Available online at www.sciencedirect.

com

Bioresource Technology 99 (2008) 2187–2191

Decolorizing kinetics of a recombinant Escherichia coli SS125

strain harboring azoreductase gene from Bacillus latrosporus RRK1
S. Sandhya *, K. Sarayu, B. Uma, K. Swaminathan
National Environmental Engineering Research Institute, CSIR-Complex, Chennai 600113, India

Received 20 March 2007; received in revised form 16 May 2007; accepted 16 May 2007
Available online 29 June 2007

Abstract

PCR amplified product containing gene responsible for dye decolorization was cloned and expressed in Escherichia coli. The resulting
recombinant strain E. coli SS125 decolorized 200 mg/l azo dye (Remazol Red) at 30 C at 255 mg cell/l/h, while the host E. coli (DH5a)
had no color removal ability. The dependence of the decolorization rate on initial dye concentration and the maximum rate occurred
with the dye at 100 mg l1. The decolorization rate of E. coli SS125 was optimal at 37–45 C. Aeration strongly-inhibited the decolor-
ization, but decolorization occurred effectively under static and anaerobic incubation conditions. The E. coli SS125 strain also exhibited
excellent stability during reported batch operation.
 2007 Elsevier Ltd. All rights reserved.

Keywords: Decolorization; Azo dyes; Recombinant; Azoreductase gene

1. Introduction potential application in biological methods for treatment

Azo dyes are widely used in printing, paper making and
cosmetic industries for their versatility. Industrial effluents
often contain residual dyes, which not only affect water
quality, but also become threats to public health, because
certain azo dyes or their metabolites may be highly toxic
and carcinogenic. Besides, azo dyes are generally consid-
ered to be recalcitrant in conventional wastewater treat-
ment processes (Carliell et al., 1995; Chung and Stevens,
1993).
It has been observed that some microorganisms can
transform azo dyes into colorless products. Bacterial deg-
radation of azo dyes is often initiated by an enzymatic step
that involves cleavage of azo linkages with the aid of an
azoreductase and an electron donor (Yeh and Chang,
2004). Hence the azoreductase containing microorganisms
that catalyze the reductive cleavage of azo groups have
*
Corresponding author. Tel./fax: +91 44 225412964.
E-mail address: sswami_in@yahoo.com (S. Sandhya).
of wastewaters containing azo compounds (Valli and
Rajkumar, 2003). Azoreductase activity has been identified
in several bacteria, such as Xenophilus azovorans KF46F
(Blumel et al., 2002) Pseudomonas luteola (Hu, 2001), Rho-
dococcus (Chang and Lin, 2001), Shigella dysenteriae Type
I (Ghosh et al., 1992), Klebsiella pnumoniae RS-13 (Wong
and Yuen, 1996) and Clostridium perfringens (Rafii et al.,
1997). Studies on these strains have suggested that some
of them require flavin compounds for azoreductase activi-
ties, while others do not (Rafii and Coleman, 1999). Recent
reports have shown that the addition of quinoid redox
mediators to anaerobically incubated cultures of various
taxonomically different bacterial species could result in sig-
nificantly increased reduction rate for azo dye (Kuldlich
et al., 1997; Rau et al., 2002). The genes encoding azore-
ductase from some bacteria, such as Geobacillus stearother-
mophilus OY1-2 (formerly Bacillus stearothermophilus
OY1-2) (Suzuki et al., 2001), X. azovorans KF46F (Blumel
et al., 2002) and Escherichia coli (Nakanishi et al., 2001)
have been identified.
Generally, it is assumed that the first step in the bio-
degradation of azo compounds is the reduction to the

0960-8524/$ - see front matter  2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.biortech.2007.05.027
2188 S. Sandhya et al. / Bioresource Technology 99 (2008) 2187–2191
corresponding amines, a reaction catalyzed by azoreduc-
tase. Then the resulting aromatic amines are further
degraded by multiple-step bioconversion, aerobically or
anaerobically (Sandhya et al., 2005). Recently, it was found
that o-aminohydroxybenzenes and o-aminohydroxynaph-
thalenes, common products of the anaerobic reduction of
azo dyes, are oxygen-sensitive and can be decomposed
under aerobic condition (Haug et al., 1991). It is suspected
that a hydrazine might be an intermediate in the reduction
of azo dyes to the corresponding amines (Kuldlich et al.,
1997). However, this mechanism is yet to be proved with
proper evidence.
An aerobic natural bacterium, Bacillus latrosporus
RRK1 isolated in our laboratory, from treated domestic
wastewater was found to be able to decolorize several azo
dyes. The azoreductase gene from B. latrosporus RRK1,
was isolated and cloned in vector and expressed in
E. coli. The recombinant enzyme expressed in recombinant
E. coli SS125 was purified and then was used for more
detailed studies on azo dye reduction. The results of these
studies are reported in this paper.
2. Methods
2.1. Bacterial strains, plasmid and culture conditions
B. latrosporus RRK1 was isolated in laboratory from a
sample collected from municipal wastewater treatment
plant. It was grown in Luria–Bertani medium or a medium
containing g/l (NH4Cl 0.1 g, NaHCO3 0.1 g, K2HPO4
0.02 g, MgSO4 Æ 7H2O 0.02 g, NaCl 0.05–0.2 g, peptone
4 g, distilled water 100 ml, pH 7.0) at 30 C. E. coli strain
DH5a was used as host strain for expression of azoreduc-
tase gene. Strain E. coli SS125 was routinely cultured at
37 C in Luria–Bertani medium in presence of ampicillin
(100 lg/ml). The vector pET32a(+) (Novagen) was used
for recombinant expression. PCR fragment recovery kit
was obtained from Biocarporal India.
2.2. Azo dyes
The azo dyes used in study were from commercial grade,
obtained from Color Chem India Ltd. and were used with-
out any purification.
2.3. Decolorization studies
Cells of both native E. coli DH5a and recombinant
E. coli SS125 were harvested from early stationary
phase cultures by centrifugation (10,000g,10 min) and
transferred to 100 ml basal medium containing known con-
centration of dye to give cell concentration 1.5 g dry
weight/l. Batch decolorization experiment were done in sta-
tic condition (without agitation) Typical dissolved oxygen
(DO) levels were in the range of 0.1–0.8 mg/l. Samples were
collected at regular intervals and analyzed for residual
color.
2.4. Color measurement
The residual color in the original and treated samples
was analyzed by measuring the absorbance of the samples
at 511 nm wavelength (absorbance maxima of Remazol
Red) using UV–Visible spectrophotometer (Shimadzu
160A, Japan). The absorbance was correlated with dye
concentration known from calibration graph.
2.5. PCR amplification
DNA of B. latrosporus RRK1 used as template and gene
amplification was obtained by ordinary PCR. PCR mix-
tures (50 ll) for the amplification of genomic DNA con-
tained 50 pmol of each primer, 0.1 lg of genomic
template DNA, a 0.1 mM concentration of each deoxynu-
cleoside triphosphate, 1.5 mM MgCl2, 0.7 U of Taq DNA
polymerase, and the corresponding reaction buffer (Biocar-
poral India).
For the amplification reaction with the primers 5 0 -
CATATGAAACTAGTCGTTATTAAC3 0 (AZR F) and
5 0 TCTAGAGCAGATAGACTATTGGCTCC3 0 (AZR R)
were used along with the following PCR program: an initial
denaturation (94 C, 3 min) was followed by 45 cycles con-
sisting of an annealing temperature of 55 C (30 s), a poly-
merization step (72 C, 2 min), and denaturation (94 C,
30 s). The last polymerization step was extended to 5 min.
2.6. Expression of the azoreductase in E. coli SS125
The PCR products were products were cleaved with
EcoR I and XbaI, and ligated into pET32a(+) (Novagen).
E. coli DH5a was transformed with the resulting plasmids.
The resulting Plasmid was designated as (p AZR-SS125.
Strain E. coli DH5a was transformed with the Plasmid p
AZR-SS125 and recombinant E. coli SS125 was formed.
2.7. Crude extract preparation
Cells from 2.5 l of culture E. coli (p AZR-SS125) were
harvested by centrifugation at 10,000g for 10 min, washed
with 10 mM phosphate buffer (pH 7) and suspended in
20 ml of same buffer. Cells were disrupted by cold sonica-
tion (30 S, 70% output 16·). Cellular debris and unbroken
cells were removed by centrifugation at 15,000g for 10 min
at 4 C. The supernatant obtained constitute the cell free
extract (soluble protein fraction). Protein concentration
was determined by the Bradford protein assay (Bradford,
1976), using bovine serum albumin as the standard.
3. Analytical gel electrophoresis
3.1. Purification and molecular weight determination
The E. coli SS125 (p AZR-SS125) cell extracts corre-
sponding to 100 ml of culture medium (1–2 g of cells) were
dialyzed against buffer containing 0.5 mM and 0.1% (v/v)
 S. Sandhya et al. / Bioresource Technology 99 (2008) 2187–2191 2189

mercaptoethanol. The dialyzed enzyme was then loaded 60

onto a Cibacron blue agarose 3G (Sigma, USA) column.

Concentration of dye, mg/l

Column (1 · 10 cm) equipped with two bed volume buffer 50
A. The column was extensively washed at a rate of
20 ml/h and than eluted with equilibrating buffer contain- 40

ing 10 mM of NADH at flow rate of 6 ml/h. Purified

enzymes were analyzed by sodium dodecyl sulfate–poly- 30

acrylamide gel electrophoresis (SDS–PAGE).

20

3.2. Polyacrylamide gel electrophoresis

10

Sodium dodecyl sulfate-polyacrylamide gel electropho- 0

resis was performed by the method of Laemnli (1970). 0 8 24 48 72 96 144
The gel was stained with coomassie brilliant blue R-250 Time, hrs
at 0.025% (w/v) in methanol/acetic acid/water solution
(4:1:5 v/v/v) for 30 min at room temperature along with Recombinent E.coli SS125 E.coli DH5a
distaining with methanol/acetic acid/water (4:1:5 v/v/v)
Fig. 1. Decolorization profiles of E. coli DH5a and transformer E. coli
solution. The relative molecular mass of the native enzyme
SS125 (condition for aerobic cultivation: temperature – 37 C, agitation
was determined by measuring relative nobilities of molecu- rate – 200 rpm, pH 7.0, dye concentration – 50 mg/l. The data presented in
lar weight protein standard. this figure is average value of triplicate runs with a standard deviation of
Azoreductase activity was localized in gels by active 3–4%).
staining. Gels were soaked in 30 lM aqueous solution of
Remazol Red, washed twice with 0.1 M potassium phos-
phate buffer pH 7.0, and incubated at room temperature Table 1
in 0.25 mM NADH. A colorless band in red background Effect of dye concentration on decolorization and degradation by
indicate the position of azoreductase activity. recombinant E. coli SS125
Dye concentration Dyes decolorizationa COD removalb (%)
4. Results and discussion (mg/l) (%)
50 90 97.4
4.1. Decolorization profile of the recombinant strain E. coli 100 83 96.4
SS125 150 77 88.3
200 66 84.6
a
To verify that the recombinant strain is able to express Dye decolorization after 24 h under static condition.
b
Organic removal after decolorization under shaking condition.
the azoreductase enzyme, experiments were conducted with
both native and recombinant strains. The cells were grown
in a medium containing 50 mg/l Remazol Red under static was also observed that decolorization occurred essentially
condition for 24 h after which it was switched to shaking in the 24 h static incubation during which there was no
mode. The decolorization profile with both the strain is microbial growth. It is well known that azo dyes serve as
shown in Fig. 1. The results clearly prove that E. coli electron acceptors for the azo – reduction related bacterial
SS125 was able to decolorize the dye very effectively. The decolorization under oxygen limited condition. However
native strain E. coli DH5a showed very low level of decol- there was little change in COD removal in this stage. This
orization. The significant difference in decolorization indicates that it was a non-growth associated enzymatic
between the stains is attributed to the expression of azore- reduction of the dye chromophore. The COD removal
ductase gene by E. coli SS125. It may also be observed that occurred during the aerobic cultivation under shaking con-
decolorization occurred essentially in the first 24 h after dition associated with cell growth. Table 1 also shows that
which there was little change in color. COD removal was less affected by dye concentration and
was noticeable only at higher concentration
4.2. Effect of dye concentration
4.3. Effect of dissolved oxygen on decolorization
It is well known that substrate concentration affects
both the enzyme activity and microbial growth. The effect It is generally known that decolorization by azoreduc-
of varying dye concentration on decolorization and COD tase is rapid only in absence of oxygen (Chung and Stevens,
removal is shown in Table 1. It is evident from the results 1993). The presence of oxygen may inhibit the activity of
that decolorization efficiency decreased from 90% to 66% azoreductase since aerobic respiration may dominate the
with a 4-fold increase in dye concentration. This may be utilization of NADH, and thus impede the electron transfer
explained to be due to the inhibition of azoreductase from NADH to azo bonds (Chung and Stevens, 1993;
enzyme activity with increasing concentration of dye. It McMulan et al., 2001). In this study, the effect of DO on
2190 S. Sandhya et al. / Bioresource Technology 99 (2008) 2187–2191

decolorization of Remazol Red was investigated by varying 60

the incubation at static, agitation and anaerobic condition.
50
It was observed that DO value in culture normally 200C

Dye Conc., mg /l
decreased rapidly in the first 4 h of static incubation and 40
decolorization starts. Fig. 2 Shows that E. coli SS125 was
able to decolorize Remazol Red faster under static 30

(DO = 0.8 mg/l) and anaerobic conditions than under agi- 20 370C
tated condition (DO = 4.38 mg/l). Yeh and Chang (2004)
have also reported that genetically modified E. coli NO3 10
450C
strain required no agitation condition. 0
0 8 24 48 72 144

4.4. Effect of temperature on decolorization Time, h

Fig. 3. Time course profile of residual dye concentration for E. coli SS125
The effect of temperature on dye decolorization by the at different temperature (condition for aerobic cultivation: agitation rate –
recombinant E. coli SS125 strain is shown in Fig. 3. The 200 rpm, pH 7.0, dye concentration – 50 mg/l. The data presented in this
dye decolorization rate increased with increase in tempera- figure is average value of triplicate runs with a standard deviation of
ture. At lower temperature of 20 C, dye decolorization 3–4%).
was very slow followed by 45 C and 37 C. Therefore,
there was essentially no thermal denaturation of the decol- Table 2
orization activity of the recombinant E. coli SS125. Yeh Decolorization and degradation of different commercial dyes by recombi-
and Chang (2004) have reported a sharp decrease in decol- nant E. coli SS125 (dye concentration: 50 mg/l)
orization activity when the temperature exceeded 37 C. Dye Absorption Dyes COD removal COD
maxima decolorizationa during removalb
(nm) (%) decolorization (%) (%)
4.5. Substrate versality of E. coli SS125 Remazol 511 90.00 22.8 97.40
Red
The decolorization and degradation of five commercial Remazol Orange 494 74.46 22.4
azo dyes and their mixture were studied with recombinant
62.46
E. coli SS125 and results are given in Table 2. All the tested
Remazol Yellow 418 45.62 34.77
azo dyes were decolorized by the Recombinant E. coli
SS125 even though at different efficiencies. Among these 70.60
azo dyes, Remazol Orange and Remazol Red had the high- Golden Yellow 412 47.38 13.77
est decolorization while Red RB showed relatively poor
57.72
degradation. Even the mixture of all dyes showed a reason-
Red RB 520 9.07 19.38 64.40
able removal of dyes in presence of E. coli SS125. The Mixed 510 47.50 31.54 68.21
dyesc
a
60 Dye decolorization after 24 h under static condition.
b
Organic removal after decolorization under shaking condition.
c
50 Mixture of all five dyes – 10 mg/l.
Dye Conc., mg /l

40 results suggested that simpler the structure of azo dye,

the easier it was to degrade. Chung and Stevens (1993) have
30
also reported that larger the molecular mass, the more dif-
20 ficult was the biodegradation. The excellent degradation
capability of E. coli SS125 in decolorizing a variety of dyes
10 confirms its potential for biological treatment of dye con-
taining wastewater.
0
0 16 24 48 72 144
4.6. Expression azoreductase from E. coli SS125
Time, h

Static Anaerobic Agitation
Fig. 2. Time course profile of residual dye concentration for E. coli SS125
at different incubation conditions (Condition for agitation cultivation:
temperature – 37 C, agitation rate – 200 rpm, anaerobic cultivation:
sealed static and static cultivation: temperature – 37 C. All have pH 7.0,
dye concentration – 50 mg/l. The data presented in this figure is average
value of triplicate runs with a standard deviation of 3–4%.).
The recombinant azoreductase E. coli SS125 was puri-
fied by Cibacron blue agarose 3G. The enzyme was purified
about 7.7-fold with the yield of 11% (Table 3). The specific
activity of final purified enzyme was 505 U/mg protein
using Remazol Red as substrate. The molecular mass of
the purified azoreductase was found to be 58 kDa as shown
by SDS–PAGE (Fig. 4). CMC was included in the gel as a
 S. Sandhya et al. / Bioresource Technology 99 (2008) 2187–2191 2191

Table 3 Xenophilus azovorans KF46F. Appli. Environ. Microbiol. 68, 3948–

Purification of recombinant azo A from E. coli SS125 3955.
Bradford, M., 1976. A rapid and sensitive method for quantitation of
Step Total Total Specific activity Yield
protein activity (U/mg) protein (%) microgram quantities of protein utilizing the principle of protein-dye
binding. Anal. Biochem. 72, 248–254.
(mg) (U)
Carliell, C.M., Barelay, S.J., Naidoo, N., Buckley, C.A., Mulholland,
Crude cell 590 3400 5.8 100 D.A., Senior, E., 1995. Microbial decolourization of a reactive azo dye
extract under anaerobic conditions. Water SA. 21, 61–69.
Cibacron blue 11 650 505 20 Chang, J.S., Lin, C.Y., 2001. Decolorization of an azo dye with
Agarose 3G recombinant Escherichia coli strain harboring azo-dye-decolorizing
determinants from Rhodococcus sp. Biotechnol. Lett. 23, 631–636.
Chen, H., Wang, R.F., Cerniglia, C.E., 2004. Molecular cloning,
overexpression, purification, and characterization of an aerobic
FMN-dependent azoreductase from Enterococcus faecalis. Protein
Express. Purif. 34, 302–310.
Chung, K.T., Stevens Jr., S.E., 1993. Degradation of azo dyes by
environmental microorganisms and helminths. Environ. Toxicol.
Chem. 12, 2121.
Ghosh, D.K., Mandal, A., Chaudhuri, J., 1992. Purification and partial
characterization of two azoreductases from Shigella dysenteriae Type
1. FEMS Microbiol. Lett. 98, 229–234.
Haug, W., Schmidt, A., Nortemann, B., Hempel, D.C., Stolz, A.,
Knackmuss, H.J., 1991. Mineralization of the sulfonated azo dye
mordant yellow 3 by 6-aminonaphthalene-2-sulfonate-degrading bac-
terial consortium. Appl. Environ. Microbiol. 57, 3144–3149.
Hu, T.L., 2001. Kinetics of azo reductase and assessment of toxicity of
metabolic products from azo dyes by Pseudomonas luteola. Water Sci.
Fig. 4. SDS-PAGE of purified azoreductase of E. coli SS125: Lane 1, Technole Technol. 43, 261–269.
protein molecular mass standards; lane 2, crude cell extract; lane 3, the Kuldlich, M., Keck, A., Klein, J., Stolz, A., 1997. Localization of the
purified azo A. enzyme system involved in anerobic reduction of azo dyes by
Sphingomonas sp. Strain BN6 and effect of artificial redox mediators
on the rate of dye reduction. Appl. Environ. Microbiol. 63, 3691–3694.
carrier of dyes, which were decolorized by active protein Laemnli, U.K., 1970. Cleavage of structural proteins during the assembly
bands of 58 kDa molecular weight under an oxygen free of the head of bacteriophage T4. Nature 227, 680–685.
atmosphere. The identification of azoreductase protein McMulan, G., Meehan, C., Conneely, A., Kirby, N., Robinson, T.,
was done by incubating gel with dye and NADH. Analysis Nigam, P., Banat, I.M., Marchant, R., 2001. Microbial decolorization
of the purified Azo A indicated the enzyme used NADH and degradation of textile dyes. Appl. Microbiol. Biotechnol. 56, 81–
87.
but not NADPH for dye reduction. It was observed that Nakanishi, M., Yatome, C., Ishida, N., Kitade, Y., 2001. Putative ACP
electron acceptor specificity spectrum of E. coli SS125 phosphodiesterase gene (acp D) encodes an azoreductase. J. Biol.
was similar to that of E. coli (AcpD) (Nakanishi et al., Chem. 276, 46394–46399.
2001) and E. feacalis (azo A) (Chen et al., 2004). Rafii, F., Hall, J.D., Cerniglia, C.E., 1997. Mutagenicity of azo dyes used
In conclusion, our results demonstrated that the recum- in foods, drugs and cosmetics before and after reduction by Clostrid-
ium species from the human intestinal tract. Food Chem. Toxicol. 35,
bent E. coli contained the gene encoding aerobic azoreduc- 897–901.
tase. The properties of the purified E. coli azo A indicated Rafii, F., Coleman, T., 1999. Cloning and expression in Escherichia coli of
that the enzyme had a broad spectrum of substrate specific- an azoreductase gene from Clostridium perfringens and comparison
ity, which was capable of degrading a wide variety of azo with azoreductase genes from other bacteria. J. Basic Microbiol. 39,
dyes. This implies that besides unspecific anaerobic reduc- 29–35.
Rau, J., Knackmuss, H.J., Stolz, A., 2002. Effects of different quinoid
tion of azo dyes, true azoreductase, which is oxygen insen- redox mediators on the anaerobic reduction of azo dyes by bacteria.
sitive, may also play an important role in the conversion of Environ. Sci. Technol. 36, 1497–1504.
the azo dyes. Sandhya, S., Padmavathy, S., Swaminathan, K., Subrahmanyam, Y.V.,
Kaul, S.N., 2005. Microaerophilic-aerobic sequential batch reactor for
Acknowledgements treatment of azo dyes containing simulated wastewater. Process
Biochem. 40, 885–890.
Suzuki, Y., Yodu, T., Ruhul, A., Suigiura, W., 2001. Molecular cloning
Authors are thankful to Director, NEERI, Nagpur, In- and characterization of the gene coding for azo reduction for Bacillus
dia for providing the support for this research. The authors sp. OY1-22 isolated for soil. J. Biol. Chem. 276 (12), 9059–9069.
wish to thank the Department of Biotechnology, New Valli, N.C., Rajkumar, G.S., 2003. Degradation of a tannery and textile
Delhi for financial support. dye, Navitan Fast Blue S5R by Pseudomonas aeruginosa. World J.
Microbiol. Biotechnol. 19, 609–614.
Wong, P.K., Yuen, P.Y., 1996. Decolorization and biodegradation of
References methyl red by Klebsiella pneumoniae RS13. Wat. Res. 30, 1736–1744.
Yeh, M.S., Chang, J.S., 2004. Bacterial decolorization of an azo dye with a
Blumel, S., Knackmuss, H.J., Stolz, A., 2002. Molecular cloning and natural isolate of Pseudomonas luteola and genetically modified
characterization of the gene coding for the aerobic azoreductase from Escherichia coli. J. Chem. Technol. Biotechnol. 79, 1354–1360.