NEET T 3 Question With Answer Key

Test Booklet Code
DATE: 05/05/2024
T3
NEET (UG)-2024
DURATION: 200 Minutes M.MARKS: 720
GENERAL INSTRUCTION
1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple-choice questions (four
options with a single correct answer) from Physics, Chemistry, and Biology (Botany and Zoology). 50
questions in each subject are divided into two sections (A and B) as per the details given below:
(a) Section A shall consist of 35 (thirty-five) Questions in each subject (questions no. – 1 to 35, 51 to 85,
101 to 135 and 151 to 185). All questions are compulsory.
(b) Section B shall consist of 15 (fifteen) questions in each subject (questions no. – 36 to 50, 86 to 100, 136
to 150 and 186 to 200). In section B, a candidate needs to attempt any 10 (Ten) questions out of 15
(Fifteen) in each subject.
Candidates are advised to read all 15 questions in each subject of Section-B before they start attempting
the question paper. In the event of a candidate attempting more than ten questions, the first ten questions
answered by the candidate shall be evaluated.
2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each
incorrect response, 1 mark will be deducted from the total scores. The maximum mark is 720.
3. Use a Blue/Black ballpoint Pen only for writing particulars on this page/marking responses on the Answer
Sheet.
4. Rough work is to be done in the space provided for this purpose in the Test Booklet only.
5. On completion of the test, the candidate must hand over the Answer Sheet (ORIGINAL and OFFICE Copy)
to the Invigilator before leaving the room/hall. The candidates are allowed to take away this Test Booklet
with them.
6. The CODE for this Booklet is T3.
7. The candidates should ensure that the Answer Sheet is not folded. Do not make any stray marks on the Answer
Sheet. Do not write your Roll No. anywhere else except in the specified space in the Test Booklet/Answer
Sheet. The use of white fluid for correction is NOT permissible on the Answer Sheet.
8. Each candidate must show on-demand his/her Admit Card to the Invigilator.
9. No candidate, without special permission of the Centre Superintendent or Invigilator, would leave his/her
seat.
10. Use of an Electronic/Manual Calculator is prohibited.
11. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in
the Examination Room/Hall. All cases of unfair means will be dealt with as per Rules and Regulations of this
examination.
12. No part of the Test Booklet and Answer Sheet shall be detached under any circumstances.
13. The candidates will write the Correct Test Booklet Code as given in the Test Booklet/Answer Sheet in the
Attendance Sheet.
[1]
NEET (UG)-2024 (Code-_T3__)
PHYSICS
SECTION – A Np 1
5. In an ideal transformer, the turns ratio is =.
1. A tightly wound 100 turns coil of radius 10 cm Ns 2
carries a current of 7 A. The magnitude of the The ratio Vs :Vp is equal to (the symbols carry their
magnetic field at the centre of the coil is (Take usual meaning):
permeability of free space as 4  10−7 SI units): (1) 1 : 1 (2) 1 : 4
(1) 4.4 mT (3) 1 : 2 (4) 2 : 1
(2) 44 T
(3) 44 mT 6. A logic circuit provides the output Y as per the
(4) 4.4 T following truth table:
A B Y
2. Math List-I with List-II.
List-I List-II 0 0 1
(Material) (Susceptibility (x)) 0 1 0
(A) Diamagnetic (I) x = 0 1 0 1
(B) Ferromagnetic (II) 0  x  −1 1 1 0
(C) Paramagnetic (III) x  1
(D) Non-magnetic (IV) 0  x   (a small (1) B (2) B
positive number) (3) A.B + A (4) A.B + A
Choose the correct answer from the options given
below: 7. In a vernier calipers, (N + 1) divisions of vernier
(1) A-III, B-II, C-I, D-IV scale coincide with N divisions of main scale. If 1
(2) A-IV, B-III, C-II, D-I MSD represents 0.1 mm, the vernier constant (in cm)
(3) A-II, B-III, C-IV, D-I
is:
(4) C-II, B-I, C-III, D-IV
(1) 100 N
3. A thermodynamic system is taken through the cycle (2) 10 (N + 1)
abcda. The work done by the gas along the path bc 1
(3)
is: 10N
1
(4)
100( N + 1)
8. The maximum elongation of a steel wire of 1 m

length if the elastic limit of steel and its Young’s
modulus, respectively, are 8 × 108 N m–2 and
2 × 1011 N m–2, is:
(1) –90 J (1) 40 mm (2) 8 mm
(2) –60 J (3) 4 mm (4) 0.4 mm
(3) zero
(4) 30 J 9. A horizontal force 10 N is applied to a block A as
shown in figure. The mass of blocks A and B are 2
4. An unipolar light beam strikes a glass surface at
kg and 3 kg, respectively. The blocks slide over a
Brewster’s angle. Then
frictionless surface. The force exerted by block A on
(1) both the reflected and refracted light will be
completely polarised. block B is:
(2) the reflected light will be completely polarised B
but the refracted light will be partially F = 10 N A
3 kg
polarised. 2 kg
(3) the reflected light will be partially polarised.
(4) the refracted light will be completely (1) 6 N (2) 10 N
polarised. (3) zero (4) 4 N
[2]
NEET (UG)-2024 (Code-_T3_)
10. If the monochromatic source in Young’s double slit 14. Consider the following statements A and B and
experiment is replaced by white light, then identify the correct answer :
(1) there will be a central bright white fringe
surrounded by a few coloured fringes.
(2) all bright fringes will be of equal width.
(3) interference pattern will disappear.
(4) there will be a central dear fringe surrounded
A. For a solar-cell, the I-V characteristics lies in
by a few coloured fringes. the IV quadrant of the given graph.
 1  B. In a reverse biaşed pn junction diode, the
11. The graph which shows the variation of    and
  current measured in (µA), is due to majority
its kinetic energy, E is (where  is de Broglie charge carriers.
(1) Both A and B are correct.
wavelength of a free particle):
(2) Both A and B are incorrect.
1 1 (3) A is correct but B is incorrect.
   (4) A is incorrect but B is correct.
(1) (2)
15. A light ray enters through a right angled prism at
O E O E o
point P with the angle of incidence 30 as shown in
1
figure. It travels through the prism parallel to its base

BC and emerges along the face AC. The refractive
(3) (4) index of the prism is:
O E
12. In the following circuit, the equivalent capacitance

between terminal A and terminal B is:
2F 2F
3 3
(1) (2)
A B
4 2
5 5
(3) (4)
4 2
2F 2F
16. Given below are two statements: one is labelled as
(1) 0.5 F Assertion A and the other is labelled as Reason R.
(2) 4 F Assertion A: The potential (V) at any axial point, at
(3) 2 F 2 m distance (r) from the centre of the dipole of
→
(4) 1 F dipole moment vector P of magnitude,
−6
4  10 C m , is 9  10 V .
3
13. 1
(Take = 9 109 SI units)
40
2P
Reason R: V =  , where r is the distance
40 r 2
In the above diagram, a strong bar magnet is moving of any axial point, situated at 2 m from the centre of
the dipole.
towards solenoid-2 from solenoid-1. The direction of
In the light of the above statements, choose the
induced current in solenoid-1 and that in solenoid-2, correct answer from the options given below:
respectively, are through the directions: (1) A is true but R is false.
(1) AB and CD (2) A is false but R is true.
(2) BA and DC (3) Both A and R are true and R is the correct
(3) AB and DC explanation of A.
(4) Both A and R are true and R is NOT the correct
(4) BA and CD
explanation of A.
[3]
17. The moment of inertia of a thin rod about an axis Choose the correct answer from the options given
passing through its mid point and perpendicular to below:
the rod, is 2400 g cm2. The length of the 400 g rod is
(1) A, C and D only
nearly:
(1) 20.7 cm (2) A, B, D and E only
(2) 72.0 cm (3) A and B only
(3) 8.5 cm (4) A, B, C and D only
(4) 17.5 cm
18. The terminal voltage of the battery, whose emf is 10  e +  e − −

21. 290
82 X ⎯⎯ →Y ⎯⎯ → Z ⎯⎯→ P ⎯⎯ →Q
V and internal resistance 1 , when connected
through an external resistance of 4  as shown in the In the nuclear emission stated above, the mass
figure is : number and atomic number of the product Q
respectively, are:
(1) 288, 82
(2) 286, 81
(3) 280, 81
(4) 286, 80
(1) 8V
(2) 10 V 22. At any instant of time t, the displacement of any
(3) 4V particle is given by 2t − 1 (SI unit) under the
(4) 6V influence of force of 5N. The value of instantaneous
power is (in SI unit):
19. Match the List-I with List-II.
(1) 7
List-I List-II
(2) 6
(Spectral Lines of (Wavelengths (nm))
(3) 10
Hydrogen for
(4) 5
transitions from)
(A) n2 = 3 to n1 = 2 I. 410.2 23. The output (Y) of the given logic gate is similar to
(B) n2 = 4 to n1 = 2 II. 434.1 the output of an/a :
(C) n2 = 5 to n1 = 2 III. 656.3
(D) n2 = 6 to n1 = 2 IV. 486.1
below:
(1) OR gate
(1) A-IV, B-III, C-I, D-II (2) AND gate
(2) A-I, B-II, C-III, D-IV (3) NAND gate
(3) A-II, B-I, C-IV, D-III (4) NOR gate
(4) A-III, B-IV, C-II, D-I
1
24. The mass of a planet is th that of the earth and its
20. If c is the velocity of light in free space, the correct 10
statements about photon among the following are : diameter is half that of the earth. The acceleration
A. The energy of a photon is E = hv. due to gravity on that planet is :
B. The velocity of a photon is c. (1) 4.9 m s −2
hv (2) 3.92 m s −2
C. The momentum of a photon, p = .
c (3) 19.6 m s −2
D. In a photon-electron collision, both total energy
(4) 9.8 m s−2
and total momentum are conserved.
E. Photon possesses positive charge.
[4]
25. Given below are two statements :

Statement I: Atoms are electrically neutral as they
contain equal number of positive and negative
charges.
Statement II: Atoms of each element are stable and
emit their characteristic spectrum.
In the fight of the above statements, choose the most (1) 50 
appropriate answer from the options given below : (2) 1280 
(1) Statement I is correct but Statement II is (3) 5 
incorrect. (4) 128 
(2) Statement I is incorrect but Statement II is
correct. 30. Two bodies A and B of same mass undergo
(3) Both Statement I and Statement II are correct. completely inelastic one dimensional collision. The
(4) Both Statement I and Statement II are incorrect. body A moves with velocity v1 while body B is at
rest before collision. The velocity of the system after
26. A wheel of a bullock cart is rolling on a level road as collision is v2. The ratio v1 : v2 is;
shows in the figure below. If its linerar speed is v in (1) 4 : 1 (2) 1 : 4
the direction shown, which one of the following (3) 1 : 2 (4) 2 : 1
options is correct (P and Q are any highest and
lowest points on the wheel respectively)?
 
31. If x = 5sin  t +  m represents the motion of a
 3
particle execting simple harmonic motion, the
amplitude and time period of motion, respectively,
are;
(1) 5 cm, 1 s (2) 5 m, 1 s
(3) 5 cm, 2 s (4) 5 m, 2 s
(1) Both the points P and Q move with equal speed.
(2) Point P has zero speed. 32. The quantities which have the same dimensions as
(3) Point P moves slower than point Q. those of solid angle are;
(4) Point P moves faster than point Q. (1) strain and arc
(2) angular speed and stress
27. A particle moving with uniform speed in a circular (3) strain and angle
path maintains; (4) stress and angle
(1) constant velocity but varying acceleration.
(2) varying velocity and varying acceleration. 33. A thin spherical shell is charged by some source. The
(3) constant velocity. potential difference between the two points C and P
(4) constant acceleration. (in V) shown in the figure is;
 1 
28. A thin flat circular disc of radius 4.5 cm is placed  Take = 9109 SI units 
 40 
gently over the surface of water. If surface tension of
water is 0.07 Nm–1, then the excess force required to
take it away from the surface is;
(1) 1.98 mN (2) 99 N
(3) 19.8 mN (4) 198 N
29. In a uniform magnetic field of 0.049 T, a magnetic

needle performs 20 complete oscillations in 5
seconds as shown. The moment of inertia of the (1) 0.5 × 105
needle is 9.8 × 10–6 kg m2. If the magnitude of (2) zero
magnetic moment of the needle is x × 10–5 Am2, then (3) 3 × 105
the value of ‘x’ is; (4) 1 × 105
[5]
34. A bob is whirled in a horizontal plane by means of a 38. The property which is not of an electromagnetic
string with an initial speed of ω rpm. The tension in wave travelling in free space is that;
the string is T. If speed becomes 2 ω white keeping 1
(1) they travel with a speed equal to
the same radius, the tension in the string becomes; 0 0
T (2) they originate from charges moving with
(1)
4 uniform speed.
(3) they are transverse in nature.
(2) 2T
(4) they energy density in electric field is equal to
(3) T energy density in magnetic field.
(4) 4T
39. Choose the correct circuit which can achieve the
35. A wire of length ‘l’ and resistance 100 Ω is divided bridge balance.
into 10 equal parts. The first 5 parts are connected in
series while the next 5 parts are connected in parallel.
The two combinations are again connected in series.
The resistance of this final combination is; (1)
(1) 55 Ω
(2) 60 Ω
(3) 26 Ω
(4) 52 Ω
SECTION-B
36. The following graph represents the T-V curves of an (2)
ideal gas (where T is the temperature and V the
volume) at three pressures P1, P2 and P3 compared
with those of Charles’s law represented as dotted
lines.
(3)
(1) P2 > P1 > P3

(4)
(2) P1 > P2 > P3
(3) P3 > P2 > P1
(4) P1 > P3 > P2
40. If the plates of a parallel plate capacitor connected to

37. A parallel plate capacitor is charged by connecting it
a battery are moved close to each other, then
to a battery through a resistor. If I is the current in
A. the charge stored in it, increase.
the circuit, then in the gap between the plates; B. the energy stored in it, decreases.
(1) displacement current of magnitude equal to I C. its capacitance increases.
flows m a direction opposite to that of I. D. the ratio of charge to its potential remains the
(2) displacement current of magnitude greater than same.
I flows but can be in any direction. E. the product of charge and voltage increases.
(3) there is no current. Choose the most appropriate answer from the
(4) displacement current of magnitude equal to I options given below:
(1) B, D and E only (2) A, B and C only
flows in the same direction as I.
[6]
(3) A, B and E only (4) A, C and E only

41. A force defined by F= αt2+βt acts on a particle at a 47. The velocity (v) –time (t) plot of the motion of a body
given time t. The factor which is dimensionless, if α is shown below:
and β are constants, is:

(1) αβt (2)
t
t
(3) (4) t
 
The acceleration (a) –time (t) graph that best suits
42. A metallic bar of Young’s modulus, 0.5 ×10 11
N this motion is:
m–2 and coefficient of linear thermal expansion
10–5 °C–1 length 1 m and area of cross-section 10–
3 2
m is heated from 0°C to 100°C without expansion (1)
or bending. The compressive force developed in it is:
(1) 100 × 103 N (2) 2 × 103 N
(3) 52 × 103 N (4) 50 × 103 N??
43. A small telescope has an objective of focal length (2)

140 cm and an eye piece of focal length 5.0 cm. The
magnifying power of telescope for viewing a distant
object is:
(1) 17 (2) 32
(3) 34 (4) 28
(3)
44. An iron bar of length L has magnetic moment M. It
is bent at the middle of its length such that the two
arms make an angle 60° with each other. The
magnetic moment of this new magnet is:
(4)
(1) 2 M (2) M
3
M
(3) M (4)
2 48. If the mass of the bob in s simple pendulum is
increased to thrice its original mass and its length is
45. A 10 μF capacitor is connected to a 210 V, 50 Hz
source as shown in figure. The peak current in the made half its original length, then the new time
circuit is nearly (π = 3.14): period of oscillation is
x
times its original time
2
period. Then the value of x is:
(1) 2 3
(2) 4
(3) 3
(4) 2
(1) 1.20 A
(2) 0.35 A
(3) 0.58 A 49. The minimum energy required to launch a satellite
(4) 0.93 A of mass m from the surface of earth of mass M and
radius R in a circular orbit at an altitude of 2R from
46. Two heaters A and B have power rating of 1 kW and the surface of the earth is:
2kW, respectively. Those two are first connected in GmM GmM
(1) (2)
series and then in parallel to a fixed power source. 2R 3R
The ratio of power outputs for these two cases is: 5GmM 2GmM
(1) 1 : 2 (2) 2 : 3 (3) (4)
6R 3R
(3) 1 : 1 (4) 2 : 9
[7]
Choose the correct statement(s) from the options

50. A sheet is placed on a horizontal surface in front of given below:
a strong magnetic pole. A force is needed to: (1) A, C and D only
A. hold the sheet there if it is magnetic. (2) C only
B. hold the sheet there if it non–magnetic. (3) B and D only
C. move the sheet away from the pole with (4) A and C only
uniform velocity if it is conducting.
D. move the sheet away from the pole with
uniform velocity if it is both, non-conducting
and non-polar.
CHEMISTRY
SECTION – A
54. Fehling’s solution ‘A’ is
51. Match List-I with List-II. (1) alkaline solution of sodium potassium tartrate
List-I List-II (Rochelle’s salt)
(Conversion) (Number of (2) aqueous sodium citrate
Faraday (3) aqueous copper sulphate
required) (4) alkaline copper sulphate
A. 1 mol of H2O to I. 3F
O2 55. 1 gram of sodium hydroxide was treated with 25 mL
B. 1 mol of MnO– II.
4
2F of 0.75 M HCl solution, the mass of sodium
hydroxide left unreacted is equal to
to Mn2+
(1) Zero mg
C. 1.5 mol of Ca III. 1F
(2) 200 mg
from molten
(3) 750 mg
CaCl2
(4) 250 mg
D. 1 mol of FeO to IV. 5F
Fe2O3
56. Match List-I with List-II.
List-I List-II
below:
(Compound) (Shape/geometry)
(1) A-II, B-III, C-I, D-IV
A. NH3 I. Trigonal
(3) A-II, B-IV, C-I, D-III Pyramidal
(4) A-III, B-IV, C-I, D-II B. BrF5 II. Square Planar
C. XeF4 III. Octahedral
52. Which reaction is NOT a redox reaction?
(1) H2 + Cl2 → 2 HCl D. SF6 IV. Square Pyramidal
(2) BaCl2 + Na2SO4 → BaSO4 + 2 NaCl Choose the correct answer from the options given
(3) Zn + CuSO4 → ZnSO4 + Cu below:
(4) 2 KClO3 + I2 → 2 KIO3 + Cl2 (1) A-III, B-IV, C-I, D-II
53. Intramolecular hydrogen bonding is present in (3) A-I, B-IV, C-II, D-III
(4) A-II, B-IV, C-III, D-I
(1) (2) HF 57. The E° value for the Mn3+/Mn2+ couple is more
positive than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to
change of
(1) d4 to d5 configuration
(3) (4) . (3) d5 to d4 configuration
[8]
(3) Si < C < N < O < F

(4) Si < C < O < N < F
58. Match List-I with List-II. 63. Which one of the following alcohols reacts
List-I List-II instantaneously with Lucas reagent?
(Process) (Conditions)
A. Isothermal process I. No heat exchange (1) CH3 − CH − CH2OH
|
B. Isochoric process II. Carried out at
CH3
constant
temperature CH3
C. Isobaric process III. Carried out at |
(2) CH3 − C − OH
constant volume |
D. Adiabatic process IV. Carried out at CH3
constant pressure
(3) CH3 − CH2 − CH2 − CH2OH
below: (4) CH3 − CH2 − CH − OH
(1) A-I, B-II, C-III, D-IV |
(2) A-II, B-III, C-IV, D-I CH3
(3) A-IV, B-III, C-II, D-I
(4) A-IV, B-II, C-III, D-I 64. Given below are two statements:
3+ 3−
Statement I: Both Co ( NH3 )6  and CoF6 
59. Activation energy of any chemical reaction can be
calculated if one knows the value of complexes are octahedral but differ in their magnetic
(1) orientation of reactant molecules during behaviour.
3+
collision. Statement II: Co ( NH3 )6  is diamagnetic
(2) rate constant at two different temperatures. 3−
(3) rate constant at standard temperature. whereas CoF6  is paramagnetic.
(4) probability of collision. In the light of the above statements, choose the
correct answer from the options given below:
60. A compound with a molecular formula of C6H14 has (1) Statement I is true but Statement II is false.
two tertiary carbons. Its IUPAC name is: (2) Statement I is false but Statement II is true.
(1) 2,3-dimethylbutane
(3) Both Statement I and Statement II are true.
(2) 2,2-dimethylbutane
(3) n-hexane (4) Both Statement I and Statement II are false.
(4) 2-methylpentane
65. Given below are two statements:
61. ‘Spin only’ magnetic moment is same for which of Statement I : The boiling point of hydrides of Group
the following ions?
16 elements follow the order
A. Ti3+ B. Cr2+
C. Mn 2+
D. Fe2+ H2O > H2Te > H2Se > H2S.
E. Sc3+ Statement II : On the basis of molecular mass, H2O
Choose the most appropriate answer from the
is expected to have lower boiling point than the other
options given below:
(1) B and C only (2) A and D only members of the group but due to the presence of
(3) B and D only (4) A and E only extensive H-bonding in H2O, it has higher boiling
point.
62. Arrange the following elements in increasing order
of electronegativity: In the light of the above statements, choose the
N, O, F, C, Si correct answer from the options given below:
Choose the correct answer from the options given (1) Statement I is true but Statement II is false.
below: (2) Statement I is false but Statement II is true.
(1) O < F < N < C < Si (3) Both Statement I and Statement II are true.
(2) F < O < N < C < Si (4) Both Statement I and Statement II are false.
[9]
(2) (i) H2O/H+

(ii) PCC
66. Match List I with List II. (3) (i) H2O/H+
Lits I List II (ii) CrO3
Quantum Number Information provided (4) (i) BH3
A. ml I. shape of orbital
(ii)
B. ms II. size of orbital
C. l III. orientation of orbital (iii) PCC
D. n IV. orientation of spin
of electron 69. The reagents with which glucose does not react to
Choose the correct answer from the options given give the corresponding tests/products are
A. Tollen’s reagent
below:
B. Schiff’s reagent
C. HCN
(2) A-II, B-I, C-IV, D-III
D. NH2OH
(3) A-I, B-III, C-II, D-IV
E. NaHSO3
(4) A-III, B-IV, C-I, D-II
Choose the correct options from the given below:
(1) B and E
67. Match List I with List II.
(2) E and D
Lits I (Reaction) List II (Reagents/
(3) B and C
Condition)
(4) A and D
A. 70. Match List I with List II.

I.
Anhyd.AlCl3
List-I List-II
(Molecule) (Number and types of
B. bond/s between two
II. CrO3
carbon atoms)
C.
III. KMnO4/
A. ethane I. one -bonds and
KOH,  two -bonds
D. IV. (i) O3
B. ethene II. two -bonds
(ii) Zn-H2O C. carbon III. one -bond

molecule, C2
Choose the correct answer from the options given D. ethyne IV. one -bond and
below: one -bond
(1) A-IV, B-I, C-II, D-III
(2) A-I, B-IV, C-II, D-III
below:
(3) A-IV, B-I, C-III, D-II
(4) A-III, B-I, C-II, D-IV
(3) A-I, B-IV, C-II, D-III
68. Identify the correct reagents that would bring about
the following transformation.
71. Among Group 16 elements, which one does NOT
show –2 oxidation state?
(1) Te
(1) (i) BH3 (2) Po
(ii) (3) O
(iii) alk. KMnO4 (4) Se
(iv) H3O
[10]
72. For the reaction 2A ⇌ B + C, Kc = 4 × 10–3. At a 76. The compound that will undergo SN1 reaction with
given time, the composition of reaction mixture is: the fastest rate is
[A] = [B] = [C] = 2 × 10–3 M.
Then, which of the following is correct? (1)
(1) Reaction has a tendency to go in backward
direction.
(2) Reaction has gone to completion in forward
direction. (2)
(3) Reaction is at equilibrium.
(4) Reaction has a tendency to go in forward
direction. (3)
1 (4)
73. Which plot of ln k vs is consistent with Arrhenius
T
equation?
77. The energy of an electron in the ground state (n =1)
for He+ ion is –x J, then that for an electron in
(1) (2)
n = 2 state for Be3+ ion in J is:
(1) – 4x
4
(2) − x
(3) (4) 9
(3) – x
x
(4) −
9
74. In which of the following equilibria, Kp and Kc are
NOT equal?
78. In which of the following processes entropy
(1) CO(g) + H2O(g) ⇌ CO2(g) + H2(g) increases?
(2) 2 BrCl(g) ⇌ Br2(g) + Cl2(g) A. A liquid evaporates to vapour.
(3) PCl5(g) ⇌ PCl3(g) + Cl2(g) B. Temperature of a crystalline solid lowered from
(4) H2(g) + I2(g) ⇌ 2 HI(g) 130 K to 0 K.
C. 2NaHCO3(s) → Na 2CO3(s) + CO2(g) + H2O(g)
Statement I : The boiling point of three isomeric D. Cl2(g) → 2Cl(g)
pentanes follows the order. Choose the correct answer from the options given
n-pentane > isopentane > neopentane below:
Statement II : When branching increases, the (1) A, C and D
molecule attains a shape of sphere. This results in (2) C and D
smaller surface area for contact, due to which the (3) A and C
intermolecular forces between the spherical (4) A, B and D
molecules are weak, thereby lowering the boiling
point.
79. On heating some solid substance change from solid
In the light of the above statements, choose the most
to vapour state without passing through liquid state.
appropriate answer from the options given below:
The technique used for the purification of such solid
(1) Statement I is correct but Statement II is
substances based on the above principle is known as:
incorrect.
(1) Distillation
(2) Statement I is incorrect but Statement II is
correct. (2) Chromatography
(3) Both Statement I and Statement II are correct. (3) Crystallization
(4) Both Statement I and Statement II are incorrect. (4) Sublimation
[11]
80. Match List-I with List-II 84. The most stable carbocation among the following is:
List-I List-II
(1)
(Complex) (Type of isomerism)
A. [Co(NH3 )5 (NO2 )]Cl2 I. Solvate
isomerism
B. [Co(NH3 )5 (SO4 )]Br II. Linkage
(2)
isomerism
C. [Co(NH3 )6 ][Cr(CN)6 ] III. Ionization
isomerism (3)
D. [Co(H2O)6 ]Cl3 IV. Coordination
isomerism
(4)
below:
(1) A-I, B-IV, C-III, D-II
(2) A-II, B-IV, C-III, D-I 85. The Henry’s law constant (KH) values of three gases
(3) A-II, B-III, C-IV, D-I (A, B, C) in water are 145, 2  10–5 and 35 kbar,
(4) A-I, B-III, C-IV, D-II respectively. The solubility of these gases in water
follow the order:
81. Given below are two statements: (1) A > C > B
Statement I: Aniline does not undergo Friedel- (2) A > B > C
Crafts alkylation reaction. (3) B > A > C
Statement II: Aniline cannot be prepared through (4) B > C > A
Gabriel synthesis.
In the light of the above statements, choose the SECTION-B
correct answer from the options given below: 86. A compound X contains 32% of A, 20% of B and
(1) Statement I is correct but Statement II is false. remaining percentage of C. Then, the empirical
(2) Statement I is incorrect but Statement II is true. formula of X is:
(3) Both Statement I and Statement II are true. (Given atomic masses of A = 64; B = 40; C = 32u)
(4) Both Statement I and Statement II are false. (1) AB2C2 (2) ABC4
(3) A2BC2 (4) ABC3
82. Arrange the following elements in increasing order
87. The products A and B obtained in the following
of first ionization enthalpy:
reactions, respectively, are
Li, Be, B, C, N
3ROH + PCl3 → 3RCl + A
Choose the correct answer from options given
ROH + PCl5 → RCl + HCl + B
below:
(1) H3PO4 and POCl3
(1) Li < Be < C < B < N
(2) H3PO3 and POCl3
(2) Li < Be < N < B < C
(3) POCl3 and H3PO3
(3) Li < Be < B < C < N
(4) POCl3 and H3PO4
(4) Li < B < Be < C < N
88. The plot of osmotic pressure () vs concentration
83. The highest number of helium atoms is in (mol L–1) for a solution gives a straight line with
(1) 4 g of helium slope 25.73 L bar mol–1. The temperature at which
(2) 2.271098 L of helium at STP the osmotic pressure measurement is done is:
(3) 4 mol of helium (Use R = 0.083 L bar mol–1 K–1)
(4) 4 u of helium (1) 25.73ºC (2) 12.05ºC
(3) 37ºC (4) 310ºC
[12]
89. For the given reaction: 93. Given below are certain cations. Using inorganic
qualitative analysis, arrange them in increasing
group number from 0 to VI.
A. Al3+ B. Cu2+
C. Ba2+ D. Co2+
‘P’ is E. Mg2+
Choose the correct answer from the option given
(1) below:
(1) E, C, D, B, A
(2) E, A, B, C, D
(2)
(3) B, A, D, C, E
(3) (4) B, C, A, D, E
(4)
94. Identify the major product C formed in the following
reaction sequence:
NaCN
90. Given below are two statements: CH3 − CH2 − CH2 − I ⎯⎯⎯→ A
Statement I: Co(NH3 )6 3+ is a homoleptic
⎯⎯⎯⎯⎯⎯→OH − NaOH
B ⎯⎯⎯→ C
Partial hydrolysis Br
+ (major)
complex whereas Co(NH3 )4 Cl2 
2
is a heteroleptic
(1) butanamide
complex. (2) -bromobutanoic acid
3+
Statement II: Complex Co(NH3 )6  has only (3) propylamine
+
one kind of ligands but Co(NH3 )4 Cl2  has more
(4) butylamine
than one kind of ligands. 95. The rate of a reaction quadruples when temperature
In the light of the above statements, choose the changes from 27ºC to 57ºC. Calculate the energy of
correct answer from the options given below: activation.
(1) Statement I is true but Statement II is false. Given R = 8.314 J K–1 mol–1, log 4 = 0.6021
(2) Statement I is false but Statement II is true.
(1) 3.80 kJ/mol
(4) Both Statement I and Statement II are false. (2) 3804 kJ/mol
(3) 38.04 kJ/mol
91. During the preparation of Mohr’s salt solution
(4) 380.4 kJ/mol
(Ferrous ammonium sulphate), which of the
following acid is added to prevent hydrolysis of Fe2+
ion? 96. Consider the following reaction in a sealed vessel at
(1) dilute nitric acid equilibrium with concentrations of
(2) dilute sulphuric acid N2 = 3.0 × 10–3 M, O2 = 4.2×10–3 M and NO =
(3) dilute hydrochloric acid 2.8×10–3 M.
(4) concentrated sulphuric acid 2NO(g) ⇌ N2(g) + O2(g)
If 0.1 mol L–1 of NO(g) is taken in a closed vessel,
92. Identify the correct answer. what will be degree of dissociation () of NO(g) at
(1) Dipole moment of NF3 is greater than that of equilibrium?
NH3. (1) 0.8889
(2) Three canonical forms can be drawn for (2) 0.717
CO32− ion. (3) 0.00889
(3) Three resonance structures can be drawn for (4) 0.0889
ozone.
(4) BF3 has non-zero dipole moment.
[13]
97. The work done during reversible isothermal

expansion of one mole of hydrogen gas at 25ºC from
pressure of 20 atmosphere to 10 atmosphere is: (1)
(Given R = 2.0 cal K–1mol–1)
(1) 413.14 calories
(2) 100 calories
(3) 0 calorie (2)
(4) – 413.14 calories
98. Mass in grams of copper deposited by passing

9.6487 A current through a voltmeter containing (3)
copper sulphate solution for 100 seconds is:
(Given: Molar mass of Cu : 63 g mol–1, 1F = 96487 C)
(1) 31.5 g
(4)
(2) 0.0315 g
(3) 3.15 g
(4) 0.315 g 100. The pair of lanthanoid ions which are diamagnetic is
(1) Gd3+ and Eu3+
99. Major products A and B formed in the following (2) Pm3+ and Sm3+
reaction sequence, are (3) Ce4+ and Yb2+
(4) Ce3+ and Eu2+
BOTANY
SECTION – A 102. The type of conservation in which the threatened
species are taken out from their natural habitat and
101. Identify the set of correct statements:
placed in special setting where they can be protected
A. The flowers of Vallisneria are colourful and
and given special care is called;
produce nectar
(1) Semi-conservative method
B. The flowers of waterlily are not pollinated by
(2) Sustainable development
water.
(3) in-situ conservation
C. In most of water-pollinated species, the pollen
(4) Biodiversity conservation
grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and 103. Inhibition of Succinic dehydrogenase enzyme by
ribbon like. malonate is a classical example of:
E. In some hydrophytes, the pollen grains are (1) Competitive inhibition
carried passively inside water. (2) Enzyme activation
Choose the correct answer from the options given (3) Cofactor inhibition
below: (4) Feedback inhibition
(1) A, C, D and E only
(2) B, C, D and E only
(3) C, D and E only
(4) A B, C and D only
[14]
104. Identify the part of the seed from the given figure Choose the correct answer from the options given
which is destined to form root when the seed below:
germinates. (1) A, B and E only
(2) A, B and D only
(4) A and B only
110. Which one of the following is not a criterion for

(1) C (2) D classification of fungi?
(3) A (4) B (1) Mode of spore formation
(2) Fruiting body
105. Bulliform cells are responsible for (3) Morphology of mycelium
(1) Increased photosynthesis in monocots. (4) Mode of nutrition
(2) Providing large spaces for storage of sugars.
(3) Inward curling of leaves in monocots.
111. How many molecules of ATP and NADPH are
(4) Protecting the plant from salt stress.
required for every molecule of CO2 fixed in the
106. Which of the following are required for the dark Calvin cycle?
reaction of photosynthesis? (1) 3 molecules of ATP and 3 molecules of
A. Light
NADPH
B. Chlorophyll
C. CO2 (2) 3 molecules of ATP and 2 molecules of
D. ATP NADPH
E. NADPH (3) 2 molecules of ATP and 3 molecuifes of
Choose the correct answer from the options given NADPH
below:
(4) 2 molecules of ATP and 2 molecules of
(1) C, D and E only
(2) D and E only NADPH
(3) A, B and C only
(4) B, C and D only 112. These are regarded as major causes of biodiversity
loss:
107. Formation of interfascicular cambium from fully A. Over exploitation
developed parenchyma cells is an example for
B. Co-extinction
(1) Dedifferentiation
(2) Maturation C. Mutation
(3) Differentiation D. Habitat loss and fragmentation
(4) Redifferentiation E. Migration
Choose the correct option:
108. Hind II always cuts DNA molecules at a particular
point called recognition sequence and it consists of: (1) A, B and E only
(1) 4 bp (2) 10 bp (2) A, B and D only
(3) 8 bp (4) 6 bp (3) A, C and D only
(4) A, B, C and D only
109. Tropical regions show greatest level of species
richness because 113. The capacity to generate a whole plant from any cell
A. Tropical latitudes have remained relatively
of the plant is called:
undisturbed for milions of years, hence more
time was available for species diversification. (1) Differentiation
B. Tropical environments are more seasonal. (2) Somatic hybridization
C. More solar energy is available in tropics. (3) Totipotency
D. Constant environments promote niche
(4) Micropropagation
specialization.
E. Tropical environments are constant and
predictable.
[15]
114. The equation of Verhulst-Pearl logistic growth is (1) Only pink flowered plants
dN K − N (2) Red, Pink as well as white flowered plants
= rN  .
dt  K  (3) Only red flowered plants
From this equation, K indicates: (4) Red flowered as well as pink flowered plants
(1) Carrying capacity
(2) Population density 120. Match List I with List II
(3) Intrinsic rate of natural increase List I List II
(4) Biotic potential A. Two or more I. Back cross
alternative forms of a
115. Spindle fibers attach to kinetochores of gene
chromosomes during
B. Cross of F1 progeny II. Ploidy
(1) Anaphase
with homozygous
(2) Telophase
recessive parent
(3) Prophase
(4) Metaphase C. Cross of F1 progeny III. Allele
with any of the parents
116. Identify the type of flowers based on the position of D. Number of IV. Test cross
calyx, corolla and androecifum with respect to the chromosome sets in
ovary from the given figures (a) and (b) plant
below:
(3) A-I, B-II, C-III, D-IV
(4) A-II, B-I, C-III, D-IV
(1) (a) Perigynous; (b) Epigynous
121. Lecithin, a small molecular weight organic
(2) (a) Perigynous; (b) Perigynous
(3) (a) Epigynous; (b) Hypogynous compound found in living tissues, is an example of:
(4) (a) Hypogynous; (b) Epigynous (1) Glycerides
(2) Carbohydrates
117. Match List I with List II (3) Amino acids
List I List II (4) Phospholipids
A. Rhizopus I. Mushroom
B. Ustilago II. Smut fungus 122. Match List I with List II
C. Puccinia III. Bread mould List I List II
D. Agaricus IV. Rust fungus A. Clostridium I. Ethanol
Choose the correct answer from the options given butylicum
below: B. Saccharomyces II. Streptokinase
(1) A-III, B-II, C-I, D-IV cerevisiae
(2) A-IV, B-III, C-II, D-I C. Trichoderma III. Butyric acid
(3) A-III, B-II, C-IV, D-I polysporum
(4) A-I, B-III, C-II, D-IV D. Streptococcus IV. Cyclosporin-A
sp.
118. In a plant, black seed color (BB/Bb) is dominant over Choose the correct answer from the options given
white seed color (bb). In order to find out the
below:
genotype of the black seed plant, with which of the
(1) A-III, B-I, C-IV, D-II
following genotype will you cross it?
(2) A-IV, B-I, C-III, D-II
(1) Bb (2) BB/Bb
(3) BB (4) bb
119. A pink flowered Snapdragon plant was crossed with
a red flowered Snapdragon plant. What type of
phenotype/s is/are expected in the progeny?
[16]
123. In the given figure, which component has thin outer 128. The cofactor of the enzyme carboxypeptidase is:
walls and highly thickened inner walls (1) Flavin (2) Haem
(3) Zinc (4) Niacin
129. The lactose present in the growth medium of bacteria

is transported to the cell by the action of
(1) Permease
(1) A (2) B (2) Polymerase
(3) C (4) D (3) Beta-galactosidase
(4) Acetylase
124. Which of the following is an example of
actinomorphic flower? 130. Which one of the following can be explained on the
(1) Pisum (2) Sesbania basis of Mendel's Law of Dominance?
(3) Datura (4) Cassia A. Out of one pair of factors one is dominant and
the other is recessive.
125. A transcription unit in DNA is defined primarily by B. Alleles do not show any expression and both
the three regions in DNA and these are with respect the characters appear as such in F2 generation.
to upstream and down stream end; C. Factors occur in pair in normal diploid plants.
(1) Inducer, Repressor, Structural gene D. The discrete unit controlling a particular
(2) Promotor, Structural gene, Terminator character is called factor.
(3) Repressor, Operator gene, Structural gene E. The expression of only one of the parental
(4) Structural gene, Transposons, Operator gene characters is found in a monohybrid cross.
below:
126. What is the fate of piece of DNA carrying only gene
(1) B, C and D only (2) A, B, C, D and E
of interest which is transferred into an alien
(3) A, B and C only (4) A, C, D and E only
organism?
A. The piece of DNA would be able to multiply
itself independently in the progeny cells of the Statement I: Bt toxins are insect group specific and
organisms. coded by a gene cry IAc.
B. It may get generated into the genome of the Statement II: Bt toxin exists as inactive protoxin in
recipient. B. thuringienis. However, after ingestion by the
C. It may multiply and be inherited along with the insect the inactive protoxin gets converted into
host DNA. active form due to acidic pH of the insect gut.
D. The alien piece of DNA is not an integrated In the light of the above statements, choose the
part of chromosome. correct answer from the options given below:
E. It shows ability to replicate. (1) Statement I is true but Statement II is false.
Choose the correct answer from the options given (2) Statement I is false but Statement II is true.
below: (3) Both Statement I and Statement II are true.
(1) B and C only (4) Both Statement I and Statement II are false.
(2) A and E only
(3) A and B only 132. Given below are two statements:
(4) D and E only Statement I: Parenchyma is living but collenchyma
is dead tissue.
127. Auxin is used by gardeners to prepare weed free Statement II: Gymnosperms lack xylem vessels but
lawns. But no damage is caused to grass as auxin; presence of xylem vessels is the characteristic of
angiosperms.
(1) does not affect mature monocotyledonous
plants.
(2) can help in cell division in grasses, to produce
(1) Statement I is true but Statement II is false.
growth.
(3) promotes apical dominance. (3) Both Statement I and Statement II are true.
(4) promotes abscission of mature leaves only. (4) Both Statement I and Statement II are false
[17]
133. Given below are two Statements: 137. Which of the following are fused in somatic
Statement I : Chromomes become gradually visible hybridization involving two varieties of plants?
under light microscope during leptotene stage. (1) Protoplsats (2) Pollens
Statement II: The begining of diplotene stage is (3) Callus (4) Somatic embryos
recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the 138. Identify the correct description about the given
correct answer from the options given below: figure:
(4) Both Statement I and Statement II are false
134. Match List-I with List-II.

List-I List-II (1) Cleistogamous flowers showing autogamy.
(2) Compact inflorescence showing complete
autogamy.
(A) Nucleolus (I) Site of
(3) Wind pollinated plant inflorescence showing
formation of
flowers with well exposed stamens.
glycolipid
(4) Water pollinated flowers showing stamens
(B) Centriole (II) Organization with mucilaginous covering.
like the
cartwheel 139. Spraying sugarcane crop with which of the following
plant growth regulators, increases the length of stem,
(C) Leucoplasts (III) Site for active thus, increasing the yield?
ribosomal RNA (1) Cytokinin (2) Abscisic acid
synthesis (3) Auxin (4) Gibberellin
(D) Golgi apparatus (IV) For storing 140. Match List-I with List-II.
nutrients
List-I List-II
below (A) Frederick (I) Genetic code
(1) A-III, B-IV, C-II, D-I Griffith
(B) Francois (II) Semi-conservative
(3) A-III, B-II, C-IV, D-I
Jacob & mode of DNA
Jacque replication
Monod
135. List of endangered spb&ies was released by-:
(1) Foam (C) Har (III) Transformation
(2) IUCN Gobind
(3) GEAC Khorana
(4) WWF
(D) Meselson (IV) Lac operson
SECTION-B & Stahl
136. The DNA present in chloroplast is: Choose the correct answer from the options given
(1) Linear, single stranded below
(2) Circular, single stranded (1) A-II, B-III, C-IV, D-I
(3) Linear, double stranded (2) A-IV, B-I, C-II, D-III
(4) Circular, double stranded (3) A-III, B-II, C-I, D-IV
[18]
141. Match List-I with List-II. Choose the correct answer from the options given
below.
List-I List-II
(A) GLUT-4 (I) Hormone (2) A-IV, B-III, C-II, D-I
(B) Insulin (II) Enzyme (4) A-II, B-I, C-IV, D-III
(C) Trypsin (III) Intercellular ground 145. Which of the following statement is correct
substances
regarding the process of replication in E.coli ?
(D) Collagen (IV) Enables glucose (1) The DNA dependent DNA polymerase
transport into cell. catalyses polymerization in 5’→3’ as well as
3’→5’ direction.
(2) The DNA dependent DNA polymerase
below
catalyses polymerization in 5’→3’ direction.
(3) The DNA dependent DNA polymerase
catalyses polymerization in one direction,
that is 3’→5’.
(4) The DNA dependent RNA polymerase
catalyase polymerization in one direction, that
is 5’→3’.
Statement I : In C3 Plants, some O2 binds RuBisCO,
hence CO2 fixation is decreased.
146. In an ecosystem if the Net Primary Productivity
Statement II: In C4 plants, mesophyll cells show
(NPP) of first trophic level is:
( )
very little photorespiration while bundle sheath cells
100x kcalm−2 yr−1 what would be the GPP (Gross
do not show photorespiration.
In the light of the above statements, choose the Primary Productivity) of the third trophic level of the
correct answer from the options given below: same ecosystem?
(1) Statement I is true but Statement II is false. (
(1) 10x kcalm−2 yr−1 )
100x
(3) Both Statement I and Statement II are true. (2)
3x
(
kcalm−2 yr−1 )
(4) Both Statement I and Statement II are false
x
143. Identify the step in tricarboxylic acid cycle, which
(3)
10
(
kcalm−2 yr −1 )
does not involve oxidation of substrate. (4) x ( kcalm−2 ) yr−1
(1) Succinyl-CoA → Succinic acid
(2) Isocitrate → α -ketoglutaric acid
(3) Malic acid → Oxaloacetic acid 147. Match List-I with List-II.
(4) Succinic acid → Malic acid List-I List-II
144. Match List-I with List-II. (A) Rose (I) Twisted

aestivation
List-I List-II
(B) Pea (II) Perigynous flower
(A) Citric acid (I) Cytoplasm
cycle (C) Cotton (III) Drupe
(B) Glycolysis (II) Mitochondrial (D) Mango (IV) Marginal

matrix placentation
(C) Electron (III) Intermembrane Choose the correct answer from the options given
transport space of below
system mitochondria (1) A-IV, B-III, C-II, D-I
(D) Proton (IV) Inner mitochondrial
(3) A-II, B-IV, C-I, D-III
gradient membrane
[19]
148. Match List-I with List-II. Choose the correct answer from the options given
below
List-I List-II
(1) A-I, B-II, C-IV, D-III
(A) Robert May (I) Species area (2) A-III, B-I, C-IV, D-II
relationship (3) A-IV, B-II, C-I, D-III
(B) Alexander (II) Long term
von ecosystem
Humboldt experiment 150. Read the following statements and choose the set
using out door of correct statements.
plots In the members of Phaeophyceae.
A. Asexual reproduction occurs usually by
(C) Paul Ehrlich (III) Global species biflagellate zoospores.
diversity at B. Sexual reproduction is by oogamous method
about 7 million
only.
(D) David Tilman (IV) Rivet popper C. Stored food is in the form of carbohydrates
hypothesis which is either mannitol or laminarin
D. The major pigments found are chlorophyll a,
c and carotenoids and xanthophyll.
below
E. Vegetative cells have a cellulosic wall, usually
covered on the outside by gelatinous coating
of algin.
Choose the correct answer front the options given
(4) A-III, B-I, C-IV, D-II below:
149. Match List-I with List-II. (2) A, B, C and E only
List-I List-II (3) A, B, C and D only
(Types of stamen) (Example) (4) B, C, D and E only
(A) Monoadelphous (I) Citrus
(B) Diadelphous (II) Pea
(C) Polyadelphous (III) Lily
(D) Epiphyllous (IV) China-rose
ZOOLOGY
SECTION – A 152. Match List I with List II:
List I List II
151. Match List I with List II:
A. Non-medicated I. Multiload 375
List I List II
IUD
A. Typhoid I. Fungus
B. Copper releasing II. Progestonges
B. Leishmaniasis II. Nematode
IUD
C. Ringworm III. Protozoa
C. Hormone III. Lippes loop
D. Filariasis IV. Bacteria
releasing IUD
D. Implants IV. LNG-20
below:
below:
(4) A-IV, B-III, C-I, D-II
(4) A-I, B-III, C-IV, D-II
[20]
153. Given below are two statements: 158. Three type of muscles are given as a, b and c.
Statement I: The presence or absence of hymen is Identify the correct matching pair along with their
not a reliable indicator of virginity. location in human body.
Statement II: The hymen is torn during the first
coitus only.
(4) Both Statement I and Statement II are false.
154. In both sexes of cockroach, a pair of jointed Name of muscle/location

filamentous structures called anal cerci are present (1) (a) Skeletal - Biceps
on: (b) Involunatry - Intestine
(1) 8th and 9th segment (c) Smooth - Heart.
(2) 11th segment (2) (a) Involunatry - Nose tip
(3) 5th segment (b) Skeletal - Bone
(4) 10th segment (c) Cardiac - Heart.
(3) (a) Smooth - Toes
155. Match List I with List II: (b) Skeletal - Legs
List I List II (c) Cardiac - Heart.
A. Pons I. Provides (4) (a) Skeletal - Triceps
additional space
(b) Smooth - Stomach
for Neurons,
(c) Cardiac - Heart
regulates posture
and balance.
159. Following are the stages of cell division:
B. Hypothalamus II. Controls
A. Gap 2 phase
respiration and
B. Cytokinesis
gastric
secretions. C. Synthesis phase
C. Medulla III. Connects D. Karyokinesis
different regions E. Gap 1 phase
of the brain. Choose the correct sequence of stages from the
D. Cerebellum IV. Neuro secretory options given below:
cells (1) B-D-E-A-C
Choose the correct answer from the options given (2) E-C-A-D-B
below: (3) C-E-D-A-B
(1) A-I, B-III, C-II, D-IV (4) E-B-D-A-C
(3) A-II, B-III, C-I, D-IV 160. Which of the following are Autoimmune disorders?
(4) A-III, B-IV, C-II, D-I A. Myasthenia gravis
B. Rheumatoid arthritis
156. Which of the following is not a steroid hormone? C. Gout
(1) Progesterone (2) Glucagon D. Muscular dystrophy
(3) Cortisol (4) Testosterone E. Systemic Lupus Erythematosus (SLE)
157. Which one is the correct product of DNA dependent options given below:
RNA polymerase to the given template? (1) B, C & E only
3' TACATGGCAAATATCCATTCA5'
(2) C, D & E only
(1) 5' AUGUACCGUUUAUAGGGAAGU3'
(3) A, B & D only
(2) 5' ATGTACCGTTTATAGGTAAGT3'
(4) A, B & E only
(3) 5' AUGUACCGUUUAUAGGUAAGU3'
(4) 5' AUGUAAAGUUUAUAGGUAAGU3'
161. Match List I with List II: 165. Given below are some stages of human evolution.
List I List II Arrange them in correct sequence. (Past to Recent)
A. Lipase I. Peptide bond A. Homo habilis
B. Nuclease II. Ester bond B. Homo sapiens
C. Protease III. Glycosidic bond C. Homo neanderthalensis
D. Amylase IV. Phosphodiester D. Homo erectus
bond Choose the correct sequence of human evolution
Choose the correct answer from the options given from the options given below:
below: (1) C-B-D-A
(1) A-II, B-IV, C-I, D-III (2) A-D-C-B
(2) A-IV, B-I, C-III, D-II (3) D-A-C-B
(3) A-IV, B-II, C-III, D-I (4) B-A-D-C
(4) A-III, B-II, C-I, D-IV
166. Following are the stages of pathway for conduction
162. The flippers of the Penguins and Dolphins are the of an action potential through the heart:
example of the A. AV bundle
(1) Convergent evolution B. Purkinje fibres
(2) Divergent evolution C. AV node
(3) Adaptive radiation D. Bundle branches
(4) Natural selection E. SA node
Choose the correct sequence of pathway from the
163. Match List I with List II: options given below:
List I List II (1) B-D-E-C-A
A. Expiratory I. Expiratory (2) E-A-D-B-C
capacity reserve volume (3) E-C-A-D-B
+ Tidal volume (4) A-E-C-B-D
+ Inspiratory
reserve volume 167. Which of the following factors are favourable for the
B. Functional II. Tidal volume + formation of oxyhaemoglobin in alveoli?
residual Expiratory (1) Low pCO2 and High H+ concentration
capacity reserve volume (2) Low pCO2 and High temperature
C. Vital capacity III. Tidal volume + (3) High pO2 and High pCO2
Inspiratory (4) High pO2 and Lesser H+ concentration
reserve volume
D. Inspiratory IV. Expiratory
capacity reserve volume List I List II
+ Residual A. -1 I. Cotton bollworm
volume antitrypsin
Choose the correct answer from the options given B. Cry IAb II. ADA deficiency
below: C. Cry IAc III. Emphysema
(1) A-II, B-I, C-IV, D-III D. Enzyme IV. Corn borer
(2) A-I, B-III, C-II, D-IV replacement
(3) A-II, B-IV, C-I, D-III therapy
(4) A-III, B-II, C-IV, D-I Choose the correct answer from the options given
below:
164. Which one of the following factors will not affect the (1) A-III, B-IV, C-I, D-II
Hardy-Weinberg equilibrium? (2) A-II, B-IV, C-I, D-III
(1) Gene migration (3) A-II, B-I, C-IV, D-III
(2) Constant gene pool (4) A-III, B-I, C-II, D-IV
(3) Genetic recombination
(4) Genetic drift
[22]
169. Given below are two statement: one is labelled as Choose the correct answer from the options given
Assertion A and the other is labelled as Reason R: below:
Assertion A: FSH acts upon ovarian follicles in (1) A-II, B-I, C-III, D-IV
female and Leydig cells in male. (2) A-III, B-IV, C-I, D-II
Reason R: Growing ovarian follicles secrete (3) A-IV, B-III, C-I, D-II
estrogen in female while interstitial cells secrete (4) A-I, B-III, C-II, D-IV
androgen in male human being.
In the light of the above statements, choose the 172. Consider the following statements:
correct answer from the options given below: A. Annelids are true coelomates
(1) A is true but R is false B. Poriferans are pseudocoelomates
(2) A is false but R is true C. Aschelminithes are acoelomates
(3) Both A and R are true and R is the correct D. Platyhelminthes are pseudocoelomates
explanation of A. Choose the correct answer from the options given
(4) Both A and R are true but R is NOT the correct below:
explanation of A. (1) C only (2) D only
(3) B only (4) A only
170. The following diagram showing restriction sites in
E.coli cloning vector pBR322. Find the role of 'X' 173. Given below are two statements:
and 'Y' genes: Statements I: In the nephron the descending limb of
loop of Henle is impermeable to water and
permeable to electrolytes.
Statement II: The proximal convoluted tubule is
lined by simple columnar brush border epithelium
and increases the surface area for reabsorption.
correct answer fropm the options given below:
(1) The gene 'X' is for protein involved in (4) Both Statement I and Statement II are false.
replication of Plasmid and 'Y' for resistance to
antibiotics. 174. Match List I with List II:
(2) Gene 'X' is responsible for recognition sites List I List II
and 'Y' is responsible for antibiotic resistance. A. Fibrous joints I. Adjacent
(3) The gene 'X' is respoinsible for resistance to vertebrae,
antibiotics and 'Y' for protein involved in the limited
replication of Plasmid. movement
(4) The gene 'X' is responsible for controlling the B. Cartilaginous II. Humerus and
copy number of the linked DNA and 'Y' for joints pectoral girdle,
protein involved in the replication of Plasmid. rotational
movement
C. Hinge III. Skull, don't
List I List II allow any
A. Cocaine I. Effective movement
sedative in D. Ball and socket IV. Knee, help in
surgery joints locomotion
B. Heroin II. Cannabis Choose the correct answer from the options given
sativa below:
C. Morphine III. Erythroxylum (1) A-II, B-III, C-I, D-IV
D. Marijuana IV. Papaver (2) A-III, B-I, C-IV, D-II
somniferum (3) A-IV, B-II, C-III, D-I
[Type here]
175. Which of the following is not a natural/traditional 179. Match List I with List II:
contraceptive method? List-I List-II
(1) Lactational amenorrhea (Sub phases of (Specific
(2) Vaults prophase I) characters)
(3) Coitus interruptus A. Diakinesis I. Synaptonemal
(4) Periodic abstinence complex formation
B. Pachytene II. Completion of
176. Match List I with List II: terminalisation of
List-I List-II chiasmata
A. Pleurobrachia I. Mollusca C. Zygotene III. Chromosomes
B. Radula II. Ctenophora look like thin
C. Stomochord III. Osteichthyes threads
D. Air bladder IV. Hemichordata D. Leptotene IV. Appearance of
Choose the correct answer form the options given recombination
below: nodules
(1) A-II, B-IV, C-I, D-III Choose the correct answer form the options given
(2) A-IV, B-III, C-II, D-I below:
(3) A-IV, B-II, C-III, D-I (1) A-II, B-IV, C-I, D-III
(4) A-II, B-I, C-IV, D-III (2) A-IV, B-III, C-II, D-I
(3) A-IV, B-II, C-III, D-I
177. Match List I with List II: (4) A-I, B-II, C-IV, D-III
List-I List-II
A. Axoneme I. Centriole 180. Match List I with List II:
List-I List-II
B. Cartwheel II. Cilia and
A. Common cold I. Plasmodium
pattern flagella
B. Haemozoin II. Typhoid
C. Crista III. Chromosome
C. Widal test III. Rhinoviruses
D. Satellite IV. Mitochondria
D. Allergy IV. Dust mites
Choose the correct answer form the options given
below:
below:
(1) A-II, B-IV, C-I, D-III
(2) A-II, B-I, C-IV, D-III (2) A-IV, B-II, C-III, D-I
(3) A-IV, B-III, C-II, D-I (3) A-II, B-IV, C-III, D-I
(4) A-IV, B-II, C-III, D-II (4) A-I, B-III, C-II, D-IV
178. Which of the following statements is incorrect? 181. Given below are two statements: one is labelled as
(1) Bio-reactors are used to produce small scale Assertion A and the other is labelled as Reason R:
bacterial cultures. Assertion A : Breast-feeding during initial period of
(2) Bio-reactors have an agitator system, an oxygen infant growth is recommended by doctors for
delivery system and foam control system. bringing a healthy baby
(3) A bio-reactor provides optimal growth Reason R: Colostrum contains several antibodies
conditions for achieving the desired product. absolutely essential to develop resistance for the new
(4) Most commonly used bio-reactors are of born baby.
stirring type. In the light of the above statements, choose the most
appropriate answer from the options given below:
(1) A is correct but R is not correct.
(2) A is not correct but R is correct.
(3) Both A and R are correct and R is the correct
explanation of A.
(4) Both A and R are correct but R is NOT the
correct explanation of A.
[24]
182. Match List I with List II: 187. Match List I with List II:
List-I List-II List-I List-II
A. Pterophyllum I. Hag fish A. Mesozoic Era I. Lower
B. Myxine II. Saw fish invertebrates
C. Pristis III. Angel fish B. Proterozoic Era II. Fish & Amphibia
D. Exocoetus IV. Flying fish C. Cenozoic Era III. Birds & Reptiles
Choose the correct answer form the options given D. Paleozoic Era IV. Mammals
below: Choose the correct answer form the options given
(1) A-IV, B-I, C-II, D-III below:
(2) A-III, B-II, C-I, D-IV
(1) A-I, B-II, C-IV, D-III
183. The "Ti plasmid" of Agrobacterium tumefaciens
stands for
(1) Tumor inducing plasmid
(2) Temperature independent plasmid Statement I: The cerebral hemispheres are
(3) Tumour inhibiting plasmid connected by nerve tract known as corpus callosum.
(4) Tumor independent plasmid Statement II: The brain stem consists of the medulla
oblongata, pons and cerebrum.
184. Which of the following is not a component of In the light of the above statements, choose the most
Fallopian tube? approriate answer from the options given below:
(1) Infundibulum (2) Ampulla (1) Statement I is correct but statement II is
(3) Uterine fundus (4) Isthmus incorrect.
(2) Statement I is incorrect but statement II is
185. Match List I with List II: correct.
List-I List-II (3) Both statement I and Statement II are correct.
A. Down's I. 11th chromosome (4) Both statement I and Statement II are incorrect.
syndrome
B.  - Thalassemia II. 'X' chromosome 189. Identify the correct option (A), (B), (C), (D) with
C. -Thalassemia III. 21st chromosome respect to spermatogenesis.
D. Klinefelter's IV. 16th chromosome GnRH
below: LH (A)
(1) A-III, B-IV, C-I, D-II  
(2) A-IV, B-I, C-II, D-III (B) (C)
(3) A-I, B-II, C-III, D-IV  
(4) A-II, B-III, C-IV, D-I Androgens Factors
 
SECTION-B
Formation of spermatids (D)
186. The following are the statements about non-
chordates: (1) FSH, Sertoli cells, Leydig cells,
A. Pharynx is perforated by gill slits. spermatogenesis.
B. Notochord is absent.
(2) ICSH, Leydig cells, Sertoli cells
C. Central nervous system is dorsal.
spermatogenesis.
D. Heart is dorsal if present.
(3) FSH, Leydig cells, Sertoli cells, spermiogenesis
E. Post anal tail is absent.
(4) ICSH, Interstitial cells, Leydig cells,
spermiogenesis.
options given below:
(1) B, D and E only (2) B, C and D only
(3) A and C only (4) A, B and D only
[Type here]
190. Match List I with List II: 193. Given below are two statements:
List-I List-II Statement I: Bone marrow is the main lymphoid
A. RNA polymerase I. snRNPs organ where all blood cells including lymphocytes
III are produced.
B. Termination of II. Promotor Statement II: Both bone marrow and thymus
transcription provide micro environments for the development
C. Splicing of Exons III. Rho factor and maturation of T-lymphocytes.
D. Tata box IV. SnRNAs, tRNA In the light of the above statements, choose the most
Choose the correct answer form the options given approriate answer from the options given below:
below: (1) Statement I is correct but statement II is
(1) A-III, B-IV, C-I, D-II incorrect.
(2) A-IV, B-III, C-I, D-II (2) Statement I is incorrect but statement II is
(3) A-II, B-IV, C-I, D-III correct.
(4) A-III, B-II, C-IV, D-I (3) Both statement I and Statement II are correct.
(4) Both statement I and Statement II are incorrect.
List-I List-II 194. Match List I with List II:
A. Exophthalmic I. Excess secretion of List-I List-II
goiter cortisol, moon face A. The structures I. Gizzard
& hyperglycemia used for storing
B. Acromegaly II. Hypo-secretion of of food.
thyroid hormone and B. Ring of 6-8 blind II. Gastric Caeca
stunted growth.
tubules at
C. Cushing's III. Hyper secretion of
junction of
syndrome thyroid hormone &
protruding eye balls. foregut and
D. Cretinism IV. Excessive secretion midgut.
of growth hormone. C. Ring of 100-150 III. Malpighian
Choose the correct answer form the options given yellow coloured tubules
below: thin filaments at
(1) A-III, B-IV, C-II, D-I junction of
(2) A-III, B-IV, C-I, D-II midgut and
(3) A-I, B-III, C-II, D-IV hindgut.
(4) A-IV, B-II, C-I, D-III D. The structures IV. Crop
used for grinding
192. Match List I with List II: the food.
List-I List-II Choose the correct answer form the options given
A. Unicellular I. Salivary glands below:
glandular (1) A-IV, B-III, C-II, D-I
epithelium (2) A-III, B-II, C-IV, D-I
B. Compound II. Pancreas (3) A-IV, B-II, C-III, D-I
epithelium (4) A-I, B-II, C-III, D-IV
C. Multicellular III. Goblet cells of
glandular alimentary canal
195. Choose the correct statement given below regarding
epithelium
juxta medullary nephron.
D. Endocrine IV. Moist surface of
glandular buccal cavity (1) Loop of Henle of juxtamedullary nephron runs
epithelium deep into medulla.
Choose the correct answer form the options given (2) Juxtamedullary nephrons outnumber the
below: cortical nephtons.
(1) A-III, B-IV, C-I, D-II (3) Juxtamedullary nephrons are located in the
(2) A-II, B-I, C-IV, D-III columns of Bertini.
(3) A-II, B-I, C-III, D-IV (4) Renal corpuscle of juxtamedullary nephron lies
(4) A-IV, B-III, C-I, D-II in the outer portion of he renal medulla.
[26]
196. Match List I with List II: In the light of the above statements, choose the most
List-I List-II approriate answer from the options given below:
A. P wave I. Heart muscles are (1) Statement I is true but Statement II is false.
electrically silent. (2) Statement I is false but statement II is true.
B. QRS II. Depolarisation of (3) Both statement I and Statement II are true.
complex ventricles. (4) Both statement I and Statement II are false.
C. T wave III. Depolarisation of atria.
D. T-P gap IV. Repolarisation of 199. Regarding catalytic cycle of an enzyme action,
ventricles. selecte the correct sequential steps:
Choose the correct answer form the options given A. Substrate enzyme complex formation.
below: B. Free enzyme ready to bind with another
(1) A-II, B-III, C-I, D-IV substrate.
(2) A-IV, B-II, C-I, D-III C. Release fo products.
(3) A-I, B-III, C-IV, D-II D. Chemical bonds of the substrate broken.
(4) A-III, B-II, C-IV, D-I E. Substrate bindig to active site.
197. As per ABO blood grouping system, the blood group below:
of fathers is B+, mother is A+ and child is O+. Their (1) B, A, C, D, E
respective genotype can be (2) E, D, C, B, A
A. IBi/IAi/ii (3) E, A, D, C, B
B. IBIB/IAIA/ii (4) A, E, B, D, C
C. IAIB/iIA/IBi
D. IAi/IBi/IAi 200. Given below are two statements:
E. iIB/iIA/IAIB Statement I: Mitochondria and chloroplasts are
Choose the most appropriate answer from the both double membrane bound organelles.
options given below: Statement II: Inner membrane of mitochondria is
(1) C & B only (2) D & E only relatively less permeable, as compared to
(3) A only (4) B only chloroplast.
In the light of the above statements, choose the most
198. Given below are two statements: approriate answer from the options given below:
Statement I: Gause's competitive exclusive (1) Statement I is correct but statement II is
principle states that two closely related species incorrect.
competing for different resources cannot exist (2) Statement I is incorrect but statement II is
indefinitely. correct.
Statement II: According to Gause's principle, (3) Both statement I and Statement II are correct.
during competition, the inferior will be eliminated. (4) Both statement I and Statement II are incorrect.
This may be true if resources are limiting.
■■■
DATE: 05/05/2024 Test Booklet Code
T3
NEET (UG)-2024
PHYSICS CHEMISTRY BOTANY ZOOOLOGY

1. (1) 51. (3) 101. (2) 151. (4)
2. (3) 52. (2) 102. (4) 152. (2)
3. (3) 53. (3) 103. (1) 153. (1)
4. (2) 54. (3) 104. (1) 154. (4)
5. (4) 55. (4) 105. (3) 155. (4)
6. (1) 56. (3) 106. (1) 156. (2)
7. (4) 57. (3) 107. (1) 157. (3)
8. (3) 58. (2) 108. (4) 158. (4)
9. (1) 59. (2) 109. (3) 159. (2)
10. (1) 60. (1) 110. (4) 160. (4)
11. (2) 61. (3) 111. (2) 161. (1)
12. (3) 62. (3) 112. (2) 162. (1)
13. (3) 63. (2) 113. (3) 163. (3)
14. (3) 64. (3) 114. (1) 164. (2)
15. (4) 65. (3) 115. (4) 165. (2)
16. (1) 66. (4) 116. (2) 166. (3)
17. (3) 67. (1) 117. (3) 167. (4)
18. (1) 68. (4) 118. (4) 168. (1)
19. (4) 69. (1) 119. (4) 169. (2)
20. (4) 70. (1) 120. (1) 170. (4)
21. (2) 71. (2) 121. (4) 171. (2)
22. (3) 72. (1) 122. (1) 172. (4)
23. (2) 73. (2) 123. (3) 173. (4)
24. (2) 74. (3) 124. (3) 174. (2)
25. (1) 75. (3) 125. (2) 175. (2)
26. (4) 76. (2) 126. (1) 176. (4)
27. (2) 77. (3) 127. (1) 177. (2)
28. (3) 78. (1) 128. (3) 178. (1)
29. (2) 79. (4) 129. (1) 179. (1)
30. (4) 80. (3) 130. (4) 180. (1)
31. (4) 81. (3) 131. (1) 181. (3)
32. (3) 82. (4) 132. (2) 182. (4)
33. (2) 83. (3) 133. (3) 183. (1)
34. (4) 84. (2) 134. (3) 184. (3)
35. (4) 85. (4) 135. (2) 185. (1)
36. (2) 86. (4) 136. (4) 186. (1)
37. (4) 87. (2) 137. (1) 187. (2)
38. (2) 88. (3) 138. (3) 188. (1)
39. (3) 89. (4) 139. (4) 189. (3)
40. (4) 90. (3) 140. (4) 190. (2)
41. (4) 91. (2) 141. (3) 191. (2)
42. (4) 92. (2) 142. (1) 192. (1)
43. (4) 93. (3) 143. (1) 193. (3)
44. (4) 94. (3) 144. (4) 194. (3)
45. (4) 95. (3) 145. (2) 195. (1)
46. (4) 96. (2) 146.* (4 or 1) 196. (4)
47. (1) 97. (4) 147. (3) 197. (3)
48. (4) 98. (4) 148. (4) 198. (2)
49. (3) 99. (3) 149. (3) 199. (3)
50. (4) 100 (3) 150. (1) 200.* (3 or 1)
HINTS AND SOLUTIONS
PHYSICS
7. (4)
1. (1)
(N + 1) vernier scale division (VSD) = (N) main scale
0 NI
Magnetic field B = division
2r
 N 
410−7 100  7 1VSD =   MSD
= = 0.0044 T  N +1
2 100 10−2 L.C = Least count = 1 MSD – 1 VSD
= 4.4 mT  N 
= 1 −  MSD
 N +1
2. (3)
 1 
=  MSD
 N +1
Material Magnetic susceptibility
( )  1  0.1
=  cm
Diamagnetic –10 to 10–9
–5  N + 1  10
10–5 to 10–3 1
Paramagnetic = cm
Ferromagnetic >> 1 100( N + 1)
Non–magnetic 0
8. (3)
3. (3) (Stress)max = Young's modulus  (Strain)max
As volume is constant along path bc, hence the work 8 108 ( )
done, W =  PdV = 0 =  max
2 1011
4 × 10–3 = ()max
4. (2)
At brewster angle, only the reflected light is ()max = 4 mm
completely polarised, but the refracted light is
partially polarised. 9. (1)
In connected motion,
5. (4) Fnet
NP 1 Common acceleration a =
= (given) Mtotal
NS 2
10
We know that transformation ratio (r) is a= = 2 m/s2
5
N V
r= S = S Now, from FBD of 2 kg block & 3 kg block
N P VP
VS 2
 =
VP 1
Force exerted by block A on block B,
VS : VP = 2 : 1
FBA = (3)a
FBA = 3  2 = 6 N
6. (1)
Output for given options.
10. (1)
(1) B (2) B (3) A. B + A (4) A. B + A
When we use white light in place of monochromatic
1 0 1 1 light, the central fringe appears white, while the
0 1 1 1 other fringes display different colours. This is
1 0 0 1 because the central fringe for all colours is formed at
0 1 1 0 central point, so it appears white after mixing up. As
So option (1) is correct. fringes of other colours fall at different positions, we
see fringes of all colours on either side of the central
bright fringe.
[2]
11. (2) 15. (4)
For surface AB
1 sin30° =  sin r ……… (1)
h h
= = For surface AC
p 2mE  sin (90° – r) = 1 ……… (2)
h   cos r = 1
=
2mE 1
 cos r =
h2 
2 = From (1) and (2)
2mE
1 1
1
E 2  =  1–
 2 2
1  1 
12. (3)  =  2 1 – 2 
4   
Balanced Wheatstone bridge
1
Equivalent circuit  = 2 –1
4
1
 2 = 1 +
4
5
 =
2
13. (3) 16. (1)

Lenz Law Kp cos 
Formula of potential is given by V =
r2
For axial point  = 0° or 180°
Kp 1 p
V =± =  2
r 2 40 r
9 109  4 10–6
=
4
14. (3) =  9  103
The I – V characteristics of solar cell is drawn in the

fourth quadrant of the coordinate axes. This is 17. (3)
because a solar cell does not draw current but
supplies the same to the load.
In reverse bias condition, the positive terminal is
connected to the n-type and the negative terminal is
connected to the p-type. Hence, majority charge
carriers are swept into terminals and minority charge ML2
= 2400
carriers are repelled by the terminals. Thus, a very 12
small drift current flows through the diode due to 400 L2
 = 2400
minority charge carriers of both n-side and p-side. 12
2400 12
 L2 =
400
 L2 = 72
 L = 72
 L = 8.5 cm
[3]
18. (1) 23. (2)
A
A A
Y
B B
B
Y = A + B = A.B (AND gate)
10 = 5 i
24. (2)
i=2A
GM
Terminal voltage = 10 – 1(2) g= = 9.8 m/s2 …………(i)
=8V R2
Now for Planet,
M D
19. (4) M ' = , D' = [D is diameter fo earth]
10 2
1  1 1
= RZ 2  2 – 2  R
  R' =
 n1 n2  2
1  n12 n22  GM ' GM  4 4 GM
=   Now, g ' = = = 
RZ 2  n22 – n12  ( R ')2 10  R2 10 R2
For H, Z = 1 So, GM
Substitute value of from equation (i)
 n2 n2  R2
 = 91.2  2 1 2 2  nm g = 0.4 × 9.8 m/s2 = 3.92 m/s2
 n2 – n1 
For A  = 656.3 25. (1)
For B  = 486.1 Statement I is correct and II is incorrect.
For C  = 434.1 Atoms are electrically neutral as they have equal
For D  = 410.2 number of positive and negative charges. Also,
atoms of most elements are stable and they emit
characteristics spectrum of their own.
20. (4)
Energy E = hv
26. (4)
Velocity = C = v In case of rolling, the velocity of the point of contact
c with the surface is zero.
=
v Also, the velocity of the point at the highest point of
h h hv the rolling body is twice the velocity of COM of the
P= = =
 c c body.
v So, point P moves faster than point Q.
Fext = 0, So momentum conserved energy conserved.
27. (2)
21. (2)
286 286
A particle moving with uniform speed in a circular
+
 286 e − e− 286
290
82 X ⎯⎯ → 80 Y ⎯⎯ → 79 Z ⎯⎯→ 80 P ⎯⎯→ 81 Q path has varying velocity as the direction of motion
changes continuously. The magnitude of velocity
For α emission, mass number decreases by 4 and remains constant. As the direction of centripetal
atomic number decreases by 2. acceleration is changing, the particle has varying
For e+, atomic number decreases by 1 and mass acceleration.
number remains unchanged.
For β–, mass number is unchanged and atomic 28. (3)
number increases by 1. For circular disc,
Fexcess = 2π r T
22. (3) where r is radius of disc and T is surface tension.
s = 2t – 1 Substituting the given values,
ds d Fexcess = 2π × 4.5 × 10–2 × 0.07
v = = (2t − 1) = 2 (SI unit) 22
dt dt =2× × 4.5 × 10–2 × 7 × 10–2
7
Instantaneous power, P = F .v
= 198 × 10–4 N = 19.8 mN
= 5 × 2 = 10 (SI unit)
[4]
29. (2) 35. (4)
B = 0.049 T = 4.9 × 10–2 T Resistance of each part = 10
5 1 First five parts equivalent = 50
T= = s, I = 9.8 × 10–6 kgm2
20 4 Next five parts equivalent = 2
I 42 I Again for series combination Req = 52
T = 2  T2 =
mB mB
36. (2)
42 I
m= According to Charle’s law V  T
T 2B
42  9.8 10−6
= 2
= 12802 10−5 Am2
1 −2
 4   4.9 10
 
 x = 1280 π2
30. (4) P1 > P2 > P3

Before collision:
m m 37. (4)
v1
As capacitor is being charged the displacement
A B
current is
rest d ( )E
After collision: I = 0
dt
v2 d
m m I = 0 ( EA )
dt
Now, from conservations of momentum, d V 
Momentum before collision = Momentum after I = 0  A 
dt  d 
collision.
0 A d  Q 
I=
d dt  C 
mv1 + (0) = 2m v2
mv1 = 2mv2
v1 2 dQ
= I= = Iconduction
v2 1 dt
 v1 : v2 = 2 : 1
38. (2)
31. (4)
EM waves do not originate from charges moving
 
x = 5sin  t +  m with uniform speed.
 3
A = 5m 39. (3)
2
== In option 3 if the diode is considered non ideal with
T resistance 10 then the bridge can be balanced.
T = 2s 40. (4)
Keeping the battery connected
32. (3) V remains same
Strain and angle are also dimensionless
A
Solid angle is dimensionless. C = 0 d is reduced
d
33. (2)  C increases
For spherical shell From
Vcentre = Vsurface Q = CV
Difference in potential is zero. As C↑ Q↑  A is correct
1
E = CV2 As C↑ E increases  B is incorrect
34. (4) 2
T = mw2r Capacitance increases  C is correct
T  w2 Product of charge and voltage increases
T becomes 4 times  E is correct.
[5]
41. (4) 46. (4)
F = t2 + t P1 = 1kW, P2 =2kW
[MLT–2] =  [T2]
 = [MLT–4] For parallel combination
[MLT–2] =  [T] PParallel = P1 + P2 = 1 + 2 = 3kW
 = [MLT–3]
For series combination
t MLT  T
−4
= = [M0L0T0] 1
=
1 1
+ =1+
1
 MLT−3 
  Pseries P1 P2 2
2
Pseries = kW
42. (4) 3
Thermal stress = thermal strain × Y Pparallel 3 9
F = 3 =
= (  T) Y Pseries 2 2
A
Pseries 2
=
F
10−3
( )
= 10−5  100  0.5  1011 Pparallel 9
F = 50 × 103 N
47. (1)
43. (4)
f0 = 140 cm, fe = 5 cm
For normal adjustment
−f0 −140
M= = = 28
fe 5
44. (4)
M = mL
Magnetic pole strength remains the same

mL M
Mnew = mLeff = =
2 2 a = slope of v – t graph
A to B → slope is positive and constant
45. (4)  so acceleration is positive & constant
Vrms = 210 volt, B to C →slope is zero  acceleration is zero.
V0 = 210 2 volt C to D → slope is negative and constant
V0 = I0 XC  so acceleration is negative & constant
1
V0 = I0 ×
C
1
210 2 = I0 ×
2 50 10 10−6
I0 = 210 2 × 2 × 500 × 10–6
I0 = 0.932A
[6]
48. (4) 50. (4)
m = 3m • If sheet is magnetic, then force is required to
1 hold the sheet because magnetic pole exert
l = l
2 force on sheet
l • As sheet is conducting, eddy current formed
T = 2 which oppose the way by which it is produced,
g
so forced is required.
l' l • As sheet is non conducting & non polar, so no
T = 2 = 2
g 2g magnetization occur in sheet hence no force is
 1  l 1 required.
T'=  2 g = T
 2 2
x
T'= T
2
1 x
T= T
2 2
2
x= = 2
2
49. (3)
(T.E)initial = PE of satellite
−GMm
=
R
(T.E)final = P.E of satellite + K.E of satellite
2
−GMm 1  GM 
= + m  
3R 2  3R 
−GMm
=
6R
Minimum energy required
−GMm GMm
= +
6R R
−GMm + 6GMm 5GMm
= =
6R 6R
[7]
CHEMISTRY
51. (3) 56. (3)
1
A) H2 O → O2 + 2e – + 2H+ (2F)
2
B) MnO−4 + 5e – + 8H+ → Mn 2+ + 4H2O (5F)
C) Molten CaCl2 → Ca 2+ + 2e – for 1.5 mole Ca 2+ (3F)
D) Fe2+ → Fe3+ + e – (1F)
52. (2)
Change in oxidation state of elements means redox
reaction:
0 0 +1 −1
H2 + Cl2 → 2HCl (Redox)
+2 −1 +1 −2 +2 −2 +1 −1
Ba Cl2 + Na 2 SO4 → BaSO4 + 2 Na Cl
(No change in oxidation state hence not redox
reaction)
0 +2 +2 0
Zn + CuSO4 → ZnSO4 + Cu (Redox reaction)
+5 0 +5 0
2KClO3 + I2 → 2KIO3 + Cl2 (Redox reaction) 57. (3)
Much larger third ionisation energy of Mn (where
53. (3) the required change is d5 to d4) is mainly responsible
for this. This also explains why the +3 state of Mn is
of little importance.
58. (2)
(A) Isothermal process → at constant temperature
Intramolecular hydrogen bonding is observed in (B) Isochoric process → at constant volume
ortho nitrophenol.
(C) Isobaric process → at constant pressure
(D) Adiabatic process → No heat exchange
54. (3)
Fehling’s solution ‘A’ is aqueous copper sulphate.
59. (2)
55. (4) • Activation energy of any chemical reaction can
NaOH + HCl → NaCl + H2O be calculated if one knows the value of rate
Mass of NaOH = 1 g constant at two different temperatures by given
1 formula:
Moles of NaOH = moles
40 k1 Ea  1 1 
• log =  – 
= 0.025 moles k 2 2.303R  T2 T1 
= 25 millimoles
Millimoles of HCl = MV = 25 × 0.75
= 18.75 millimoles
60. (1)
Millimoles of NaOH unreacted
= 25 – 18.75
= 6.25 millimoles
Mass = 40 × 6.25 = 250 mg
IUPAC name: 2,3-dimethyl butane
[8]
61. (3) 65. (3)
• Spin only magnetic moment • The boiling point of hydrides of group 16 are in
= n(n + 2) the order H2O > H2Te > H2Se > H2S.
• n = number of unpaired electrons • It is due to the presence of extensive H-bonding
A Ti3+ d1 1.73 in H2O.
B Cr2+ d4 4.90
2+ 5
C Mn d 5.92 66. (4)
D Fe2+ d6 4.90 (A) ml → orientation of orbital.
3+ 0
E Sc d 0 (B) ms → orientation of spin of electron.
B = Cr2+ = 4.90 D = Fe2+ = 4.90 (C) l → shape of orbital.
(D) n → size of orbital.
62. (3)
F = 4.0 
67. (1)
O = 3.5 
 (A)
N = 3.0 electronegativity
C = 2.5 

Si = 1.8 
Hence order will be:
(B)
Si < C < N < O < F
63. (2) (C)

• 3° alcohols react with Lucas reagent
instantaneously.
(D)
• 2° alcohols react with Lucas reagent after 5
minute.
• 1° alcohols do not react with Lucas reagent at 68. (4)
ordinary temperature.
64. (3)
• Both [Co(NH3)6]3+ and [CoF6]3– are octahedral
complex because coordination number are six.
• Electronic configuration of Co3+ in
[Co(NH3)6]3+ is Co3+ : [Ar]3d64s04p0
69. (1)
Glucose does not react with Schiff’s reagent and
NaHSO3.
As NH3 is a strong ligand, so pairing takes place
70. (1)
(A) → One  bond

No unpaired electron, so it is diamagnetic in nature
Electronic configuration of Co3+ in [CoF6]3– is (B) H2C=CH2 → One -bond and one -bond
Co3+ : [Ar]3d64s04p0 (C) C2 → Two -bonds
(D) HCCH → One -bond and two -bonds
71. (2)
3
sp hybridisation Po does not show –2 oxidation state because on
–
As F is a weak ligand no pairing takes place going down the group, electropositive nature
So, it is paramagnetic in nature. increases.
[9]
72. (1) (4) H2(g) + I2(g)  2HI(g)
2A  B + C ng = 2 − 2 = 0
KC =
BC = 2 10  2 10
−3 −3
  HI
2
KC =
A2  2 10−3 
2
H2 I2 
QC = 1 Kp = KC (RT) ng
QC > KC Kp = KC (RT)0
Reaction has a tendency to go in backward direction. Here, Kp = KC
73. (2) 75. (3)

• Arrhenius equation is; • Boiling point decreases with increase in
E 1 branching as the intermolecular forces
ln k = − a  + log A
R T decreases
1 • Boiling point: CH3 − CH2 − CH2 − CH2 − CH3 >
• Graph between ln k vs with intercept = log A (n-pentane)
T
E
and slope = − a
R
76. (2)
• SN1 reaction are fastest in those compound,
where the intermediate carbocation is resonance
stablised.
• is resonance stablised
74 . (3) carbocation among given options. So, rate of

(1) CO(g) + H2O(g) CO2(g) + H2(g) SN1 reaction will be fastest in
KC =
CO2 H2 
COH2O
n g = 2 − 2 = 0
Kp = KC (RT) ng 77. (3)
• For He+ ion; Energy = –x J, Z = 2, n = 1
Kp = KC (RT)0
−2.18 10−18 Z2
Kp = KC Energy = J
n2
(2) 2BrCl(g)  Br2(g) + Cl2(g) −2.18 10−18  (2)2
−x = J
ng = 2 − 2 = 0 (1)2
x = 2.18 × 10–18 × 4 J
Br Cl2 
KC = 2 • For Be3+ ion; Z = 4, n = 2
BrCl2 −2.18 10−18 Z2
(E2 )Be3+ = J
Kp = KC (RT) ng n2
Kp = KC (RT)0 −2.18 10−18  (4)2
= J
Kp = KC (2)2
(3) PCl5(g)  PCl3(g) + Cl2(g) = –2.18 × 10–18 × 4 J

= –x J
ng = 2 −1 = 1
KC =
PCl3 Cl2 
PCl5 
Kp = KC (RT) ng
Kp = KC (RT)1
Here, Kp  KC
[10]
78. (1) 82. (4)
(A) When liquid evaporates to vapour, entropy • In a period, generally on moving left to right
increases due to increase in randomness. ionization enthalpy increases. But due to more
(B) When temperature of crystalline solid lowered stable configuration of Be(2s2), its ionization
from 130 K to 0 K, the random collisions will enthalpy is more as compared to B(2p1), less
decrease, resulting in decrease in entropy. stable configuration.
(C) In the given reaction, • So, correct order of first IE : Li < B < Be < C < N
2NaHCO3(s) → Na2CO3(s) + CO2(g) + H2O(g)
Solid is converting to gas, due to which 83. (3)
randomness increases and hence, entropy 4
• Atoms in 4 g of Helium =  NA = NA
increase. 4
(D) In the given conversion, Cl2(g) → 2Cl(g) • Atoms in 2.271098 L of Helium at
number of gaseous atom increases, due to 2.271098
STP =  NA = 0.101 NA
which entropy increases. 22.4
Hence, Entropy will increase in case of A, C, D. • Atoms in 4 mol of Helium = 4 × NA = 4NA
4
• Atoms in 4u of Helium = = 1
79. (4) 4
On heating, solid substances change from solid to Hence, highest number of atoms are present in 4 mol
vapour state without passing through liquid state. of Helium.
This purification technique is known as sublimation
and is used to separate sublimable compound from 84. (2)
non-sublimable impurities.
80. (3)
(A) [Co(NH3)5(NO2)]Cl2 shows linkage isomerism.
Its linkage Isomer is [Co(NH3)5(ONO)]Cl2
(B) [Co(NH3)5(SO4)]Br shows ionization
isomerism. Its ionization isomer is
[Co(NH3)5(Br)]SO4
(C) [Co(NH3)6][Cr(CN)6] shows coordination
isomerism. Its coordination isomer is
[Cr(NH3)6][Co(CN)6]
(D) [Co(H2O)6]Cl3 shows solvate isomerism. Its
one of the solvate isomer is • Stability order of carbocation : 3° > 2° > 1°.
[Co(H2O)5Cl]Cl2.H2O • Hence, most stable carbocation is present in
So correct option is: option (2).
A → II, B → III, C → IV, D → I
85. (4)
81. (3) Lesser the value of KH, more will be the solubility of
• Aniline does not undergo Friedel-craft reaction gas in water.
due to salt formation with anhy. aluminium So, solubility order:
chloride (the lewis acid) which is used as a B(K H = 2 10−5 )  C(K H = 35)  A(K H = 145)
catalyst.
• Gabriel synthesis is used for the preparation of
aliphatic primary amines only. Aromatic
primary amines cannot be prepared by this
method because aryl halide do not undergo
nucleophilic substitution with the anion formed
by phthalimide.
[11]
86. (4) 90. (3)
Element Percentage Atomic Atomic Simplest • Homoleptic complex is one which contains
composition mass ratio of ratio of only one kind of ligands. Heteroleptic complex
atoms atoms
is one which contains two or more kinds of
ligand.
A 32% 64 32 0.5
= 0.5 =1 • [Co(NH3)6]3+ has only one kind of ligands but
64 0.5
[Co(NH3)4Cl2] + has more than one kind of
B 20% 40
ligands.
20 0.5
= 0.5 =1
40 0.5
91. (2)
C 48% 32 48 1.5
Fe2+ ion undergoes hydrolysis, therefore, while
= 1.5 =3 preparing aqueous solution of ferrous sulphate in
32 0.5
Hence, empirical formula is ABC3. water, 2-3 ml of dilute sulphuric acid is added to
prevent the hydrolysis of Mohr’s salt.
87. (2)
92. (2)
3ROH + PCl3 → 3RCl + H3PO3
• Dipole Moment:
(A)
ROH + PCl5 → RCl + HCl + POCl3
(B)
Hence, A : H3PO3 and B : POCl3
88. (3)
 = CRT • CO32− has three canonical forms.
 slope = RT = 25.73 L bar mol-1
25.73
T =
0.083
= 310K • Two resonating structures can be drawn for
= 37°C ozone.
• BF3 has trigonal planar structures. Its net dipole

moment is Zero.
89. (4) 93. (3)

Below given the ions and the group they belong as
• per qualitative analysis.
Cation Group
Cu2+ 2
3+
Al 3
2+
Co 4
Ba2+ 5
2+
Mg 6
• Will be completely oxidized in
presence of acidified KMnO4 into carboxylic
acid.
[12]
94. (3) 97. (4)
P 
W = −2.303nRT log  1 
 P2 
 20 
= −2.303 1 2  298  log  
 10 
= −2.303  2  298  0.301
= −413.14 Calories
95. (3) 98. (4)

K  Ea  330 − 300  W = Z i  t
log  330  =  
 K300  2.303R  300  330  =
63
 9.6487 100
K 96487  2
Given: 330 = 4 = 0.315g
K300
Ea 30
 log 4 =  99. (3)
2.303R 300  330
0.602  2.303  8.314  300  330
 Ea = J / mol
30
= 38037.7 J / mol
= 38.0377 kJ / mol
38.04 kJ / mol 100. (3)
Gd3+ :[Xe]4f 7 (7 unpaired e− )
(Z = 64)
96. (2)
 Eu3+ :[Xe]4f 6 (6 unpaired e− )
2NO(g) N2 (g) + O2 (g) (Z = 63)
At t = 0 0.1 M – –  Pm3+ :[Xe]4f 4 (4 unpaired e− )

(Z = 61)
 0.1   0.1   Sm3+ :[Xe]4f 5 (5 unpaired e− )
At time = t (0.1 –0.1 )M  M  2 M
 2    (Z = 62)
 Ce4+ :[Xe]4f 0 (No unpaired e− )

0.1 0.1 (Z = 58)

3 10−3  4.2 10−3
 Kc = = 2 2  Yb2+ :[Xe]4f 14 (No unpaired e− )
(2.8 10−3 )2 (0.1 − 0.1)2 (Z = 70)
2
 0.1   Ce3+ :[Xe]4f 1 (1unpaired e− )
(Z = 58)
 2 
1.6 =  
 Eu2+ :[Xe]4f 7 (7 unpaired e− )
( 0.1 − 0.1)2 (Z = 63)
 0.1  Species having no unpaired e− [Ce4+ and Yb2+] are

 2  diamagnetic in nature.
1.27 =  
0.1 − 0.1
 = 0.717
[13]
BOTANY
101. (2) 105. (3)
Both wind and water pollinated flowers are not very In grasses, certain adaxial epidermal cells along the
colourful and do not produce nectar. veins modify themselves into large, empty,
In most of the water-pollinated species, pollen grains colourless cells. These are called bulliform cells.
are protected from wetting by a mucilaginous When the bulliform cells in the leaves have absorbed
covering. water and are turgid, the leaf surface is exposed.
Some examples of water pollinated plants are When they are flaccid due to water stress, they make
Vallisneria and Hydrilla which grow in fresh water the leaves curl inwards to minimise water loss.
and several marine sea-grasses such as Zostera.
Not all aquatic plants use water for pollination. In a 106. (1)
majority of aquatic plants such as water hyacinth and For the dark reaction or Calvin cycle, CO2 is required
water lily, the flowers emerge above the level of for the carboxylation step and ATP and NADH is
water and are pollinated by insects or wind as in most required for the reduction and regeneration step.
of the land Plants.
In another group of water pollinated plants such as 107. (1)
seagrasses, female flowers remain submerged in Plants show an interesting phenomenon, the living
water and the pollen grains are released inside the differentiated cells, that by now have lost the
water. Pollen grains in many such species are long, capacity to divide can regain the capacity of division
ribbon like and they are carried passively inside the under certain conditions. This phenomenon is
water; some of them reach the stigma and achieve termed as dedifferentiation. For example, formation
pollination. of meristems – interfascicular cambium and cork
cambium from fully differentiated parenchyma cells.
102. (4)
Ex situ Conservation– In this approach, threatened 108. (4)
animals and plants are taken out from their natural Recognition sequence of Hind II is of 6 base pairs
habitat and placed in special setting where they can and it generates blunt ends.
be protected and given special care. Zoological
parks, botanical gardens and wildlife safari parks 109. (3)
serve this purpose. Speciation is generally a function of time, unlike
temperate regions subjected to frequent glaciations
103. (1) in the past, tropical latitudes have remained
Inhibition of succinic dehydrogenase by malonate is relatively undisturbed for millions of years and thus,
an example of competitive inhibition. Malonate had a long evolutionary time for species
resembles the substrate succinate and competes with diversification.
the substrate for the substrate-binding site of the Tropical environments, unlike temperate ones, are
enzyme. Consequently, the substrate cannot bind less seasonal, relatively more constant and
and as a result, the enzyme action declines. predictable. Such constant environments promote
niche specialisation and lead to a greater species
104. (1) diversity.
The primary root, or radicle is the first organ to There is more solar energy available in the tropics,
appear when a seed germinates. which contributes to higher productivity; this in turn
might contribute indirectly to greater diversity.
110. (4)
The morphology of the mycelium, mode of spore
formation and fruiting bodies form the basis for the
division of the kingdom fungi into various classes.
[14]
111. (2) 116. (2)
For every CO2 molecule entering the Calvin cycle, 3 If gynoecium is situated in the centre and other parts
molecules of ATP and 2 of NADPH are required. of the flower are located on the rim of the thalamus
The Calvin cycle can be described under three almost at the same level, it is called perigynous. The
stages: carboxylation, reduction and regeneration. ovary here is said to be half inferior, e.g., plum, rose,
Reduction step involve utilisation of 2 molecules of peach.
ATP for phosphorylation and two of NADPH for
reduction per CO2 molecule fixed. The regeneration
steps require one ATP for phosphorylation to form
RuBP.
112. (2) (a) (b) (c) (d)

Causes of biodiversity losses: The accelerated rates Position of floral parts on thalamus :(a) Hypogynous
of species extinctions that the world is facing now (b) and (c) Perigynous (d) Epigynous
are largely due to human activities. There are four
major causes (‘ The Evil Quartet ’ is the sobriquet 117. (3)
used to describe them). Some common members of basidiomycetes are
1. Habitat loss and fragmentation: Agaricus (mushroom) , Ustilago (smut) and
2. Over-exploitation: Puccinia (rust fungus).
3. Alien species invasions: Rhizopus is also known as the bread mould. It
4. Co-extinctions: belongs to Phycomycetes.
113. (3) 118. (4)

The capacity to generate a whole plant from any cell In a typical test cross an organism (pea plants here)
of plant is called as totipotency. showing a dominant phenotype (and whose
genotype is to be determined) is crossed with the
114. (1) recessive parent instead of self-crossing.
A population growing in a habitat with limited
resources show initially a lag phase, followed by 119. (4)
phases of acceleration and deceleration and finally
an asymptote, when the population density reaches
the carrying capacity. A plot of N in relation to time
(t) results in a sigmoid curve. This type of population
growth is called Verhulst-Pearl Logistic Growth and
is described by the following equation:
K−N
dN / dt = rN  
 K 
Where N = Population density at time t
r = Intrinsic rate of natural increase 50% flowers are red in colour and 50% flowers are
K = Carrying capacity pink in colour.
115. (4) 120. (1)

The key features of metaphase are: Two or more alternative forms of a gene- Allele
I. Spindle fibres attach to kinetochores of Cross of F₁ progeny with homozygous recessive
chromosomes. parent- Test cross
II. Chromosomes are moved to spindle equator Cross of F1 progeny with any of the parents- Back
and get aligned along metaphase plate through cross
spindle fibres to both poles. Number of chromosome sets in plant- Ploidy
121. (4)
Lecithin or phosphatidyl choline is an example of
phospholipid.
[15]
122. (1) 130. (4)
Clostridium butylicum - Butyric acid Alleles show expressions in the F2 generation.
Saccharomyces cerevisiae- Ethanol
Trichoderma polysporum- . Cyclosporin-A- 131. (1)
Streptococcus sp.- Streptokinase Bt toxins are insect-group specific. The toxin is
coded by a gene cryIAc named cry.
123. (3) The Bt toxin protein exist as inactive protoxins but
once an insect ingest the inactive toxin, it is
converted into an active form of toxin due to the
alkaline pH of the gut which solubilise the crystals.
132. (2)
Parenchyma and collenchyma are living tissue.
The outer walls of guard cells (away from the
Gymnosperms lack vessels in their xylem but in
stomatal pore) are thin and the inner walls (towards
flowering plants, tracheids and vessels are the main
the stomatal pore) are highly thickened.
water transporting elements.
124. (3)
When a flower can be divided into two equal radial 133. (3)
halves in any radial plane passing through the centre, During leptotene stage the chromosomes become
it is said to be actinomorphic, e.g., mustard, datura, gradually visible under the light microscope.
chilli. The beginning of diplotene is recognised by the
dissolution of the synaptonemal complex and the
125. (2) tendency of the recombined homologous
A transcription unit in DNA is defined primarily by chromosomes of the bivalents to separate from each
the three regions in the DNA: other except at the sites of crossovers.
(i) A Promoter
(ii) The Structural gene 134. (3)
(iii) A Terminator A. Nucleolus - site for active ribosomal RNA
synthesis.
126. (1) B. Centriole - organisation like cartwheel
When a piece of DNA carrying gene of interest is C. Leucoplasts - for storing nutrients
D. Golgi apparatus- site for formation of
transferred into an alien organism – it may get
glycolipid
integrated itself into the genome of the recipient and
may multiply and be inherited along with the host
135. (2)
DNA.
The IUCN Red List (2004) documents the extinction
of 784 species (including 338 vertebrates, 359
127. (1)
invertebrates and 87 plants) in the last 500 years.
Auxins are widely used as herbicides. 2, 4-D, widely
used to kill dicotyledonous weeds, does not affect
136. (4)
mature monocotyledonous plants.
Chloroplast contains small, double- stranded circular
DNA molecules and ribosomes.
128. (3)
Metal ions are the common cofactors. Cofactor for
137. (1)
enzyme carboxypeptidase is zinc.
In somatic hybridisation, protoplasts are fused
involving two varieties of plants.
129. (1)
In the absence of a preferred carbon source such as
glucose, if lactose is provided in the growth medium
of the bacteria, the lactose is transported into the
cells through the action of permease.
[16]
138. (3) 143. (1)
The given diagram shows a wind-pollinated plant
showing compact inflorescence and well exposed
stamens.
144. (4)
Citric acid cycle Mitochondrial matrix
Glycolysis Cytoplasm
Electron transport Inner mitochondrial
system membrane
Proton gradient Intermembrane space of
mitochondria
139. (4) 145. (2)

Sugarcane stores carbohydrate as sugar in their The DNA-dependent DNA polymerase E.Coli in
stems. Spraying sugarcane crop with gibberellins catalyse polymerisation only in one direction, that is
increases the length of the stem, thus increasing the 5' → 3'.
yield by as much as 20 tonnes per acre.
146. (4 or 1)
140. (4) The NPP of the first trophic level is the GPP of the
second trophic level and the NPP of the 2nd trophic
Frederick Griffith Transformation
level is GPP is 3rd trophic level.
Francois Jacob and Lac operon
According to the 10% law 90 per cent is the
Jacque Monod respiratory loss (R) at each trophic level.
Har Gobind Khorana Genetic code NPP = GPP – R
At the first trophic level NPP is 100x which is GPP
Meselson and Stahl Semi-conservative mode of second trophic level.
of DNA replication At second trophic level NPP is 10% of GPP = 10x
Since the GPP of the 3rd trophic level is the same
141. (3) as the NPP of the second trophic level, it is equal to
GLUT-4 enables glucose transport into cells. 10x.
Insulin is a hormone secreted by pancreas.
Trypsin is an example of enzyme. 147. (3)
Rose Perigynous flower
Collagen is the most abundant protein in animal Pea Marginal placentation
world, which is an intercellular ground substances. Cotton Twisted aestivation
Mango Drupe
142. (1)
In C3 plants some O2 does bind to RuBisCO, and 148. (4)
hence CO2 fixation is decreased. In C4 plants Robert May Global species diversity at
about 7 million
photorespiration does not occur.
Alexander von Species-Area relationship
Humboldt
Paul Ehrlich Rivet popper hypothesis
David Tilman Long term ecosystem
experiment using outdoor plots
[17]
149. (3) 157. (3)
Monoadelphous China rose The process of copying genetic information from
Diadelphous Pea one strand of the DNA into RNA is termed as
Polyadelphous Citrus transcription.
Epiphyllous Lily The process of transcription is catalyzed by the
enzyme DNA dependent RNA polymerase in only
150. (1) one direction, that is, 5' → 3', the strand of DNA that
Sexual reproduction can be isogamous, anisogamous has the polarity 3' → 5' acts as a template, and is also
or oogamous in phaeophyceae. referred to as template strand.
The given template strand of DNA is:
151. (4) 3'-TACATGGCAAATATCCATTCA 5'
List-I List-II So, the transcribed strand of RNA will be:
Typhoid Bacteria 5'AUGUACCGUUUAUAGGUAAGU 3'
Leishmaniasis Protozoa
Ringworm Fungus 158. (4)
Filariasis Nematode Skeletal muscles: Triceps
Smooth muscles: Stomach
152. (2) Cardiac muscles: Heart
List-I List-II
159. (2)
Non-medicated IUD Lippes loop
The correct sequence of stages of cell division is:
Copper releasing IUD Multiload 375
Gap-1 phase → Synthesis phase → Gap-2 phase →
Hormone releasing IUD LNG-20
Karyokinesis → Cytokinesis
Implants Progestogens
160. (4)
153. (1) Myasthenia gravis, Rheumatoid arthritis and
The presence or absence of hymen is not a reliable Systemic Lupus Erythematosus are autoimmune
indicator of virginity or sexual experience. disorders.
However, it can also be broken by a sudden fall or Gout is a skeletal disorder affecting joints and
jolt, insertion of a vaginal tampon, active Muscular dystrophy is genetic disorder affecting
participation in some sports like horseback riding, muscles.
cycling, etc. In some women the hymen persists even
after coitus. 161. (1)
List-I List-II
154. (4) Lipase Ester bond
A pair of jointed filamentous structures called anal Nuclease Phosphodiester bond
cerci are present in the 10th abdominal segment in Protease Peptide bond
both sexes of cockroaches. Amylase Glycosidic bond
155. (4) 162. (1)

List-I List-II The flippers of Penguins and Dolphins are analogous
Pons Connects different regions of the organs and thus are examples of convergent
brain evolution.
Hypothalamus Neurosecretory cells Other examples of analogy are the eye of the octopus
Medulla Controls respiration and gastric and of mammals.
secretions
Cerebellum Provides additional space for
neurons, regulates posture and
balance
156. (2)
Glucagon is a peptide hormone secreted by the alpha
cells of Islets of Langerhans of pancreas.
Remaining are steroidal hormones.
[18]
163. (3) 171. (2)
List-I List-II List-I List-II
Expiratory Tidal Volume + Expiratory Cocaine Obtained from coca plant (Erythroxylum
capacity Reserve Volume coca)
Functional Expiratory Reserve Volume + Heroine Papaver sominiferum
residual Residual Volume Morphine Effective and sedative pain killer
capacity Marijuana Flower tops, leaves and the resin of
Cannabis sativa
Vital capacity Tidal Volume + Expiratory
Reserve Volume + Inspiratory
172. (4)
Reserve Volume
Annelids – True coelomates
Inspiratory Tidal Volume + Inspiratory Poriferans to Platyhelminthes – Acoelomates
capacity Reserve Volume Aschelminthes – Pseudocoelomates
164. (2) 173. (4)

Gene pool (total number of genes and alleles in a Descending limb of Henle’s loop - Permeable to
population) will remain constant if a population is water and impermeable to electrolytes.
following Hardy-Weinberg equilibrium. The factors Proximal convoluted tubule - Lined by simple
affecting Hardy-Weinberg equilibrium are: genetic cuboidal brush border epithelium.
drift, mutation, gene migration or gene flow, genetic
recombination and natural selection. 174. (2)
List-I List-II
165. (2) Fibrous joints Seen in flat skull bones and do
Homo habilis (A) → Homo erectus (D) → not allow any movement.
Cartilaginous Present between adjacent
Homo neanderthalensis (C) → Homo sapiens (B).
joints vertebrae and allow limited
movements.
166. (3)
Hinge joints Present in knees and help in
Correct sequence is – locomotion.
SA node (E) → AV node (C) → AV bundle (A) → Ball and socket Present between humerus and
Bundle branches (D) → Purkinje fibres (B). joints pectoral girdle and allow
rotational movement.
167. (4)
Factors which are favourable for formation of 175. (2)
oxyhaemoglobin in the alveoli – High pO2, high pH,
Vaults – Barrier method.
low pCO2, lower temperature, lesser H+ concentration.
168. (1) 176. (4)

List-I List-II Pleurobrachia is the example of phylum ctenophora.
-1-antitrypsin protein is used to treat Radula is a file like rasping organ found in phylum
emphysema. mollusca.
cryIAb controls corn borer Stomochord is found in phylum hemichordata
cryIAc cotton bollworms. similar to notochord of chordata.
Enzyme replacement treat ADA deficiency. Air - bladder maintains buoyancy in Osteichthyes.
therapy
177. (2)
169. (2)
A. Axoneme - Cilia and flagella
FSH acts upon ovarian follicles in females and
B. Cartwheel pattern - Centriole
sertoli cells in males.
C. Crista - Mitochondria
170. (4) D. Satellite - Chromosome
X – ori and Y – rop
Ori responsible for controlling copy number of the 178. (1)
linked DNA. Bio-reactors are used to produce large scale
Rop codes for the proteins involved in the replication of bacterial culture.
the plasmid.
[19]
179. (1) 188. (1)
Diakinesis - Completion of terminalisation of The cerebral hemispheres are connected by a tract of
chiasmata nerve fibres called corpus callosum.
Pachytene - Appearance of recombination nodules Three major regions make up the brain stem; mid
Zygotene - Synaptonemal complex formation brain, pons and medulla oblongata. Cerebrum is the
Leptotene - Chromosomes look like thin threads part of forebrain.
180. (1)
189. (3)
Common cold is caused by rhinoviruses.
A - FSH
Haemozoin is toxic substance released from ruptured
B - Leydig cell
RBCs.
C - Sertoli cells
Widal test is used for diagnosis of typhoid.
D - Spermiogenesis
Allergy is exaggerated response of immune system
The increased levels of GnRH acts at the anterior
caused by allergens (Dust mites etc).
pituitary gland and stimulates secretion of two
gonadotropins – luteinising hormone (LH) and
181. (3)
follicle stimulating hormone (FSH). LH acts at the
Breast feeding during initial periods of infants
Leydig cells and stimulates synthesis and secretion
growth is recommended by doctors for bringing a
of androgens. Androgens, in turn, stimulate the
healthy baby because colostrum contains several
process of spermatogenesis. FSH acts on the Sertoli
antibodies absolutely essential for develop
cells and stimulates secretion of some factors which
resistance for new born.
help in the process of spermiogenesis.
182. (4)
190. (2)
Scientific name of Angel fish is Pterophyllum.
A. RNA Polymerase III - SnRNAs, tRNA
Myxine is also known as hagfish.
B. Termination of transcription - Rho factor
Scientific name of saw fish is Pristis.
C. Splicing of exons - snRNPs
Scientific name of flying fish is Exocetus.
D. TATA box - Promoter
183. (1)
191. (2)
The ‘Ti plasmid’ of Agrobacterium tumefaciens
Exopthalmic goitre is a form of hyperthyroidism,
stands for Tumor inducing plasmid.
characterised by enlargement of the thyroid gland,
protrusion of the eyeballs, increased basal metabolic
184. (3)
rate, and weight loss, also called Graves’ disease.
Uterine fundus is a part of uterus. Infundibulum,
Acromegaly is the excessive secretion of growth
ampulla and isthmus are the parts of fallopian tube.
hormone.
185. (1) Cushing’s syndrome is caused by excessive secretion
Down’s syndrome - 21st chromosomes of cortisol. Cretinism is the hyposecretion of thyroid
α-thalassemia - 16th chromosomes hormone during pregnancy which leads to stunted
-thalassemia - 11th chromosomes growth (cretinism), mental retardation, low intelligence
Klinefelter’s syndrome - ‘X’ chromosome quotient, abnormal skin, deaf-mutism, etc.
186. (1) 192. (1)

Notochord is absent in non-chordate instead it is a Goblet cells of alimentary canal is an example of
characterstic of chordate. In non-chordate heart is unicellular glandular epithelium. Compound
dorsal (if present) but in chordate it is ventral. Post epithelium is present in the dry surface of the skin,
anal tail is found in chordate. the moist surface of buccal cavity, pharynx, inner
lining of ducts of salivary glands and of pancreatic
187. (2) ducts.
Mesozoic Era - Birds and reptiles Salivary gland is an example of multicellular
Proterozoic Era - Lower invertebrates glandular epithelium.
Coenozoic Era - Mammals Pancreas is a type of endocrine glandular epithelium.
Paleozoic Era - Fish and amphibians It secretes insulin and glucagon hormone.
[20]
193. (3) 197. (3)
The bone marrow is the main lymphoid organ where If a child has blood group O+ (ii) so according to that
all blood cells including lymphocytes are produced. both the parents should have at least one recessive
Both bone-marrow and thymus provide micro- allele (i). So the correct answer is father (IBi) and the
environments for the development and maturation of mother is (IAi).
T-lymphocytes.
198. (2)
194. (3) Gause’s ‘Competitive Exclusion Principle’ states
The structure used for storing food in cockroaches is that two closely related species competing for the
Crop. same resources cannot co-exist indefinitely and the
A ring of 6-8 blind tubules called hepatic or gastric competitively inferior one will be eliminated
caeca is present at the junction of foregut and eventually.
midgut, which secrete digestive juice.
At the junction of midgut and hindgut is present 199. (3)
another ring of 100-150 yellow coloured thin The correct sequential steps in the enzyme action is
filamentous Malpighian tubules. as follows:
Gizzard helps in grinding the food particles in A. Substrate binding to active site.
cockroach. B. Substrate enzyme complex formation.
C. Chemical bonds of the substrate broken.
195. (1) D. Release of products.
In juxtamedullary nephron, the loop of Henle is very E. Free enzyme ready to bind with another
long and runs deep into the medulla. substrate.
Cortical nephron is present in majority w.r.t
juxtamedullary nephron. 200. (3 or 1)
Like mitochondria, the chloroplasts are also double
196. (4) membrane bound. Of the two, the inner chloroplast
In ECG, The P-wave represents the electrical membrane is relatively less permeable.
excitation (or depolarisation) of the atria, which
leads to the contraction of both the atria.
The QRS complex represents the depolarisation of
the ventricles, which initiates the ventricular
contraction.
The T-wave represents the return of the ventricles
from excited to normal state (repolarisation). The
end of the T-wave marks the end of systole. T-P gap
represents joint diastole of heart, in which heart
muscles are electrically silent.
[21]

NEET T 3 Question With Answer Key

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

NEET T 3 Question With Answer Key

Uploaded by

Copyright:

Available Formats

Test Booklet Code

8. The maximum elongation of a steel wire of 1 m

12. In the following circuit, the equivalent capacitance

18. The terminal voltage of the battery, whose emf is 10  e +  e − −

25. Given below are two statements :

29. In a uniform magnetic field of 0.049 T, a magnetic

(1) P2 > P1 > P3

40. If the plates of a parallel plate capacitor connected to

(3) A, B and E only (4) A, C and E only

43. A small telescope has an objective of focal length (2)

Choose the correct statement(s) from the options

(3) Si < C < N < O < F

(2) (i) H2O/H+

A. 70. Match List I with List II.

(ii) Zn-H2O C. carbon III. one -bond

97. The work done during reversible isothermal

98. Mass in grams of copper deposited by passing

110. Which one of the following is not a criterion for

129. The lactose present in the growth medium of bacteria

134. Match List-I with List-II.

144. Match List-I with List-II. (A) Rose (I) Twisted

(B) Glycolysis (II) Mitochondrial (D) Mango (IV) Marginal

(A) Monoadelphous (I) Citrus

(B) Diadelphous (II) Pea

(C) Polyadelphous (III) Lily

(D) Epiphyllous (IV) China-rose

154. In both sexes of cockroach, a pair of jointed Name of muscle/location

PHYSICS CHEMISTRY BOTANY ZOOOLOGY

13. (3) 16. (1)

The I – V characteristics of solar cell is drawn in the

30. (4) P1 > P2 > P3

Magnetic pole strength remains the same

63. (2) (C)

(A) → One  bond

73. (2) 75. (3)

74 . (3) carbocation among given options. So, rate of

(3) PCl5(g)  PCl3(g) + Cl2(g) = –2.18 × 10–18 × 4 J

• BF3 has trigonal planar structures. Its net dipole

89. (4) 93. (3)

95. (3) 98. (4)

At t = 0 0.1 M – –  Pm3+ :[Xe]4f 4 (4 unpaired e− )

 Ce4+ :[Xe]4f 0 (No unpaired e− )

 0.1  Species having no unpaired e− [Ce4+ and Yb2+] are

112. (2) (a) (b) (c) (d)

113. (3) 118. (4)

115. (4) 120. (1)

139. (4) 145. (2)

155. (4) 162. (1)

164. (2) 173. (4)

168. (1) 176. (4)

186. (1) 192. (1)

You might also like