BIOLOGY OF REPRODUCTION 77, 416–424 (2007)
Published online before print 18 April 2007.
DOI 10.1095/biolreprod.106.056762
Oxytocin and Vasopressin Stimulate Anion Secretion by Human and Porcine Vas
Deferens Epithelia1
Travis M. Hagedorn, Ryan W. Carlin, and Bruce D. Schultz2
Department of Anatomy and Physiology, Kansas State University, Manhattan, Kansas 66506
ABSTRACT
Experiments were conducted to characterize the effects of
oxytocin (OT) and vasopressin (VP) on epithelial cells isolated
from human (18HVD) and porcine (18PVD) vas deferens and an
immortalized epithelial cell line derived from porcine vas
deferens (PVD9902 cells). Cultured monolayers were assessed
in modified Ussing flux chambers and the OT- or VP-induced
change in short circuit current (ISC) was recorded. All cell types
responded to basolateral OT or VP with a transient increase in
ISC that reached a peak of 3–5 lA cm2. Concentration-response
curves constructed with 18PVD and PVD9902 cells revealed that
the apparent KD (kapp) for OT was ;100-fold less than the kapp
for VP. Amplicons for the OT receptor (OXTR) and vasopressin
type 2 and type 1a receptors (AVPR2 and AVPR1A) were
generated with RT-PCR and the identification of each amplicon
confirmed by sequence analysis. A selective antagonist for OXTR
and AVPR1A fully blocked the effects of OT and partially
blocked the effects of VP when assessed in both 18PVD and
PVD9902 monolayers. APVR2 antagonists blocked the effects of
low (30 nM) but not high concentrations of VP, indicating that
VP was affecting both AVPR2 and a second receptor subtype,
likely OXTR or AVPR1A. Experiments employing chelerythrine
demonstrated that OT stimulation of vas deferens monolayers
requires PKC activity. Alternatively, VP (but not OT) increased
the accumulation of cytosolic cAMP in vas deferens epithelial
cells. Results from this study demonstrate that OT and VP can
modulate ion transport across vas deferens epithelia by
independent mechanisms. OT and VP have the potential to
acutely change the environment to which sperm are exposed
and thus, have the potential to affect male fertility.
male reproductive tract, mechanisms of hormone action,
oxytocin, vas deferens, vasopressin
INTRODUCTION
The deferent duct possesses ion transport mechanisms that
change the environment to which sperm are exposed and thus
can contribute to male fertility. Mammalian sperm leaving the
testis are incapable of fertilization [1, 2]. Substantial maturation
occurs in the efferent ducts and epididymes [3, 4], where it
appears that the environment must typically be acid [5–9],
1Supported by National Institutes of Health R21 DK064001, National
Institutes of Health P20 RR017686, National Institutes of Health T32
RR017497, and Cystic Fibrosis Foundation SCHULT06P0. This manu-
script represents contribution no. 07-41-J from the Kansas Agricultural
Experiment Station.
2Correspondence: Bruce D. Schultz, Department of Anatomy and
Physiology, Kansas State University, 1600 Denison Ave., Coles Hall
228, Manhattan, KS 66506. FAX: 785 532 4557;
e-mail: bschultz@vet.ksu.edu
Received: 24 August 2006.
First decision: 27 September 2006.
Accepted: 5 April 2007.
Ó 2007 by the Society for the Study of Reproduction, Inc.
ISSN: 0006-3363. http://www.biolreprod.org
416
although exposure to an alkaline environment is required for
sperm to show hyperactivated motility [10] and to induce other
cytosolic processes associated with capacitation [11, 12].
Epithelial cells lining the epididymis possess H þ and HCO3
transporters that can acidify the duct lumen [6–9] and anion
channels that are modulated by cAMP and Ca2þ [13, 14].
Nonetheless, only a limited amount of work has been done to
characterize the regulatory cascades that modulate vas deferens
epithelial ion transport.
Infertility affects 15% of couples worldwide, with male
factors contributing to approximately half of all cases [15–19].
Diseases of epithelial ion transport contribute a portion of these
cases. For example, cystic fibrosis (CF) is an inherited disease
of anion transport that has long been associated with male
infertility [20]. Greater than 97% of men diagnosed with
classical CF exhibit congenital bilateral absence of the vas
deferens [21, 22]. Thus, the cystic fibrosis transmembrane
conductance regulator (CFTR; the gene that is mutated to cause
CF) is critical to maintain the anatomical structure of the distal
male duct in humans (mice lacking CFTR exhibit normal
reproductive anatomy and function). Some CFTR mutations
that are associated with milder forms of airway and pancreatic
disease have been associated with both obstructive and
nonobstructive male infertility [23–26]. Clearly, there is a link
between CFTR-associated ion transport disorders and male
infertility, even in the presence of a patent deferent duct [27].
In addition to CFTR, vas deferens epithelial cells expresses
various ion transporters including the epithelial Na þ channel
(ENaC), Na þ-HCO3 cotransporters, and various anion
exchangers [28–30] that may also be affected in disease states.
Although progress has been made in characterizing the ion
transport properties of the vas deferens, there are many aspects
of this tissue that remain unexplored.
Neurohypophyseal hormones affect the male reproductive
tract. For example, oxytocin (OT), a hormone that is classically
associated with smooth muscle contraction in the uterus and
mammary gland [31], stimulates or potentiates smooth muscle
contraction in the male duct [32–34]. Previous studies have
shown that OT receptors (OXTR) are present in male
reproductive tissues [35, 36] and that plasma levels of OT
increase in males during sexual arousal [37–39], suggesting
that this hormone may play an acute critical role in male
fertility. Vasopressin (VP), typically associated with its effects
on either vascular tone or water and salt balance [40], likewise
stimulates male duct smooth muscle contraction and potentiates
smooth muscle contraction that is induced by adrenergic
agonists [32, 41, 42]. A survey for effects of agents that are
reportedly present in vas deferens revealed that VP directly
stimulates ion transport across cultured porcine vas deferens
epithelia [30]. Thus, neurohypophyseal hormones appear to
play an important, although not fully understood, role in male
fertility. Any effect that either hormone has on vas deferens ion
transport has not been fully defined.
The goal of this study was to characterize the effects of OT
and VP on vas deferens epithelial ion transport. Particular focus
 REGULATION OF VAS DEFERENS ANION SECRETION
TABLE 1. Primer set characteristics.
Receptor Sense primer Anti-sense primer
OXTR TTCCTTTGCTGCTCTTCC GTCACCAATCCTATACTTACC
AVPR1A GCTGGGACATCACCTACCG GTCATCCAGGTCACGTAGGC
AVPR1B GCCAAGGTGGAGATCGG ATGGTGAAAGCCACATTGG
AVPR2 CAGATGGTAGGCATGTACG AGGCTGGTGTGAATCTCC
was placed on determining the membrane receptor location and
molecular identity that correlates with functional effects that
would be expected to modify sperm delivery, activity, and
viability due to changes in the luminal environment. The
outcomes from these studies suggest that neurohypophyseal
hormones play an integral regulatory role that likely contrib-
utes to male fertility.
MATERIALS AND METHODS
Tissue Acquisition and Epithelial Cell Isolation
The distal portions of porcine reproductive ducts were removed
immediately postmortem from 3- to 5-month-old boars at a local swine
production facility. Tissues were placed in ice-cold Hanks buffered salt solution
(HBSS; composition in mM: 137 NaCl, 5.4 KCL, 0.4 KH2PO4, 0.6 Na2HPO4,
5.5 glucose) supplemented with 100 U/mL penicillin, 100 lg/mL streptomycin,
and 20 lg/mL amphotericin B for transport to the laboratory.
Epithelial cells lining the vas deferens were isolated as described previously
[30]. Briefly, the distal epididymis and transitional vas deferens were discarded
to insure that only the vas deferens was employed to obtain cells for the
reported studies. The remaining duct was stripped of connective tissue and
flushed with HBSS supplemented with antibiotics. After being filled to
distension with PBS containing trypsin, EDTA, and collagenase, the ducts were
incubated at 378C for 35 minutes. Following incubation, each duct was
massaged gently and epithelial cells were flushed from the duct with 5 mL of
growth medium (Dulbeccos modified Eagle medium, DMEM; Invitrogen,
Carlsbad, CA) supplemented with 10% heat-inactivated fetal bovine serum
(FBS; Atlanta Biological, Atlanta, GA), 100 U/mL penicillin and 100 lg/mL
streptomycin. The resulting suspensions of porcine vas deferens epithelial cells
for primary culture (18PVD) were seeded onto 25 cm2 tissue culture flasks
(Corning, Corning, NY).
Segments of distal human vas deferens were obtained from a local hospital
using procedures approved by both the University and hospital Institutional
Review Boards. The isolation of human vas deferens epithelial cells for primary
culture (18HVD) is similar to that of 18PVD cells and has been described
previously [43]. 18HVD cells were grown initially on 24-well tissue culture
plates (Cellstar; Marsh Biomedical Products, Rochester, NY).
Cell Culture
18PVD, 18HVD, PVD9902 (an immortalized epithelial cell line derived
from porcine vas deferens [28]), and LLC-PK1 cells (American Type Culture
Collection, Manassas, VA) were seeded and grown on 25-cm2 tissue culture
flasks or 24-well tissue culture plates and maintained in DMEM supplemented
with 10% FBS and 1% penicillin and streptomycin with media changes every
other day. LLC-PK1 cells, which were originally derived from porcine kidney,
are epithelial in nature and have been shown to express receptors for both
oxytocin and vasopressin [44]. Upon reaching confluency, cells were lifted
with PBS containing trypsin and EDTA, suspended, and seeded onto 1.13 or
0.33 cm2 Transwell permeable supports (Corning-Costar; Cambridge, MA)
with media replacement every other day until used (typically ;14 days) for
electrophysiology, RNA isolation, or cAMP assays.
Electrophysiology
Epithelial cell monolayers on permeable supports were placed into
individual modified Ussing flux chambers (model DCV9, Navicyte; San
Diego, CA) and bathed symmetrically in Ringer solution (composition in mM:
120 NaCl, 25 NaHCO3, 3.3 KH2PO4, 0.83 K2HPO4, 1.2 CaCl2, 1.2 MgCl2)
maintained at 398C for 18PVD and PVD9902 or 378C for 18HVD cells and
continuously bubbled with 5% CO2–95% O2. Monolayers were then clamped
to 0 mV and ISC was measured continuously with a voltage-clamp apparatus
(model 558C, University of Iowa, Dept. of Bioengineering, Iowa City, IA).
417
Annealing temp. (8C) Product length (bp)
50.1 525
56.6 340
52.7 866
52.0 353
Monolayers were periodically exposed to a 5 mV bipolar pulse and the
resulting change in current was used to calculate transepithelial electrical
resistance (RTE) according to Ohm’s law. Data were acquired digitally at 1 Hz
with an Intel-based computer using an MP100A-CE interface and AcqKnowl-
edge software (ver. 3.7.3, BIOPAC Systems, Santa Barbara, CA).
RNA Isolation
18PVD, PVD9902, and LLC-PK1 cells were grown on 4.5-cm2 Transwell
permeable supports (Corning-Costar) for 12–16 days with media changes every
other day, and total RNA was isolated using an RNeasy kit (Qiagen, Valencia,
CA). Cells were exposed to a lysis buffer supplied with the kit, transferred to a
QIAshredder column (Qiagen) and centrifuged to homogenize the preparation.
The supernatant was moved to an RNeasy column and, following a set of
appropriate washings, the RNA was eluted from the column using 30 lL of
nuclease-free water. Liver and pituitary were also dissected from pigs ,30 min
postmortem, and samples were immediately snap frozen in liquid nitrogen until
used for RNA extraction, at which time the tissue was ground with a mortar and
pestle and the RNA was isolated with the protocol outlined above. All RNA
samples were treated with Turbo DNA-free (Ambion, Austin, TX) to remove
genomic DNA, quantified on an ND-1000 spectrophotometer (NanoDrop
Technologies, Wilmington, DE), and finally stored at 808C until used for
molecular studies.
Reverse Transcription-PCR
Reverse transcription followed by amplicon generation of OXTR and the
vasopressin receptor subtypes (AVPR1A, AVPR1B, AVPR2) was performed
using a one-step RT-PCR kit (Qiagen). Primers specific for porcine OXTR and
AVPR2 and the porcine homologs of AVPR1A and AVPR1B were designed with
Beacon software (version 4.0, Premier Biosoft International; Palo Alto, CA)
and are presented in Table 1. RT-PCR reactions were assembled using 100–300
ng of total RNA, 400 lM dNTPs, 300 nM sense and antisense primers, 0.75 lL
enzyme mix and 5 lL buffer in a 25-lL reaction volume. The following
thermocycler protocol was performed: 30 min reverse transcription step at
508C, 15 min RT inactivation step at 958C followed by 40 cycles of a denature
step at 948C for 1 min, annealing step for 1 min and elongation at 728C for 1
min, with a final extension at 728C for 10 min on a Techne Touchgene
thermocycler (Krackler Scientific, Albany, NY). Reactions conducted with
ExTaq (TaKaRa, Otsu, Shiga, Japan) in place of the OneStep RT-PCR enzyme
mix were run in parallel. PCR products were resolved in a 1% agarose gel
containing 1 lg/mL ethidium bromide. Images were captured on a FluorChem
8900 imaging system (Alpha Innotech, San Leandro, CA) and processed for
publication using CorelDRAW (version 10.0) and Paint Shop Pro (version
5.01, Corel Corp.; Ottawa, Ontario, Canada).
Complementary DNA Sequencing
Amplicons from RT-PCR reactions were cut from gels, and the cDNA was
purified using a QIAquick gel extraction kit (Qiagen). Samples of cDNA were
then sequenced with a CEQ8000 (software version 8.0.52, instrument version
6.0.2, sequence analysis algorithm version 2.3.13, fragment analysis algorithm
version 2.2.1; Beckman Coulter; Fullerton, CA) according to the manufactur-
er’s specifications.
Cyclic AMP Measurements
Intracellular cAMP generation was measured in PVD9902 epithelial
monolayers using an immunoassay kit (Biotrak; Amersham Pharmacia Biotech,
Inc.; Piscataway, NJ) as described previously [43]. Briefly, PVD9902 cells
were seeded to permeable supports (0.33 cm2) and maintained for 13–15 days
with media changes every other day. Media in both the apical and basolateral
compartments was replaced by warmed PBS 1 h prior to assay. Monolayers
were then exposed to one of several treatments in PBS for 6 min prior to cell
lysis using reagents supplied in the kit. Results are initially expressed as pmol
418 HAGEDORN ET AL.
FIG. 1. 18HVD epithelial cell monolayers respond to oxytocin (OT) with
increased anion secretion as indicated by elevated ISC. Apical and
basolateral aspects of a 18HVD monolayer were exposed to OT (1 lM) as
indicated by the bars. Results are typical of two experiments conducted
with cells derived from two individuals. Dashed line represents zero net
current.
cAMP per Transwell (0.33 cm2) as determined from a standard curve and were
then normalized to standard treatments within each assay.
Chemical Sources
Forskolin (Coleus forskohlii) was purchased from Biomol (Plymouth
Meeting, PA). Penicillin, streptomycin, amphotericin B, collagenase, gentami-
cin and trypsin-EDTA (0.5% trypsin, 5.3 mM EDTA, 10X liquid) were
purchased from Invitrogen-Life Technologies (Carlsbad, CA). Oxytocin, Lys8-
vasopressin, Arg8-vasopressin, isoproterenol, chelerythrine, [b-Mercapto-b,b-
cyclopentamethylene-propionyl1, O-Me-Tyr2, Orn8]-oxytocin (selective OXTR
antagonist that also blocks AVPR1A designated by Sigma catalog # O6887),
and [Adamantaneacetyl1, O-Et-D-Tyr2, Val4, Aminobutyryl6, Arg8,9]-vaso-
pressin (selective AVPR2 antagonist designated by Sigma catalog # V2381)
were purchased from Sigma-Aldrich, Inc. (Saint Louis, MO). P9, a scrambled
nonapeptide (sequence: [H]-Met-Ala-Glu-Glu-Gly-Ala-Gly-Gly-Cys-[OH]),
was generously provided by Dr. John Tomich (Kansas State University,
Manhattan, KS). desGly-NH2, d(CH2)5[D-Tyr2, Thr4]ornithine-vasotocin (ST-
11-61; selective OXTR antagonist [45]) was generously provided by Dr.
Maurice Manning (Medical College of Ohio, Toledo, Ohio). (6)-5-dimethyl-
amino-1-[4-(2-methylbenzoylamino)benzoyl]-2,3,4,5-tetrahydro-1H-benzaze-
pine monohydrochloride (OPC-31260; selective AVPR2 antagonist [46]) and
1-[1-[4-(3-acetyalaminopropoxy)benzoyl]-4-piperidyl]-3, 4-dihydro-2(1H)-qui-
nolinone (OPC-21268; selective AVPR1A antagonist [46]) were gifts provided
by Dr. Koji Komuro (Otsuka Pharmaceutical Co., Ltd., Tokushima, Japan).
Statistical and Regression Analysis
A paired Student t-test or ANOVA was conducted using SAS (version 9.1,
SAS Institute Inc., Cary, NC) to compare means between different treatments.
Probability of type I error , 0.05 was considered statistically significant. A
modified Hill equation, y ¼ [axb]/[cb þ xb], was used in which y is the measured
DISC, a is the maximum DISC (DISC-MAX), x is the concentration of agonist, b is
the Hill coefficient, and c is the concentration required for a half-maximal
response (i.e., the apparent KD or kapp). The equation was fitted to each set of
data collected to test for concentration dependency. A Hill coefficient not
different from unity was confirmed for each fit, and the data were subsequently
refitted with the Hill coefficient constrained to unity to allow for a more direct
comparison of the kapp values derived for OT and VP in the presence and
absence of receptor antagonists and with different cell sources. Curve fitting
was conducted and all graphs were created using SigmaPlot (version 6.0, Systat
Software, Inc., Point Richmond, CA). Mean and SEM were calculated using a
Microsoft Excel spreadsheet.
RESULTS
OT Increases Anion Secretion Across Cultured Vas
Deferens Epithelial Cell Monolayers
Experiments were conducted to test the hypothesis that OT
stimulates ion transport across human vas deferens epithelia.
18HVD epithelial monolayers exhibited a baseline ISC and RTE
of 4.6 6 0.6 lA cm2 and 1750 6 300 X cm2, respectively (n
¼ 12). A subset of these monolayers was then exposed to 1 lM
FIG. 2. Porcine vas deferens epithelial cell monolayers respond to
oxytocin (OT) with changes in ISC that indicate anion secretion. A, B)
Typical response of 18PVD monolayers to basolateral OT exposure as
indicated by the bars. The typical responses illustrated in A and B were
observed in 4–5 experiments. C) Summary of data from 18PVD
monolayers where each data point represents 3–5 observations and
vertical bars indicate SEM. D) Responses of PVD9902 monolayers to
basolateral OT exposure are summarized. Each data point represents 3–6
observations, vertical bars indicate SEM. Solid lines in C and D represent
the best fit of a modified Hill equation to the data sets. Parameters of the
fits are included in the text.
OT, a concentration expected to be maximally effective. Apical
exposure to OT caused no discernable effect while basolateral
exposure stimulated a rapid increase in ISC, indicating an
increase in anion secretion [29, 30], that subsequently relaxed
toward baseline (Fig. 1). In all experiments, 18HVD monolay-
ers responded to basolateral OT exposure and the peak DISC
was 5.7 6 0.9 lA cm2 (n ¼ 4). These results suggest that
OXTRs are present in the basolateral aspect of human vas
deferens epithelia and that OT exposure is linked to acute
stimulation of anion secretion.
OT stimulates a change in ISC across 18PVD epithelial cell
monolayers that is similar to the response of 18HVD. 18PVD
epithelial cells were employed to more fully characterize the
response due to their ready availability and ease of use. Cells
used in the present studies were derived from 13 different
animals. Cultured monolayers used throughout all experiments
exhibited a baseline ISC and RTE of 0.7 6 0.1 lA cm2 and
3400 6 200 X cm2 (n ¼ 90 wells), respectively. A subset of
these monolayers was employed in experiments to characterize
the concentration-dependent effect of OT on vas deferens
epithelial ion transport. Typical results are presented in Figure
2, A and B. The basolateral aspect of 18PVD monolayers were
exposed to OT (1 nM or 100 nM, as indicated) that resulted in
rapid rise in ISC followed by a return toward baseline. Data for
DISC from Figure 2, A and B are included with similar
observations that are summarized in Figure 2C, where each
data point represents the average response of 18PVD
monolayers to the given OT concentration. The solid line
represents the best fit of a modified Hill equation to the data
set, which predicts a DISC-MAX of 3.1 6 0.4 lA cm2 and a kapp
of 1.8 6 1.2 nM.
 REGULATION OF VAS DEFERENS ANION SECRETION 419

PVD9902 epithelial cells also exhibited OT-induced

increases in anion secretion. PVD9902 have been described
recently [28] and were used extensively for the present studies.
Baseline parameters are similar to 18PVD with baseline ISC and
RTE of 0.5 6 0.1 lA cm2 and 4600 6 200 X cm2,
respectively (n ¼ 226 wells). A subset of these PVD9902
monolayers was exposed to various concentrations of OT, and
the resultant DISC were virtually indistinguishable from
responses of 18PVD cells. Data are summarized in Figure
2D, where each data point indicates the average response of
monolayers to the given concentration of OT, and the fit of the
modified Hill equation to the data revealed a DISC-MAX of 4.8 6
0.4 lA cm2 with a kapp of 0.2 6 0.1 nM. When compared
with observations with 18PVD monolayers (Fig. 2C), addi-
tional observations were made at lower concentrations to
document the full concentration-response profile and confor-
mity to Michalis-Menten kinetics. These results indicate that
OT stimulates a concentration-dependent increase in anion
secretion across vas deferens epithelia, and that stimulation
occurs at concentrations that have been measured in serum
from sexually aroused men [47] and from rams [48].

OXTR Antagonists Reduce OT-Stimulated Anion Secretion

Across Cultured Porcine Vas Deferens Epithelial Cell
Monolayers
The receptor(s) that mediates the effect of OT on anion
secretion across vas deferens epithelia was evaluated utilizing
pharmacological methods. OXTR antagonists ST-11–61 (80
nM) and O6887 (20 nM) had no effect on ISC when added to
the basolateral compartment. However, the subsequent re-
sponse to OT (3 or 30 nM) was reduced by both antagonists
when compared to untreated controls (Fig. 3A). Similar studies
were performed with PVD9902 monolayers and both ST-11–
61 (80 nM) and O6887 (20 nM) reduced the magnitude of OT-
stimulated DISC. Data analysis revealed that ST-11–61 caused a
right-shift in the concentration-response when compared to
untreated monolayers where the derived kapp values were 15.2
6 20.6 nM and 1.3 6 1.2 nM, respectively (Fig. 3B).
Additionally, O6887 caused a right-shift in the concentration-
dependent response compared to untreated monolayers where
the derived kapp values were 12.7 6 21.3 nM and 0.5 6 1.1
nM, respectively (Fig. 3C). These results suggest that OXTR is
expressed in porcine vas deferens epithelia and functionally
linked to the stimulation of anion secretion.
OXTR, AVPR2, and AVPR1A mRNAs Are Present in
Porcine Vas Deferens Epithelia
Experiments were conducted to test for the presence of
mRNA for all of the receptors that OT is known to bind and
activate. Primers designed to detect transcripts of OXTR,
AVPR2, AVPR1A, and AVPR1B were used to probe total RNA
isolated from 18PVD epithelial cells from 6 to 12 different pigs
and 3 to 4 different PVD9902 cell passages. Primer
information, including probe sequence, annealing temperature,
and expected product size is presented in Table 1. Reactions
using OXTR, AVPR2, and AVPR1A primers and total RNA
isolated from 18PVD and PVD9902 epithelial monolayers
yielded bands of expected mobility (Fig. 4). Parallel reactions
were conducted using RNA from alternative tissues (LLC-PK1
cells and porcine liver) shown previously to express mRNA for
each receptor of interest, and amplicons of expected mobility
were obtained using the same primer sets to generate amplicons
from OXTR, AVPR2, and AVPR1A transcripts. Primers
designed to amplify AVPR1B failed to generate a product
FIG. 3. Oxytocin receptor antagonists competitively inhibit oxytocin-
stimulated anion secretion. A) 18PVD monolayers pretreated with ST-11–
61 (80 nM) or O6887 (20 nM) exhibit a significant reduction in DISC
compared with untreated monolayers following exposure to 30 nM OT
(gray bars) or 3 nM OT (cross-hatched bars). B, C) Summary of data
demonstrating the concentration-dependent response of PVD9902 mono-
layers to OT in the absence (white triangle) or presence (black circle) of ST-
11–61 (B) or in the presence (black square) of O6887 (C). Each data point
represents the mean and SEM of 3–4 observations. Each solid line
represents the best fit of a modified Hill equation to each data set.
Parameters of each fit are included in the text. Asterisk (*) indicates
significant difference (P , 0.05) from response in monolayers not exposed
to OXTR antagonists.
from 18PVD or PVD9902 total RNA. However, a parallel
reaction conducted with the same primer set and RNA isolated
from porcine pituitary tissue produced a band of expected
mobility. Each amplicon represented in Figure 4 was
sequenced and BLAST (NCBI) analysis revealed that each
product had a sequence identity corresponding to each receptor
that was studied. The molecular analysis for expression of
various receptors in 18PVD and PVD9902 cells indicate that
mRNA for OXTR, AVPR2, AVPR1A, but not AVPR1B is
present in porcine vas deferens epithelia.
Vasopressin Increases ISC in Cultured Vas Deferens
Epithelial Cell Monolayers
The presence of AVPR2 and AVPR1A mRNA in porcine vas
deferens epithelial cells suggested that these receptors may also
be functionally expressed and linked to changes in ion
transport. Therefore, experiments were conducted to test the
effect of VP on cultured porcine vas deferens epithelial
monolayers. 18PVD monolayers were exposed to various
concentrations of VP that resulted in a concentration-dependent
increase in ISC that returned toward baseline values (Fig. 5, A
and B). Data are summarized in Figure 5C, where the DISC-MAX
420 HAGEDORN ET AL.
FIG. 4. Gel images demonstrate the expression of mRNA for various
receptors in 18PVD monolayers (first column), PVD9902 monolayers
(second column), and alternative tissues (third column). Amplicons for
OXTR and AVPR2 with expected mobilites (525 bp and 353 bp,
respectively) were generated via RT-PCR utilizing RNA isolated from
18PVD, PVD9902, and LLC-PK1 monolayers. Amplicons for the AVPR1A
(expected mobility 340 bp) were generated from RNA isolated from
18PVD monolayers and porcine liver tissue. An amplicon for the AVPR1B
was generated from RNA isolated from porcine pituitary tissue. All
reactions utilizing total RNA from 18PVD and PVD9902 monolayers were
repeated in at least three individual experiments, and each band
illustrated in this figure was sequenced with a confirmed identity for the
given receptor. Arrowheads denote 500 bp.
and kapp values derived from a Hill equation that was fitted to
the data were 2.9 6 0.4 lA cm2 and 200 6 100 nM,
respectively. PVD9902 epithelial monolayers also responded to
VP and the data are summarized in Figure 5D, where the values
derived for DISC-MAX was 4.3 6 0.6 lA cm2 and kapp was 54
6 35 nM. Experiments performed using 18HVD monolayers
revealed that apical VP (1 lM) was without effect, but that
basolateral exposure to VP (0.1 lM) resulted in a rapid
increase in ISC (Fig. 6). For 18HVD monolayers, the average
DISC induced by 100 nM VP was 5.3 6 2.0 lA cm2 (n ¼ 7).
These results indicate that VP has a clear effect on both human
and porcine vas deferens epithelia, but the identity of the
receptor(s) mediating this effect was unclear.
OT and VP Receptor Antagonists Reduce VP-Stimulated
Anion Secretion Across Cultured Porcine Vas Deferens
Epithelial Cell Monolayers
A set of pilot experiments was performed to test for the
receptor(s) that mediates VP-stimulated DISC across porcine
vas deferens epithelia. PVD9902 monolayers were exposed to
one of three concentrations of VP in the absence or presence of
O6887, a selective OXTR antagonist that also has blocking
activity at AVPR1A. Monolayers that were not exposed to
O6887 exhibited a concentration-dependent increase in VP-
stimulated DISC with a maximal effect observed at 300 nM
(Fig. 7, A–C). Alternatively, monolayers that were pretreated
FIG. 5. Vasopressin (VP) stimulates ISC across porcine vas deferens
epithelial cell monolayers. A, B) Typical responses of 18PVD monolayers
to basolateral VP exposure as indicated by the bars. The typical responses
illustrated in A and B were observed in four experiments. C) Summary of
data for VP-stimulated DISC where each data point represents 3–4
observations, vertical bars indicate SEM, and the solid line shows the
best fit a modified Hill equation to the data set. D) Summarized data
demonstrating response of PVD9902 monolayers to VP where each data
point represents 3–7 observations, vertical bars indicate SEM, and the
solid line represents the best fit a modified Hill equation to the data set.
Parameters of the fitted lines are included in the text.
with O6887 exhibited a reduced DISC that was of the same
magnitude regardless of the concentration of VP used for
stimulation (Fig. 7, D–F). Additionally, the magnitude of DISC
in all monolayers pretreated with O6887 was similar to that
observed in the monolayer that had no O6887 exposure and
was stimulated with 30 nM VP (Fig. 7C). These results
suggested that, at concentrations in excess of 30 nM, VP may
be stimulating anion secretion by interactions with an OXTR or
AVPR1A. However, the lower concentration of VP used in this
study stimulates a DISC that is mediated by a receptor other
than OXTR or AVPR1A in porcine vas deferens epithelia.
Additional experiments were conducted to identify this
receptor.
Pharmacological analysis suggests that the lowest concen-
tration of VP used in these experiments, 30 nM, interacts with
AVPR2 to stimulate an increase in anion secretion. Therefore,
PVD9902 epithelial monolayers were exposed to 30 nM VP in
FIG. 6. Vasopressin (VP) stimulates ISC across human vas deferens
epithelial cell monolayers. The apical and basolateral aspects of a 18HVD
monolayer were exposed to VP as indicated by the bars. Responses are
typical of results from two experiments.
 REGULATION OF VAS DEFERENS ANION SECRETION
FIG. 7. O6887, an OXTR and AVPR1A antagonist, precludes the
stimulatory effect of high but not low concentrations of VP on PVD9902
monolayers. PVD9902 monolayers were exposed to three different
concentrations of VP, as indicated, in the absence (A–C) or presence
(D–F) of O6887 (300 nM).
the absence or presence of one of several receptor subtype
selective antagonists (V2381, OPC-31260, O6887, OPC-
21268, or ST-11–61). Monolayers exposed to VP in the
presence of AVPR2-selective antagonists (V2381 or OPC-
31260) exhibited a significantly lower DISC compared with
paired monolayers that had no antagonist pretreatment (Fig. 8).
Alternatively, pretreating PVD9902 monolayers with antago-
nists selective for OXTR (ST-11–61), for AVPR1A (OPC-
21268), or mixed OXTR/AVPR1A (O6887) resulted in a VP-
stimulated DISC that was indistinguishable from untreated
monolayers (Fig. 8). These outcomes provide compelling
evidence that lower concentration of VP used in these
experiments stimulates anion secretion across vas deferens
epithelial cells by interacting with an AVPR2.
OT- and VP-Stimulated Anion Secretion Requires
PKC Activity
Functional, pharmacological, and molecular analysis indi-
cated the presence of OXTR and AVPR2 in vas deferens
epithelia. Thus, experiments were conducted to explore the
intracellular pathways that might be associated with activation
of these receptors in porcine vas deferens epithelia.
The effects of OT, VP, and forskolin on DISC were assessed
in PVD9902 monolayers in the absence and presence of
chelerythrine, a broad-spectrum PKC antagonist. Monolayers
were mounted in Ussing chambers and exposed to cheleryth-
rine (4 lM) for 20 min prior to stimulant exposure. OT
stimulated a maximal DISC that was, on average, 65% less than
the response in paired monolayers that were not exposed to
chelerythrine (Fig. 9). Additionally, the response to VP was, on
average, 40% less in the presence of chelerythrine, although
statistical significance was not achieved. Alternatively, chele-
rythrine had no discernable effect on forskolin-stimulated DISC.
These results demonstrate that OT stimulation of anion
secretion across porcine vas deferens epithelia requires PKC
activity, as expected for OXTR mediated responses. Addition-
ally, the data suggest that PKC contributes to a portion of VP-
induced anion secretion, likely due to activation of OXTR, or
perhaps an AVPR1A.
VP but Not OT Stimulates an Increase in Intracellular cAMP
PVD9902 monolayers were exposed to one of several
treatments, and following cell lysis, the resulting generation of
intracellular cAMP was measured. In order to establish a
421
FIG. 8. AVPR2 antagonists inhibit VP-stimulated DISC across porcine vas
deferens epithelia. PVD9902 monolayers were exposed to selective
receptor antagonists or remained untreated as indicated and subsequently
were exposed to VP (30 nM). When compared to vehicle-treated control,
the response to VP was less with AVPR2 antagonists (V2381, 10 lM; OPC-
31260, 10 lM), but unaffected by oxytocin or AVPR1A antagonists
(O6887, 300 nM; OPC-21268, 100 lM; ST-11–61, 1 lM). Each bar
represents mean and SEM for 4–6 observations from a total of six
experiments. Asterisks indicate significant difference (P , 0.05) from
response in paired control conditions.
baseline level of cAMP, one monolayer in each experimental
block was exposed to water as a vehicle treatment. Another
monolayer was exposed to forskolin, a receptor independent
activator of adenylyl cyclase, in order to determine a standard
level of cAMP generation in PVD9920 monolayers. The level
of cAMP generated from all other treatments (OT, VP,
Isoproterenol, P9) was measured and expressed as a percent
of the average forskolin-stimulated response. Monolayers that
were exposed to OT generated levels of cAMP that were no
different from the levels associated with water or scrambled
nonapeptide (P9; Fig. 10). Alternatively, monolayers treated
with various concentrations of VP exhibited incremental
increases in cAMP accumulation. At the highest concentration
of VP tested, 3 lM, the amount of cAMP was greater than that
observed in the forskolin treated cells and lower than that
observed in isoproterenol treated cells (Fig. 10). These data
suggest that VP-stimulated anion secretion across porcine vas
deferens epithelia is coupled to cAMP generation, while OT-
stimulated anion secretion occurs thru a cAMP-independent
mechanism.
DISCUSSION
The results of this study provide functional evidence to
demonstrate that OT and VP stimulate ion transport across vas
deferens epithelia. Key experiments were conducted with cells
derived from human vas deferens and the results show that OT
and VP act exclusively at the basolateral membrane to cause a
rapid increase in ISC that we interpret as HCO3 and/or Cl
secretion. Additional studies with cells derived from porcine
ducts (18PVD and PVD9902 epithelial monolayers) provide
functional, pharmacological, and molecular evidence to
support the conclusion that OT and VP modify ion transport
across vas deferens epithelium through interactions with
OXTR and AVPR2, respectively, although AVPR1A may
also be present. Finally, the results show that stimulation of
422 HAGEDORN ET AL.
FIG. 9. Chelerythrine, a PKC antagonist, reduces oxytocin (OT)-induced
ion transport across porcine vas deferens epithelial monolayers. Paired
monolayers were exposed to chelerythrine (4 lM) or vehicle control for 20
min before exposure to OT, vaspressin (VP), or forskolin (Fsk). Each bar
represents the mean and SEM from 4–6 paired observations. Asterisk
indicates significant difference (P , 0.05) from response in paired
untreated conditions.
anion secretion by OT, and to a lesser extent VP, requires PKC
activity. Alternatively, VP acts through AVPR2 to increase
cAMP generation. All of these observations have a significant
impact on our understanding of vas deferens physiology as it
participates to normal reproductive function.
Vas deferens epithelia are capable of secreting both HCO3
and Cl [28–30]. Results from previous studies in this
laboratory have documented, with functional assays, CFTR
and ENaC in apical membranes and SLC4A4 (formerly known
as pNBC), Na þ/K þ ATPase, Na þ/K þ/2Cl cotransporter, and
K þ channel(s) in the basolateral membranes of cells derived
from porcine or human vas deferens [28–30, 43]. A recent
report provided molecular evidence indicating expression of
additional transporters that might contribute to HCO3
secretion, including SLC26A3 (the epithelial protein that is
mutated to cause congenital chloride diarrhea, also known as
downregulated in adenoma, DRA), SLC26A4 (pendrin), and
SLC26A6 (also known as putative anion transporter 1, PAT1,
and as a Cl/formate exchanger, CFEX) [28]. AQP2 and AQP9
are reportedly expressed in rat epididymis and/or vas deferens
[49, 50] and mRNA coding for these proteins has been detected
in 18HVD (BDS, unpublished observation). These components
can be configured in theoretical cell models to secrete
preferentially either HCO3 or Cl, or some combination of
these anions while maintaining an isotonic luminal milieu.
Secretion associated with OT and VP stimulation of the vas
deferens could incorporate one or both of these anions that
would osmotically affect water movement through aquaporins
that are reportedly resident in the epithelial cell membranes
[49, 51]. Thus, neurohypophyseal hormones have the potential
to modify the fluid volume in the duct lumen as well as
changing the pH due to HCO3 secretion, outcomes that would
be expected to affect sperm activity or viability.
OT and VP are now firmly placed among a list of
physiological agents that are documented to increase anion
secretion across epithelial cells derived from the vas deferens.
Norepinephrine, vasoactive intestinal peptide (VIP), histamine,
adenosine, and VP were reported previously to stimulate anion
secretion across 18PVD [30] and PVD9902 cells [28], and
adenosine was shown to stimulate anion secretion by 18HVD
cells [43]. A clearer picture of anion secretion regulation
emerges as these observations are combined. Norepinephrine,
FIG. 10. Vasopressin stimulates cAMP generation in porcine vas
deferens epithelia. PVD9902 cell monolayers were exposed to the
indicated treatments for 6 min prior to cell lysis and assay. Results are
expressed as the percent of the forskolin-stimulated change in cAMP.
Treatments: P9, a nonapeptide lacking disulfide bonds; OT, oxytocin; VP,
vasopressin; Fsk, forskolin; Iso, isoproterenol. Each bar represents the
mean and SEM from 3–5 observations that were included in a total of
seven individual assays.
VIP, VP, and OT exhibit activity exclusively from the
basolateral aspect of the cells, whereas adenosine effects on
18HVD are observed only with apical exposure [43].
Adrenergic agonists, adenosine and VP increase adenylyl
cyclase activity to promote cAMP generation, whereas OT (and
VP likely acting at OXTR) appears to act via a PKC-dependent
mechanism. These results suggest that vas deferens epithelial
cells integrate signals from a variety of sources to produce a
fine-tuned response in the rate and composition of secretions.
Submucosal neurons in pig and human vas deferens reportedly
contain noradrenalin, VIP, neuropeptide Y, somatostatin,
calcitonin gene-related peptide, substance P, galanin, and nitric
oxide synthase [52–56]. There may, however, be some species
to species differences in OXTR-mediated function, as strong
OXTR immunoreactivity has been reported for epithelial cells
lining the vas deferens of rams [57] while little OXTR
immunoreactivity was observed in marmoset vas deferens [36].
There is clearly a response to OT and VP by cells derived from
both the human and pig vas deferens when grown in culture.
The source of either VP or OT that would affect vas deferens
function in vivo is uncertain. Some reports have suggested that
OT is synthesized in the testis [36] and that sexual arousal or
orgasm may be associated with elevated serum OT levels [37–
39, 47], presumably from the pituitary. Likewise, substantial
amounts of VP are also present in testis [38], which suggests
local synthesis, and serum levels of VP increase prior to
ejaculation [39]. Regardless of source, the present results show
that concentrations of OT and VP at or near the physiological
range can modify the activity of epithelial cells derived from
the vas deferens that, in vivo, would be expected to modify the
volume and composition of the luminal environment.
Contributions of the vas deferens to male fertility are poorly
defined. Mammalian sperm can neither swim nor fertilize an
egg when they leave the testis, but acquire these abilities as
they traverse the epididymis [1, 2]. The efferent ducts
 REGULATION OF VAS DEFERENS ANION SECRETION
concentrate sperm by reducing fluid volume by ;96% while
maintaining constant Na þ and Cl concentrations [3, 4].
Approximately 50% of the remaining fluid is absorbed in the
epididymes [3]. Luminal pH is reportedly reduced from neutral
in the rete testis to ;6.5 in the caput epididymis, a pH that
maintains sperm in a quiescent state during storage [58].
HCO3 exposure activates sperm by directly stimulating
soluble adenylyl cyclase [11, 12] and by the activation of
Ca2 þ channels resulting in hypermotility [10]. It was proposed
previously that adrenergic stimuli during the pre-ejaculatory
arousal period would be expected induce HCO3 secretion that
would raise luminal pH and initiate the activation process in
sperm [30]. Current results suggest that OT and/or VP may
have a similar effect. The serum concentration of both
hormones increases during sexual arousal [39] and the results
show that direct effects on epithelial anion secretion can occur
near the range of concentrations reported in serum. Taken
together, these observations strongly suggest that vas deferens
epithelium is acutely modulated by OT and VP, in addition to
locally released neurotransmitters.
Infertility is a pervasive problem throughout the world.
Using the World Health Organization definition for infertility,
;15% of couples worldwide experience primary or secondary
infertility, with male factors contributing to approximately half
of all cases [15–19]. That epithelial ion transport diseases
contribute to male infertility, including obstructive azoosper-
mia, is well-documented with the recessively inherited disease
of CF. Ninety-seven percent of CF men have impaired
reproductive function [59] with reduced sperm quality in some
cases [23–27, 60] and gross changes in vas deferens anatomy
in others [20, 60–63]. Furthermore, numerous studies have
shown that a disproportionately high percentage of men
seeking assistance at reproductive health centers have at least
one affected CFTR allele [23–26]. These observations suggest
that, in the vas deferens or the epididymis, CFTR plays a role
that is critical to normal male reproductive function. In addition
to this well-documented population, an unacceptably high
proportion of male infertility cases are diagnosed as idiopathic
[16, 22, 27]. Such diagnoses provide no logical therapeutic
options and research to determine root causes is lagging [15].
Outcomes from the current studies suggest that OT or VP
contribute to normal male reproductive function and thus,
aberrant hormone release or function may contribute to
infertility in some individuals. Additionally, the current
outcomes suggest that therapies for other conditions may
impact function in the male reproductive tract incidentally.
Indeed, consideration must be given to current clinical
treatments that target OXTR or AVPR2. OT has been utilized
to treat a variety of disorders including autism, Asperger’s
syndrome, and obsessive compulsive disorder [64–66]. Addi-
tionally, VP analogs such as OPC-31260, SR-121463, and
OPC-41061 (tolvaptan) have been developed to antagonize
AVPR2 in order to treat a variety of conditions including
congestive heart failure, hypertension, hyponatremia, and
nephritic syndrome [67, 68]. Although the prospect of treating
these illnesses is promising, the effects of OT and VP analogs
on the normal function of vas deferens epithelium must be
considered as one seeks to optimize patient quality of life.
In conclusion, the results from this study have expanded the
working model that describes ion transport across vas deferens
epithelial cells. Neurohypophyseal hormones, OT and VP,
have a clear stimulatory effect on anion secretion across
porcine and human epithelial cells, and these effects are
mediated though OXTR and AVPR2, respectively. Addition-
ally, OT and VP stimulation of vas deferens epithelia requires
PKC activity, and the effects of VP, but not OT, are coupled to
423
the generation of cAMP. These results could provide insight
necessary to develop treatments for male infertility as well as
male contraceptives. Finally, treatment regimens that exploit
OXTR and AVPR2 may need to be reviewed in light of their
potential effects on male fertility.
ACKNOWLEDGMENTS
The authors extend special thanks to Dr. Fernando Pierucci-Alves, Dr.
Rebecca Quesnell, and Ms. Natalee Holt for technical assistance. Thanks
are extended to Mr. Roy Henry, Dr. John Devine, Mr. Dick Allen, Henrys
Limited, and the Via Christi Health System for assistance in tissue
procurement. Finally, the authors extend their appreciation to Dr. Frank
Blecha and Dr. Lisa Freeman for coordinating research opportunities for
professional students in the veterinary medicine curriculum.
REFERENCES
1. Orgebin-Crist MC. Sperm maturation in rabbit epididymis. Nature 1967;
216:816–818.
2. Zhou CX, Zhang YL, Xiao L, Zheng M, Leung KM, Chan MY, Lo PS,
Tsang LL, Wong HY, Ho LS, Chung YW, Chan HC. An epididymis-
specific beta-defensin is important for the initiation of sperm maturation.
Nat Cell Biol 2004; 6:458–464.
3. Jones RC. Luminal composition and maturation of spermatozoa in the
genital ducts of the African elephant (Loxodonta africana). J Reprod Fertil
1980; 60:87–93.
4. Clulow J, Jones RC, Hansen LA. Micropuncture and cannulation studies
of fluid composition and transport in the ductuli efferentes testis of the rat:
comparisons with the homologous metanephric proximal tubule. Exp
Physiol 1994; 79:915–928.
5. Blomqvist SR, Vidarsson H, Soder O, Enerback S. Epididymal expression
of the forkhead transcription factor Foxi1 is required for male fertility.
Embo J 2006; 25:4131–4141.
6. Pastor-Soler N, Pietrement C, Breton S. Role of acid/base transporters in
the male reproductive tract and potential consequences of their
malfunction. Physiology (Bethesda) 2005; 20:417–428.
7. Brown D, Breton S. H( þ)V-ATPase-dependent luminal acidification in
the kidney collecting duct and the epididymis/vas deferens: vesicle
recycling and transcytotic pathways. J Exp Biol 2000; 203:137–145.
8. Brown D, Smith PJ, Breton S. Role of V-ATPase-rich cells in acidification
of the male reproductive tract. J Exp Biol 1997; 200:257–262.
9. Zhou Q, Clarke L, Nie R, Carnes K, Lai LW, Lien YH, Verkman A,
Lubahn D, Fisher JS, Katzenellenbogen BS, Hess RA. Estrogen action and
male fertility: roles of the sodium/hydrogen exchanger-3 and fluid
reabsorption in reproductive tract function. Proc Natl Acad Sci U S A
2001; 98:14132–14137.
10. Kirichok Y, Navarro B, Clapham DE. Whole-cell patch-clamp measure-
ments of spermatozoa reveal an alkaline-activated Ca2 þ channel. Nature
2006; 439:737–740.
11. Chen Y, Cann MJ, Litvin TN, Iourgenko V, Sinclair ML, Levin LR, Buck
J. Soluble adenylyl cyclase as an evolutionarily conserved bicarbonate
sensor. Science 2000; 289:625–628.
12. Luconi M, Porazzi I, Ferruzzi P, Marchiani S, Forti G, Baldi E. Tyrosine
phosphorylation of the a kinase anchoring protein 3 (AKAP3) and soluble
adenylate cyclase are involved in the increase of human sperm motility by
bicarbonate. Biol Reprod 2005; 72:22–32.
13. Huang SJ, Leung AY, Fu WO, Chung YW, Zhou TS, Chan PS, Wong PY.
Electrophysiological studies of anion secretion in cultured human
epididymal cells. J Physiol 1992; 455:455–469.
14. Huang SJ, Fu WO, Chung YW, Zhou TS, Wong PY. Properties of cAMP-
dependent and Ca(2þ)dependent whole cell Cl conductances in rat
epididymal cells. Am J Physiol 1993; 264:C794–C802.
15. Birenbaum-Carmeli D, Carmeli YS, Casper RF. Discrimination against
men in infertility treatment. J Reprod Med 1995; 40:590–594.
16. Kolettis PN. Evaluation of the subfertile man. Am Fam Physician 2003;
67:2165–2172.
17. Krause W. Contribution of andrological factors to sterility. Andrologia
1996; 28(suppl 1):15–17.
18. Comhaire F. Economic strategies in modern male subfertility treatment.
Hum Reprod 1995; 10(suppl 1):103–106.
19. Philippov OS, Radionchenko AA, Bolotova VP, Voronovskaya NI,
Potemkina TV. Estimation of the prevalence and causes of infertility in
western Siberia. Bull World Health Organ 1998; 76:183–187.
20. Denning CR, Sommers SC, Quigley HJ Jr. Infertility in male patients with
cystic fibrosis. Pediatrics 1968; 41:7–17.
424 HAGEDORN ET AL.
21. Gazvani R, Lewis-Jones DI. Cystic fibrosis mutation screening before
assisted reproduction. Int J Androl 2004; 27:1–4.
22. Jarzabek K, Zbucka M, Pepinski W, Szamatowicz J, Domitrz J, Janica J,
Wolczynski S, Szamatowicz M. Cystic fibrosis as a cause of infertility.
Reprod Biol 2004; 4:119–129.
23. Cuppens H, Cassiman JJ. CFTR mutations and polymorphisms in male
infertility. Int J Androl 2004; 27:251–256.
24. Dohle GR, Halley DJ, Van Hemel JO, van den Ouwel AM, Pieters MH,
Weber RF, Govaerts LC. Genetic risk factors in infertile men with severe
oligozoospermia and azoospermia. Hum Reprod 2002; 17:13–16.
25. Traystman MD, Schulte NA, MacDonald M, Anderson JR, Sanger WG.
Mutation analysis for cystic fibrosis to determine carrier status in 167
sperm donors from the Nebraska Genetic Semen Bank. Hum Mutat 1994;
4:271–275.
26. van der Ven K, Messer L, van der Ven H, Jeyendran RS, Ober C. Cystic
fibrosis mutation screening in healthy men with reduced sperm quality.
Hum Reprod 1996; 11:513–517.
27. Jakubiczka S, Bettecken T, Stumm M, Nickel I, Musebeck J, Krebs P,
Fischer C, Kleinstein J, Wieacker P. Frequency of CFTR gene mutations
in males participating in an ICSI programme. Hum Reprod 1999; 14:
1833–1834.
28. Carlin RW, Sedlacek RL, Quesnell RR, Pierucci-Alves F, Grieger DM,
Schultz BD. PVD9902, a porcine vas deferens epithelial cell line that
exhibits neurotransmitter-stimulated anion secretion and expresses numer-
ous HCO3() transporters. Am J Physiol Cell Physiol 2006; 290:C1560–
C1571.
29. Carlin RW, Quesnell RR, Zheng L, Mitchell KE, Schultz BD. Functional
and molecular evidence for Naþ-HCO3 cotransporter in porcine vas
deferens epithelia. Am J Physiol Cell Physiol 2002; 283:C1033–C1044.
30. Sedlacek RL, Carlin RW, Singh AK, Schultz BD. Neurotransmitter-
stimulated ion transport by cultured porcine vas deferens epithelium. Am J
Physiol Renal Physiol 2001; 281:F557–F570.
31. Gimpl G, Fahrenholz F. The oxytocin receptor system: structure, function,
and regulation. Physiol Rev 2001; 81:629–683.
32. Studdard PW, Stein JL, Cosentino MJ. The effects of oxytocin and
arginine vasopressin in vitro on epididymal contractility in the rat. Int J
Androl 2002; 25:65–71.
33. Botting JH. Spurious effects of commercial preparations of oxytocin on
the isolated vas deferens of the rat. Br J Pharmacol 1981; 72:101–102.
34. Knight TW. A qualitative study of factors affecting the contractions of the
epididymis and ductus deferens of the ram. J Reprod Fertil 1974; 40:19–29.
35. Frayne J, Nicholson HD. Localization of oxytocin receptors in the human
and macaque monkey male reproductive tracts: evidence for a physiolog-
ical role of oxytocin in the male. Mol Hum Reprod 1998; 4:527–532.
36. Einspanier A, Ivell R. Oxytocin and oxytocin receptor expression in
reproductive tissues of the male marmoset monkey. Biol Reprod 1997; 56:
416–422.
37. Carmichael MS, Humbert R, Dixen J, Palmisano G, Greenleaf W,
Davidson JM. Plasma oxytocin increases in the human sexual response. J
Clin Endocrinol Metab 1987; 64:27–31.
38. Wathes DC. Oxytocin and vasopressin in the gonads. Oxf Rev Reprod
Biol 1989; 11:225–283.
39. Ivell R, Balvers M, Rust W, Bathgate R, Einspanier A. Oxytocin and male
reproductive function. Adv Exp Med Biol 1997; 424:253–264.
40. Holmes CL, Landry DW, Granton JT. Science review: vasopressin and the
cardiovascular system part 1-receptor physiology. Crit Care 2003; 7:427–
434.
41. Medina P, Segarra G, Chuan P, Domenech C, Vila JM, Aldasoro M, Lluch
S. Vasopressin receptors involved in adrenergic neurotransmission in the
circular muscle of the human vas deferens. Eur J Pharmacol 1998; 355:41–
49.
42. Medina P, Martinez MC, Aldasoro M, Vila JM, Chuan P, Lluch S.
Contractile responses of human deferential artery and vas deferens to
vasopressin. Eur J Pharmacol 1996; 300:221–225.
43. Carlin RW, Lee JH, Marcus DC, Schultz BD. Adenosine stimulates anion
secretion across cultured and native adult human vas deferens epithelia.
Biol Reprod 2003; 68:1027–1034.
44. Gorbulev V, Buchner H, Akhundova A, Fahrenholz F. Molecular cloning
and functional characterization of V2 [8-lysine] vasopressin and oxytocin
receptors from a pig kidney cell line. Eur J Biochem 1993; 215:1–7.
45. Manning M, Miteva K, Pancheva S, Stoev S, Wo NC, Chan WY. Design
and synthesis of highly selective in vitro and in vivo uterine receptor
antagonists of oxytocin: comparisons with Atosiban. Int J Pept Protein Res
1995; 46:244–252.
46. Japundzic-Zigon N, Milutinovic S, Jovanovic A. Effects of nonpeptide
and selective V1 and V2 antagonists on blood pressure short-term
variability in spontaneously hypertensive rats. J Pharmacol Sci 2004; 95:
47–55.
47. Kruger TH, Haake P, Chereath D, Knapp W, Janssen OE, Exton MS,
Schedlowski M, Hartmann U. Specificity of the neuroendocrine response
to orgasm during sexual arousal in men. J Endocrinol 2003; 177:57–64.
48. Pinckard KL, Stellflug J, Stormshak F. Influence of castration and
estrogen replacement on sexual behavior of female-oriented, male-
oriented, and asexual rams. J Anim Sci 2000; 78:1947–1953.
49. Stevens AL, Breton S, Gustafson CE, Bouley R, Nelson RD, Kohan DE,
Brown D. Aquaporin 2 is a vasopressin-independent, constitutive apical
membrane protein in rat vas deferens. Am J Physiol Cell Physiol 2000;
278:C791–C802.
50. Pastor-Soler N, Bagnis C, Sabolic I, Tyszkowski R, McKee M, Van Hoek
A, Breton S, Brown D. Aquaporin 9 expression along the male
reproductive tract. Biol Reprod 2001; 65:384–393.
51. Badran HH, Hermo LS. Expression and regulation of aquaporins 1, 8, and
9 in the testis, efferent ducts, and epididymis of adult rats and during
postnatal development. J Androl 2002; 23:358–373.
52. Kaleczyc J. Origin and neurochemical characteristics of nerve fibres
supplying the mammalian vas deferens. Microsc Res Tech 1998; 42:409–
422.
53. Jen PY, Dixon JS, Gosling JA. Co-localization of nitric oxide synthase,
neuropeptides and tyrosine hydroxylase in nerves supplying the human
post-natal vas deferens and seminal vesicle. Br J Urol 1997; 80:291–299.
54. Jen PY, Dixon JS, Gosling JA. Development of peptide-containing nerves
in the human fetal vas deferens and seminal vesicle. Br J Urol 1995; 75:
378–385.
55. Kong JY, Thureson-Klein AK, Klein RL. Are NPY and enkephalins
costored in the same noradrenergic neurons and vesicles? Peptides 1990;
11:565–575.
56. Jen PY, Dixon JS, Gearhart JP, Gosling JA. Nitric oxide synthase and
tyrosine hydroxylase are colocalized in nerves supplying the postnatal
human male genitourinary organs. J Urol 1996; 155:1117–1121.
57. Whittington K, Assinder SJ, Parkinson T, Lapwood KR, Nicholson HD.
Function and localization of oxytocin receptors in the reproductive tissue
of rams. Reproduction 2001; 122:317–325.
58. Levine N, Marsh DJ. Micropuncture studies of the electrochemical aspects
of fluid and electrolyte transport in individual seminiferous tubules, the
epididymis and the vas deferens in rats. J Physiol 1971; 213:557–570.
59. Dean M, Santis G. Heterogeneity in the severity of cystic fibrosis and the
role of CFTR gene mutations. Hum Genet 1994; 93:364–368.
60. Larriba S, Bassas L, Egozcue S, Gimenez J, Ramos MD, Briceno O,
Estivill X, Casals T. Adenosine triphosphate-binding cassette superfamily
transporter gene expression in severe male infertility. Biol Reprod 2001;
65:394–400.
61. Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher
TA, White MB, Milunsky A. Congenital bilateral absence of the vas
deferens. A primarily genital form of cystic fibrosis. JAMA 1992; 267:
1794–1797.
62. Bienvenu T, Adjiman M, Thiounn N, Jeanpierre M, Hubert D, Lepercoq J,
Francoual C, Wolf J, Izard V, Jouannet P, Kaplan JC, Beldjord C.
Molecular diagnosis of congenital bilateral absence of the vas deferens:
analyses of the CFTR gene in 64 French patients. Ann Genet 1997; 40:
5–9.
63. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I,
Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander
HJ, Sperling H, et al. Distinct spectrum of CFTR gene mutations in
congenital absence of vas deferens. Hum Genet 1997; 100:365–377.
64. Hollander E, Novotny S, Hanratty M, Yaffe R, DeCaria CM, Aronowitz
BR, Mosovich S. Oxytocin infusion reduces repetitive behaviors in adults
with autistic and Asperger’s disorders. Neuropsychopharmacology 2003;
28:193–198.
65. Epperson CN, McDougle CJ, Price LH. Intranasal oxytocin in obsessive-
compulsive disorder. Biol Psychiatry 1996; 40:547–549.
66. Epperson CN, McDougle CJ, Price LH. Intranasal oxytocin in
trichotillomania. Biol Psychiatry 1996; 40:559–560.
67. Paranjape SB, Thibonnier M. Development and therapeutic indications of
orally active non-peptide vasopressin receptor antagonists. Expert Opin
Investig Drugs 2001; 10:825–834.
68. Yeates KE, Morton AR. Vasopressin antagonists: role in the management
of hyponatremia. Am J Nephrol 2006; 26:348–355.