhardt H,
Dewerchin M, Carmeliet P (2013) Role of
PFKFB3-driven glycolysis in vessel sprouting.
Cell 154:651–663. https://doi.org/10.
1016/j.cell.2013.06.037
45. Ochoa-Espinosa A, Affolter M (2012)
Branching morphogenesis: from cells to
organs and back. Cold Spring Harb Perspect
B i o l 4 . h t t p s : // d o i . o r g / 1 0 . 1 1 0 1 /
cshperspect.a008243
46. Wang S, Sekiguchi R, Daley WP, Yamada KM
(2017) Cell and matrix dynamics in branching
morphogenesis. J Cell Biol 216:559–570.
https://doi.org/10.1016/B978-0-12-
818422-6.00014-9
47. Caswell P, Vadrevu S, Norman J (2009)
Integrins: masters and slaves of endocytic
transport. Nat Rev Mol Cell Biol 10:843–853
48. Moreno-Layseca P, Icha J, Hamidi H, Ivaska J
(2019) Integrin trafficking in cells and tissues.
Nat Cell Biol 21:122–132. https://doi.org/
10.1038/s41556-018-0223-z.Integrin
49. Nolte MA, Nolte-‘t Hoen ENM, Margadant
C (2021) Integrins control vesicular traffick-
ing; new tricks for old dogs. Trends Biochem
Sci 46:124–137. https://doi.org/10.1016/j.
tibs.2020.09.001
50. Paul NR, Jacquemet G, Caswell PT (2015)
Endocytic trafficking of Integrins in cell
migration. Curr Biol 25:R1092–R1105.
12 Coert Margadant
https://doi.org/10.1016/j.cub.2015.
09.049
51. Jonker C, Galmes R, Veenendaal T, Brink C,
van der Welle R, Liv N, de Rooij J, Peden AA,
van der Sluijs P, Margadant C, Klumperman J
(2018) Vps3 and Vps8 control integrin traf-
ficking from early to recycling endosomes and
regulate integrin-dependent functions. Nat
Commun 9:1–12
52. Lobert VH, Brech A, Pedersen NM,
Wesche J, Oppelt A, Malerød L, Stenmark H
(2010) Ubiquitination of α5β1 integrin con-
trols fibroblast migration through lysosomal
degradation of fibronectin-integrin com-
plexes. Dev Cell 19:148–159. https://doi.
org/10.1016/j.devcel.2010.06.010
53. Kempers L, Wakayama Y, van der Bijl I,
Furumaya C, De Cuyper IM, Jongejan A,
Kat M, van Stalborch AMD, van Boxtel AL,
Hubert M, Geerts D, van Buul JD, de
Korte D, Herzog W, Margadant C (2021)
The endosomal RIN2/Rab5C machinery
prevents VEGFR2 degradation to control
gene expression and tip cell identity during
angiogenesis. Angiogenesis 24:695–714.
https://doi.org/10.1007/s10456-021-
09788-4
54. Salvatore C, Malinverno C, Neumann B,
Tischer C, Palamidessi A, Frittoli E,
Panagiotakopoulou M, Disanza A, Malet-
Engra G, Nastaly P, Galli C, Luise C,
Bertalot G, Pece S, Di Fiore PP, Gauthier N,
Ferrari A, Maiuri P, Scita G (2018) A RAB35-
p85/PI3K axis controls oscillatory apical pro-
trusions required for efficient chemotactic
migration. Nat Commun 9:1–19
55. Linford A, Yoshimura SI, Bastos RN,
Langemeyer L, Gerondopoulos A, Rigden
DJ, Barr FA (2012) Rab14 and its exchange
factor FAM116 link endocytic recycling and
Adherens junction stability in migrating cells.
Dev Cell 22:952–966
56. Guadagno NA, Margiotta A, Bjørnestad SA,
Haugen LH, Kjos I, Xu X, Hu X, Bakke O,
Margadant F, Progida C (2020) Rab18 reg-
ulates focal adhesion dynamics by interacting
with kinectin-1 at the endoplasmic reticulum.
J Cell Biol 219. https://doi.org/10.1083/
JCB.201809020
57. Stenmark H (2009) Rab GTPases as coordi-
nators of vesicle traffic. Nat Rev Mol Cell Biol
10:513–525
58. Homma Y, Kinoshita R, Kuchitsu Y, Wawro
PS, Marubashi S, Oguchi ME, Ishida M,
Fujita N, Fukuda M (2019) Comprehensive
knockout analysis of the Rab family GTPases
in epithelial cells. J Cell Biol 218:2035–2050
59. Sung BH, Ketova T, Hoshino D, Zijlstra A,
Weaver AM (2015) Directional cell move-
ment through tissues is controlled by exo-
some secretion. Nat Commun 6:1–14.
https://doi.org/10.1038/ncomms8164
60. Sung BH, Parent CA, Weaver AM (2021)
Extracellular vesicles: critical players during
cell migration. Dev Cell 56:1861–1874
61. Moissoglu K, Stueland M, Gasparski AN,
Wang T, Jenkins LM, Hastings ML, Mili S
(2020) RNA localization and co-translational
interactions control RAB 13 GTP ase func-
tion and cell migration. EMBO J 39:1–19.
h t t p s : // d o i . o r g / 1 0 . 1 5 2 5 2 / e m b j .
2020104958
62. Costa G, Bradbury JJ, Tarannum N, Herbert
SP (2020) RAB13 mRNA compartmentalisa-
tion spatially orients tissue morphogenesis.
EMBO J 39:1–20. https://doi.org/10.
15252/embj.2020106003
63. Kuhn J, Lin Y, Devreotes PN (2021) Using
live-cell imaging and synthetic biology to
probe directed migration in Dictyostelium.
Front Cell Dev Biol 9:740205. https://doi.
org/10.3389/fcell.2021.740205
64. Sherwood DR, Plastino J (2018) Invading,
leading and navigating cells in caenorhabditis
elegans: insights into cell movement in vivo.
Genetics 208:53–78. https://doi.org/10.
1534/genetics.117.300082
65. Lebreton G, Casanova J (2014) Specification
of leading and trailing cell features during
collective migration in the Drosophila tra-
chea. J Cell Sci 127:465–474. https://doi.
org/10.1242/jcs.142737
66. Klußmann-Fricke B-J, Martı́n-Bermudo MD,
Llimargas M (2022) The basement mem-
brane controls size and integrity of the dro-
sophila tracheal tubes. Cell Rep 39:110734.
https://doi.org/10.1016/j.celrep.2022.
110734
67. Bischoff MC, Bogdan S (2021) Collective cell
migration driven by filopodia-new insights
from the social behavior of myotubes. BioEs-
says 43:2100124. https://doi.org/10.1002/
bies.202100124
68. Prasad M, Wang X, He L, Cai D, Montell DJ
(2015) Border cell migration: a model system
for live imaging and genetic analysis of collec-
tive cell movement. Methods Mol Biol:89–97
69. Stuelten CH, Parent CA, Montell DJ (2018)
Cell motility in cancer invasion and metastasis:
insights from simple model organisms. Nat
Rev Cancer 18:296–312. https://doi.org/
10.1038/nrc.2018.15
70. van Boxtel AL, Economou AD, Heliot C, Hill
CS (2018) Long-range signaling activation

and local inhibition separate the mesoderm
and endoderm lineages. Dev Cell 44:
179-191.e5. https://doi.org/10.1016/j.
devcel.2017.11.021
71. Richardson BE, Lehmann R (2010) Mechan-
isms guiding primordial germ cell migration:
strategies from different organisms. Nat Rev
Mol Cell Biol 11:37–49. https://doi.org/10.
1038/nrm2815
72. Mayor R, Theveneau E (2012) The neural
crest. Dev 140:2247–2251. https://doi.org/
10.1242/dev.091751
73. Nieto MA, Huang RYYJ, Jackson RAA, Thi-
ery JPP (2016) EMT: 2016. Cell 166:21–45.
https://doi.org/10.1016/j.cell.2016.
06.028
74. Ellertsdóttir E, Lenard A, Blum Y,
Krudewig A, Herwig L, Affolter M, Belting
H (2010) Vascular morphogenesis in the zeb-
rafish embryo. Dev Biol 341:56–65
75. Schuermann A, Helker C, Herzog W (2014)
Angiogenesis in zebrafish. Semin Cell Dev
Biol 31:106–114
76. Greenspan LJ, Weinstein BM (2021) To be or
not to be: endothelial cell plasticity in devel-
opment, repair, and disease. Angiogenesis 24:
251–269. https://doi.org/10.1007/
s10456-020-09761-7
77. Li C, Ma J, Groenewoud A, Ren J, Liu S,
Snaar-Jagalska BE, ten Dijke P (2022) Estab-
lishment of embryonic zebrafish xenograft
assays to investigate TGF-β family signaling
in human breast cancer progression. Methods
Mol Biol
78. Bussmann J, Raz E (2015) Chemokine-
guided cell migration and motility in zebrafish
development. EMBO J 34:1309–1318.
h t t p s : // d o i . o r g / 1 0 . 1 5 2 5 2 / e m b j .
201490105
79. Ma EY, Raible DW (2009) Signaling path-
ways regulating zebrafish lateral line develop-
ment. Curr Biol 19:381–386. https://doi.
org/10.1016/J.CUB.2009.03.057
80. Omelchenko T, Hall A, Anderson KV (2020)
β-Pix-dependent cellular protrusions propel
collective mesoderm migration in the mouse
embryo. Nat Commun 11
81. Zhang Y, Kim TH, Niswander L (2012)
Phactr4 regulates directional migration of
enteric neural crest through PP1, integrin sig-
naling, and cofilin activity. Genes Dev 26:69–
81
82. Molè MA, Galea GL, Rolo A, Weberling A,
Nychyk O, De Castro SC, Savery D, F€assler R,
Ybot-González P, Greene NDE, Copp AJ
(2020) Integrin-mediated focal Anchorage
drives epithelial zippering during mouse
Cell Migration in Three Dimensions 13
neural tube closure. Dev Cell 52:321-334.
e6. https://doi.org/10.1016/j.devcel.2020.
01.012
83. Milde F, Lauw S, Koumoutsakos P, Iruela-
Arispe ML (2013) The mouse retina in 3D:
quantification of vascular growth and remo-
deling. Integr Biol 5:1426–1438. https://
doi.org/10.1039/c3ib40085a
84. Clemente C, Rius C, Alonso-Herranz L, Mar-
tı́n-Alonso M, Pollán Á, Camafeita E,
Martı́nez F, Mota RA, Núñez V,
Rodrı́guez C, Seiki M, Martı́nez-González J,
Andrés V, Ricote M, Arroyo AG (2018)
MT4-MMP deficiency increases patrolling
monocyte recruitment to early lesions and
accelerates atherosclerosis. Nat Commun
9. https://doi.org/10.1038/s41467-018-
03351-4
85. Seynhaeve ALB, ten Hagen TLM (2021) An
adapted dorsal skinfold model used for 4D
intravital followed by whole-mount imaging
to reveal endothelial cell-pericyte association.
Sci Rep 123:20389. https://doi.org/10.
1038/s41598-021-99939-w
86. Scheele CLGJ, Hannezo E, Muraro MJ,
Zomer A, Langedijk NSM, Van
Oudenaarden A, Simons BD, Van Rheenen J
(2017) Identity and dynamics of mammary
stem cells during branching morphogenesis.
Nature 542:313–319. https://doi.org/10.
1038/nature21046
87. Gurevich DB, Severn CE, Twomey C,
Greenhough A, Cash J, Toye AM, Mellor H,
Martin P (2018) Live imaging of wound
angiogenesis reveals macrophage orchestrated
vessel sprouting and regression. EMBO J 37:
1–23. https://doi.org/10.15252/embj.
201797786
88. Cukierman E, Pankov R, Stevens DR, Yamada
KM (2001) Taking cell-matrix adhesions to
the third dimension. Science 294:1708–
1712. https://doi.org/10.1126/science.
1064829
89. Chen H-C (2005) Boyden chamber assay.
Methods Mol Biol 294:15–22
90. Trujillo S, Gonzalez-Garcia C, Rico P, Reid A,
Windmill J, Dalby MJ, Salmeron-Sanchez M
(2020) Engineered 3D hydrogels with full-
length fibronectin that sequester and present
growth factors. Biomaterials 252:120104.
https://doi.org/10.1016/j.biomaterials.
2020.120104
91. Ondeck MG, Kumar A, Placone JK, Plunkett
CM, Matte BF, Wong KC, Fattet L, Yang J,
Engler AJ (2019) Dynamically stiffened
matrix promotes malignant transformation
of mammary epithelial cells via collective
mechanical signaling. Proc Natl Acad Sci U S
14 Coert Margadant
A 116:3502–3507. https://doi.org/10.
1073/pnas.1814204116
92. Kaukonen R, Jacquemet G, Hamidi H, Ivaska
J (2017) Cell-derived matrices for studying
cell proliferation and directional migration in
a complex 3D microenvironment. Nat Protoc
12:2376–2390. https://doi.org/10.1038/
nprot.2017.107
93. Yang Q, Liberali P (2021) Collective beha-
viours in organoids. Curr Opin Cell Biol 72:
81–90. https://doi.org/10.1016/j.ceb.
2021.06.006
94. Rodrigues J, Heinrich MA, Teixeira LM, Pra-
kash J (2021) 3D in vitro model (R)evolution:
unveiling tumor–stroma interactions. Trend
Cancer 7:249–264. https://doi.org/10.
1016/j.trecan.2020.10.009
95. Khalil AA, Ilina O, Vasaturo A, Venhuizen JH,
Vullings M, Venhuizen V, Bilos AB, Figdor
CG, Span PN, Friedl P (2020) Collective
invasion induced by an autocrine purinergic
loop through connexin-43 hemichannels. J
Cell Biol 219:e201911120. https://doi.org/
10.1083/JCB.201911120
96. Staneva R, El Marjou F, Barbazan J,
Krndija D, Richon S, Clark AG, Vignjevic
DM (2019) Cancer cells in the tumor core
exhibit spatially coordinated migration pat-
terns. J Cell Sci 132:1–9. https://doi.org/
10.1242/jcs.220277
97. Garcia-Arcos JM, Chabrier R, Deygas M,
Nader G, Barbier L, Sáez PJ, Mathur A,
Vargas P, Piel M (2019) Reconstitution of
cell migration at a glance. J Cell Sci 132:0–2.
https://doi.org/10.1242/jcs.225565
98. Jiang X, Bruzewicz DA, Wong AP, Piel M,
Whitesides GM (2005) Directing cell migra-
tion with asymmetric micropatterns. Proc
Natl Acad Sci U S A 102:975–978. https://
doi.org/10.1073/pnas.0408954102
99. Roca-Cusachs P, Conte V, Trepat X (2017)
Quantifying forces in cell biology. Nat Cell
Biol 19:742–751. https://doi.org/10.
1038/ncb3564
100. Simpson KJ, Selfors LM, Bui J, Reynolds A,
Leake D, Khvorova A, Brugge JS (2008)
Identification of genes that regulate epithelial
cell migration using an siRNA screening
approach. Nat Cell Biol 10:1027–1038.
https://doi.org/10.1038/ncb1762
101. Chen X, Nadiarynkh O, Plotnikov S, Cam-
pagnola PJ (2012) Second harmonic genera-
tion microscopy for quantitative analysis of
collagen fibrillar structure. Nat Protoc 7:
654–669. https://doi.org/10.1038/nprot.
2012.009
102. Weigelin B, Bakker GJ, Friedl P (2016) Third
harmonic generation microscopy of cells and
tissue organization. J Cell Sci 129:245–255.
https://doi.org/10.1242/jcs.152272
103. Huet-Calderwood C, Rivera-Molina F, Iwa-
moto DV, Kromann EB, Toomre D, Calder-
wood DA (2017) Novel ecto-tagged integrins
reveal their trafficking in live cells. Nat Com-
mun 8:8. https://doi.org/10.1038/s41467-
017-00646-w
104. Ferrari R, Martin L, Tagit O, Guichard A,
Cambi A, Vassilopoulos P, Chavrier P (2019)
MT1-MMP directs force-producing proteo-
lytic contacts that drive tumor cell invasion.
Nat Commun 10. https://doi.org/10.1038/
s41467-019-12930-y
105. Mehta P, Rahman Z, Ten Dijke P, Boukany
PE (2022) Microfluidics meets 3D cancer cell
migration. Trend Cancer 8:683. https://doi.
org/10.1016/j.trecan.2022.03.006
106. Paul CD, Hung W-C, Wirtz D, Konstanto-
poulos K (2016) Engineered models of con-
fined cell migration. Annu Rev Biomed Eng
18:159–180. https://doi.org/10.1146/
annurev-bioeng-071114-040654
107. Yi H-G, Lee H, Cho D-W, Kim HJ (2017)
3D printing of organs-on-chips. Bioengineer-
i n g 4 . h t t p s : // d o i . o r g / 1 0 . 3 3 9 0 /
bioengineering4010010
108. Massarwa R, Niswander L (2013) In toto live
imaging of mouse morphogenesis and new
insights into neural tube closure. Develop-
ment 140:226–236
109. Aguilera-Castrejon A, Oldak B, Shani T,
Ghanem N, Itzkovich C, Slomovich S,
Tarazi S, Bayerl J, Chugaeva V, Ayyash M,
Ashouokhi S, Sheban D, Livnat N,
Lasman L, Viukov S, Zerbib M, Addadi Y,
Rais Y, Cheng S, Stelzer Y, Keren-Shaul H,
Shlomo R, Massarwa R, Novershtern N,
Maza I, Hanna JH (2021) Ex utero mouse
embryogenesis from pre-gastrulation to late
organogenesis. Nature 593:119–124.
https://doi.org/10.1038/s41586-021-
03416-3
110. van Rheenen J, Scheele CLGJ (2021) Intravi-
tal microscopy to illuminate cell state plastic-
ity during metastasis. Curr Opin Cell Biol 72:
28–35. https://doi.org/10.1016/j.ceb.
2021.04.004
 Part I

The Cell Biology of Cell Migration

 Chapter 2

Use of Ecto-Tagged Integrins to Monitor Integrin Exocytosis

and Endocytosis
Clotilde Huet-Calderwood, Felix Rivera-Molina, Derek Toomre,
and David A. Calderwood

Abstract
Controlled exocytosis and endocytosis of integrin adhesion receptors is required for normal cell adhesion,
migration, and signaling. In this chapter, we describe the design of functional β1 integrins carrying
extracellular fluorescent or chemically traceable tags (ecto-tag) and methods for their use to image β1
integrin trafficking in cells. We provide approaches to generate cells in which endogenous β1 integrins are
replaced by ecto-tagged integrins containing a pH-sensitive fluorophore pHluorin or a HaloTag and
describe strategies using photobleaching, selective extracellular/intracellular labeling, and chase, quench-
ing, and blocking to reveal β1 integrin exocytosis, endocytosis, and recycling by live total internal reflection
fluorescence (TIRF) microscopy.

Key words Integrins, Ecto-tagged, pHluorin, HaloTag, Exocytosis, Endocytosis, Recycling, Total
internal reflection fluorescence microscopy

1 Introduction

The binding of integrin adhesion receptors to the complex web of

extracellular matrix (ECM) that surrounds most mammalian cells
permits bidirectional transmission of mechanical and biochemical
signals required for cell adhesion, migration, differentiation, and
survival [1–3]. Integrins are obligate heterodimers of α and β sub-
units, each type I transmembrane proteins with a large multi-
domain extracellular portion, a single transmembrane domain,
and a generally short cytoplasmic tail. In humans the 18 α subunits
and 8 β subunits combine to generate 24 different αβ heterodimers
with specific ECM ligand-binding activities, e.g., α5β1 binds fibro-
nectin (FN) while α2β1 binds collagen. ECM engagement causes
large structural rearrangements in integrins’ extracellular domains
and results in clustering of integrins into nano- to micron-sized
structures and the association of integrin cytoplasmic tails with

Coert Margadant (ed.), Cell Migration in Three Dimensions,

Methods in Molecular Biology, vol. 2608, https://doi.org/10.1007/978-1-0716-2887-4_2,
© The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2023

17
18 Clotilde Huet-Calderwood et al.

cytoplasmic adaptor, cytoskeletal, and signaling proteins

[3, 4]. Depending on their size, shape, and composition, these
sites of integrin clustering are termed focal complexes, focal adhe-
sions (FA), or fibrillar adhesions [5–7] and are important sites
connecting the intracellular actin cytoskeleton to the extracellular
environment, permitting mechanotransduction and signaling.
Notably, these adhesions are not fixed, rather, they continually
remodel as cells spread and move, e.g., during cell migration, new
adhesions form at the cell front and are released from the rear.
The importance of tightly controlling integrin-mediated adhe-
sion during development, wound healing, hemostasis, inflamma-
tion, and the immune response is now well established, and there
have been extensive studies investigating the molecular bases for
assembly, maturation, and turnover of integrin-mediated adhesions
[2, 3, 8]. Integrins are known to be regulated at multiple levels,
such as by control of integrin expression levels, through conforma-
tional regulation that impacts integrin affinity for extracellular
ligands, via interactions with specific intracellular adaptors, and,
crucially, through trafficking of integrins to and from the cell
surface [1, 3, 9–12].
Membrane traffic-mediated delivery of integrins to the cell
surface (exocytosis), removal of integrins by internalization (endo-
cytosis), and recycling of internalized integrins back to the cell
surface have received considerable interest in recent years, especially
as alterations in integrin trafficking promote cell invasion and can-
cer metastasis [12–22]. Newly synthesized integrins reach the cell
surface after transiting the endoplasmic reticulum, the Golgi, and
the secretory machinery, and they are subsequently internalized
from the cell surface via various endocytic pathways and can be
recycled back to the cell surface using several different trafficking
routes. Integrins have been shown to traffic via retrograde flow and
to signal from the endosome compartment. However, exactly how
integrins are reorganized in space and time and how their traffick-
ing is tuned to different cell and ECM environments remain key
questions.
A variety of approaches have been taken to investigate integrin
trafficking. Genetic studies show a clear requirement for integrin
exocytosis and endocytosis and biochemical studies (e.g., cell-
surface biotinylation) have revealed bulk integrin internalization
and recycling rates [14, 17, 23, 24]. Fixed-point endocytic assays,
often using antibodies, have helped characterize molecular path-
ways of integrin endocytosis, and many molecular adaptors
involved in membrane trafficking have been found to regulate
integrin surface levels and to affect integrin-mediated activities,
with some adaptors shown to directly bind integrin subunits
[13, 14, 19, 23–25].
 Imaging Ecto-Tagged Integrins 19

However, fundamental insights into the dynamic spatiotempo-

ral control of integrin traffic in cell physiology and pathology
require sophisticated microscopy tools. To help provide the tools
to address critical gaps in understanding integrin exocytosis, endo-
cytosis, and recycling, we recently generated functional “ecto-
tagged” β1 integrins that allowed us to follow integrin delivery
to, and internalization from, the plasma membrane in live cells
[26]. Specifically, we inserted GFP, the pH-sensitive fluorophore
pHluorin, or a chemical genetic HaloTag into an exposed loop in
the extracellular hybrid domain of β1 and established that these
ecto-tagged integrins pair with endogenous α-subunits, express at
normal levels, localize normally, and support normal cell
adhesion [26].
Extracellular tagging offers three major advantages to tradi-
tional probes: (1) accessibility to the extracellular environment
permits use of affinity tags for selective covalent surface labeling;
(2) exposure of tags to the extracellular environment enables the
use of pH-sensitive fluorophores to selectively detect integrins at
the cell surface; and (3) ecto-tags avoid modification of the short
(20–70 amino acids) cytoplasmic tails of integrins preventing
potential interference with the binding of cytoplasmic partners
[27–30]. Notably, using pHluorin as an ecto-tag, we obtained the
first live-cell studies of exocytosis of β1 integrin-rich vesicles with
the plasma membrane, and, using HaloTag as a self-labeling
ecto-tag that covalently binds synthetic chemical ligands [31], we
selectively labeled cell-surface and intracellular β1 integrins with
different fluorophores allowing us to follow β1 integrin internaliza-
tion and trafficking in cells [26]. The ability to image both integrin
exocytosis and endocytosis opens the possibility of mapping the
entire integrin endo-exo cycle in live cells and investigating how
sites and timing of delivery are determined, their effect on focal
adhesion function and dynamics, and ultimately their impact on cell
morphology and motility. In this chapter we describe the
approaches we employ to generate ecto-tagged integrins and their
use in experiments to assess various aspects of integrin trafficking in
live cells.

2 Materials

2.1 Cells 1. HEK293T cells (ATCC#CRL-3216).

2. HeLa cells (ATCC#CCL-2).
3. EAhy926 cells (a gift from William Sessa, Yale University).
4. Immortalized β1itg-null murine fibroblasts (a gift from
Anthony Koleske, Yale University).
20 Clotilde Huet-Calderwood et al.

2.2 Plasmids 1. pcDNA3-human β1itg (designed by the Calderwood Lab),

2. pEGFP-C2 (Clontech),
3. sspH-mSmo [32],
4. C-Halo (Promega).
5. pDONR221 (Thermo Fisher Scientific),
6. pLENTI CMV Puro ecto-PH-β1itg (designed by
Calderwood Lab),
7. pLENTI CMV Puro ecto-Halo-β1itg (designed by
Calderwood Lab),
8. pLENTI PGK Blast ecto-PH-β1itg (designed by
Calderwood Lab),
9. pLENTI PGK Blast ecto-Halo-β1itg (designed by
Calderwood Lab),
10. pLENTI CMV Hygro paxillin-mCherry (designed by the
Calderwood Lab),
11. pLENTI CMV Hygro paxillin-GFP (designed by the
Calderwood Lab),
12. psPAX2 (viral proteins Gag and Rev. under the SV40 pro-
moter; Addgene plasmid #12260, a gift from D. Trono),
13. pMD2.G (viral protein VSV-G expressed under the CMV
promoter, Addgene plasmid #12259, a gift from D. Trono),
14. pLKO.1-β1itg shRNA TRCN0000275133 (Sigma),
15. pLENTI CMV Puro (Addgene plasmid #17452, gift from Eric
Campeau [33],
16. pLENTI PGK Blast (gift from Ben Turk, Yale University).

2.3 Culture Media 1. Complete culture medium: DMEM high glucose with
L-glutamine, 9% fetal bovine serum, nonessential amino
acids, and sodium pyruvate.
2. Complete imaging medium: Phenol red-free DMEM high glu-
cose supplemented with GlutaMAX, 9% fetal bovine serum,
nonessential amino acids, and sodium pyruvate.
3. Complete imaging medium with HEPES: Phenol red-free
DMEM high glucose containing L-glutamine and 25 mM
HEPES, 9% fetal bovine serum, nonessential amino acids, and
sodium pyruvate.
4. 0.05% trypsin/EDTA solution.
5. ProLong Live Antifade Reagent (Thermo Fisher Scientific).
 Imaging Ecto-Tagged Integrins 21

2.4 Plasticware 1. 10 cm diameter tissue culture treated Petri dishes (Falcon).

2. 35 mm glass bottom dishes (no. 1.5 coverslip 14 mm glass
diameter from MatTek). MatTek dishes were coated with
10 μg/mL bovine plasma fibronectin for 1 h at 37 °C prior
to use.
3. Acrodisc filters (0.45 μm) (Pall Corporation).

2.5 Chloroalkane 1. Membrane-impermeant AF488-CA (Alexa Fluor

Halo Ligands 488-HaloTag chloroalkane ligand, commercially available
from Promega).
2. Membrane-permeant SiR-CA (SiR-HaloTag chloroalkane
ligand, gift from Promega).
3. Membrane-impermeant CF568-SS-CA (reducible CF568-
labeled HaloTag chloroalkane ligand, gift from Promega).
4. Membrane-impermeant PEG-biotin-CA (PEG-biotin chlor-
oalkane ligand, commercially available from Promega).

2.6 Buffers and 1. Bovine plasma fibronectin (Sigma).

Reagents 2. MycoAlert mycoplasma detection kit (Lonza).
3. Gateway BP and LR Clonase II enzyme mix (Thermo Fisher
Scientific).
4. PEI (linear polyethylenimine MW 25,000, Polysciences, Inc.).
Make stock solution at 1 mg/mL in water.
5. Polybrene (hexadimethrine bromide, Sigma, H9268).
6. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (Gold
Biotechnology).
7. Anti-Alexa Fluor 488 antibody (Life Technology, A11094).
8. Anti-CD29 antibody clone HMβ1–1 (BioLegend, 112,203).
9. NT buffer: 150 mM NaCl, 1.0 mM EDTA, 0.2% BSA, 20 mM
Tris, pH 8.6.
10. Phosphate-buffered saline (PBS): 137 mM NaCl, 2.7 mM KCl,
4.3 mM Na2HPO4, 1.47 mM KH2PO4.
11. PBS 2+: phosphate-buffered saline (pH 7.4), 1.5 mM MgCl2,
0.2 mM CaCl2.
12. Stripping solution: 50 mM TCEP in NT buffer, pH 7.
13. Oligonucleotide primer sequences are provided in Table 1.

2.7 Microscopy 1. Image cells with a TIRF microscope in a 37 °C/5% CO2-

Equipment controlled environment. We use an Okolab chamber (Okolab;
Burlingame, CA, USA) mounted onto a Nikon Ti-2 eclipse
microscope (Nikon; Tokyo, Japan, USA) equipped with a
motorized Ti-LA-HTIRF module with LUN4 488, 561 nm
and 640 lasers (15 mW), a CFI Plan Apo Lambda 100× oil
22 Clotilde Huet-Calderwood et al.

Table 1
Oligonucleotide primer sequences

Primer name Primer sequence (5′-3′)

β1 integrin EcoRI- GTAACCAACCGTAGCAAAGGAGAATTCCTCGAGACAGCAGAGAAGC
XhoI for TCAAGCCAGAG

β 1 integrin EcoRI- CTCTGGCTTGAGCTTCTCTGCTGTCTCGAGGAATTCTCCTTTGCTACGG

XhoI rev TTGGTTAC

4AA GFP EcoRI for GAATTCGGAGGTATGGTGAGCAAGGGC

4AA GFP XhoI rev CTCGAGACCTCCCTTGTACAGCTCGTC
9AA GFP EcoRI for GAATTCGGAGGTTCTGGAGGTTCTGGTATGGTGAGCAAGGGCAG
9AA GFP XhoI rev CTCGAGACCAGAACCTCCAGAACCTCCCTTGTACAGCTCGTC
4AA pHluorin EcoRI GAATTCGGAGGTATGAGTAAAGGAGAAG
for
4AA pHluorin XhoI CTCGAGACCTCCACTAGTTTTGTATAGTTCATCC
rev
9AA pHluorin EcoRI GAATTCGGAGGTTCTGGAGGTTCTGGTATGAGTAAAGGAGAAGAAC
for
9AA pHluorin XhoI CTCGAGACCAGAACCTCCAGAACCTCCACTAGTTTTGTATAGTTCATCC
rev
9AA halo EcoRI for GGGGAATTCGGAGGTTCTGGAGGTTCTGGTGAAATCGGTACTGGC
TTTCCATTC
9AA halo XhoI rev GGGCTCGAGACCAGAACCTCCAGAACCTCCACCGGAAATC
TCCAGAGTAGACAG
attB1 β1 integrin for GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGGTACCATGAA
TTTACAACCAATTTTCTGG

attB2 β1 integrin rev GGGGACCACTTTGTACAAGAAAGCTGGGTCTAACTATTTTCCCTCATAC

TTCGGATT

TIRF objective (1.45 NA), and a 1100 × 1100 pixels Teledyne

Photometrics and Prime 95B sCMOS camera 110 nm/pixel
and controlled by NIS-Elements AR software.
2. For highly inclined and laminated optical sheet (HILO) experi-
ments, we use a custom-built axicon lens ring TIRF illumina-
tion system built around an Olympus XI71 inverted
microscope, an Innova 70 laser coupled to single-mode fiber,
equipped with a 2048 × 2048 pixels Andor’s Zyla sCMOS
65 nm/pixel scale, and controlled by the MicroManager Ima-
geJ software. The position of the axicon lens is adjusted to
switch the illumination between TIRF and HILO using a
Plan Apo 100× objectives (1.49 NA).
 Imaging Ecto-Tagged Integrins 23

3 Methods

3.1 Design and With the goal of generating integrins containing an extracellular tag
Generation of Ecto- (ecto-tag) that facilitates analysis of integrin trafficking, we initially
Tagged Integrins tagged the β1 integrin subunit [26]. The β1 subunit is broadly
expressed and pairs with many different α subunits [34], potentially
enabling analysis of integrin traffic in many different settings. The
methods described in this chapter, therefore, focus on our validated
ecto-tagged β1 integrins [26], but, in principle, similar strategies
could be applied to generate and validate other ecto-tagged integ-
rins (see Note 1).
Integrin β subunits contain eight extracellular domains, with
three N-terminal domains nested within one another (Fig. 1a). Ide-
ally, effective ecto-tagged integrins should enable tracking of the
integrin without altering the function of these complex multi-
domain heterodimeric receptors. Suitable sites for inserting a large
tag such as GFP or Halo are therefore limited by a number of factors,
including the following: (1) the need to retain correct folding of the
nested N-terminal domains, (2) the requirement for retention of the
N-terminal signal peptide, (3) the necessity of avoiding interference
with integrin heterodimerization, and (4) the ability to accommo-
date the large-scale conformational rearrangements that occur dur-
ing integrin activation. To identify suitable tagging sites, we
examined the crystal structures of α5β1, αvβ3, and αIIbβ3 alone or
in complex with inhibitors or ligands [11, 35–44]. We sought a
surface loop far from the ligand-binding site that is exposed in
both full-length bent and active headpiece structures. We selected a
long loop (β1 residues 92–114) between β strands X and A [36]
(Fig. 1b) which we hypothesized could accommodate a tag with
flexible linkers. A very similar strategy for ecto-tagging β1 integrin
in this loop has now also been described by others [45], confirming
the utility of this approach. Expression constructs for our ecto-
tagged β1 integrins are available upon request, but the general
strategy for generating these constructs is provided below.
1. Once a suitable insertion site has been identified, introduce
unique restriction enzyme sites to allow cloning into that site.
We used QuikChange mutagenesis with primers “β1 integrin
EcoRI-XhoI For” and “β1 integrin EcoRI-XhoI Rev”
(Table 1) to insert a GAATTCCTCGAG sequence introducing
unique EcoRI and XhoI sites into the ecto-domain coding
region of a human β1 integrin pCDNA3 expression construct
between codons encoding Gly101 and Tyr102.
2. PCR amplify eGFP from the pEGFP-C2 vector, ecliptic
pHluorin from the sspH-mSmo vector [32], or HaloTag from
the C-Halo vector using primers that add suitable spacers
regions and restriction sites at the 5′ and 3′ linkers. We used a
5′ linker containing an EcoRI site and a 3′ linker containing a
24 Clotilde Huet-Calderwood et al.

A
N
N N

C C C

targeted loop

GFP

β1 α5
C
101
Nterm...NKNVTNRSKGEFGG tag GGLETAEKLKPEDIHQIQ...Cterm
β1 integrin hybrid domain linker linker β1 integrin hybrid domain

101
Nterm...NKNVTNRSKGEFGGSGGSG tag GGSGGSGLETAEKLKPEDIHQIQ...Cterm
β1 integrin hybrid domain linker linker β1 integrin hybrid domain

Fig. 1 Design of an ecto-tagged β1 integrin. (a), Cartoon of the conformational changes in the integrin αβ
heterodimer during integrin activation (α subunit depicted in red, β subunit in blue with polypeptide chain in
back), (b), Ribbon diagram of the crystal structures of the α5β1 integrin headpiece (PDB: 3VI4) and GFP (PDB:
1GFL). The hybrid domain loop into which ecto-tags were inserted is indicated. (c), Zoom in on the amino acid
sequence of human ecto-tagged β1 integrins at the tag insertion site. Each tag (pHluorin or Halo, in blue, N-
and C-terminal sequences specified) was inserted into the hybrid domain of human β1 integrin between
residues Gly101 and Tyr102 (in green). Linkers of four or nine amino acids (in red) were added on each side of
the tag to facilitate cloning and provide flexibility. This figure was adapted from [26]

3.2 Generation of
Stable Cell Lines
Expressing Ecto-
Tagged β1 Integrins
3.2.1 Production of
Lentiviral Particles Driving
Expression of Ecto-Tagged
β1 Integrin
Imaging Ecto-Tagged Integrins 25
XhoI site along with a spacer sequence encoding an additional
GlyGly or a GlyGlySerGlyGlySerGly flexible linker on each side
(Table 1).
3. Subclone PCR products into the modified human β1 integrin
expression construct generated in step 1. In our case, this
generates β1 containing tags flanked with four or nine amino
acid spacers (Fig. 1c).
Although for simple imaging experiments, it is possible to express
ecto-tagged β1 integrin in wild-type cells to validate the function-
ality of ecto-tagged integrins, and for detailed investigation of
integrin trafficking, we prefer to stably express ecto-tagged β1
integrins in a β1 null background. This helps ensure an optimum
level of ecto-tagged β1 at the cell surface as the exogenous integrin
does not need to compete with endogenous untagged integrin. We
have achieved this using lentiviral transduction of either immorta-
lized β1 knockout mouse fibroblasts or of human HeLa cells and
EA.hy926 cells in which endogenous β1 expression has been stably
knocked down by shRNA.
To generate lentiviral particles driving expression of ecto-tagged
β1, the ecto-tagged expression construct is recombined into a
lentiviral vector and viral particles are generated in HEK293T cells.
Generate final lentivirus expression vectors by Gateway LR
recombination with pLENTI CMV Puro or pLENTI PGK Blast
Destination vectors.
Verify all constructs by DNA sequencing.
1. PCR amplify the ecto-tagged β1 expression construct (gener-
ated as described in Sect. 3.1) with primers designed according
to the Gateway Cloning manufacturer’s instructions to intro-
duce flanking attB1 and attB2 recombination sites—primers
“attB1 β1 integrin For” and “attB2 β1 integrin Rev” (Table 1).
2. Generate pENTRY vectors by Gateway BP recombination with
the PCR product and pDONR221 and verify all constructs by
DNA sequencing.
3. Generate final pLENTI ecto-tagged β1 integrin lentivirus
expression vectors by Gateway LR recombination of the pEN-
TRY vector with pLENTI CMV Puro or pLENTI PGK Blast
Destination vectors and verify all constructs by digestion with
restriction enzymes.
4. Plate HEK293T cells in 10 cm diameter dishes in complete
growth medium without antibiotics.
5. When HEK293T cells confluence reaches 50–70%, transfect
with 4.5 μg pLENTI ecto-tagged β1 integrin plasmid DNA
along with lentivirus packaging plasmid DNA (4.5 μg
pcPAX2 + 0.45 μg pMD2.G) and 28 μL PEI stock solution
(1 mg/mL) in 500 μL DMEM.
26 Clotilde Huet-Calderwood et al.

6. 24 h after HEK293T cell transfection, replace medium with

complete growth medium.
7. Harvest lentivirus-containing supernatant at 48 h and 72 h,
pass through a 0.45 μm pore size Acrodisc filter and store at -
80 °C.

3.2.2 Replacing For studies in murine fibroblasts, we use a clonal line of β1 integrin
Endogenous β1 Integrins knockout fibroblasts (KO6) (see Note 2). Use of a clonal line
with Ecto-Tagged β1 ensures that all subsequent lines start from the same original popu-
Integrins in Murine lation and minimize the chances of differences arising due to clonal
Fibroblasts variation. Prior to infection with lentivirus, puromycin and hygro-
mycin kill curves were performed on KO6 cells to identify optimum
concentrations needed for selection of transduced cells [46].
1. Culture β1 null fibroblast clone KO6 in complete growth
medium.
2. Infect cells with lentivirus generated from pLENTI CMV Puro
ecto-tagged β1 plasmids (Sect. 3.2.1) and 8 μg/mL polybrene.
The dilution of the virus is adjusted according to the viral titer
in order to achieve 50% surviving cells after selection with
puromycin.
3. 24 h after infection, select cells with 2 μg/mL puromycin and
maintain cells in selection medium for 5 days.
4. When an independent label for focal adhesions is required,
KO6 fibroblasts reconstituted with ecto-tagged β1 can be
infected with lentiviral particles generated with pLENTI
CMV Hygro paxillin-mCherry. These particles are prepared
using protocols similar to those in Sect. 3.2.1.

3.2.3 Replacing To allow investigation of integrin traffic in cells other than mouse
Endogenous β1 Integrins fibroblasts, we used stable lentiviral-mediated delivery of a previ-
with Ecto-Tagged β1 ously validated shRNA targeting human β1 integrins to knock β1
Integrins in Human Cell down in various human cell lines. Similar approaches using
Lines CRISPR/Cas9-mediated knockout of β1 integrins could also be
applied. The use of a puromycin-resistant pLKO.1 knockdown
plasmid requires the use of a different selection marker on the
ecto-tagged integrin construct—we have used pLENTI PGK
Blast for these studies.
1. Culture HeLa cells or EA.hy926 in complete growth medium.
2. Infect cells with lentivirus generated from shRNA-encoding
pLKO.1 plasmid and 8 μg/mL polybrene. These lentiviral
particles are generated as in Sect. 3.2.1. The dilution of the
virus is adjusted according to the viral titer in order to achieve
less than 50% surviving cells after selection with puromycin.
3. 24 h after infection, select cells with 1 μg/mL puromycin and
maintain cells in selection medium for 3 days.

3.3 Validation of
Ecto-Tagged Integrin
Function
3.4 Imaging
Exocytosis of Ecto-
Tagged Integrins
3.4.1 Imaging Exocytosis
of pHluorin-β1 Integrins by
Live TIRFM
Imaging Ecto-Tagged Integrins 27
4. Validate effective integrin knockdown by flow cytometry.
5. Infect β1 integrin knockdown cells with lentivirus generated
from pLENTI PGK Blast ecto-tagged β1-itg plasmids (Sect.
3.2.1) and 8 μg/mL polybrene. The dilution of the virus is
adjusted according to the viral titer in order to achieve less than
50% surviving cells after selection with blasticidin.
6. 24 h after infection, select cells with blasticidin (5 μg/mL for
EA.hy926 and 4 μg/mL for HeLa) and maintain selection for
10 days.
As introduction of ecto-tags into integrin subunits has the potential
to interfere with their expression, folding, heterodimerization, traf-
fic, activation, and ligand binding, it is important to validate the
functionality of ecto-tagged integrins expressed in cells. The ecto-
tagged β1 integrins described in this chapter have been extensively
characterized [26] for their expression level and molecular mass,
ability to pair with appropriate α subunits, express at the cell sur-
face, localize to focal adhesions, bind soluble FN-9-10 fragments in
an EDTA and manganese-sensitive manner, and, importantly, res-
cue the adhesion defect of β1 null fibroblasts. We note that the
differing lengths of spacers used (Fig. 1) had no consistent impact
on integrin function and both spacers are effective. Similar valida-
tion of any newly generated ecto-tagged integrins, including
potential optimization of linker length, will be required prior to
their use in trafficking assays. Detailed protocols for classical assays
of integrin function are not provided here but are available else-
where [47–51].
The availability of cells expressing ecto-tagged integrins enables a
variety of experiments to examine integrin exocytosis. However,
challenges to imaging exocytosis include visualization of the rela-
tively small changes in total local surface levels that occur in
response to exocytic vesicle fusion, especially when in the context
of relatively high integrin surface levels. The rapid dynamics of the
pH sensitivity of pHluorin fluorescence [52] or the selective, irre-
versible, and environment-specific labeling of surface-exposed
HaloTagged integrins provided by cell impermeant HaloTags
[31, 53] can be used to overcome these problems as described
below.
Imaging exocytosis of ecto-pHluorin-tagged β1 integrins takes
advantage of the pHluorin fluorescence pH sensitivity [52]. The
pHluorin fluoresces poorly in intracellular vesicles due to their low
internal pH but brightly after exposure to higher pH once these
vesicles fuse with the plasma membrane. Thus, fusion events gen-
erate rapid localized increases in fluorescence that exhibit charac-
teristic kinetics as the contents diffuse in the plasma membrane or
28 Clotilde Huet-Calderwood et al.

A B
t(sec) 0 0.2 0.4 0.6 0.8
PH-β1itg prior to photobleaching
MatLab validated fusion events
1.0 1.2 1.4 1.6 1.8

C normalized
intentity

time (sec)

Fig. 2 Imaging exocytosis of ecto-PH-β1itg. HeLa cells knocked down for endogenous β1 integrin and
reconstituted with ecto-PH-β1 were imaged by TIRFM at five frames/sec. (a). TIRFM image of ecto-PH-
β1itg prior to photobleaching overlaid with MATLAB-validated fusion events marked as red spots. Bar = 10 μm.
(b). Gallery of a single ecto-PH-β1itg fusion event over time, Bar = 1 μm. (c). Temporal alignment of the
50 MATLAB validated fusion events recorded in this HeLa cell in 5 min. Data is shown as mean +/- 95%
confidence interval

the extracellular medium (Fig. 2), and this phenomenon has

allowed analysis of exocytosis of a range of pHluorin-tagged pro-
teins [52, 54, 55]. To apply this approach to integrins, we use stable
lines expressing β1 integrin carrying an ecto-pHluorin (Sect. 3.2).
Cells co-expressing the focal adhesion marker paxillin-mCherry can
also be used as this enables ready identification of adhesions. Cells
are imaged by live-cell total internal reflection fluorescence micros-
copy (TIRFM) after photobleaching of the surface β1 integrin
pHluorin fluorescence to allow visualization of new vesicle fusion.
Images are collected at high temporal resolution to reveal the
transient fusion events and diffusion of the β1 integrin pHluorin
cargo. Further analysis of recordings using custom MATLAB algo-
rithms [26] allows localization of fusion events on images (Fig. 2)
and shows that, at least in these murine fibroblasts, exocytosis
occurs in proximity to focal adhesions, in agreement with our
previously published study [26].
1. Plate cells expressing ecto-PH-β1itg and paxillin-mCherry in a
glass bottomed FN-coated MatTek dish in complete imaging
medium and culture until cells are fully spread.
2. Transfer dish to Okolab chamber-fitted Nikon Ti2 microscope
for imaging at 37 °C and 5% CO2 atmosphere.
 Imaging Ecto-Tagged Integrins 29

3. Image ecto-PH-β1itg and paxillin-mCherry by 2-color TIRFM

with 488 nm and 568 nm lasers.
4. Photobleach the ecto-PH-β1itg signal with the 488 nm TIRF
laser set at 100% intensity for 10–30 s.
5. Immediately image ecto-PH-β1itg with the 488 nm TIRF laser
set at 25% laser intensity at 5 frames/s for 3–5 min. Exocytosis
events are visible as fluorescent spots appearing suddenly,
reaching maximum intensity within 0.2 s and decaying more
slowly (within 1–3 s) with a spreading of the fluorescence as the
cargo diffuses into the plasma membrane. We used custom
MATLAB algorithms to detect and validate fusion events and
for mapping their coordinates onto a focal adhesion map [26].

3.4.2 Imaging Newly While direct imaging of ecto-pHluorin-β1 integrin exocytosis in

Exocytosed Ecto-Halo-β1 individual cells is a powerful technique, it requires high-frequency
Integrins imaging of cells and consequently individual cells cannot be imaged
for extended periods. An alternative method that uses the inter-
changeable chemical-genetic labeling technology of the HaloTag in
ecto-Halo-β1 integrins allows assessment of the localization of β1
integrins exocytosed over a longer period of time. The HaloTag is a
modified haloalkane dehalogenase that covalently binds synthetic
small-molecule ligands which can be coupled to fluorophores or
other affinity tags [31, 53, 56]. Membrane-permeant and imper-
meant chloroalkane ligands tagged with fluorescent markers or
functional groups (e.g., biotin) can be purchased from Promega.
To identify newly exocytosed integrins, first block all surface-
exposed ecto-Halo-β1 integrins by incubating cells with saturating
concentrations of the membrane-impermeant PEG-biotin-Halo
ligand (1 μM using protocol below). Then culture cells for various
times (30 min, Fig. 3) and reveal the localization of newly exocy-
tosed, unblocked, ecto-Halo-β1 integrins with a fluorescent
membrane-impermeant HaloTag ligand (see Note 3 for discussion
of optimization of signal over background). As shown in Fig. 3B,
staining with fluorescent membrane-impermeant HaloTag imme-
diately after blocking shows minimal cell surface labeling (although
focal adhesions are intact), but after a 30 min incubation at 37 °C,
newly exocytosed ecto-Halo-β1 integrins mostly colocalize with
the focal adhesion marker paxillin (Fig. 3C). These data are consis-
tent with the idea that exocytosis of recycled β1 integrins preferen-
tially occurs in the vicinity of focal adhesions (as suggested from our
analysis of ecto-pHluorin-β1 integrin, Fig. 2 [26]) or that exocy-
tosed integrins are rapidly incorporated into focal adhesions.
1. Plate ecto-Halo-β1itg KO6 fibroblasts on FN-coated MatTek
dishes in complete growth medium; culture until cells are fully
spread.
30 Clotilde Huet-Calderwood et al.

Fig. 3 Imaging recent exocytosis using ecto-Halo-β1itg. TIRFM images of ecto-Halo-β1itg labeled with a
membrane-impermeant HaloTag ligand (here we used CF568-SS-CA, left) and paxillin-GFP (right) in recon-
stituted fibroblasts. (a). Positive control: cells were labeled with CF568-SS-CA without prior block with
PEG-biotin-CA. (b). Negative control: cells were blocked with PEG-biotin-CA and immediately labeled with
CF568-SS-CA. (c). Cells were blocked with PEG-biotin-CA, incubated for 30 min at 37 °C to allow for
exocytosis to occur and then labeled with CF568-SS-CA. Different cells are shown in two channels. Bar,
10 μm

3.5 Using Ecto-Halo-
β1 Integrins to
Investigate Integrin
Endocytosis and
Recycling
3.5.1 Labeling Surface
and Intracellular Pools of
Ecto-Halo-β1 Integrins with
Distinct Halo Ligands and
Following Exchange
Imaging Ecto-Tagged Integrins 31
2. Block all surface Halo binding sites with 1 μM PEG-Biotin-CA
(membrane impermeant) in serum-free phenol red-free
DMEM for 5 min at room temperature.
3. Wash cells three times with cold PBS2 + .
4. Add complete imaging medium and incubate at 37 °C for
defined time period to allow for exocytosis to occur.
5. Wash once with cold PBS2+.
6. Chill cells on ice for 5 min.
7. Label with a membrane-impermeant fluorophore-tagged
HaloTag ligand (250 nM-1 μM final) in complete imaging
medium for 5 min at room temperature.
8. Wash with complete imaging medium with HEPES for 10 min
on ice, then with cold PBS2+ for 10 min on ice.
9. Fix with 4% PFA for 15 min at room temperature.
10. Wash once with PBS and image by TIRFM.
Combining cell lines expressing ecto-Halo-β1 integrins with the
diversity of HaloTag ligands (both commercially available and cus-
tom generated), sequential labeling protocols, fluorophore
quenching and ligand cleavage, and advanced microscopy techni-
ques allows for detailed investigation of integrin traffic. The exact
protocol employed will depend on the experimental questions
being asked, but here we highlight three related methodologies
to investigate the trafficking of β1 integrins.
Using a combination of membrane permeable and non-permeable
HaloTag ligands, we have developed a straightforward method to
selectively label intracellular and extracellular pools of β1 integrins
with two distinct fluorophores and to then follow the exchange of
these pools over time by live-cell microscopy [26]. By first saturat-
ing labeling of the cell surface pool, we ensure that subsequent
incubation with the membrane-permeant HaloTag ligand labels
only intracellular ecto-Halo-β1 integrins as the cell surface popula-
tion is already fully labeled with the original HaloTag ligand. Using
this method, we have observed that, by 1 h after labeling and for
more than 20 h thereafter, β1 integrins from both the originally
intracellular labeled pool and the cell surface labeled pool are
colocalized in focal adhesions, indicating that β1 integrins are
long-lived receptors that undergo highly dynamic trafficking and
recycling within the cell.
1. Plate ecto-Halo-β1itg KO6 fibroblasts on FN-coated MatTek
in complete growth medium.
2. Label extracellular ecto-Halo-β1itg with 250 nM AF488-CA
(membrane-impermeant Halo ligand) in complete imaging
medium for 5 min at room temperature.
32 Clotilde Huet-Calderwood et al.

3. Wash three times with PBS.

4. Label intracellular ecto-Halo-β1itg with 250 nM SiR-CA
(membrane permeant Halo ligand) in complete imaging
medium for 5 min at room temperature.
5. Wash three times with PBS.
6. Add complete imaging medium.
7. Image exchange between the two pools of fluorescently labeled
β1itg by live-cell microscopy. This labeling method may be
used with TIRFM or other approaches such as confocal
microscopy.

3.5.2 Imaging In principle, the differential labeling approach from Sect. 3.5.1
Endocytosis of Ecto-Halo- could be used to visualize internalization of cell-surface β1 integ-
β1 Integrins Using HILO- rins. However, a major challenge is that the low level of internaliza-
TIRF tion is easily obscured by the strong surface labeling, particularly if
internalization takes place close to bright focal adhesions. To over-
come this problem, we have combined HILO illumination with
antibody quenching of surface fluorophores. Surface ecto-Halo-β1
integrins are first labeled with a membrane-impermeant fluorescent
HaloTag ligand and cells are cultured for various times to allow
internalization. Labeled integrins at the surface and below can then
be monitored by low-angle HILO-TIRFM (see Note 4). Further-
more, upon addition of anti-Alexa Fluor 488 antibody to the
imaging medium, the surface fluorescence is immediately quenched
while labeled internalized ecto-Halo-β1 integrins are protected.
Cells can then be fixed and immunolabeled with makers of traffick-
ing compartments to identify the exact localization of internalized
ecto-Halo-β1itg.
1. Plate ecto-Halo-β1itg KO6 fibroblasts on FN-coated MatTek
in complete growth medium until they are fully spread.
2. Label surface ecto-Halo-β1itg with 250 nM AF488-CA (mem-
brane impermeant) for 5 min at room temperature.
3. Wash three times with PBS.
4. Add complete imaging medium and image in live TIRFM with
HILO illumination every 30 s for 40 min.
5. Add anti-Alexa Fluor 488 antibody (5 μg/mL final) to the
culture medium to quench the surface fluorescence and keep
imaging by live TIRFM or fix samples if immunostaining is
required. Ecto-Halo-β1integrins internalized during the
40 min incubation at 37 °C are protected from the quenching
by the antibody and can therefore be visualized by HILO
TIRFM.
 Imaging Ecto-Tagged Integrins 33

3.5.3 Imaging the A further development of the ecto-Halo-β1 integrin assays that
Recycling of Ecto-Halo-β1 does not rely on the quenching antibody involves the use of cleav-
Integrins Using Reducible able HaloTag ligands. With support from Promega, we obtained a
Halo Ligands novel HaloTag ligand containing a reducible disulfide bound con-
necting the CF568 fluorophore to the chloroalkane moiety. This
allows us to remove surface labeling with a reducing agent such as
TCEP, enabling development of methods to image the recycling of
ecto-Halo-β1itg to the plasma membrane after internalization
(Fig. 4). To do so, ecto-Halo-β1itg fibroblasts are labeled with a
membrane-impermeant reducible fluorescent Halo ligand, cells are
allowed to internalize labeled ecto-Halo-β1itg for 30 min to 2 h at
37 °C (chase), the fluorophore is stripped from non-internalized
ecto-Halo-β1itg with the reducing agent TCEP, and labeled ecto-
Halo-β1itg recycling back to the plasma membrane is imaged by
TIRFM. TIRF and epifluorescence images taken at various stages of
the procedure (Fig. 4) show the effectiveness of the TCEP treat-
ment at eliminating surface fluorescence, the internalization of
labeled ecto-Halo-β1itg during the 30 min incubation at 37 °C
prior to stripping, and the recycling of labeled ecto-Halo-β1 back
to the cell surface and to focal adhesions in particular.
1. Plate ecto-Halo-β1itg expressing cells in a FN-coated MatTek
dish in complete medium until they are fully spread.
2. Label surface ecto-Halo-β1itg with 2 μM CF568-SS-CA
(membrane- impermeant Halo ligand) in complete imaging
medium with HEPES for 5 min at room temperature (see
Note 5).
3. Wash cells 4 times with PBS2+, add complete imaging
medium, and return cells to tissue culture incubator to allow
for integrin internalization for 30 min to 2 h (chase).
4. Freshly prepare stripping solution.
5. Aspirate medium and incubate cells with stripping solution for
5 min at room temperature.
6. Wash four times with PBS2+.
7. Add complete imaging medium and image the recycling of
labeled ecto-Halo-β1itg back to the cell surface either by live
TIRM in the presence of ProLong Live reagent to reduce
photobleaching or after fixation with 4% PFA in PBS for
15 min at room temperature.

4 Notes

1. We anticipate that tagging other β integrin subunits at similar

sites to those used for β1 integrins will also allow generation
and imaging of functional integrin heterodimers using the
approaches described in this chapter. Our preliminary
Another random document with
no related content on Scribd:
 M. Foucault’s Proofs of the Earth’s Motion.

It was hardly to be expected that we should discover, in our own

day, a new physical proof of the earth’s motion, yet so it has been.
The experiments of M. Foucault have enabled us to see the Rotation
of the Earth on its axis, as taking place, we may say, before our
eyes. These experiments are, in fact, a result of what has been said
in speaking of the Moon’s rotation: namely, That the mechanical
causes of motion operate with reference to absolute, not relative,
space; so that where there is no cause operating to change a
motion, it will retain its direction in absolute space; and may on that
account seem to change, if regarded relatively in a limited space.

In M. Foucault’s first experiment, the motion employed was that of

a pendulum. If a pendulum oscillate quite freely, there is no cause
acting to change the vertical plane of oscillation absolutely; for the
forces which produce the oscillation are in the vertical plane. But if
the vertical plane remain the same absolutely, at a spot on the
surface of the revolving Earth, it will change relatively to the
spectator. He will see the pendulum oscillate in a vertical plane
which gradually 526 turns away from its first position. Now this is
what really happens; and thus the revolution of the Earth in absolute
space is experimentally proved.

In subsequent experiments, M. Foucault has used the rotation of a

body to prove the same thing. For when a body rotates freely, acted
upon by no power, there is nothing to change the position of the axis
of rotation in absolute space. But if the position of the axis remain
the same in absolute space, it will, in virtue of its relative motion,
change as seen by a spectator at any spot on the rotating Earth. By
taking a heavy disk or globe and making it rotate on its axis rapidly,
the force of absolute permanence (as compared with the inevitable
casual disturbances arising from the machinery which supports the
revolving disk) becomes considerable and hence the relative motion
can, in this way also, be made visible.

Mr. De Morgan has said (Comp. to Brit. Alm. 1836, p. 18) that
astronomy does not supply any argument for the earth’s motion
which is absolutely and demonstrably conclusive, till we come to the
Aberration of Light. But we may now venture to say that the
experiments of M. Foucault prove the diurnal motion of the Earth in
the most conclusive manner, by palpable and broad effects, if we
accept the doctrines of the Science of Mechanics: while Aberration
proves the annual motion, if we suppose that we can observe the
places of the fixed stars to the accuracy of a few seconds; and if we
accept, in addition to the doctrines of Mechanics, the doctrine of the
motion of light with a certain great velocity.
 CHAPTER III.

Sequel to Copernicus.

English Copernicans.

P ROFESSOR DE MORGAN has made numerous and interesting

contributions to the history of the progress and reception of the
Copernican System. These are given mainly in the Companion to the
British Almanac; especially in his papers entitled “Old Arguments
against the Motion of the Earth” (1836); “English Mathematical and
Astronomical Writers” (1837); “On the Difficulty of Correct 527
Description of Books” (1853); “The Progress of the Doctrine of the
Earth’s Motion between the Times of Copernicus and Galileo”
(1855). In these papers he insists very rightly upon the distinction
between the mathematical and the physical aspect of the doctrines
of Copernicus: a distinction corresponding very nearly with the
distinction which we have drawn between Formal and Physical
Astronomy; and in accordance with which we have given the history
of the Heliocentric Doctrine as a Formal Theory in Book v., and as a
Physical Theory in Book vii.

Another interesting part of Mr. De Morgan’s researches are the

notices which he has given of the early assertors of the heliocentric
doctrine in England. These make their appearance as soon as it was
well possible they should exist. The work of Copernicus was
published, as we have said, in 1543. In September 1556, John Field
published an Ephemeris for 1557, “juxta Copernici et Reinholdi
Canones,” in the preface to which he avows his conviction of the
truth of the Copernican hypothesis. Robert Recorde, the author of
various works on Arithmetic, published among others, “The Pathway
to Knowledge” in 1551. In this book, the author discusses the
question of the “quietnes of the earth,” and professes to leave it
undecided: but Mr. De Morgan (Comp. A. 1837, p. 33) conceives that
it appears from what is said, that he was really a Copernican, but did
not think the world ripe for any such doctrine.

Mr. Joseph Hunter also has brought to notice 29 the claims of Field,
whom he designates as the Proto-Copernican of England. He quotes
the Address to the Reader prefixed to his first Ephemeris, and dated
May 31, 1556, in which he says that, since abler men decline the
task, “I have therefore published this Ephemeris of the year 1557,
following in it as my authorities, N. Copernicus and Erasmus
Reinhold, whose writings are established and founded on true,
certain, and authentic demonstrations.” I conceive that this passage,
however, only shows that Field had adopted the Copernican scheme
as a basis for the calculation of Ephemerides; which, as Mr. De
Morgan has remarked, is a very different thing from accepting it as a
physical truth. Field, in this same address, makes mention of the
errors “illius turbæ quæ Alphonsi utitur hypothesi;” but the word
hypothesis is still indecisive.
29 Ast. Soc. Notices, vol. iii. p. 3 (1833).

As evidence that Field was regarded in his own day as a man who
528 had rendered good service to science, Mr. Hunter notices that, in
1558, the Heralds granted to him the right of using, with his arms,
the crest or additional device of a red right arm issuing from the
clouds, and presenting a golden armillary sphere.

Recorde’s claims depend upon a passage in a Dialogue between

Master and Scholar, in which the Master expounds the doctrine of
Copernicus, and the authorities against it; to which the Scholar
answers, taking the common view: “Nay, sir, in good faith I desire not
to hear such vaine phantasies, so far against common reason, and
repugnant to all the learned multitude of wryters, and therefore let it
passe for ever and a day longer.” The Master, more sagely, warns
him against a hasty judgment, and says, “Another time I will so
declare his supposition, that you shall not only wonder to hear it, but
also peradventure be as earnest then to credit it, as you now are
now to condemne it.” I conceive that this passage proves Mr. De
Morgan’s assertion, that Recorde was a Copernican, and very likely
the first in England.

In 1555, also, Leonard Digges published his “Prognostication

Everlasting;” but this is, as Mr. De Morgan says (Comp. A. 1837, p.
40) a meteorological work. It was republished in 1592 by his son
Thomas Digges with additions; and as these have been the occasion
of some confusion among those who have written on the history of
astronomy, I am glad to be able, through the kindness of Professor
Walker of Oxford, to give a distinct account of the editions of the
work.

In the Bodleian Library, besides the editions of 1555 and 1592 of

the “Prognostication Everlasting,” there is an edition of 1564. It is still
decidedly Ptolemaic, and contains a Diagram representing a number
of concentric circles, which are marked, in order, as—
“The Earth,
Moone,
Venus,
Mercury,
Sunne,
Mars,
 Jupiter,
Saturne,
The Starrie Firmament,
The Crystalline Heavens,
The First Mover,
The Abode of God and the Elect. Here the Learned do approve.”
529

The third edition, of 1592, contains an Addition, by the son, of

twenty pages. He there speaks of having found, apparently among
his father’s papers, “A description or modile of the world and
situation of Spheres Cœlestiall and elementare according to the
doctrine of Ptolemie, whereunto all universities (led thereunto chiefly
by the authoritie of Aristotle) do consent.” He adds: “But in this our
age, one rare witte (seeing the continuall errors that from time to
time more and more continually have been discovered, besides the
infinite absurdities in their Theoricks, which they have been forced to
admit that would not confesse any Mobilitie in the ball of the Earth)
hath by long studye, paynfull practise, and rare invention, delivered a
new Theorick or Model of the world, shewing that the Earth resteth
not in the Center of the whole world or globe of elements, which
encircled and enclosed in the Moone’s orbe, and together with the
whole globe of mortalitye is carried yearely round about the Sunne,
which like a king in the middest of all, raygneth and giveth lawes of
motion to all the rest, sphærically dispersing his glorious beames of
light through all this sacred cœlestiall Temple. And the Earth itselfe
to be one of the Planets, having his peculiar and strange courses,
turning every 24 hours rounde upon his owne centre, whereby the
Sunne and great globe of fixed Starres seem to sway about and
turne, albeit indeed they remaine fixed—So many ways is the sense
of mortal man abused.”
 This Addition is headed:
“A Perfit Description of the Cœlestiall Orbes, according to the most
ancient doctrine of the Pythagoreans: lately revived by Copernicus,
and by Geometrical Demonstrations approved.” Mr. De Morgan, not
having seen this edition, and knowing the title-page only as far as
the word “Pythagoreans,” says “their astrological doctrines we
presume, not their reputed Copernican ones.” But it now appears
that in this, as in other cases, the authority of the Pythagoreans was
claimed for the Copernican system. Antony a Wood quotes the latter
part of the title thus: “Cui subnectitur orbium Copernicarum accurata
descriptio;” which is inaccurate. Weidler, still more inaccurately, cites
it, “Cui subnectitur operum Copernici accurata descriptio.” Lalande
goes still further, attempting, it would seem, to recover the English
title-page from the Latin: we find in the Bibl. Astron. the following:
“1592 . . Leonard Digges, Accurate Description of the Copernican
System to the Astronomical perpetual Prognostication.”

Thomas Digges appears, by others also of his writings, to have

been 530 a clear and decided Copernican. In his “Alæ sive Scalæ
Mathematicæ,” 1573, he bestows high praise upon Copernicus and
upon his system: and appears to have been a believer in the real
motion of the Earth, and not merely an admirer of the system of
Copernicus as an explanatory hypothesis.

Giordano Bruno.

The complete title of the work referred to is:

“Jordani Bruni Nolani De Monade Numero et Figura liber
consequens Quinque De Minimo Magno et Mensura, item De
Innumerabilibus, Immenso et Infigurabili; seu De Universo et Mundis
libri octo. (Francofurti, 1591.)”

That the Reader may judge of the value of Bruno’s speculations, I

give the following quotations:

Lib. iv. c. 11 (Index). “Tellurem totam habitabilem esse intus et

extra, et innumerabilia animantium complecti tum nobis sensibilium
tum occultorum genera.”

C. 13. “Ut Mundorum Synodi in Universo et particulares Mundi in

Synodis ordinentur,’ &c.

He says (Lib. v. c. 1, p. 461): “Besides the stars and the great

worlds there are smaller living creatures carried through the etherial
space, in the form of a small sphere which has the aspect of a bright
fire, and is by the vulgar regarded as a fiery beam. They are below
the clouds, and I saw one which seemed to touch the roofs of the
houses. Now this sphere, or beam as they call it, was really a living
creature (animal), which I once saw moving in a straight path, and
grazing as it were the roofs of the city of Nola, as if it were going to
impinge on Mount Cicada; which however it went over.”

There are two recent editions of the works of Giordano Bruno; by

Adolf Wagner, Leipsick, 1830, in two volumes; and by Gfrörer, Berlin,
1833. Of the latter I do not know that more than one volume (vol. ii.)
has appeared.

Did Francis Bacon reject the Copernican System?

Mr. De Morgan has very properly remarked (Comp. B. A. 1855,

p. 11) that the notice of the heliocentric question in the Novum
Organon must be considered one of the most important passages in
his works upon this point, as being probably the latest written and
best 531 matured. It occurs in Lib. ii. Aphorism xxxvi., in which he is
speaking of Prerogative Instances, of which he gives twenty-seven
species. In the passage now referred to, he is speaking of a kind of
Prerogative Instances, better known to ordinary readers than most of
the kinds by name, the Instantia Crucis: though probably the
metaphor from which this name is derived is commonly wrongly
apprehended. Bacon’s meaning is Guide-Post Instances: and the
Crux which he alludes to is not a Cross, but a Guide-Post at Cross-
roads. And among the cases to which such Instances may be
applied, he mentions the diurnal motion of the heavens from east to
west, and the special motion of the particular heavenly bodies from
west to east. And he suggests what he conceives may be an
Instantia Crucis in each case. If, he says, we find any motion from
east to west in the bodies which surround the earth, slow in the
ocean, quicker in the air, quicker still in comets, gradually quicker in
planets according to their greater distance from the earth: then we
may suppose that there is a cosmical diurnal motion, and the motion
of the earth must be denied.

With regard to the special motions of the heavenly bodies, he first

remarks that each body not coming quite so far westwards as
before, after one revolution of the heavens, and going to the north or
the south, does not imply any special motion; since it may be
accounted for by a modification of the diurnal motion in each, which
produces a defect of the return, and a spiral path; and he says that if
we look at the matter as common people 30 and disregard the
devices of astronomers, the motion is really so to the senses; and
that he has made an imitation of it by means of wires. The instantia
crucis which he here suggests is, to see if we can find in any credible
history an account of any comet which did not share in the diurnal
revolution of the skies.
30 Et certissimum est si paulisper pro plebeiis nos geramus
(missis astronomorum et scholæ commentis, quibus illud in more
est, ut sensui in multis immerito vim faciant et obscuriora malint)
talem esse motum istum ad sensum qualem diximus.

On his assertion that the motion of each separate planet is, to

sense, a spiral, we may remark that it is certainly true; but that the
business of science, here, as elsewhere, consists in resolving the
complex phenomenon into simple phenomena; the complex spiral
motion into simple circular motions.

With regard to the diurnal motion of the earth, it would seem as if

Bacon himself had a leaning to believe it when he wrote this
passage; for neither is he himself, nor are any of the
Anticopernicans, 532 accustomed to assert that the immensely rapid
motion of the sphere of the Fixed Stars graduates by a slower and
slower motion of Planets, Comets, Air, and Ocean, into the
immobility of the Earth. So that the conditions are not satisfied on
which he hypothetically says, “tum abnegandus est motus terræ.”

With regard to the proper motions of the planets, this passage

seems to me to confirm what I have already said of him; that he does
not appear to have seen the full value and meaning of what had
been done, up to his time, in Formal Astronomy.

We may however fully agree with Mr. De Morgan; that the whole of
what he has said on this subject, when put together, does not justify
Hume’s assertion that he rejected the Copernican system “with the
most positive disdain.”
 Mr. De Morgan, in order to balance the Copernican argument
derived from the immense velocity of the stars in their diurnal
velocity on the other supposition, has reminded us that those who
reject this great velocity as improbable, accept without scruple the
greater velocity of light. It is curious that Bacon also has made this
comparison, though using it for a different purpose; namely, to show
that the transmission of the visual impression may be instantaneous.
In Aphorism xlvi. of Book ii. of the Novum Organon he is speaking of
what he calls Instantiæ curriculi, or Instantiæ ad aquam, which we
may call Instances by the clock: and he says that the great velocity
of the diurnal sphere makes the marvellous velocity of the rays of
light more credible.

“Immensa illa velocitas in ipso corpore, quæ cernitur in motu

diurno (quæ etiam viros graves ita obstupefecit ut mallent credere
motum terræ), facit motum illum ejaculationis ab ipsis [stellis] (licet
celeritate ut diximus admirabilem) magis credibilem.” This passage
shows an inclination towards the opinion of the earth’s being at rest,
but not a very strong conviction.

Kepler persecuted.

We have seen (p. 280) that Kepler writes to Galileo in 1597—“Be

trustful and go forwards. If Italy is not a convenient place for the
publication of your views, and if you are likely to meet with any
obstacles, perhaps Germany will grant us the necessary liberty.”
Kepler however had soon afterwards occasion to learn that in
Germany also, the cultivators of science were exposed to
persecution. It is true that 533 in his case the persecution went
mainly on the broad ground of his being a Protestant, and extended
to great numbers of persons at that time. The circumstances of this
and other portions of Kepler’s life have been brought to light only
recently through an examination of public documents in the Archives
of Würtemberg and unpublished letters of Kepler. (Johann Keppler’s
Leben und Wirken, nach neuerlich aufgefundenen Manuscripten
bearbeitet von J. L. C. Freiherrn v. Breitschwart, K. Würtemberg.
Staats-Rath. Stuttgart, 1831.)

Schiller, in his History of the Thirty Years’ War, says that when
Ferdinand of Austria succeeded to the Archduchy of Stiria, and
found a great number of Protestants among his subjects, he
suppressed their public worship without cruelty and almost without
noise. But it appears now that the Protestants were treated with
great severity. Kepler held a professorship in Stiria, and had married,
in 1507, Barbara Müller, who had landed property in that province.
On the 11th of June, 1598, he writes to his friend Mæstlin that the
arrival of the Prince out of Italy is looked forwards to with terror. In
December he writes that the Protestants had irritated the Catholics
by attacks from the pulpit and by caricatures; that hereupon the
Prince, at the prayer of the Estates, had declared the Letter of
License granted by his father to be forfeited, and had ordered all the
Evangelical Teachers to leave the country on pain of death. They
went to the frontiers of Hungary and Croatia; but after a month,
Kepler was allowed to return, on condition of keeping quiet. His
discoveries appear to have operated in his favor. But the next year
he found his situation in Stiria intolerable, and longed to return to his
native country of Würtemberg, and to find some position there. This
he did not obtain. He wrote a circular letter to his Brother
Protestants, to give them consolation and courage; and this was held
to be a violation of the conditions on which his residence was
tolerated. Fortunately, at this time he was invited to join Tycho Brahe,
who had also been driven from his native country, and was living at
Prague. The two astronomers worked together under the patronage
of the Emperor Rudolph II.; and when Tycho died in 1601, Kepler
became the Imperial Mathematicus.

We are not to imagine that even among Protestants, astronomical

notions were out of the sphere of religious considerations. When
Kepler was established in Stiria, his first official business was the
calculation of the Calendar for the Evangelical Community. They
protested against the new Calendar, as manifestly calculated for the
furtherance of an impious papistry: and, say they, “We hold the Pope
for a 534 horrible roaring Lion. If we take his Calendar, we must
needs go into the church when he rings us in.” Kepler however did
not fail to see, and to say, that the Papal Reformation of the
Calendar was a vast improvement.

Kepler, as court-astronomer, was of course required to provide

such observations of the heavens as were requisite for the
calculations of the Astrologers. That he considered Astrology to be
valuable only as the nurse of Astronomy, he did not hesitate to
reveal. He wrote a work with a title of which the following is the best
translation which I can give: “Tertius interveniens, or: A Warning to
certain Theologi, Medici, Philosophi, that while they reasonably
reject star-gazing superstition, they do not throw away the kernel
with the shell. 31 1610.” In this he says, “You over-clever
Philosophers blame this Daughter of Astronomy more than is
reasonable. Do you not know that she must maintain her mother with
her charms? How many men would be able to make Astronomy their
business, if men did not cherish the hope to read the Future in the
skies?”
 31 The German passage involves a curious image, borrowed, I
suppose, from some odd story: “dass sie mit billiger Verwerfung
des sternguckerischen Aberglaubens das Kind nicht mit dem
Bade ausschütten.” “That they do not throw away the child along
with the dirty water of his bath.”

Were the Papal Edicts against the Copernican System repealed?

Admiral Smyth, in his Cycle of Celestial Objects, vol. i. p. 65,

says—“At length, in 1818, the voice of truth was so prevailing that
Pius VII. repealed the edicts against the Copernican system, and
thus, in the emphatic words of Cardinal Toriozzi, ‘wiped off this
scandal from the Church.’”

A like story is referred to by Sir Francis Palgrave, in his

entertaining and instructive fiction, The Merchant and the Friar.

Having made inquiry of persons most likely to be well informed on

this subject, I have not been able to learn that there is any further
foundation for these statements than this: In 1818, on the revisal of
the Index Expurgatorius, Galileo’s writings were, after some
opposition, expunged from that Catalogue.

Monsignor Marino Marini, an eminent Roman Prelate, had

addressed to the Romana Accademia di Archeologia, certain
historico-critical Memoirs, which he published in 1850, with the title
Galileo e l’Inquisizione. In these, he confirms the conclusion which, I
think, almost 535 all persons who have studied the facts have arrived
at; 32 that Galileo trifled with authority to which he professed to
submit, and was punished for obstinate contumacy, not for heresy.
M. Marini renders full justice to Galileo’s ability, and does not at all
hesitate to regard his scientific attainments as among the glories of
Italy. He quotes, what Galileo himself quoted, an expression of
Cardinal Baronius, that “the intention of the Holy Spirit was to teach
how to go to heaven, not how heaven goes.” 33 He shows that
Galileo pleaded (p. 62) that he had not held the Copernican opinion
after it had been intimated to him (by Bellarmine in 1616), that he
was not to hold it; and that his breach of promise in this respect was
the cause of the proceedings against him.
32 M. Marini (p. 29) mentions Leibnitz, Guizot, Spittler, Eichhorn,
Raumer, Ranke, among the “storici eterodossi” who have at last
done justice to the Roman Church.

33 Come si vada al Cielo, e non come vada il Cielo.

Those who admire Galileo and regard him as a martyr because,

after escaping punishment by saying “It does not move,” he forthwith
said “And yet it does move,” will perhaps be interested to know that
the former answer was suggested to him by friends anxious for his
safety. Niccolini writes to Bali Cioli (April 9, 1633) that Galileo
continued to be so persuaded of the truth of his opinions that “he
was resolved (some moments before his sentence) to defend them
stoutly; but I (continues Niccolini) exhorted him to make an end of
this; not to mind defending them; and to submit himself to that which
he sees that they may desire him to believe or to hold about this
matter of the motion of the earth. He was extremely afflicted.” But the
Inquisition was satisfied with his answers, and required no more. 34
34 Marini, p. 61.
B O O K VI.

MECHANICS.
 CHAPTER III.

Principles and Problems.

Significance of Analytical Mechanics.

I N the text, page 372, I have stated that Lagrange, near the end of
his life, expressed his sorrow that the methods of approximation
employed in Physical Astronomy rested on arbitrary processes, and
not on any insight into the results of mechanical action. From the
recent biography of Gauss, the greatest physical mathematician of
modern times, we learn that he congratulated himself on having
escaped this error. He remarked 35 that many of the most celebrated
mathematicians, Euler very often, Lagrange sometimes, had trusted
too much to the symbolical calculation of their problems, and would
not have been able to give an account of the meaning of each
successive step of their investigation. He said that he himself, on the
other hand, could assert that at every step which he took, he always
had the aim and purpose of his operations before his eyes without
ever turning aside from the way. The same, he remarked, might be
said of Newton.
35 Gauss, Zum Gedächtniss, von W. Sartorius v. Waltershausen,
p. 80.

Engineering Mechanics.

The principles of the science of Mechanics were discovered by

observations made upon bodies within the reach of men; as we have
seen in speaking of the discoveries of Stevinus, Galileo, and others,
up to the time of Newton. And when there arose the controversy
about vis viva (Chap. v. Sect. 2 of this Book);—namely, whether the
“living force” of a body is measured by the product of the weight into
the 537 velocity, or of the weight into the square of the velocity;—still
the examples taken were cases of action in machines and the like
terrestrial objects. But Newton’s discoveries identified celestial with
terrestrial mechanics; and from that time the mechanical problems of
the heavens became more important and attractive to
mathematicians than the problems about earthly machines. And thus
the generalizations of the problems, principles, and methods of the
mathematical science of Mechanics from this period are principally
those which have reference to the motions of the heavenly bodies:
such as the Problem of Three Bodies, the Principles of the
Conservation of Areas, and of the Immovable Plane, the Method of
Variation of Parameters, and the like (Chap. vi. Sect. 7 and 14). And
the same is the case in the more recent progress of that subject, in
the hands of Gauss, Bessel, Hansen, and others.

But yet the science of Mechanics as applied to terrestrial

machines—Industrial Mechanics, as it has been termed—has made
some steps which it may be worth while to notice, even in a general
history of science. For the most part, all the most general laws of
mechanical action being already finally established, in the way which
we have had to narrate, the determination of the results and
conditions of any combination of materials and movements becomes
really a mathematical deduction from known principles. But such
deductions may be made much more easy and much more luminous
by the establishment of general terms and general propositions
suited to their special conditions. Among these I may mention a new
abstract term, introduced because a general mechanical principle
can be expressed by means of it, which has lately been much