Aquaculture 577 (2023) 739894

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Impact of dietary soybean inclusion on the endocrine disruptive effect in

female brood stock of Cyprinus carpio
Pallath Muhammed Nuzaiba a, c, *, Tamilarasan Nirmal b, Prabhakaran Arya c, Tincy Varghese c,
Subodh Gupta c, *, Narottam Prasad Sahu c, Prem Prakash Srivastava c, d
a
School of Animal and Fishery Sciences, ICAR-Indian Agricultural Research Institute, Gauria Karma, Hazaribagh, Jharkhand, India
b
School of Fisheries, Centurion University of Technology and Management, Paralakhemundi, 761211 Gajapati, Odisha, India
c
Fish Nutrition, Biochemistry and Physiology Division, ICAR-Central Institute of Fisheries Education, Versova, 400061 Andheri West, Mumbai, India
d
College of Fisheries, Dr Rajendra Prasad Central Agricultural University, Dholi, 843121 Muzaffarpur, Bihar, India

A R T I C L E I N F O A B S T R A C T

Keywords: Phytoestrogens, mostly found in legumes, mimic animal estrogens and induce either pro- or anti-estrogenic
Phytoestrogen activity. A feeding trial for matured Cyprinus carpio females was carried out to assess the endocrine disrupting
Soybean meal effect of phytoestrogens in SBM and to suggest a dietary inclusion of soybean meal for broodstock of carps. The
Broodstock diet
fish were fed diets containing graded levels of soybean meal (SBM-0, 15, 20, 25, 30, 35, and 40%) for 60 days. To
Aromatase enzyme
Ovarian development
assess the endocrine disruption, sex hormone profiling, gene expression analysis of candidate genes, and his­
tological examinations were conducted. Serum T3, serum vitellogenin, and mRNA levels of cyp19a1, cyp19b, and
erβ were found to be higher in fish groups fed with diet containing low levels of SBM (SBM 15, 20, and 25), and
significantly lower in high SBM diet (≥30%) fed groups. Serum concentrations of cholesterol, cortisol, and the
mRNA level of 20βHSD all decreased as SBM increased. Increased levels of testosterone, estradiol, and the mRNA
for the erα gene were observed in the diet when SBM was incorporated into the diet. In the treatment groups with
≥30% inclusion of SBM, the number of vitellogenic oocytes and the gonadosomatic index were significantly
lower than the groups with low inclusion levels. Thus, soybean meal can be included in the diet of female carp
broodstocks up to 25% without disrupting the reproductive function. However, an inclusion level beyond 25%
could harm the endocrine axis, subsequently capable of impacting reproductive performance.

1. Introduction
World per capita fish consumption is expected to climb by 15%,
reaching an average of 21.4 kg per capita in 2030 (FAO, 2022),
reflecting a tremendous demand for the global fish food supply. Despite
diminishing wild capture production, fed aquaculture (semi-intensive
and intensive aquaculture) continues to provide a substantial and
growing share of the fish food supply. However, the main concerns with
semi-intensive and intensive aquaculture are the scarcity of high-quality
seeds for most cultivable species and the need for supplementary feed
with a high protein content (Jayasankar, 2018).
Due to its high protein content and balanced amino acid composi­
tion, fishmeal (FM) has classically been the main protein source used in
aquaculture feed (Tacon and Metian, 2015); however, a decline in global
capture production has led fish nutritionists to focus on finding
sustainable alternatives to fishmeal for the past four decades. Soybean
meal has been identified as the best alternative to fish meal due to its
high protein content and amino acid profile. It is currently the most
widely used plant protein substitute for fishmeal in aquafeed (replacing
40–60% of the fish meal (Francis et al., 2001; Dersjant-Li, 2002; García-
Ortega et al., 2016)). Soybean meal has been completely substituted for
fish meal through a variety of processing techniques and the addition of
limiting amino acids (Zhang et al., 2016; Kokou et al., 2017; Ye et al.,
2019). However, most replacement studies have focused on fish growth
and feed conversion, with only a few authors attempting to investigate
the impact of including soybean meal on gonad growth and
reproduction.
Phytoestrogens are plant-derived endocrine-disrupting chemicals
found in legumes typically associated with nodule formation and plant
defence (Setchell, 1998; Francis et al., 2001). These non-steroidal

* Corresponding author at: Fish Nutrition, Biochemistry and Physiology Division, ICAR-Central Institute of Fisheries Education, Versova, 400061 Andheri West,
Mumbai, India.
E-mail addresses: nuzaibapmuhammed@gmail.com (P.M. Nuzaiba), sgupta@cie.edu.in (S. Gupta).

https://doi.org/10.1016/j.aquaculture.2023.739894
Received 8 February 2023; Received in revised form 23 June 2023; Accepted 14 July 2023
Available online 17 July 2023
0044-8486/© 2023 Elsevier B.V. All rights reserved.
P.M. Nuzaiba et al.
estrogenic compounds mimic animal estrogen and stimulate or inhibit
reproduction in animals, including fish. Phytoestrogens are abundant in
soybean meal. Genistein, the main phytoestrogen in soybean meal, has
been measured at 2–300 mg/100 g (Eldridge and Kwolek, 1983; Achouri
et al., 2005; Chen and Wei, 2008). The genistein content of commercial
fish diets was reported to be 0.93–23.71 mg/100 g (Inudo et al., 2004;
Xiao et al., 2018).
Soy phytoestrogens interfered with the reproductive functions of
organisms by interacting with the endocrine system, causing serious
effects on reproduction in many teleosts: Genistein inhibited steroido­
genesis and vitellogenesis in Oncorhynchus mykiss, Cyprinus carpio, and
Morone saxatilis, (Pelissero et al., 2001; Pollack et al., 2003; Nuzaiba
et al., 2020), slowed the development of vitellogenic oocytes (Pelissero
et al., 2001), and caused sex reversal in Oryzias latipes, Ictalurus punc­
tatus, Poecilia Reticulata, Oreochromis niloticus, Clarias gariepinus and
Aralichthys Lethostigma (Kiparissis et al., 2003; Green and Kelly, 2009;
Chakraborty et al., 2012; El-Sayed et al., 2012; Ahmed et al., 2015;
DiMaggio et al., 2016). Teleosts have also shown reproductive impair­
ment after consuming daidzein (Sarasquete et al., 2020; Fajkowska
et al., 2021). Furthermore, Li et al. (2016) reported that the dietary level
of daidzein in gibel carp is five times the safety margin (40 mg/kg).
Purified phytoestrogens may not have the same effect on reproduc­
tion when fed as part of an ingredient. The bioavailability of estrogenic
compounds, nutrient composition of the ingredient, agonistic and
antagonistic factors of phytoestrogens in the ingredient, and loss of
phytoestrogens during feed processing must all be addressed when there
is an instinctive addition of phytoestrogens through the ingredients. A
few studies have found that feeding soybean meal causes reproductive
impairment, such as decreased gonad weight and fertilization rate
(Turker and Bozcaarmutlu, 2009; Bagheri et al., 2013). However, no
research has been conducted to predict the appropriate inclusion level of
soybean meal in the diet of carp brooders, without any estrogenic or
antiestrogenic effect.
The current study sought to determine the level of soybean meal
inclusion in the diet that brooder fish could consume without signifi­
cantly impairing their endocrine system. The study used C. carpio as an
experimental fish because it exhibits asynchronous ovarian develop­
ment in tropical conditions, making it easier to determine the disruptive
effects on the endocrine system throughout the season. A graded level of
soybean meal, 15, 20, 25, 30, 35, and 40%, was included in the diet and
fed to the experimental fish for 60 days under controlled conditions.
After the feeding trial, alterations in the level of serum thyroid hormones
(Tri-iodothyronine (T3) and Thyroxine (T4)), sex steroid level (testos­
terone and estradiol), cortisol, cholesterol, and vitellogenin were
determined. The mRNA encoding enzymes responsible for steroid syn­
thesis and development of secondary sexual characteristics (cyp19a1 &
cyp19b), vitellogenesis (vtgb2, erα & erβ), oocyte maturation, and
ovulation (20βHSD) were evaluated from tissues. Further, ovarian
development was examined by histological examination and gonado­
somatic index.
2. Material and methods
2.1. Ethical statement
The research undertaken complies with the current animal welfare
laws in India. The care and treatment of animals used in this study were
following the guidelines of the CPCSEA [(Committee for the purpose of
Control and Supervision of Experiments on Animals), Ministry of Envi­
ronment and Forests (Animal Welfare Division), Govt. of India] on care
and use of animals in scientific research. The study was approved by the
board of Studies and IAEC (Institute Animal Ethics Committee) of ICAR-
Central Institute of Fisheries Education, Mumbai, India. The experi­
mental animal is Cyprinus carpio, L. which is not an endangered fish, the
provisions of the govt. of India’s Wildlife Protection Act of 1972 are not
applicable for experiments on this fish.
2
Aquaculture 577 (2023) 739894
2.2. Experimental fish and rearing condition
Reproductively active C. carpio were procured from Patel Fish Farm,
Raigarh, located on the outskirt of Mumbai, Maharashtra, India, and
transported to the wet laboratory facility of ICAR-Central Institute of
Fisheries Education, Mumbai. For 20 days, the fish were acclimated to a
diet that was 32% dietary protein and made with basic ingredients free
of soybean meal. The experiment was conducted for 60 days in circular
FRP tanks of 500 L capacity covered with perforated lids. To maintain
ideal water quality as described for C. carpio by Bhatnagar and Devi
(2013), water exchange was carried out two to three times per week. The
water in the experimental tanks was continuously and properly aerated
throughout the experiment, and the water volume was kept at 3/4th of
the tank capacity. Physiochemical parameters of the water estimated
were 28 ◦ C water temperature, 5.1 ± 0.18 mg. L− 1 DO, 221 ± 1.4 mg.
L− 1 as CaCO3 hardness, 7.7 ± 0.51 water pH, less than <0.06 mg. L− 1
total ammonia, <0.8 mg. L− 1 nitrate and <0.07 mg/L nitrite.
2.3. Experimental design, diets, and feeding regimes
Twenty-one FRP tanks were divided into seven treatment groups,
comprised of three replication tanks for each. Reproductively active
female C. carpio weighing around 112.23 ± 5.14 g, was randomly
distributed to the experimental tanks, followed by male fish, following a
completely randomized design. Each tank received three female and six
male common carps. Seven different experimental diets containing a
graded level of soybean meal; Control (0%), SBM-15 (15%), SBM-20
(20%), SBM-25 (25%) and SBM-30 (30%), SBM-35 (35%), SBM-40
(40%) were prepared using semi-purified ingredients. The crude pro­
tein inclusion is adjusted using casein and gelatine at a 4:1 ratio. The
powdered ingredients were mixed properly according to the composi­
tion given in Table 1 and cooked under steam using a pressure cooker.
The cooked dough was cooled to room temperature and mixed with the
heat-labile ingredients and oil. The homogenous blend of ingredients is
then subjected to palletization using an automatic pelletizer. The feed
pellets are dried and crumbled before storing them in a deep freezer. The
experimental fish were fed twice daily with appropriate diets up to
satiation throughout the experiment.
2.4. Sampling and sample preparation
Three female fish from each tank were randomly selected (n = 9) at
the conclusion of the 60-day feeding trial, anaesthetized with clove oil
emulsion (30 mg/L), weighed for analyzing growth related parameters
(Table 2) and then dissected. A sterile needle was used to draw blood
from the caudal peduncle of pre-weighed fish. The blood was then
poured into a microfuge, where it was centrifuged at 1500 ×g for 20 min
after being incubated at RT for 15 min. For RNA extraction and subse­
quent gene expression analysis, tissues including the brain, ovary, and
liver from the experimental fish were preserved in RNALater® under
aseptic conditions. The central part of the ovary was collected for his­
tology and stored in neutral buffered formalin (NBF) at room tempera­
ture. The entire ovary from the experimental fishes was weighed and
related to the total body weight and expressed in percentage.
2.5. Serum cholesterol and hormone profile using EIA kits
The ERBA Manheim diagnostics kit was used to determine the level
of serum cholesterol (Allain et al., 1974; Roeschlau et al., 1974). EIA kits
for Tri-iodothyronine (T3, TF E-2300), Tetraiodothyronine (T4, TF
E2400), Cortisol (Cat. No.: MS E-5000), Testosterone (Cat. No.: AA E-
1300) and Estradiol (Cat. No.: FR E- 2000) were procured from LDN®
immunoassays and servicers, Germany and were deployed for analyzing
serum concentration of hormones. Intra-assay and inter-assay validation
for the test kits were published as supplementary data in Nuzaiba et al.
(2022). The absorbance at the desired wavelength was measured using
P.M. Nuzaiba et al. Aquaculture 577 (2023) 739894

Table 1
Composition of experimental diet.
Sl. No Ingredients (g/kg) Control SBM-15 SBM-20 SBM-25 SBM-30 SBM-35 SBM-40

1. Soybean meal 0 150 200 250 300 350 400

2. Casein 245 175 152 129 105 81 59
3. Gelatine 61.25 43.75 38 32.25 26.25 20.25 14.75
4. Cellulose 116.85 94.35 93.1 91.85 81.85 71.85 69.35
5. Wheat flour 225 185 165 145 135 125 105
6. DORB 250 250 250 250 250 250 250
7. CMC 15 15 15 15 15 15 15
8. Oil 65 65 65 65 65 65 65
9. BHT 0.2 0.2 0.2 0.2 0.2 0.2 0.2
10. Choline chloride 2 2 2 2 2 2 2
11. Vitamin C 0.3 0.3 0.3 0.3 0.3 0.3 0.3
12. Vitamin - Mineral premix* 19.4 19.4 19.4 19.4 19.4 19.4 19.4
Total 1000 1000 1000 1000 1000 1000 1000
**Genistein (mg/kg) 0.00 338.55 451.40 564.25 677.10 789.95 902.80
**Daidzein (mg/kg) 0.00 0.32 0.43 0.54 0.65 0.75 0.86
Proximate analysis***

Abbreviations: DORB-De-oiled rice bran; CMC- Carboxy methyl cellulose sodium salt; BHT- Butylated hydroxytoluene; 1–4, 7 and 9–11 were purified ingredient
procured from HiMedia Laboratory; Ingredients 5,6 and 8 were procured from local market.
*
Composition of vitamin-mineral premix (quantity/250 g starch powder): vitamin A: 550000 IU; vitamin D3: 110000 IU; vitamin B1: 20 mg; vitamin B2: 200 mg;
vitamin E: 75 mg; vitamin K: 100 mg; vitamin B12: 0.6 μg; calcium pantothenate: 250 mg; nicotinamide: 1000 mg; pyridoxine: 100 mg; folic acid: 25 mg; Mn: 2700 mg;
I 100 mg; Fe: 750 mg; Zn: 500 mg; Cu: 200 mg; Co: 45 mg; Ca: 50 g; P: 30 g; selenium: 5 ppm.
***
All the feeds were isonitrogenous and isocaloric and contained on DM basis: crude protein 31.96 ± 2.18, ether extract 8.73 ± 0.06, Nitrogen Free Extract (NFE) =
37.28 ± 0.28 total CHO (TC) 54.61 ± 0.28, ash 8.36 ± 0.19, and digestible energy (DE) 355.54 ± 1.33 kcal/100 g. DE (Kcal/100 g) = (% CP × 4) + (% EE × 9) + (NFE
× 4). (n = 3), (As per AOAC method).

2.6. mRNA quantification by quantitative real-time PCR

Table 2
Growth indices of SBM fed female C. carpio.
The quantitative real-time PCR technique was used to determine the
Treatments IW (g) FW (g) WG (%) SGR Feed FCR expression levels of genes such as vtgb2, cyp19a1, erβ, 20βHSD, erα and
(g/ Intake
cyp19b. In brief, TRIzol reagent (Invitrogen) was used to extract the RNA
day) (g/day)
from tissue preserved in RNALater. The total RNA extracted was sub­
2.52
113.73 206.13 81.29 0.99 3.88 ± jected to DNase (DNase-I, RNase free, Thermo Scientific, USA) treatment
Control ±
± 1.80 ± 1.80 ± 1.27 ± 0.01 0.05
0.03 for removing genomic DNA contamination, and reverse transcription
2.53 PCR was deployed using the first strand cDNA synthesis kit (Thermo
114.43 206.83 80.82 0.99 3.90 ±
SBM-15
± 2.37 ± 2.37 ± 1.69 ± 0.02 0.06
± Scientific, USA) for cDNA synthesis. For the relative quantification of
0.04 mRNA, β-actin (validated and data published supplementary data with
2.46
110.47 202.87 83.99 1.02 3.80 ± Nuzaiba et al. (2022)) was used as an internal control. Gene-specific
SBM-20 ±
± 4.96 ± 4.96 ± 3.86 ± 0.03 0.13 primers (Table 3) were designed using coding nucleotide sequences
0.08
2.51 from National Centre for Biotechnology Information (NCBI) with Gen­
112.80 205.20 81.95 1.00 3.85 ±
SBM-25
± 1.63 ± 1.63 ± 1.17 ± 0.01 0.04
± eRunner v. 6.0. The abundance of mRNA was determined using SYBR­
0.03
green DNA intercalating dye in AgilantAriaMax qRT-PCR. The CT
2.50
SBM-30
112.43 204.83 82.19 1.01 3.85 ±
± obtained was calculated using the 2-ΔΔCT method by Livak and
± 0.83 ± 0.83 ± 0.60 ± 0.01 0.02 Schmittgen (2001).
0.01
2.49
111.76 204.16 82.77 0.99 3.83 ±
SBM-35
2.7. Histological evaluation of ovary and gonadosomatic index
±
± 2.65 ± 2.65 ± 1.98 ± 0.02 0.07
0.04
2.45
109.80 202.20 84.20 1.02 3.78 ±
SBM-40 ± By histologically examining the ovary, the gonad development was
± 1.80 ± 1.80 ± 1.40 ± 0.01 0.05
0.03 seen. For the same, the central region of the ovary preserved in NBF was
P value NS NS NS NS NS NS
utilised. The tissue was embedded in paraffin wax after being fixed in
IW-Initial body weight; FW-Final body weight; WG(%)-Weight gain percentage, Bouin’s solution and dehydrated in alcohol for serial sectioning with a
calculated as (Final body weight (wet weight, g) − Initial body weight (wet microtome. Hematoxylin and eosin were used to stain the sections, and a
weight, g)) × 100/ Initial body weight (wet weight, g); SGR- Specific Growth bright-field microscope (OLYMPUS) was used to view them. Under a
Rate, calculated as (Ln (Final body weight (wet weight, g)) − Ln (Initial body light microscope (OLYMPUS IX70), the frequency of distribution of the
weight (wet weight, g)) × 100 /duration of feeding in days.; Daily feed intake =
various stages of oocytes was counted. The diameter of vitellogenic
Total feed consumed/ duration of feeding in days; FCR-Feed Conversion Ratio,
oocytes was measured from histology samples with the aid of a micro­
calculated as Feed intake (dry weight, g)/Body weight gain (wet weight, g);
scope, and different oocyte stages were identified, counted, and
Control, SBM-15, SBM-20, SBM-25, SBM-30, SBM-35 and SBM-40 are experi­
mental diets with 0, 15, 20, 25, 30, 35 and 40% SBM in feed. Data are arranged identified.
as Mean ± SE (n = 9).
2.8. Statistical analysis
the ELISA reader (BioTek Instruments, USA). The 4 Parameter Logistics
(4PL) curve fit was used to automatically calculate the hormone con­ To examine the homogeneity and normality of variance, residual
centrations. The circulating vitellogenin level was estimated using the plots were used. All data were subjected to one-way ANOVA (SPSS,
Fish Vitellogenin EIA kit (VTG, Cat.No.: E0020Fi, Bioassay Technology version 22), where, in addition to overall treatment effects, the poly­
Laboratory, Shanghai, China) following the manufacturer’s instructions. nomial contrast was used to test both linear and quadratic effects of
dietary SBM inclusion on various parameters. For observing significant

3
P.M. Nuzaiba et al. Aquaculture 577 (2023) 739894

Table 3
Primers used for gene expression analysis.
Primer NCBI Accession No. F/R Sequence (3′-5′) Product size (bp) Annealing temperature (◦ C)

F AGACATCAGGGTGTCATGGTTGGT
β-actin M24113.1 132 60.0
R AAGGTGTGATGCCAGATCTTCTC
F TCAAGGGCCCGGTAAACATC
cyp19b EU375456.1 165 58.0
R CTCATAATCGGGCCGAGACC
F GAGTCGTTTCTTTCAGCCT
cyp19a1 DQ534411.1 126 58.1
R CAGCAGCGTCACAAGAATGG
F ATGGTGATGTCTGGAGGG
erα AB334722.1 128 60.0
R TGAGAGTTTGTGGGCAGTGG
F TTGGAGTGCTGCTGGTTAGAGG
erβ KU205262.1 180 59.1
R GACAAGCATACTCCTCTCTCTG
F ACTGCTGAGAGGACTGTTCC
vtgb2 AF441432.1 177 57.8
R AAAGCAGCATTGTGAGAGTG
F AAGATGCGGTTGCTGGACTG
20β-HSD JQ230326.1 180 57.1
R AATGGCTCTGTTGCTGAATGC

Abbreviation: - β-actin: reference beta actin; vtgb2: vitellogenin precursor; cyp19a1: ovarian aromatase; erβ: estrogen receptor-β; 20β-HSD: 20β-Hydroxysteroid de­
hydrogenase; erα: estrogen receptor-α; cyp19b: brain aromatase; F: Forward primer; R: Reverse primer.

differences between the mean values at the 5% probability level (p <
0.05), Duncan’s multiple range test under Post-hoc was used. To
determine the best fit model (R2) to represent the data, regression
analysis (linear and quadratic) was carried out (Table 4). The correlation
coefficient (r) between GSI and the parameters with high R2 values was
calculated (Table 5). Serum vitellogenin was fitted to a second-order
polynomial regression analysis model to determine the maximum level
of SBM that could be included in the fish diet. Additionally, one-way
ANOVA was performed on the growth parameters, and the results
were expressed as mean ± standard error.
25% enhanced cyp19a1 expression and then reduced as the inclusion of
SBM increased. The mRNA levels of cyp19b was induced in the group
with 20% SBM inclusion, however, the expression levels reduced to the
level of control in the treatment with 25% inclusion, and further in­
crements in inclusion level of SBM brought about its downregulation.
The pattern of 20βHSD expression in both the liver and the ovary
(Fig. 3B), exhibited a decreasing trend as the SBM level in the feed was
increased.
3.4. Estrogen receptors and vitellogenin

3. Results
3.1. Thyroid hormones
The tri-iodothyronine (T3) and tetra-iodothyronine (thyroxine, T4)
levels in serum were determined after a feeding trial conducted with the
female C. carpio (Fig. 1). The serum T3 concentration in control was
observed as 2.47 ± 0.02 ng/mL, which significantly reduced (P < 0.05)
to 0.78 ± 0.01 and 0.76 ± 0.02 ng/mL in BM-35 and SBM-40. The
change in serum T4 level with increasing SBM inclusion was insignifi­
cant (P > 0.05).
3.2. Steroids
Serum total testosterone and estradiol in different treatment groups
is depicted in Fig. 2A. The testosterone levels in fish groups fed with high
SBM diets (SBM-30, 35, and 40) were ranging from 3.30 to 3.42 ng/mL,
which is significantly higher (P < 0.05) than control and low levels of
SBM-fed groups. Serum estradiol concentration in SBM included diet
ranged from 711.42 to 969.08 pg/mL, which is significantly higher than
the control (681.07 ± 25.72 pg/mL).Dietary inclusion of SBM reduced
the total circulating cholesterol concentration gradually and signifi­
cantly from 1.98 ± 0.20 mg/dL in control to 1.27 ± 0.03 mg/dL in SBM-
40. The serum total cholesterol level in control group was 1.98 ± 0.20
mg/dL, which gradually and significantly (p < 0.05) reduced to 1.27 ±
0.30 mg/dL as dietary inclusion of SBM increased to 40% (Fig. 2B). A
similar trend was observed in the case of cortisol level in serum depicted
in Fig. 2B: serum cortisol concentration in control was 191.62 ± 3.80
ng/mL, was gradually reduced as the SBM inclusion in the feed
increased.
3.3. Steroidogenic enzymes
The gene expression levels of ovarian aromatase (cyp19a1) and brain
aromatase (cyp19b) of female C. carpio fed with graded levels of SBM are
given in Fig. 3A. An increase in dietary soybean meal inclusion of up to
The mRNA expression of estrogen receptors (erα and erβ) in the he­
patic cells showed contrasting patterns (Fig. 4A). The erβ expression was
reduced as the level of SBM inclusion increased in the diet, with the
lowest expression recorded in SBM-30, 35, and 40. Contrastingly the
expression pattern of erα increased in SBM 25 onwards. Serum vitello­
genin level and the vtgb2 expression showed similar trends in expression
(Fig. 4B). Both protein and gene expression of vitellogenin showed a
slight increase in the low inclusion level of soybean meal. The dietary
inclusion of SBM at 10.90% showed the highest level of vitellogenin
concentration in serum in the regression analysis (Fgure 5). Further, the
level reduced, but reached the level in control group at the inclusion of
21.8% SBM. The level was similar to the control in SBM-21.8% and a
further increase in the inclusion level of soybean meal inhibited the
vitellogenin expression in liver (Fig. 5).
3.5. Ovarian development
Histological images of the ovary of female C.carpio fed with graded
levels of SBM are given in supporting data, Supporting Fig. 1A-G, sup­
porting data. The figures represented the asynchronous ovary of the
female C. carpio comprised of mid-vitellogenic oocytes, early vitello­
genic oocytes, cortical alveolar oocytes, and peri nucleolar oocytes. The
number of vitellogenic immature oocytes increased in fish fed with a
high SBM-included diet. In high in SBM included diet fed groups (SBM-
30, 35, and 40), the percentage of vitellogenic oocytes in the ovary is
declined and oocytes at the perinucleolar stage are increased propor­
tionately (Fig. 6A). The number of alveolar oocytes did not show any
trend with the increased inclusion of soybean meal. Similarly, most of
the vitellogenic oocytes (68.71 ± 0.53%) were in the size range of
0.86–1.15 mm, and were gradually reduced and distributed in a wide
range of a size (0.5–1.5 mm) as the SBM inclusion in the diet is increased
(Supporting Fig. 2, supporting data).
Gonadosomatic index is given Fig. 6B, where the GSI was reduced in
high inclusion of SBM in the diet (SBM-35 and 40) while there was no
significant difference was observed in 15–30% inclusion of SBM from
control.

4
P.M. Nuzaiba et al. Aquaculture 577 (2023) 739894

Table 4 Table 5
Regression analysis1. Correlation (r = correlation coefficient) of steroid synthesis, vitellogenesis and
Linear Quadratic
ovarian development with gonadosomatic index.
2 Parameters1 Correlation2 (r) with Strength and
Parameters Equation R Equation R2
gonadosomatic index (GSI) Association3
Parameters related to Steroidogenesis and vitellogenesis
T4 (ng/mL) − 0.91 Negative, high
y = − 0.0352× + y = − 0.0007 ×
T3 (ng/mL) 0.50 2 0.53 T (ng/mL) − 0.75 Negative, high
2.4482 –0.0089× + 2.2938
cyp19a1 0.57 Positive, Moderate
y = 0.0875× + y = 0.0021 × 2 +
T4 (ng/mL) 0.73 0.80 erβ 0.75 Positive, high
8.4031 0.0032× + 8.8983
vtgb2 0.79 Positive, high
y = 0.0578× + y = 0.0012 × 2 +
T (ng/mL) 0.72 0.78 VTG (μg/mL) 0.80 Positive, high
1.0866 0.0091× + 1.3732
Cortisol (ng/mL) 0.84 Positive, high
y = − 0.0262× + y = − 0.0037 × 2 +
cyp19a1 0.18 0.80 Cholesterol (mg/dL) 0.80 Positive, high
2.301 0.121× + 1.4363
20βHSD (Liver) 0.93 Positive, high
y = − 0.0299× + y = − 0.0018 × 2 +
cyp19b 0.38 0.63 20βHSD (Ovary) 0.75 Positive, high
1.5934 0.0441× + 1.1587
Vitellogenic oocytes 0.70 Positive, high
y = 3.4664× + y = − 0.181 × 2 +
E2 (pg/mL) 0.22 0.33 Perinuclear oocytes − 0.73 Negative, high
715.44 10.738× + 672.7
Vitellogenic oocyte of
y = 0.0206× + y = 0.0006 × 2–0.0023×
erα 0.31 0.35 1.16–1.45 mm − 0.43 Negative, low
0.7437 + 0.8783
y = − 0.0235× + y = 0.0001 × 2–0.0284× Abbreviations: T3-Tri-iodothyronine, T4-thyroxine, T-testosterone, cyp19a1-
erβ 0.92 0.92
1.0836 + 1.1126 ovarian aromatase, cyp19b- brain aromatase, E2- 17β-estradiol, erα and erβ- es­
y = − 0.0142× + y = − 0.0013 × 2 +
vtgb2 0.27 0.69 trogen receptors alpha and beta, vtgb2- vitellogenin b2 mRNA, VTG- Serum
1.3421 0.0399× + 1.0243
y = − 0.3787× + y = − 0.0205 × 2 +
vitellogenin, 20βHSD- 20β-hydroxysteroid dehydrogenase, and GSI-
VTG (μg/mL) 0.58 0.88 gonadosomatic index.
35.737 0.4462× + 30.89
1
Cortisol (ng/ y = − 1.7695× + y = − 0.0305 × Parameters showed high R2 value (>7.0) with dietary inclusion of soybean
0.86 0.91
mL) 195.47 2
–0.5447× + 188.27 meal.
2
Cholesterol y = − 0.0177× + y = − 0.0002 × Only the mean (n = 9) values are considered for correlation analysis.
0.88 2 0.90 3
(mg/dL) 2.0213 –0.0092× + 1.9716 Strength of association (both for positive and negative), high, ≥0.7; mod­
y = − 0.0171× + y = − 0.0005 × 2 + erate, ≥0.5 to <0.7; low, ≤0.5.
20βHSD (Liver) 0.81 0.94
1.2938 0.0041× + 1.1692
20βHSD y = − 0.0268× + y = 0.0005 × 2–0.0479×
0.85 0.91
(Ovary) 1.3295 + 1.4531

Frequency of different stages of oocytes in ovary

y = − 0.9136× + y = − 0.0453 × 2 +
Vitellogenic 68.746 0.53 0.9063× + 58.051 0.75
y = − 0.1897× + y = − 0.001 × 2–0.1487×
Alviolar 10.537 0.50 + 10.296 0.50
y = 1.1033× + y = 0.0463 × 2–0.7572×
Perinuclear 20.719 0.60 + 31.652 0.78

Size of vitellogenic oocytes

y = − 0.3968× + y = 0.0032 × 2–0.5238×
<0.85 mm 21.3 0.58 + 22.046 0.59
y = − 0.8725× + y = 0.0413 × 2–2.533×
0.86–1.15 mm 55.25 0.47 + 65.007 0.64
y = 0.7519× + y = − 0.0435 × 2 +
1.16–1.45 mm 19.657 0.46 2.4977× + 9.3986 0.72
y = 0.5174× + y = − 0.001 × 2 +
>1.46 mm 3.7927 0.44 0.5591× + 3.5478 0.44
y = − 0.1983× + y = − 0.0065 × 2 +
GSI 31.162 0.65 0.0615× + 29.635 0.77

Abbreviations: T3-Tri-iodothyronine, T4-thyroxine, T-testosterone, cyp19a1-

ovarian aromatase, cyp19b- brain aromatase, E2- 17β-estradiol, erα and erβ- es­
trogen receptors alpha and beta, vtgb2- vitellogenin b2 mRNA, VTG- Serum
vitellogenin, 20βHSD- 20β-hydroxysteroid dehydrogenase, and GSI-
gonadosomatic index.
1
Only the mean (n = 9) values are considered for correlation analysis.
3.6. Correlation of steroid synthesis, vitellogenesis and ovarian
development with gonadosomatic index
Among the various parameters selected, expression level of erβ, vtgb2,
20βHSD (Liver) and 20βHSD (Ovary), serum vitellogenin concentration,
Cortisol and Cholesterol, and the number of vitellogenic oocytes in the
ovary were highly and positivly correlated (Table 5). Wheraas serum T4,
testosterone levels and no of perinucleolar oocytes in the ovary were
negatively and highly correlated.
4. Discussion
According to previous studies conducted in our laboratory, 10 mg/
Fig. 1. Serum level of triiodothyronine (T3) and tetra-iodothyronine (T4) of
female C. carpio fed with graded levels of SBM in the diet.
Control, SBM-15, SBM-20, SBM-25, SBM-30, SBM-35 and SBM-40 are experi­
mental diets with 0, 15, 20, 25, 30, 35 and 40% SBM in feed. Data are arranged
as Mean ± SE. Data labelled with different superscripts in the same type bar are
significantly different (P < 0.05) (n = 9).
Kg (1 mg%) genistein, a prominent phytoestrogen in soybean induced
endocrine disruptive effects both in female (Nuzaiba et al., 2020) and
male (Nuzaiba et al., 2022) common carp when administered through
the diet. The present investigation was conducted to understand the
level of endocrine disruption when the female common carp is fed with
diets containing graded levels of soybean meal. Thus, the present study
is aimed at recommending a level of SBM inclusion in the broodstock
diet, without impairing its reproductive-endocrine axis.

5
P.M. Nuzaiba et al. Aquaculture 577 (2023) 739894

Fig. 2. (A) serum testosterone (T) and 17β-estradiol (E2) concentration and (B) serum cholesterol and cortisol concentration of female C. carpio fed with graded levels
of SBM in the diet.
Control, SBM-15, SBM-20, SBM-25, SBM-30, SBM-35 and SBM-40 are experimental diets with 0, 15, 20, 25, 30, 35 and 40% SBM in feed. Data are arranged as Mean
± SE. Data labelled with different superscripts in the same type bar are significantly different (P < 0.05) (n = 9).

Fig. 3. (A) Relative expression of ovarian aromatase (cyp19a1), brain aromatase (cyp19b) genes and (B) 20β-hydroxysteroid dehydrogenase (20βHSD) gene in the
liver, ovary of female C. carpio fed with graded levels of soybean meal in the diet.
Control, SBM-15, SBM-20, SBM-25, SBM-30, SBM-35 and SBM-40 are experimental diets with 0, 15, 20, 25, 30, 35 and 40% SBM in feed. Data are arranged as Mean
± SE. Data labelled with different superscripts in the same type bar are significantly different (P < 0.05) (n = 9).

Thyroid hormones, being important endocrine modulators with a
cross talk with reproductive steroids were estimated after the feeding
trial with graded level of soybean inclusion. Thyroid hormones consist of
two forms: the predominant circulating form, tetraiodothyronine
(thyroxine, T4), and the most biologically active form, tri-iodothyronine
(T3). Conversion of T4 to T3 occurs in central and peripheral tissues by
enzymatic removal of iodine (5′ monodeiodenation) by the enzyme 5′-
iodothyronine deiodinase enzyme. Disruption of the deiodinase enzyme
induces a reduction in circulating T3 and an increase in the level of T4.
In the present study, an increase in SBM inclusion in the feed increased
the level of T4 and reduced the level of serum T3, indicating the possible
disruptive effect of the deiodinase enzyme. Genistein was reported to
disrupt thyroid homeostasis in male C. carpio and showed low levels of
T3 in genistein-fed groups (Nuzaiba et al., 2020). Similarly, genistein
administration in the early life stages of Solea senegalensis (Sarasquete
et al., 2017) induced disruption of the deiodinase enzyme. The disrup­
tive effects on thyroid homeostasis by isoflavones are also reported in
mammals (Schroder-van der Elst et al., 1991; Šošić-Jurjević et al., 2010).
However, the link between thyroid hormones and reproduction is not
mechanistically established. According to Nelson and Habibi (2016),
impaired thyroid homeostasis affects vitellogenesis in female fish.
Similarly, spermatogenesis in male fishes is affected by disrupted thy­
roid bioconversion (Flood et al., 2013). The presence of deiodinases
enzymes (DIO1, DIO2, and DIO3) is found in the gonads of many fishes
(Deal and Volkoff (2020). Moreover, the transcripts level of DIO3
increased as the vitellogenesis progressed (Houbrechts and Darras,
2019). Further, to enhance reproductive performance in terms of egg
quality and quantity, thyroid hormones are used (Brown et al., 1989; El-
Zibdeh et al., 1996; Tachihara et al., 1997). Hence, the study indicated
that the higher inclusion of soybean meal in the diet (>35%) induces
disruption of thyroid axis, to reduce T4 levels, possibly affecting the
endocrine axis of reproduction.
All classes of steroids are synthesized from the common precursor,
cholesterol. In the current investigation, the serum cholesterol level in

6
P.M. Nuzaiba et al.
Fig. 4. (A) Relative expression of estrogen receptor-α (erα), estrogen receptor-β (erβ) in the liver tissue and (B) Serum vitellogenin concentration and hepatic vtgb2
expression of female C. carpio fed with graded levels of SBM in the diet.
Control, SBM-15, SBM-20, SBM-25, SBM-30, SBM-35 and SBM-40 are experimental diets with 0, 15, 20, 25, 30, 35 and 40% SBM in feed. Data are arranged as Mean
± SE. Data labelled with different superscripts in the same type bar are significantly different (P < 0.05) (n = 9).
Fig. 5. Second order polynomial regression analysis to of serum vitellogenin
against dietary inclusion of SBM.
The concentration of serum vitellogenin is highest when the dietary inclusion of
SBM is 10.90%. The serum vitellogenin concentration gradually decreased and
reached to the level observed in control at 22.2% SBM inclusion and further
reduced as the SBM increased. Only the mean values are considered for the
regression analysis.
fish groups fed with SBM showed hypocholesterolaemia, with the lowest
cholesterol level found in high SBM-diet-fed groups (30, 35, and 40%).
Similar effects were observed in giant grouper, Epinephelus lanceolatus,
when 50% fishmeal is replaced with SBM in the diet (Wu et al., 2020).
However, genistein showed no effect on hypocholesterolaemia but
increased total circulating cholesterol content (Nuzaiba et al., 2022).
Natural glucocorticoids such as cortisol regulate reproduction and
development in vertebrates and play a critical role in primary stress
response (Holsboer and Barden, 1996). A serum cortisol level reduction
caused downregulation of vitellogenin expression in females (Berg et al.,
2004). According to Kamińska et al. (2007), isoflavones suppress
cortisol release from adrenocortical cells. An in vitro test using H295R
cells indicated that genistein at 12.5 μM inhibited cortisol secretion in
the cells (Ohno et al., 2002). The vivo studies performed by Nuzaiba
et al. (2022) in male C. carpio and by Aluru et al. (2005) in O. mykiss
revealed that cortisol production was reduced up on feeding genistein or
isoflavanoids, respectively. These findings imply that genistein, when
7
Aquaculture 577 (2023) 739894
fed to fish, disrupts the synthesis of cortisol, which is reflected in the
high SBM fed groups of the current study.
The balance between serum testosterone and estradiol determines
the sexual characteristics of fish. The enzyme cytochrome P450 aro­
matase enzyme aids in the bioconversion of testosterone (C19 andro­
gens) to 17β-estradiol (C18 estrogens) (Uno et al., 2012) in fish as well as
in humans. Teleosts possess two isoforms of the enzyme: gonadal,
P450aromA and brain, P450aromB (genes encoding the enzymes are
cyp19a1 and cyp19b, respectively). In the present study, the expression
of cyp19a1, cyp19b, and the serum testosterone concentration indicated
inhibition of aromatase enzyme activity (Almstrup et al., 2002; Weber
et al., 2002; Wang et al., 2008) at high SBM feeding, which in turn
induced the testosterone level and reduced estradiol level in the serum.
The increase in E2 concentration up to 25% SBM inclusion in C. carpio
observed in this experiment may be due to the disruption of estrogen-
metabolizing enzymes. In the study conducted by Ng et al. (2006),
inhibited E2 metabolism was observed when liver and kidney tissues of
Atlantic salmon and rainbow trout or liver tissue of lake trout incubated
1 and 10 μM of genistein.
According to Clotfelter and Gendelman (2014) and Latonnelle et al.
(1999), phytoestrogens are structurally similar to animal 17β-estradiol
but have a 50-fold lower affinity for the receptors than 17β-estradiol. An
increase in the estrogen receptor alpha (erα) expression and reduction in
the mRNA level of estrogen receptor-beta (erβ) with the increase in the
dietary SBM level was also observed in the present study. The increase in
erα might have been the transcription activation associated with the
increased E2 levels in the circulation. The phytoestrogen-ERβ protein
complex changes its confirmation and results in a lack of control over the
erβ gene by the ERβ protein (Patisaul et al., 1999; Nuzaiba et al., 2022).
A low level of erβ mRNA reduces the concentration of ERα-ERβ hetero­
dimer. This heterodimer exhibits comparatively high activity in trans­
activating endogenous E2, eventually inducing the vitellogenesis
expression and the protein level. In females, since vitellogenesis is a
natural process, the increase in ERα-ERα homodimer is less significant in
E2 activation and consequently exhibit little effect on vitellogenesis.
In the present study, vtgb2 mRNA level and vitellogenin protein
expression supported the low erβ expression. Vitellogenin concentration
in SBM-fed female fishes was not impaired by SBM inclusion up to 25%
but reduced with a further increase in dietary SBM inclusion. The data
P.M. Nuzaiba et al.
Fig. 6. The proportion of (A) different stages of oocytes and (B) gonadosomatic index of female C. carpio fed with graded levels of SBM in the diet.
Control, SBM-15, SBM-20, SBM-25, SBM-30, SBM-35 and SBM-40 are experimental diets with 0, 15, 20, 25, 30, 35 and 40% SBM in feed. Data are arranged as Mean
± SE. Data labelled with different superscripts in the same type bar are significantly different (P < 0.05) (n = 9).
observed from the gene expression study of vtgb2 showed a similar
pattern as that of the protein. The result showed a similar trend as that of
genistein-fed C. carpio in the first experiment. The effect of soybean meal
on reducing the vitellogenin concentration in vitellogenic female
A. baeri was observed earlier when soybean meal was included in the
diet at 30% (Pelissero et al., 1991). Similarly, another study conducted
by Banani (2019) in our laboratory revealed that an inclusion of another
soy phytoestrogen, daidzein (3.8–7.5 mg/Kg diet) resulted in a reduc­
tion in vitellogenin concentration in 35% SBM-fed female C. carpio.
The developing oocytes in the ovary uptake vitellogenin, grow
themselves and increase the gonad weight during reproduction. Fish
gonad weight to body weight is measured by the gonadosomatic index
(GSI). Given that gravid females’ ovaries rapidly enlarge just before
spawning, the GSI is especially useful for determining the spawning
seasons. In the present study, a reduction of vitellogenic oocytes on
feeding high levels of SBM was observed. The proportion was lower in
high SBM diet-fed female C. carpio. A comparatively higher number of
vitellogenic oocytes was observed in 15, 20, and 25% of SBM-fed fishes.
Similar findings were reported by Banani (2019) when C. carpio female
fishes were fed with 17.5% and 35% soybean meal, a comparatively
higher proportion of vitellogenic oocytes was observed in 17.5% SBM-
fed groups and lower in 35% fed groups than the control group. In
support, the research by Fontaınhas-Fernandes et al. (2000) observed a
reduction in the number of vitellogenic oocytes in the ovary of the fe­
male O. niloticus when fed with a 100% plant protein diet. The size of the
vitellogenic oocyte did not vary among SBM-fed fishes. However, almost
uniform-sized vitellogenic oocytes were observed in the control than in
other treatment groups. Thus, it might be wise to conclude that SBM
inclusion brought about more asynchrony in ovarian development of
C. carpio.
In the present study, the reduction in the gonadosomatic index in
female C. carpio was also observed when the fish were fed a diet con­
taining 30% or more soybean meal. Estrogen receptor β, vitellogenin
and its precursor mRNA-vtgb2 were highly and positively correlated
with GSI. Similarly the steroids including cortisol and steroid synthesis
enzyme 20βHSD were highly correlated with GSI. The number of vitel­
logenic oocytres in the ovary ios highly and positively correlated, while
the no of perinucleolar oocytes were higly and negatively correlated.
Bagheri et al. (2013) reported that adult female C. auratus responded to
the high soybean meal inclusion by reducing the gonadosomatic index to
8
Aquaculture 577 (2023) 739894
35% and 65% of the dietary incorporation of soybean meal. Including
soybean meal in the diet at 30% reduced the gonadosomatic index in
C. gariepinus (Ugwoke, 2013). A slight but non-significant reduction in
GSI of female C. carpio was also observed in 35% of SBM-fed fishes
(Banani, 2019).
The 20β-Hydroxy steroid dehydrogenase (20βHSD) enzyme stimu­
lates the synthesis of 17-α, 20β-dihydroprogesterone (DHP). The high
endogenous testosterone in fish body fluid limits the synthesis of DHP by
downregulating the activity of 20βHSD (Kusakabe et al., 2006; Schulz
et al., 2010; Scott et al., 2010). In the present study, 20βHSD expression
is decreased as the serum testosterone and dietary SBM inclusion
increased. DHP may be reduced as the 20βHSD expression is down­
regulated, which eventually delays the maturation of the ovary (Kusa­
kabe et al., 2006; Schulz et al., 2010; Scott et al., 2010).
5. Conclusion
Based on the current and previous research, it is determined that soy-
phytoestrogens have a significant impact on thyroid homeostasis, ste­
roidogenesis, vitellogenesis, and gonad development in female carp.
Nonetheless, the severity of endocrine disruption is lowered when
phytoestrogens are delivered through their dietary source rather than in
pure form. Lowered phytoestrogens bioavailability, phytoestrogens
antagonistic in soybean meal, and phytoestrogens loss due to the heat
process (Kuligowski et al., 2022) may have reduced its impact on
reproductive-endocrine function. The presence of up to 25% SBM in the
feed did not affect the various endocrine and molecular players involved
in reproduction, but further inclusion of SBM disrupted reproduction.
Hence, the study came to the conclusion that up to 25% soybean meal
should be included in the diet of female carp broodstock in order to
produce good quality seeds. However, further evaluations are necessary
to comprehend the individual and combined effects of each antinutri­
tional factor on the reproduction of Cyprinus carpio.
CRediT authorship contribution statement
Pallath Muhammed Nuzaiba: Investigation, Data curation, Formal
analysis, Writing – original draft. Tamilarasan Nirmal: Investigation,
Software. Prabhakaran Arya: Investigation. Tincy Varghese: Writing –
review & editing. Subodh Gupta: Conceptualization, Supervision.
P.M. Nuzaiba et al.
Narottam Prasad Sahu: Methodology, Visualization. Prem Prakash
Srivastava: Resources.
Declaration of Competing Interest
All authors are equally contributed from idea generation to manu­
script preparation. The authors declare that there are no conflicts of
interest.
Data availability
No data was used for the research described in the article.
Acknowledgements
This research article is a part of PhD thesis of the first author. The
authors are thankful to the Director, ICAR-Central Institute of Fisheries
Education, Mumbai for providing the facilities for completing the
research. The first author is grateful to the Indian Council of Agricultural
Research for PhD fellowship.
This research did not receive any specific grant from funding
agencies in the public, commercial, or not-for-profit sectors.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.aquaculture.2023.739894.
References
Achouri, A., Boye, J.I., Belanger, D., 2005. Soybean isoflavones: efficacy of extraction
conditions and effect of food type on extractability. Food Res. Int. 38 (10),
1199–1204. https://doi.org/10.1016/j.foodres.2005.05.005.
Ahmed, Y., Idowu, T., Adedeji, H., Sogbesan, O., 2015. Sex reversal and growth
performances in Clarias gariepinus (Burchell, 1822) fry fed dietary genistein under
laboratory conditions. J. Agric. Food Technol. 5, 1–4.
Allain, C.C., Poon, L.S., Chan, C.S., Richmond, W., Fu, P.C., 1974. Enzymatic
determination of total serum cholesterol. Clin. Chem. 20 (4), 470–475. https://doi.
org/10.1093/clinchem/20.4.470.
Almstrup, K., Fernández, M.F., Petersen, J.H., Olea, N., Skakkebæk, N.E., Leffers, H.,
2002. Dual effects of phytoestrogens result in u-shaped dose-response curves.
Environ. Health Perspect. 110 (8), 743–748. https://doi.org/10.1289/
ehp.02110743.
Aluru, N., Renaud, R., Leatherland, J.F., Vijayan, M.M., 2005. Ah receptor-mediated
impairment of interrenal steroidogenesis involves StAR protein and P450scc gene
attenuation in rainbow trout. Toxicol. Sci. 84 (2), 260–269. https://doi.org/
10.1093/toxsci/kfi077.
Bagheri, T., Imanpoor, M.R., Jafari, V., Bennetau-Pelissero, C., 2013. Reproductive
impairment and endocrine disruption in goldfish by feeding diets containing soybean
meal. Anim. Reprod. Sci. 139 (1–4), 136–144. https://doi.org/10.1016/j.
anireprosci.2013.02.003.
Banani, M., 2019. Comparative assessment of estrogenic activity in female Cyprinus
carpio (Linnaeus, 1758) fed with soybean or synthetic diadzein (M.F.Sc.
Dessertation). In: ICAR-Central Institute of Fisheries Education (Deemed University),
Versova, Mumbai,-400061.
Berg, H., Modig, C., Olsson, P.-E., 2004. 17beta-estradiol induced vitellogenesis is
inhibited by cortisol at the post-transcriptional level in Arctic char (Salvelinus
alpinus). Reprod. Biol. Endocrinol. 2 (1), 1–10. https://doi.org/10.1186/1477-7827-
2-62.
Bhatnagar, A., Devi, P., 2013. Water quality guidelines for the management of pond fish
culture. Int. J. Environ. Sci. 3 (6), 1980–2009. https://doi.org/10.6088/
ijes.2013030600019.
Brown, C.L., Doroshov, S.I., Cochran, M.D., Bern, H.A., 1989. Enhanced survival in
striped bass fingerlings after maternal triiodothyronine treatment. Fish Physiol.
Biochem. 7 (1), 295–299. https://doi.org/10.1007/BF00004720.
Chakraborty, S.B., Molnár, T., Hancz, C., 2012. Effects of methyltestosterone, tamoxifen,
genistein and Basella alba extract on masculinization of guppy (Poecilia reticulata).
J. Appl. Pharm. Sci. 2 (12), 048–052. https://doi.org/10.7324/JAPS.2012.21209.
Chen, R.T., Wei, K.Q., 2008. Analysis of bioactive aglycone isoflavones in soybean and
soybean products. Nutr. Food Sci. 38 (6), 540–547. https://doi.org/10.1108/
00346650810920132.
Clotfelter, E.D., Gendelman, H.K., 2014. Exposure to environmentally relevant
concentrations of genistein during activation does not affect sperm motility in the
fighting fish Betta splendens. Biomed. Res. Int. 2014 https://doi.org/10.1155/2014/
865741.
Deal, C.K., Volkoff, H., 2020. The role of the thyroid axis in fish. Front. Endocrinol. 11,
596585 https://doi.org/10.3389/fendo.2020.596585.
9
Aquaculture 577 (2023) 739894
Dersjant-Li, Y., 2002. The use of soy protein in aquafeeds. In: Cruz-Suárez, L.E., Ricque-
Marie, D., Tapia-Salazar, M., Gaxiola-Cortés, M.G., Simoes, N. (Eds.), Avances en
Nutricion Acuicola VI. Memorias del VI Simposium Internacional de Nutricion
Acuicola (3 al 6 de Septiembre del 2002 ed., Vol. 3, pp. 541–558). Cancún, Quintana
Roo, México.
DiMaggio, M.A., Kenter, L.W., Breton, T.S., Berlinsky, D.L., 2016. Effects of dietary
genistein administration on growth, survival and sex determination in southern
flounder, Paralichthys lethostigma. Aquac. Res. 47 (1), 82–90. https://doi.org/
10.1111/are.12470.
Eldridge, A.C., Kwolek, W.F., 1983. Soybean isoflavones: effect of environment and
variety on composition. J. Agric. Food Chem. 31 (2), 394–396. https://doi.org/
10.1021/jf00116a052.
El-Sayed, A.-F.M., Abdel-Aziz, E.-S.H., Abdel-Ghani, H.M., 2012. Effects of
phytoestrogens on sex reversal of Nile tilapia (Oreochromis niloticus) larvae fed diets
treated with 17α-Methyltestosterone. Aquaculture. 360, 58–63. https://doi.org/
10.1016/j.aquaculture.2012.07.010.
El-Zibdeh, M.K., Tachihara, K., Tsukashima, Y., Tagawa, M., Ishimatsu, A., 1996. Effect
of triiodothyronine injection of broodstock fish on seed production in cultured
seawater fish. Aquac. Sci. 44 (4), 487–496. https://doi.org/10.11233/
aquaculturesci1953.44.487.
Fajkowska, M., Adamek-Urbańska, D., Ostaszewska, T., Szczepkowski, M.,
Rzepkowska, M., 2021. Effect of genistein, daidzein and coumestrol on sex-related
genes expression in Russian sturgeon (Acipenser gueldenstaedtii). Aquaculture. 530,
735872 https://doi.org/10.1016/j.aquaculture.2020.735872.
Flood, D.E., Fernandino, J.I., Langlois, V.S., 2013. Thyroid hormones in male
reproductive development: evidence for direct crosstalk between the androgen and
thyroid hormone axes. Gen. Comp. Endocrinol. 192, 2–14. https://doi.org/10.1016/
j.ygcen.2013.02.038.
Fontaınhas-Fernandes, A., Monteiro, M., Figueiredo, A., Gomes, E., Coimbra, J., Reis-
Henriques, M., 2000. Partial or total replacement of fish meal byplant protein affects
gonadal development and plasma17 b-estradiol levels in female Nile tilapia. Aquac.
Int. 8, 299–313.
Francis, G., Makkar, H.P., Becker, K., 2001. Antinutritional factors present in plant-
derived alternate fish feed ingredients and their effects in fish. Aquaculture. 199
(3–4), 197–227. https://doi.org/10.1016/S0044-8486(01)00526-9.
García-Ortega, A., Kissinger, K.R., Trushenski, J.T., 2016. Evaluation of fish meal and
fish oil replacement by soybean protein and algal meal from Schizochytrium
limacinum in diets for giant grouper Epinephelus lanceolatus. Aquaculture. 452, 1–8.
https://doi.org/10.1016/j.aquaculture.2015.10.020.
Green, C., Kelly, A., 2009. Effects of the estrogen mimic genistein as a dietary component
on sex differentiation and ethoxyresorufin-O-deethylase (EROD) activity in channel
catfish (Ictalurus punctatus). Fish Physiol. Biochem. 35 (3), 377–384. https://doi.org/
10.1007/s10695-008-9260-z.
Holsboer, F., Barden, N., 1996. Antidepressants and hypothalamic-pituitary-
adrenocortical regulation. Endocr. Rev. 17 (2), 187–205. https://doi.org/10.1210/
edrv-17-2-187.
Houbrechts, A.M., Darras, V.M., 2019. Disruption of deiodinase type 2 in zebrafish
disturbs male and female reproduction. J. Endocrinol. 241 (2), 111–123. https://doi.
org/10.1530/JOE-18-0549.
Inudo, M., Ishibashi, H., Matsumura, N., Matsuoka, M., Mori, T., Taniyama, S.,
Kadokami, K., Koga, M., Shinohara, R., Hutchinson, T., 2004. Effect of estrogenic
activity, and phytoestrogen and organochlorine pesticide contents in an
experimental fish diet on reproduction and hepatic vitellogenin production in
medaka (Oryzias latipes). Comp. Med. 54 (6), 673–680.
Jayasankar, P., 2018. Present status of freshwater aquaculture in India-a review. Indian
J. Fish. 65 (4), 157–165.
Kamińska, B., Opalka, M., Dusza, L., 2007. Phytoestrogens alter cortisol and and
rostenedione secretion by porcine adrenocortical cells. Acta Vet. Hung. 55 (3),
359–367. https://doi.org/10.1556/avet.55.2007.3.10.
Kiparissis, Y., Balch, G.C., Metcalfe, T.L., Metcalfe, C.D., 2003. Effects of the isoflavones
genistein and equol on the gonadal development of Japanese medaka, Oryzias latipes.
Environ. Health Perspect. 111 (9), 1158–1163. https://doi.org/10.1289/ehp.5928.
Kokou, F., Sarropoulou, E., Cotou, E., Kentouri, M., Alexis, M., Rigos, G., 2017. Effects of
graded dietary levels of soy protein concentrate supplemented with methionine and
phosphate on the immune and antioxidant responses of gilthead sea bream (Sparus
aurata L.). Fish Shellfish Immunol. 64, 111–121. https://doi.org/10.1016/j.
fsi.2017.03.017.
Kuligowski, M., Sobkowiak, D., Polanowska, K., Jasińska-Kuligowska, I., 2022. Effect of
different processing methods on isoflavone content in soybeans and soy products.
J. Food Compos. Anal. 110, 104535 https://doi.org/10.1016/j.jfca.2022.104535.
Kusakabe, M., Nakamura, I., Evans, J., Swanson, P., Young, G., 2006. Changes in mRNAs
encoding steroidogenic acute regulatory protein, steroidogenic enzymes and
receptors for gonadotropins during spermatogenesis in rainbow trout testes.
J. Endocrinol. 189 (3), 541–554. https://doi.org/10.1677/joe.1.06684.
Latonnelle, K., Bennetau-Pelissero, D., Fostier, A., Le Menn, F., 1999. Affinity of estradiol
receptors from rainbow trout hepatocytes for phytoestrogens. In: Paper presented at
the Proceedings of the 6th International Symposium on the Reproductive Physiology
of Fish, Bergen, Norway.
Li, Y., Yu, H., Xue, M., Zhang, Y., Mai, K., Hu, H., Liu, J., 2016. A tolerance and safety
assessment of daidzein in a female fish (Carassius auratus gibelio). Aquac. Res. 47 (4),
1191–1201. https://doi.org/10.1111/are.12575.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method. Methods. 25 (4), 402–408. https://
doi.org/10.1006/meth.2001.1262.
P.M. Nuzaiba et al.
Nelson, E.R., Habibi, H.R., 2016. Thyroid hormone regulates vitellogenin by inducing
estrogen receptor alpha in the goldfish liver. Mol. Cell. Endocrinol. 436, 259–267.
https://doi.org/10.1016/j.mce.2016.08.045.
Ng, Y., Hanson, S., Malison, J.A., Wentworth, B., Barry, T.P., 2006. Genistein and other
isoflavones found in soybeans inhibit estrogen metabolism in salmonid fish.
Aquaculture. 254 (1–4), 658–665. https://doi.org/10.1016/j.
aquaculture.2005.10.039.
Nuzaiba, P.M., Varghese, T., Gupta, S., Sahu, N.P., Banani, M., Srivastava, P.P.,
Krishna, G., 2020. Dietary genistein disrupts sex steroid and vitellogenic response in
female common carp, Cyprinus carpio L. Aquaculture. 522, 735062 https://doi.org/
10.1016/j.aquaculture.2020.735062.
Nuzaiba, P.M., Varghese, T., Gupta, S., Sahu, N.P., Srivastava, P.P., 2022. Estrogenic and
vitellogenic responses in genistein fed adult male Cyprinus carpio. Aquaculture. 548,
737559 https://doi.org/10.1016/j.aquaculture.2021.737559.
Ohno, S., Shinoda, S., Toyoshima, S., Nakazawa, H., Makino, T., Nakajin, S., 2002.
Effects of flavonoid phytochemicals on cortisol production and on activities of
steroidogenic enzymes in human adrenocortical H295R cells. J. Steroid Biochem.
Mol. Biol. 80 (3), 355–363. https://doi.org/10.1016/S0960-0760(02)00021-3.
Patisaul, H.B., Whitten, P.L., Young, L.J., 1999. Regulation of estrogen receptor beta
mRNA in the brain: opposite effects of 17β-estradiol and the phytoestrogen,
coumestrol. Mol. Brain Res. 67 (1), 165–171. https://doi.org/10.1016/S0169-328X
(99)00058-3.
Pelissero, C.B., Bennetau, B., Babin, P., Le Menn, F., Dunogues, J., 1991. The estrogenic
activity of certain phytoestrogens in the Siberian sturgeon, Acipenser baeri. J. Steroid
Biochem. Mol. Biol. 38 (3), 293–299. https://doi.org/10.1016/0960-0760(91)
90100-J.
Pelissero, C.B., Breton, B., Bennetau, B., Corraze, G., Le Menn, F., Davail Cuisset, B.,
Helou, C., Kaushik, S., 2001. Effect of genistein-enriched diets on the endocrine
process of gametogenesis and on reproduction efficiency of the rainbow trout,
Oncorhynchus mykiss. Gen. Comp. Endocrinol. 121 (2), 173–187. https://doi.org/
10.1006/gcen.2000.7585.
Pollack, S.J., Ottinger, M.A., Sullivan, C.V., Woods III, L.C., 2003. The effects of the soy
isoflavone genistein on the reproductive development of striped bass. N. Am. J.
Aquac. 65 (3), 226–234. https://doi.org/10.1577/C02-041.
Roeschlau, P., Bernt, E., Gruber, W., 1974. Enzymatic determination of total cholesterol
in serum. Z. Klin. Chem. Klin. Biochem. 12 (5), 226.
Sarasquete, C., Úbeda-Manzanaro, M., Ortiz-Delgado, J.B., 2017. Effects of the soya
isoflavone genistein in early life stages of the Senegalese sole, Solea senegalensis:
thyroid, estrogenic and metabolic biomarkers. Gen. Comp. Endocrinol. 250,
136–151. https://doi.org/10.1016/j.ygcen.2017.06.008.
Sarasquete, C., Úbeda-Manzanaro, M., Ortiz-Delgado, J.B., 2020. Soya isoflavones,
genistein and daidzein, induce differential transcriptional modulation in the ovary
and testis of zebrafish, danio rerio. Aquat. Biol. 29, 79–91. https://doi.org/10.3354/
ab00726.
Schroder-van der Elst, J., Van der Heide, D., Kohrle, J., 1991. In vivo effects of flavonoid
EMD 21388 on thyroid hormone secretion and metabolism in rats. Am. J. Physiol.
Endocrinol. Metab. 261 (2), E227–E232. https://doi.org/10.1152/
ajpendo.1991.261.2.E227.
10
Aquaculture 577 (2023) 739894
Schulz, R.W., de França, L.R., Lareyre, J.-J., LeGac, F., Chiarini-Garcia, H., Nobrega, R.
H., Miura, T., 2010. Spermatogenesis in fish. Gen. Comp. Endocrinol. 165 (3),
390–411. https://doi.org/10.1016/j.ygcen.2009.02.013.
Scott, A., Sumpter, J., Stacey, N., 2010. The role of the maturation-inducing steroid, 17,
20β-dihydroxypregn-4-en-3-one, in male fishes: a review. J. Fish Biol. 76 (1),
183–224. https://doi.org/10.1111/j.1095-8649.2009.02483.x.
Setchell, K., 1998. Phytoestrogens: the biochemistry, physiology, and implications for
human health of soy isoflavones. Am. J. Clin. Nutr. 68 (6), 1333S–1346S. https://
doi.org/10.1093/ajcn/68.6.1333S.
Šošić-Jurjević, B., Filipović, B., Ajdžanović, V., Savin, S., Nestorović, N., Milošević, V.,
Sekulić, M., 2010. Suppressive effects of genistein and daidzein on pituitary–thyroid
axis in orchidectomized middle-aged rats. Exp. Biol. Med. 235 (5), 590–598. https://
doi.org/10.1258/ebm.2009.009279.
Tachihara, K., El-Zibdeh, M.K., Ishimatsu, A., Tagawa, M., 1997. Improved seed
production of goldstriped amberjack Seriola lalandi under hatchery conditions by
injection of triiodothyronine (T3) to broodstock fish. J. World Aquac. Soc. 28 (1),
34–44. https://doi.org/10.1111/j.1749-7345.1997.tb00959.x.
Tacon, A.G., Metian, M., 2015. Feed matters: satisfying the feed demand of aquaculture.
Rev. Fish. Sci. Aquac. 23 (1), 1–10. https://doi.org/10.1080/
23308249.2014.987209.
Turker, H., Bozcaarmutlu, A., 2009. Effect of total isoflavones found in soybean on
vitellogenin production in common carp. Kafkas Univ. Vet. Fak. Derg. 15 (4),
561–568. https://doi.org/10.9775/kvfd.2009.062-A.
Ugwoke, C., 2013. Effects of Supplementation of Fish Meal with Soybean Meal on the
Growth and Gonad Development of the African Catfish (Clarias Gariapinus) (M. Sc.
Thesis). University of Nigeria Nsukka.
Wang, Y., Gho, W.M., Chan, F.L., Chen, S., Leung, L.K., 2008. The red clover (Trifolium
pratense) isoflavone biochanin a inhibits aromatase activity and expression. Br. J.
Nutr. 99 (2), 303–310. https://doi.org/10.1017/S0007114507811974.
Weber, L.P., Kiparissis, Y., Hwang, G.S., Niimi, A.J., Janz, D.M., Metcalfe, C.D., 2002.
Increased cellular apoptosis after chronic aqueous exposure to nonylphenol and
quercetin in adult medaka (Oryzias latipes). Comp. Biochem. Physiol. C Toxicol.
Pharmacol. 131 (1), 51–59. https://doi.org/10.1016/S1532-0456(01)00276-9.
Wu, T.M., Jiang, J.J., Lu, R.M., Lin, Y.H., 2020. Effects of dietary inclusion of soybean
meal and cholesterol on the growth, cholesterol status and metabolism of the giant
grouper (Epinephelus lanceolatus). Aquac. Nutr. 26 (2), 351–357. https://doi.org/
10.1111/anu.12997.
Xiao, Y., Zhang, S., Tong, H., Shi, S., 2018. Comprehensive evaluation of the role of soy
and isoflavone supplementation in humans and animals over the past two decades.
Phytother. Res. 32 (3), 384–394. https://doi.org/10.1002/ptr.5966.
Ye, H., Xu, M., Liu, Q., Sun, Z., Zou, C., Chen, L., Su, N., Ye, C., 2019. Effects of replacing
fish meal with soybean meal on growth performance, feed utilization and
physiological status of juvenile obscure puffer, Takifugu obscurus. Comp. Biochem.
Physiol. C Toxicol. Pharmacol. 216, 75–81. https://doi.org/10.1111/j.1365-
2095.2012.00945.x.
Zhang, Y., Ji, W., Wu, Y., Han, H., Qin, J., Wang, Y., 2016. Replacement of dietary fish
meal by soybean meal supplemented with crystalline methionine for Japanese
seabass (Lateolabrax japonicus). Aquac. Res. 47 (1), 243–252. https://doi.org/
10.1111/are.12486.