JKAU: Sci., Vol. 26 No. 2, pp: 3-18 (2014 A.D./ 1435 A.H.

)
DOI:10.4197/Sci.26-2.1

Morphological and Molecular Taxonomical Study of

Euglena viridis Ehren and Euglena gracilis Klebs Growing
in Aleppo, Syria

Montaha Sheikh Al-Ashra, Mohamed Abiad,

Ahmad Allahem

Dept. of Zoology, Faculty of Sciences, University of Aleppo, Syria

E-mail: montahash2014@hotmail.com

Abstract: In spite of the big progress in taxonomy by means of the

classical methods, they could not help dealing with many issues
especially when studying similar species. This led scientists to use
the genotype. Molecular biological data came to emphasize the given
taxonomical data which is reasonable since that all the characteristics
in an organism reflect the molecular reservoir the organism has “the
DNA”. Matter produced by organisms is remarkable. Evolutionary
optimized properties such as in Euglena (E.) Euglena descends to the
protozoa, It mostly occurs in still water of puddles, ponds, and lakes
especially in water with high levels of organic nutrients, Species of
genus Euglena are very important for the food chain, and are used as
indicators of water quality and in many academic studies.
In this study two species were isolated (E. viridis and E. gracilis )
and cultivated by using The differential modified media (HUT,
Cramer and Myers). E. viridis was cultivated on Hutner's modified
medium (HUT), while E. gracilis was Cultivated on Cramer and
Myers modified medium. Both species were classified
morphologically and Molecularly using species-specific primers. A
local taxonomic key was developed.

Key words: E. viridis, E. gracilis, HUT, Cramer and Myers.

3
4 Montaha Sheikh Al-Ashra et al

Introduction

Euglena is classified as: Kingdom Protista, Sub Kingdom Protozoa,

Phylum Sarcomastigopora, Subphylum Mastigophora, Order Euglenida,
Family Euglenidae[1]. The name Euglena comes from a Greek word
meaning “eyeball organism’’ [2]. The Euglenoid genus is mostly common
worldwide. Motile cells are ovoid-cylindrical to narrowly fusiform,
frequently with a narrow, elongated, posterior caudus[3]. All green cells
have an orange to red stigma unassociated with chloroplasts. There is a
single emergent flagellum from a ventral canal opening, and a very short
second flagellum retained in the reservoir, with its tip opposite to the
paraflagellar swelling of the emergent flagellum[4].
Cytokinesis has been the only way proven of asexual reproduction
for Euglena spp[5]. Cell division was described in motile and palmelloid
cells, and in certain cyst types [6]. Chloroplast number ranges from one
to many, with or without pyrenoids[7]. Euglena mostly occurs in still
water of puddles, ponds, and lakes, especially in water with high levels
of organic nutrients. It may also occur in and on sediments of river
banks[8]. Euglena inhabits shaded or sunny areas, in hard or soft water, of
low pH =0.9 to high pH =over 8.0[9].
Euglena gracilis showed some promise after the purification of the
waste water with growing conditions pH= 4, and temperature 30–
35°C[10]. Species studied (mostly Euglena) have both a vitamin B12
(cyanocobalamin) and a vitamin B1 (thiamine) requirement in nature[11].
Euglena gracilis strain Z is the first euglenoid to have its chloroplast
DNA genome sequenced[12].
Euglena gracilis strain Z is used in medical science as a bioassay for
vitamin B12 in blood plasma, and it may one day become useful in
aquaculture, making it a nutritious food item for the mass production of
cultured marine fish larvae [13]. An aquaculture activity system including
fish and microalgae, which will be an essential component of
Bioregenerative Life Support Systems (BLSS) in space to sustainable
development for aqueous environments. Cultivation system of Protozoa
is the highest standard in aquaculture activity system, they form the base
of the pyramid of power and the beginning of the food chain[14].
 Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis 5

New culturing techniques of micro- organisms caused remarkable

progress in the field of Protozoa as at Euglenoids following
physiological, genetic and biochemistry process.
Euglena Cultivation needs patience and experience, it is inexpensive
and can be maintained long time by renew of media, getting a pure
isolates of them is not easy, but repetition of Cultivate and work in sterile
conditions can provide pure isolates of Euglena for Molecular study. It
was difficult to distinguish the species of Euglena, but by a local
taxonomic key which was made depending on an international
taxonomic keys we distincted between E. viridis and E. gracilis.

In this study two species were isolated and cultivated ( E. viridis and
E. gracilis Klebs (strainZ) by cultivation techniques, using the
differential modified media (HUT, Cramer and Myers). E. viridis was
cultivated on Hutner's modified medium (HUT)[15], E. gracilis was
cultivated on Cramer and Myers modified medium[16] and they have been
classified Morphologically and Molecularly using species-specific
primers.

Materials and Methods

Organism and culture conditions

Samples of waste water were collected in bottles from

El Hamadania area in Aleppo. pH and temperature were measured.
Euglena gracilis cells were grown on modified Cramer-Meyer medium
as shown in Table1, under the following growth conditions: 24 ±1 ºC;
12:12 h light: dark regime with cool-white fluorescent light at 70 μmol
photons m-2s-1 irradiance. Euglena viridis cells were grown on modified
HUT medium as shown in Table 2, under the following growth
conditions: 20–22ºC; 10:14h light: dark regime with cool white
fluorescent tubes which provided approximately 30 μmol photons m -2s-1
irradiance. The two mediums were modified to the optimal medium for
growth to increase the numbers of Euglena cells.
6 Montaha Sheikh Al-Ashra et al

Cell number determination

Cell movement was stopped with formalin 3%, Cellular density was
evaluated using a Neubauer chamber through a microscope.
Cells in the exponential phase of growth were used in all
experiments.
Culture conditions
Euglena cells were maintained autotrophically. Cells were harvested
at 4°C, suspended in cold STE buffer (0.37 M Sucrose, 10 mM Tris –
HCl, 50 mM EDTA [ethylene diamine tetraacetic acid], pH 7.6), and
centrifuged at 4000 rpm for 10 min. The pellets were suspended in 4
volumes of cold STE and used immediately for chloroplast isolation.
Isolation of chloroplasts
Euglena chloroplasts were isolated by modification of the procedure
of Manning et al. (1971) [17]. Autotrophically grown cells were destroyed
by SLB (Solution Lyses Buffer). The resulting suspension was
centrifuged at 4000 rpm for 10 min, the pellet was resuspended in 20 vol
(all volumes are based on the original packed-cell volume) of STE and
allowed to stand for 10 min. The upper 3/4 of the suspension was
decanted through 10 layers of cheesecloth to remove unbroken cells and
cell debris, and the remaining solution was discarded. The decanted
suspension was centrifuged at 4000 rpm for 10 min and the pellet was
suspended in 2 volumes of STE. Four volumes of 2.2 M sucrose were
added and the suspension was centrifuged at 14500 rpm for 30 min in the
eppendorf rotor.
The green pad that layered on top of the sucrose solution was
removed and suspended in STE and centrifuged at 4000 rpm for 10 min;
the pellet was suspended in STE. Another sucrose flotation was
performed, and the floating pad was again suspended in STE and
centrifuged at 4000 rpm for 10 min. This pellet was washed two more
times. These chloroplasts were suspended in 0.3 M KCl-0.05 M EDTA
(pH=7.6) and centrifuged at 1000 rpm for 5 min. This washing was
repeated twice, and the pellet was finally suspended in an equal volume
of 0.15 M NaCl- 0.10 M EDTA -0.05 M Tris HCl (pH=9.0) and stored
at -20°C.
 Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis 7

Isolation of DNA by kt Promega

Tissue Culture Cells
1) The cell or pellet of chloroplast was centrifuged at 14500 rpm for
10 seconds.
2) This pellet was washed with PBS, vortexed and then 600μl of
Nuclei Lysis Solution was added and mixed by pipetting.
Lysis and Protein Precipitation
3) 3μl of RNase Solution was added to the cell or pellet of
chloroplast and mixed. It was incubated for 15–30 minutes at 37°C and
cooled to room temperature.
4) 200μl of Protein Precipitation Solution was added. Then it was
vortexed and chilled on ice for 5 minutes.
5) It was centrifuged at 14500 rpm for four minutes.
DNA Precipitation and Rehydration
6) Supernatant was transfered to a fresh tube containing 600μl
isopropanol at room temperature.
7) It was mixed gently by inversion.
8) It was centrifuged at 14500 rpm for one minute.
9) Supernatant was removed and added 600μl 70% ethanol at room
temperature and mixed.
10)It was centrifuged again as in step six.
11)The ethanol was aspirated and the pellet was air-dried for 15
minutes.
12)DNA rehydrated in 100μl of DNA rehydration solution overnight
at 4°C.
DNA Amplification by Polymerase Chain Reaction (PCR)
All primers were synthesized by Sigma Company. E. viridis specific
primer for ycf9 gene (accession no. AY047487) are as follows: V1: 5′-
CAACCAACGTCTTTTATCAG and V2: 5′-
CTAATCAACTTAGGCGTA. E. gracilis specific primer for rpoA gene
from chloroplast complete genome (accession no. X70810) are as
8 Montaha Sheikh Al-Ashra et al

follows: P1: 5′-CTCTTCTAAACCTAAAAAGTTGTGAAC; P2: 5′-

AAG [18].
Table 1. Cramer-Meyer modified medium
Material Per Liter modified
(NH4)2HPO4 1g NH4H2PO4
KH2PO4 1g
MgSO4.7H2O 0.2g
CaCl2 0.02 g
Sodium Citrate(Na3C6H507.2H2O) 0.8 g
Fe2(SO4)3.nH20 3 mg Fen(SO4)3.nH20
MnCl2.4H2O 1.8 mg
CoSO4.7H2O 1.5 mg CoSO4
ZnSO4.7H2O 0.4 mg
Na2MoO4.2H2O 0.2 mg Na2MoO4
CuSO4.5H2O 0.02 mg CuSO4
H3BO3 2.48 mg
Thiamine HCl(VitaminB1) 0.5 mg 0.8 mg
Cyanocobalamin ( Vitamin B12) 0.02 mg 0.7 mg
Glucose 10 g
PH=3.4

Table 2. HUT modified medium

Exemplary modified
Material Amount-quantity
KH2PO4 2 mg
MgSO4 · 7H2O 2.5 mg
Sodium acetate 40 mg
Potassium citrate 4 mg
Polypeptone 60 mg peptone
Yeast extract 40 mg
Vitamin B12 0.05 µg 50 µl (1g/L)
Thiamine HCl 0.04 mg
Distilled water 100 mL
pH 6.4

PCR amplification reactions was carried out in 25μl volume

reactions mix, according to the following protocol: 12.5 μl of 2X Taq
Master Mix, 1 μl of MgCl2(50mM), 2 μl of P1, P2 (25 mM), 3.5 μl of
water and 4µl of DNA. PCR tubes were carried out on PCR apparatus
(eppendorf). The amplification program consisted of: For E.viridis cycles
were as follows: 95°C/2min (1x); 95°C/30 sec, 58°C/30 sec, and
72°C/1min (30x); and 72°C/5min (1x). For E. gracilis cycles were as
follows: 95°C/2min (1x); 95°C/30 sec, 55°C/30 sec, and 72°C/1min
(30x); and 72°C/5min (1x).
 Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis 9

Electrophoresed through a 1% agarose gel, visualized by ethidium

bromide staining; amplified DNA products were run on a 1% TBE
agarose gel. The gel was stained with 4 μl ethidium bromide after the
mixture was cooled. After the gel was allowed to be solidified, 7 μl of
amplified DNA fragments, 3 μl of Bromphenolxylencyanolblau (Ficoll)
and 5μl of molecular 500 or 1000-bp loading marker ladder (provided
from ROTH) were independently added in wells made by special comb
and loaded in the gel, then the gel was run under 100 volts for 30 min.
The gel was viewed under UV illumination and photographed using gel
documentation system.

Results
Cells of E. viridis was appeared on HUT modified medium and
arrived to exponential phase of growth after two weeks. Cellular density
was evaluated using a neubauer chamber by microscope and it was (45 x
103 cells/ml) Figure 1.
The morphological taxonomicy was supported by using analysis
molecular and species - specific primers for E. viridis [18] and after PCR
reaction products were separated in agarose gels and visualized by
ethidium bromide staining for E. viridis and bands appeared in
(amplified sample was repeated to confirm the result) Figure 2.
1. E. viridis, p1=V1 ,p2=V2 ( specific primers V1,V2) 375 pb
2. E. viridis, p1=V1 ,p2=V2 ( specific primers V1,V2) 375 pb
Cells of E. gracilis appeared on Cramer and Myers medium and
arrived to exponential phase of growth after three weeks, Cellular density
was evaluated using a Neubauer chamber by microscope, it was (2 x 106
cells/ml) Figure 3.
A morphological classification was supported by molecular analysis
using species specific primers for E. gracilis [18] and after PCR reaction,
products were separated in agarose gels and visualized by ethidium
bromide staining. E. gracilis bands appeared (amplified the sample
was repeated to confirm the result) Figure 4.
1- E. gracilis , p1= P1, p2= P2 ( specific primers P1,P2)350 pb
10 Montaha Sheikh Al-Ashra et al

2- E. gracilis, p1= P1, p2= P2 ( specific primers P1,P2) 350 pb

Fig. 1: Culture of E. viridis on HUT modified medium 4X (image of search)

Fig. 2. PCR reaction products were separated in agarose gels and visualized
by ethidium bromide staining for E. viridis, 1, 2 =375 pb
 Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis 11

Fig. 3. A-B Cultures of E. gracilis on Cramer and Myers modified medium

4X,40X(image of search)

Fig. 4 . PCR reaction products were separated in agarose gels and visualized
by ethidium bromide staining for E. gracilis 1, 2 = 350 pbA
12 Montaha Sheikh Al-Ashra et al

Discussion
The qualities of individuals of Euglena viridis coincided with the
results showing by Dillard[19] and Kim et al.[20] but differed in
dimensions. It was (30-89) µm long, (11-22) µm broad[19] and it was (55-
68) µm long, (11-19 ) µm broad [20].
The qualities of individuals of Euglena gracilis coincided with those
of Dillard[19]; Kim et al.[20] and Kudo.[21] but differed in dimensions. It
was (31-68) µm long, (6-18) µm broad[19]; (46-84) µm long, (11-19 ) µm
broad[20], and (35-55) µm long, (6-25) µm broad[21]. This is due to the
different conditions in places of samples collection; intensity of light,
difference of night and day length, pH, and of temperature.
Cells of E. viridis appeared on HUT modified medium [1], while
Cells of E. gracilis appeared on Cramer and Myers modified
medium [17].
Species Synopsis
A local taxonomic key was made depending on international
taxonomic keys [19,20], based on some characteristics of organelles as
chloroplasts shape, dimensions of cell, length of the Flagellum, and
paramylon grains.
A local taxonomic key for E. viridis and E. gracilis:
1- Cell with > 1chloroplast …………………….......................………..……......2
2a- Chloroplasts long and flattened, ribbon-like…………....….…3a
2b- Chloroplasts with paramylon-sheathed pyrenoids….……..….3b
3a- Chloroplasts arranged in stellate groups ……………….…......4a
3b- Chloroplasts discoid to oval, the margins smooth……………4b
4a- Cell spindle-shaped………………………………….….….….5a
4b- Cell nearly cylindrical without haematochrome….……..……5b
5a- Cell 13-18 W., 30-75 L,; paramylon bodis ovoid………..E.
viridis
5b- Cell 18-25 W., 40-80 L …………………………...…… E.
gracilis
 Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis 13

Euglena viridis Ehrenberg ,1830 (Figures 5,6)

Synonyms: E. viridis var. lacustris Francee 1897, E. viridis var.
stagnalis France 1897, E. viridis var. mucosa Lemmennann 1910, E.
viridis var. purourea Playfair 1921, E. stellata Mainx 1926, E. viridis
var. lefevrei Chadefaud 1937, E. viridis var. cuntabrica Pringsheim
1956, E . viridis var. maxima Philipose l982.
Cells are 30-75µm long, 13-18 µm broad, spindle-shaped to
cylindrical, anterior end rounded, posterior end tapering gradually to a
point. Flagellum exceeding cell length, with moderate euglenoid
Movement; Nucleus spherical, shifted posteriorly. Chloroplasts 7-12,
elongate bands converging to area anterior to the nucleus, giving rise to a
satellite formation, axial with centrally located pyrenoid, pyrenoid in
central portion of the chloroplast, covered by other cellular organelles,
numerous, small, oval or rod- like paramylon bodis and Stigma present.

A B
Chloroplast

Flagellum

Nucleus
20µm
20µm

Fig. 5: A: E. viridis 40X (image of search), B: Sketch of an Euglena viridis cell [20].

A B

10µm
10µm
14 Montaha Sheikh Al-Ashra et al

Fig. 6: A: E. viridis 40X (image of search), B: Sketch of an Euglena viridis cell

[21]
.

Euglena gracilis Klebs,1883 (Figure 7)

Synonyms: E. agilis Carter 1865, E. gracilis var. zumsteinii Lwoff

1932, E. hiemalis Matvienko1938, E. gracilis var, urophora Chadefaud
et Provasoli 1939, E. gracilis var. bacillaris Pringsheim et Hovasse
1950, E. gracilis var. luxunans Pringsheim 1955,
E. gracilis var. saccharophila Pringsheim 1955.
Cells are 40-80µm long, 18-25 µm broad, metabolic, cylindrical or
spindle-shaped, slightly attenuated and rounded anteriorly, narrowing
posteriorly and terminated by short, non-hyaline obtuse peak.
Chloroplasts are brilliant, rather few (8-14 in the cell ), parietal, big,
discoid with slightly lobed margins, saucer-shaped in ventral view; each
with single pyrenoid doubly sheathed with paramylon caps. Paramylon
grains small, oval, elliptical or rod-like, few to fairly numerous, scattered
throughout the cell. Nucleus is spherical or elliptical in shape and located
in center of the cell or slightly posterior to the center. Flagellum was
about one half of the body length, stigma distinct and nearly cup-
shaped, relatively small. With marked euglenoid movement, swimming
and rotating. Locomotion was clearly metabolic.

Fig. 7. A-D E. gracilis Cells 40X (image of search), E Sketch of an Euglena gracilis cell
[5]
.
 Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis 15

Conclusions
1. Morphological characters of local Euglena spp. were similar to
Euglena species around the world, except the dimensions; because of changing
environment conditions, lightning, pH, temperate, etc.
2. Shape, number and position of the chloroplasts are some of the most
important classical taxonomic features. 2
3. HUT is a special and differential medium for E. viridis.
4. Cramer-Meyer is a special and differential medium for E. gracilis.
5. Environmental conditions, light, temperature and pH affect growth and
abundance of Euglena. 2
6. Components of medium play major role in growth of specific species of
Euglena.
7. Molecular data agreed with the given classical taxonomic data.

Acknowledgements
I would like to thank the University Administration and Zoology
Department Faculty of Sciences in Aleppo university for their financial
support, their continuous help and support during the preparation of this
work.

References
[1] Lee, J. J., Hutner, S. H. and Bovee, E. C.., An Illustrated Guide to the Protozoa. Society of
Protozoologists, U.S.A. 600 (1985).
[2] Brocklesby, J., Views of the microscopic world. Pratt. Woodford, Co., New York, 146 (1851).
[3] Pringsheim, E. G., Contributions towards a monograph of the genus Euglena. Nova Acta
Leopoldina 18:1–168 (1956).
[4] Johnson, L. P. and Jahn, T. L., Cause of the green–red color change in Euglena rubra.
Physiological Zoology 15:89–94 (1942).
[5] Leedale, G. F., Euglenoid flagellates Prentice Hall, Englewood Cliffs, NJ, 242 (1967).
[6] Johnson, L. P., Euglenae of Iowa. Transactions of the American Microscopical Society
63:97–135 (1944).
[7] Zakrys´, B. and Walne, P. L., Floristic, taxonomic and phytogeographic studies of green
Euglenophyta from the southeastern United States, with emphasis on new and rare species.
Algological Studies 72:71–114 (1994).
[8] Say, P. J. and Whitton, B. A. Changes in flora down a stream showing a zinc gradient.
Hydrobiologia 76:255–262 (1980).
 16 Montaha Sheikh Al-Ashra et al

[9] Rosowski, J. R., Photosynthetic Euglenoids, (in: Wehr, J. D. and Sheath, R. G., Freshwater
Algae of North America Ecology and Classification). Academic Press. 383-(412)422 (2003).
[10] Waygood, F. R., Hussain, A., Godavari, H. R., Tai, Y. C. and Badour, S. S. Purification
and reclamation of farm and urban wastes by Euglena gracilis: photosynthetic capacity,
effect of pH hydrogen-ion concentration, temperature acetate and whey. Ecological and
Biological Series A Environmental Pollution.23:179–215 (1980).
[11] Provasoli, L., Nutrition and ecology of protozoa and algae. Annual Review of Microbiology
12:279–308 (1958).
[12] Hallick, R. B., Hong, L., Drager, R. G., Favreau, M. R., Monfort, A., Orsat, B.,
Spielmann, A. and Stutz, E., Complete sequence of Euglena gracilis chloroplast DNA.
ucleic Acids Research, 21:3537–3544 (1993).
[13] Hayashi, M., Toda, K. and Kitaoka, S., Enriching Euglena with unsaturated fatty acids.
Bioscience, Biotechnology and Biochemistry, 57:352–353 (1993).
[14] Kitaya, Y., Azuma, H. and kiyota, M ., Effects of temperature, CO2/O2 concentrations and
light intensity on cellular multiplication of microalgae, Euglena gracilis. Advances in Space
Research 35, 1584–1588, Japan (2005).
[15] Hutner, S. H., Zahalsky, A. C., Aaronson, S., Baker, H. and Frank, O., Culture media for
Euglena gracilis. In Methods in Cell Physiology. Vol. 2, Ed. by Prescott, D. M., Academic
Press, New York, p. 217-228 (1966).
[16] Cramer, M. and Myers, J., Growth and hotosynthetic characteristics of Euglena gracilis.
Arch. Microbiol. 17, 384–402 (1952).
[17] Manning, J. E., Wolstenholme, D. R., Ryan, R. S., I1untert, J. A. and Richards, O. C.,
Circular Chlor-oplast DNA from Euglena gracilis (electron microscopy/density gradient
centrifugation/mitochondrial DNA). Proc. Nat. Acad. Sci. USA, 68, No.6, 1169-1173 (1971).
[18] Sheveleva, E. V., Giordani, N. v. and Hallick, R.B., Identification and comparative
analysis of the chloroplast -subunit gene of DNA-dependent RNA polymerase from seven
Euglena species. Nucleic Acids Research., 30, No. 5 1247–1254 (2002).
[19] Dillard, G. E., Freshwater algae of the southeastern United States. Part 7. Pigmented
Euglenophyceae. Bibliotheca Phycologica, Vol. 106. Cramer, Stuttgart, 134 p. + 20 plates
and captions (2000).
[20] Kim, J.T., Boo, S.M. and Zakrys, B., Floristic and taxonomic accounts of the genus
Euglena (Euglenophyceae) from Korean fresh waters. Algae, 13: 173-197 (1998).
[21] Kudo, R. R., Protozoology. 5th ed. Charles C.Thomas, Illinois. 1174 (1966).
[22] Zakrys´, B. and Walne, P. L., Floristic, taxonomic and phytogeographic studies of green
Euglenophyta from the southeastern United States, with emphasis on new and rare species.
Algological Studies, 72:71–114 (1994).
 ‫‪Morphological and Molecular Study of Euglena spp. E. viridis and E. gracilis‬‬ ‫‪17‬‬

‫دراسة تصنيفية مظھرية وجزيئية لنوعي الجنس ‪Euglena‬‬

‫)‪ E. viridis‬و‪ (E. gracilis‬النامي في حلب‪ ،‬سوريا‬

‫منتھى شيخ العشرة‪ ،‬محمد أبيض‪ ،‬و أحمد الالحم‬

‫قسم علم الحياة الحيوانية‪ ،‬كلية العلوم‪ ،‬جامعة حلب‪ ،‬سورية‬

‫المستخلص‪ :‬رغم التقدم الكبير الذي أنجزه علم التصنيف باالعتماد على معايير‬

‫التصنيف التقليدية فإنه لم يستطع البت بالكثير من المعضالت وخاصة عندما يتعلق‬
‫األمر بالتمييز بين األنواع المتشابھة‪ .‬ولھذا السبب فقد تم اللجوء لالعتماد على‬

‫دراسة الطابع النووي‪ .‬ومع التقدم الحاصل في المعارف في مجال األحياء الجزيئية‬

‫فقد أصبح متاحا ً حاليا ً اعتماد المعطيات الجزيئية في حل المشاكل التصنيفية‪ .‬حيث‬

‫تعتبر تقنية الـ‪ PCR‬تقانة فعالة ومفيدة جداً في حقول علم األحياء الجزيئية‪ .‬وإن‬

‫مسألة اإلنتاجية عن طريق الكائنات الحية مسألة ھامة وجديرة بالمالحظة‪ .‬ومن ھذه‬

‫الكائنات جنس الـ‪ Euglena‬الذي يعد من الكائنات األولية الھامة التي تشكل حلقة‬
‫أساسية في السالسل الغذائية‪ .‬كما أن أفراده تقوم بوظائف متنوعة في البيئة ال يمكن‬

‫االستغناء عنھا‪ .‬ھذا وتعد بعض أنواع جنس الـ‪ Euglena‬مؤشراً لتلوث المياه‬

‫بالمواد العضوية فتساھم بتنقيتھا‪ .‬كما أن لھا أھمية في الدراسات األكاديمية لذلك جاء‬

‫ھذا البحث ليلقي الضوء على ھذه الكائنات عزالً وتنميةً وتنميطا ً جزيئيا ً‪ .‬وتم في ھذا‬

‫البحث وضع مفتاح تصنيفي محلي لنوعي الجنس ‪E.) gracilis, E. Euglena‬‬
‫‪ ( virids‬بعد عزل أفرادھا وزراعتھا على أوساط تفريقية معدلة )‪ HUT‬و‬

‫‪ .(Cramer and Myers‬وقد أدى استعمال المعطيات األحيائية الجزيئية )تقانة‬

‫الـ‪ PCR‬والرحالن الكھربائي واستخدام البادئات النوعية المتخصصة للنوعين‬

‫‪18‬‬ ‫‪Montaha Sheikh Al-Ashra et al‬‬

‫السابقين( إلى تأكيد المعطيات التصنيفية الموضوعة حيث أن كل ما يتميز به الكائن‬

‫من صفات ھو انعكاس لما يملكه من جزيئات عضوية وبشكل خاص الـ ‪DNA‬‬
‫المادة الوراثية‪.‬‬