Received: 6 July 2020 | Revised: 18 December 2020 | Accepted: 23 December 2020

DOI: 10.1111/anu.13226

ORIGINAL ARTICLE

Feeding sundried cassava leaf meal as a replacement for de-

oiled rice bran in the diets of rohu, Labeo rohita, fingerlings:
effect on growth, enzyme activities and gene expression of
igf-i and igf-bpi

Oluwagbenga Olanrewaju Olude1,3 | Narottam Prasad Sahu1 |

Pallath Muhammed Nuzaiba1 | Gopal Krishna2

1
Division of Fish Nutrition, Biochemistry
and Physiology, ICAR-Central Institute of
Fisheries Education, Versova, Mumbai,
India
2
Division of Fisheries Genetics and
Biotechnology, ICAR-Central Institute of
Fisheries Education, Versova, Mumbai,
India
3
Department of Marine Sciences,
University of Lagos, Akoka, Nigeria
Correspondence
Olude O.O. Department of Marine
Sciences, University of Lagos, Akoka,
Nigeria.
Email: oolude@unilag.edu.ng
Funding information
Academy of Sciences for the Developing
World; Department of Biotechnology ,
Ministry of Science and Technology
Abstract
A 75-day feeding trial was conducted to evaluate the nutritional implication of feed-
ing diets containing graded levels of sundried cassava leaf meal (SCLM) to Labeo rohita
fingerlings. Four isonitrogenous (300 g/kg crude protein) and isoenergetic (18 MJ/kg)
diets were prepared by replacing de-oiled rice bran (DORB) with 0 (diet 1), 130 (diet 2),
260 (diet 3) and 390 g/kg (diet 4) of SCLM. The diets were fed to the triplicate groups
of L. rohita fingerlings (average weight, 2.03 ± 0.03 g) in a completely randomized
experimental design. At the end of the trial, diet 3 had similar (p > 0.05) percentage
weight gain (106.38 ± 4.41%), specific growth rate (1.29 ± 0.04%/day) and feed con-
version ratio (2.38 ± 0.08) relative to the control group. Intestinal digestive enzyme
activities, hepatic and muscle transaminases and proximate body composition of L.
rohita fingerlings were not significantly (p > 0.05) influenced by the dietary treatment.
Superoxide dismutase activity of the group reared on diets 3 and 4 was significantly
(p < 0.05) higher than that of diet 1. Based on the second-order polynomial regres-
sion analysis on the expression of IGF-I and IGF-BPI, it was concluded that as much as
166.5 g/kg DORB can be replaced by SCLM for optimal growth performance, in the
diets of L. rohita fingerlings.

KEYWORDS
Cassava leaf, de-oiled rice bran, enzyme activities, insulin-like growth factor I, insulin-like
growth factor-binding protein I, Labeo rohita

1 | I NTRO D U C TI O N in 2016 (FAO, 2018). In India, aquaculture growth is largely driven by

Aquaculture has become an important sector for improving food
security, raising nutritional standards and alleviating poverty, par-
ticularly in the world's poorest countries (Bene et al. 2016). This is
evident in the continuous growth of global farmed food fish, which
increased from about 52 million tonnes, with a value of US$78.8 bil-
lion, in 2006 to 80 million tonnes, with a value of US$231.6 billion,
the farming of Indian major carps (IMC) namely rohu (Labeo rohita),
mrigal (Cirrhinus cirrhosus) and catla (Catla catla), which are usually
reared in polyculture system. Of the three IMC, rohu represents the
most widespread farmed fish species and also the mainstay of aqua-
culture industry in many other Asian countries such as Bangladesh,
Pakistan, Myanmar, Lao People's Democratic Republic, Vietnam and
Nepal (Ramakrishna et al. 2013). This is because of its fast growth,

Aquaculture Nutrition. 2021;27:817–828. wileyonlinelibrary.com/journal/anu © 2021 John Wiley & Sons Ltd | 817
818 | OLUDE et al.
consumer preference due to taste, high fecundity and ease of re-
production. However, the provision of feeds that are cost-effective,
sustainable and nutritionally adequate has been a major lid on fur-
ther expansion of carp aquaculture, at both local and global levels.
Traditionally, feeding practice in rohu farming uses mash feed, which
principally contains de-oiled rice bran (DORB) mixed with protein in-
gredients such as groundnut and cottonseed oilcake. Recently, com-
mercial pelleted aquafeed, which also usually contain substantial
quantities of DORB, has been successfully proven to increase pro-
duction output (Ramakrishna et al. 2013). Either in mash feed or in
commercial pelleted feed, DORB represents a very significant feed
input in the farming of L. rohita. Meanwhile, there has been a steady
rise in the cost of de-oiled rice bran, since its demand far outweighs
its supply. This challenge stems from the fact that DORB is heavily
used in other livestock production and has also recently become a
major ingredient in the production of cookies for human consump-
tion at the commercial level (Younas et al., 2011). In the past ten
years, marginal growth rate in rice production, the commodity from
which DORB is derived, has been recorded both globally and in India
(FAO, 2017). The need to source and assess the suitability of other
ingredients that could replace or supplement DORB in order to re-
duce its use in carp culture has therefore become imperative.
One of such sustainable and cheap alternatives is leaf meal, since
they synthesize their food from cheap and readily available primary
materials. Meshram et al. (2018) recently demonstrated the possi-
bility of incorporating sweet potato leaf meal as a replacement for
DORB, especially when fermented, in the diet of L. rohita. Similarly,
Maiti et al. (2019) reported that Hygrophila spinosa leaf meal can com-
pletely replace DORB in the diet of rohu without affecting growth
and nutrient utilization; they further observed that the supplemen-
tation of the leaf meal-based diet with carbohydrase enzyme did not
elicit further benefits. Another crop residue that could be similarly
relevant is cassava leaf meal, which is usually a waste after cassava
tuber harvest. Cassava plant (Manihot esculenta) is cultivated over
most of non-arid tropical region, mainly for its roots (Nhassico et al.,
2008), and it is the fourth most important global staple crop, coming
behind rice, wheat and maize (FAO, 2013). Its production grew from
124 million tonnes in 1980 through 252 million tonnes in 2011 (FAO,
2013) and to 292 million tonnes in 2017 (www.fao.org › faostat).
According to the review of Morgan and Choct (2016), approximately
10 tons of dry cassava foliage is produced per hectare of cassava
plantation and this is readily available as a waste product at the time
of harvesting the roots. Unlike the roots that are essentially carbo-
hydrate, cassava leaf is rich in protein, calcium, iron, vitamins and
carotene (Adewusi & Bradbury, 1993; Morgan & Choct, 2016), with
metabolizable energy of 1800 kcal/kg (Ravindran, 1991). A major
limitation to the use of cassava leaf in animal diet, like many other
non-conventional feed resources, is the presence of high crude fibre,
and antinutrients such as hydrogen cyanide, phytate and tannin,
which are capable of altering normal fish physiology and metabolism
and ultimately influencing growth and health status. Bradbury and
Denton (2011, 2014) among other investigators suggested differ-
ent processing methods such as pounding, washing and sundrying
either singly or in combination as veritable processing method that
can reduce the cyanide content of cassava leaf. The cyanide content
of cassava leaf meal (CLM) has been reported to decrease as the
leaf matures, while crude fibre and hemicellulose contents increase
(Ravindran, 1991).
Perhaps the first report on the utilization of CLM in fish diet is
that of Ng and Wee (1989) who incorporated graded levels of CLM
(25% crude protein) as a protein source in place of fish meal (54%
crude protein) and reported an adverse effect on growth and nu-
trient utilization of tilapia, Oreochromis niloticus, at the lowest level
(206 g/kg) of CLM supplementation. Their study was limited in scope
and also inconclusive, as they could not ascertain an optimal level of
CLM that will not elicit growth compromise in tilapia diet. Similar
context applies in the study of Madalla et al. (2016) with their re-
ports suggesting that CLM has limited value as protein source in fish
diet. A pragmatic approach should therefore seek to utilize CLM as a
carbohydrate rather than protein source in fish diet. Thus, the pres-
ent study aimed to evaluate the nutritional implications of feeding
diets containing graded levels of sundried cassava leaf meal (SCLM)
as a substitute to de-oiled rice bran in the diets of rohu, L. rohita.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Collection and preparation of cassava leaf
meal
The cassava leaf used under current investigation was collected as
a crop residue after the harvest of cassava tuber from a local farm
in Kerala, India. It was sundried for three days after which the peti-
oles were removed. The leaves were milled using a locally fabricated
grinder (Bajaj Electricals Ltd, India) and kept in a sealed polythene
bag at room temperature until used.
2.2 | Diet formulation and preparation
Four isonitrogenous (≈300 g/kg crude protein) and isoenergetic
diets (≈18 MJ/kg) were prepared (Table 1). The diets contained
groundnut oilcake and equal quantities of defatted soybean meal as
the main protein source. The control diet (diet 1) has DORB (390 g/
kg) as the main energy source, and it was progressively replaced by
130 (diet 2), 260 (diet 3) and 390 g/kg (diet 4) of SCLM. The diets also
contained an equal amount of oil (sunflower and cod liver oil in the
same ratio), vitamin/mineral premix, choline chloride and butylated
hydroxytoluene, which served as antioxidant, and carboxylmethyl
cellulose was used as binder.
2.3 | Experimental fish
L. rohita (rohu) fingerlings (average weight, 2.03 ± 0.01 g) were pur-
chased from Roshan Akhade Fish Farm, Goregaon, Maharashtra,
OLUDE et al. | 819

TA B L E 1 Ingredient (g/kg), and proximate and antinutritional compositions of the experimental diets.

Ingredients Diet 1 Diet 2 Diet 3 Diet 4 DORB SCLM

a
GNOC 252 219 186 153
b
DSBM 250 250 250 250
SCLMc 0 130 260 390
DORBd 390 260 130 0
Wheat flour 15.8 48.8 81.8 114.8
Sunflower oil 30 30 30 30
Cod liver oil 30 30 30 30
e
Vit-Min. premix 20 20 20 20
CMCf 10 10 10 10
g
BHT 0.2 0.2 0.2 0.2
Choline chloride 2 2 2 2
Proximate composition (g/kg)
Dry matter 947.3 ± 0.1 955.2 ± 0.1 957.5 ± 0.3 952.6 ± 0.2 940.5 ± 0.3 918.5 ± 0.8
Crude protein 304.3 ± 4.3 304.2 ± 4.9 303.2 ± 0.7 297.0 ± 2.1 155.3 ± 0.8 242.1 ± 4.2
Ether extract 78.2 ± 0.4 83.8 ± 3.3 89.2 ± 0.3 87.2 ± 2.4 2.8 ± 0.2 66.3 ± 2.5
Total ash 83.2 ± 0.8 78.9 ± 0.2 75.1 ± 0.3 71.8 ± 0.4 83.2 ± 0.3 103.1 ± 2.5
Crude fibre 93.6 ± 0.6 100.8 ± 6.5 102.6 ± 0.2 106.8 ± 0.7 148.0 ± 0.4 185.3 ± 2.61
h
NFE 388.2 ± 4.1 384.6 ± 14.8 388.4 ± 1.2 389.9 ± 3.0 551.2 ± 1.4 321.7 ± 11.0
Gross energy (MJ/kg) 18.15 ± 0.35 18.30 ± 0.07 18.45 ± 0.12 18.53 ± 0.26 ND 19.84 ± 0.11
Antinutritional composition (g/kg)
Tannin ND 0.02 ± 0.00 0.03 ± 0.00 0.05 ± 0.01 ND 0.12 ± 0.01
Phytate ND 0.72 ± 0.03 1.45 ± 0.06 2.17 ± 0.09 ND 5.57 ± 0.23
Hydrogen cyanide ND 0.05 ± 0.00 0.09 ± 0.00 0.14 ± 0.01 ND 0.46 ± 0.02
a
GNOC, groundnut oil cake.
b
DSBM, defatted soybean meal.
c
SCLM, sundried cassava leaf meal.
d
DORB, de-oiled rice bran.
e
Vit-min mix, vitamin and mineral premix.
f
CMC, carboxymethyl cellulose.
g
BHT, butylated hydroxytoluene.
h
NFE (nitrogen-free extract, g/kg) =1000-(moisture content +crude protein +crude lipid +total ash +crude fibre); composition of vitamin–mineral
premix (Premix Plus) (quantity/kg): vitamin A, 55,00,000 IU; vitamin D3, 11,00,000 IU; vitamin B2, 2,000 mg; vitamin E, 750 mg; vitamin K,
1,000 mg; vitamin B6, 1,000 mg; vitamin B12, 6 mg; calcium pantothenate, 2,500 mg; nicotinamide, 10 g; choline chloride, 150 g; Mn, 27,000 mg; I,
1,000 mg; Fe, 7,500 mg; Zn, 5,000 mg; Cu, 2,000 mg; Co, 450 L-lysine, 10 g; DL-methionine, 10 g; selenium; ND, not determined.

and transported to the wet laboratory of ICAR–Central Institute
of Fisheries Education in oxygenated polythene bag. At the wet
laboratory, they were acclimated for 21 days in circular fibre glass
tank (1000L) filled to 2/3 of its volume with fallowed water and
kept under constant aeration. They were maintained on the con-
trol diet until the commencement of the experiment. The fish were
treated and handled according to the guidelines of Committee for
the Purpose of Control and Supervision of Experiments on Animals
(CPCSEA), Ministry of Environment and Forests (Animal Welfare
Division), Government of India, on care and use of animals in sci-
entific research. This study was approved by the authorities of
Indian Council of Agriculture Research–Central Institute of Fisheries
Education (ICAR-CIFE), Mumbai—400,061.
2.4 | Experimental design and sampling
One hundred and forty-four rohu fingerlings were randomly distrib-
uted into 12 rectangular tubs (96 L capacity) at 12 fish per tub. The
tubs’ covers were perforated, and the water in the tubs was kept
under continuous aeration to ensure optimal dissolved oxygen. The
tubs were then randomly assigned to the four experimental diets in
triplicates, and the fishes were fed at 3% of their body weight given
in two equal instalments: in the morning at 09:00 and evening at
16:00 hr. Fish wastes were syphoned every other day after which
freshwater was added to make up to the original water volume,
which was at 80% of the tub's capacity. Fish weight was recorded
in bulk per treatment replicate using sensitive scale, firstly at the
820 | OLUDE et al.
commencement of the feeding trial and subsequently, every 15th day
throughout the experimental period that lasted for 75 days. Water
quality parameters such as temperature (27.2–29.4°C), pH (7.2–8.1),
dissolved oxygen (6.4–7.5 mg/l) and ammonia (0.06–0.12 mg/l) were
measured and maintained at optimum range throughout the feeding
experiment. At the end of the experiment, four fishes were sacri-
ficed by subjecting them to overdose of anaesthesia (clove oil) and
used for carcass proximate analysis. Liver and intestine were also
excised from four fishes per treatment and used for the calculation
of hepatosomatic and intestinal somatic indices. Tissues of interest
(intestine, liver and muscle) were also removed from three fish per
treatment replicate into 0.25 M chilled sucrose solution and ho-
mogenized using Teflon-coated mechanical homogenizer (MICCRA
D-9; ART Prozess & Labortechnik, Germany). Subsequently, the ho-
mogenate was centrifuged (Heraeus Megafuge 8R; Thermo Fisher
Scientific, USA) at 5000 rpm for 10 min at 4°C; the supernatant was
collected into well-labelled Eppendorf tubes and stored at −20°C
until used for assays relating to enzyme activity.
2.5 | Digestive, metabolic and antioxidant
enzyme activities
Enzyme isolated from intestinal tissue was used to estimate amyl-
ase and protease activities. Amylase activity was assayed using the
method of Rick and Stegbauer, 1974) based on the brown-coloured
complex (3-amino-5-nitrosalicylic acid) formed when 3, 5 dinitrosali-
cylic (DNS) acid reacts with reducing sugars produced by α-amylase.
Amylase activity was expressed as mole of maltose released from
starch per min at 37°C. Casein digestion method of Drapeau (1974)
was used to determine protease activity. The amount of enzyme
needed to release acid-soluble fragments equivalent to Δ0.001A 280
per min at 37°C and pH 7.8 was defined as one unit of protease
activity.
Aspartate transaminase (AST) and alanine transaminase (ALT) ac-
tivities in the liver and muscle tissues of the experimental fish were
determined using the method of Wooten (1964). L-aspartic acid and
DL-alanine acid were, respectively, used as substrate for AST and
ALT assays in addition to α-ketoglutaric acid dissolved in potassium
phosphate buffer (pH 7.7). AST and ALT activities were expressed
as nanomole of sodium pyruvate released per min per mg protein.
Liver and muscle lactate dehydrogenase (LDH) activities were
estimated from the amount of NAD+ produced at 340 nm when
sodium pyruvate was added to the mixture of NADH and tissue
homogenate in phosphate buffer as described by Wrobleiuski and
Laude (1955). LDH activity was expressed as unit per mg protein per
min at 25°C (where 1 unit was equal to Δ0.01ODmin-1). Malate dehy-
drogenase (MDH) activities of the liver and muscle were assayed fol-
lowing similar protocol used for LDH. However, oxaloacetate rather
than sodium pyruvate was used to initiate the reaction in the deter-
mination of MDH activity according to the method of Ochoa (1955).
The method of Takahara et al. (1960) was followed to determine
the hepatic catalase activity. The decrease in absorbance at 240 nm
for 3 min (at 15-sec interval) as a result of decomposition of hydro-
gen peroxide was measured and expressed as nanomoles H2O2 de-
composed per min per mg protein. Liver superoxide dismutase (SOD)
was measured based on epinephrine auto-oxidation and expressed
as the amount of protein required to give 50% inhibition of epineph-
rine auto-oxidation.
Total protein content of each tissue sample used for enzyme
analysis was estimated by the method of Lowry et al. (1951) using
bovine serum albumin as standard.
2.6 | Biochemical analysis
The method of AOAC (1990) was used in the determination of proxi-
mate composition of ingredients, feed and fish carcass. Briefly, mois-
ture was calculated as weight loss after samples were oven-dried
to constant weight at 105°C using hot air oven. Crude protein was
determined using micro-Kjeldahl procedure, while crude lipid fol-
lowed Soxhlet extraction procedure using SOCS Plus, SAS-AS 08,
PELICAN, India. Acid–alkali digestion method, carried out in Tulin
Equipments (India), was used for crude fibre determination. Total ash
was determined as loss on ignition after incinerating in muffle fur-
nace at 550°C for 6 hrs. Gross energy was determined using adiaba-
tic bomb calorimeter (CKiC, 5E-AC/PL-C5500). The method of Latta
and Eskin (1980) was used to quantify the phytic acid content of
SCLM. 500 mg finely ground sample of SCLM was extracted on or-
bital shaker (ORBITEK, Scigenics, India) set at 200 rpm for 1 hr using
10 ml of 3.5% HCl. The mixture was centrifuged (Heraeus Megafuge
8R; Thermo Fisher Scientific, USA) at 5000 rpm for 10 min, and
the supernatant was collected. 0.1 ml of supernatant was diluted
with 3 ml distilled water and mixed with 1 ml Wade reagent (0.03%
FeCl3.6H2O + 0.3% sulphosalicylic acid). After 30 min, the mixture
was centrifuged at 5000 rpm for 10 min and the absorbance was
read at 500 nm using Shimadzu–UV spectrophotometer (Thermo
Scientific, USA). The phytic acid content of SCLM was calculated
from calibration curve using sodium phytate as standard. Folin–
Ciocalteu method as described by Makkar et al. (2007) was used in
determining total tannin content. Briefly, 70 mg of dried powdered
sample was extracted in 15 ml distilled water with the application
of gentle heat (70°C) for 30 min. The mixture was centrifuged at
5000 rpm for 10 min. 0.25 ml 1 N Folin–Ciocalteu reagent and 0.5 ml
20% sodium carbonate solution were added to 0.25 ml of diluted
supernatant. The mixture was incubated for 30 min, and the absorb-
ance was read at 700 nm. The total tannin content was estimated
from calibration curve prepared from standard tannic acid solution.
The cyanide content was determined by the titrimetric method of
AOAC (1995). 5 g sample was extracted for 2 hrs at room tempera-
ture on orbital shaker (ORBITEK, Scigenics, India) using 100 ml of
distilled water. Another 100 ml of distilled water was added after
which 150 ml of hydrolysed cyanide from the sample steam was
distilled into 20 ml 0.01 N silver nitrate acidified with 1 ml HNO3.
The excess silver nitrate was back-titrated with 0.02 N KSCN using
ferric alum as indicator. Total HCN was calculated as follows: HCN
OLUDE et al. | 821

(mg/100 g) = (VAgNO3 x 0.27 x 100) / W, where VAgNO3 is the volume from mRNA using RevertAid First-Strand cDNA Synthesis Kit
of silver nitrate used and W is the weight of the sample. (Thermo Scientific, USA) by following manufacturer's instruction, in
which OligodT was used as primer.

2.7 | Growth and nutrient utilization parameters

The following growth and nutrient utilization parameters were cal-
culated according to the relationships given below:
Percentage weight gain (PWG, %) =
[(Final weight (g) − Initial weight(g))∕Initial weight(g)] × 100
Specific growth rate (SGR, %/day) =100(ln W2 – ln W1) / (T2 – T1),
where W1 is the weight at time T1 and W2 is the weight at time T2.
Feed conversion ratio (FCR) = total dry feed fed (g) ∕ total wet weight gained ( g )
Protein efficiency ratio (PER) = wet weight gain (g) ∕ protein fed ( g )
2.8.1 | Quantification of IGF-I and IGF-BPI
The mRNA levels for IGF-I and IGF-BPI in the liver of L. rohita finger-
lings were quantified using relative quantification method in quan-
titative real-time PCR (Agilent AriaMx) system. Reaction mix for
each well contains SYBR Green qPCR Master Mix (5 µl) without ROX
(Thermo Scientific, USA), forward and reverse primers (1 µl each;
Table 2) and nuclease-free water up to 10 µl. β-actin was used as ref-
erence gene as it showed maximum stability in L. Rohita during vari-
ations in feeding trials. Relative mRNA expression was calculated by
ΔΔCt method of Livak and Schmittgen (2001), where ΔCt test sample=
Ctgenein test sample-Ct βin test sample; ΔCtcontrol= Ctgenein control-Ct βin control;
and ΔΔCt= ΔCt testsample-ΔCtcontrol.

2.8 | Total RNA extraction and CDNA synthesis

Fresh liver tissues were collected per treatment replicate and stored
in RNAlater. Approximately 100 mg of the stored liver tissues was
blotted on filter paper and homogenized in 1 ml of TRIzol™ Reagent
(Invitrogen) using a bead mill homogenizer (Bead Ruptor Elite, OMNI
International). 200 µl chloroform was used to separate the aqueous
phase from lipid phase. Centrifugation at 12000 × g for 15 min was
performed after 15-min incubation to separate the layers. The aque-
ous phase was carefully transferred without disturbing the white
middle layer to a fresh sterile centrifuge tube (1.5 ml), and 500 µl
isopropanol was added and centrifuged at 12000 × g for 10 min to
precipitate the nucleic acid. The RNA pellet was washed with 1 ml of
70% ethanol (7000 × g, 5 min) and dissolved in 20–50 µl nuclease-
free water. The purity and concentration of the RNA were checked
using NanoDrop spectrophotometer (NanoDrop™ 2000/2000c;
Thermo Scientific), and the integrity was confirmed by 2% agarose
gel electrophoresis. Total RNA was subjected to DNase treatment
using DNase I (RNase-free, Fermentas) to eliminate any genomic
DNA contamination during preparation following manufacturers’ in-
struction. First-strand complementary DNA (cDNA) was synthesized
2.9 | Data analysis
Generated data were expressed as mean ±standard error. The data
were subjected to one-way analysis of variance using Statistical
Package for Social Sciences (SPSS, version 16) at 95% confidence
level. The level of significance among means was resolved using
Duncan's multiple range test. The second-order polynomial regres-
sion analysis was used to estimate the optimal supplementation of
SCLM in the diet of L. rohita based on the expression of IGF-1 and
IGF-BP1 in the different treatments.
3 | R E S U LT S
3.1 | Proximate composition and antinutritional
factors of experimental diets
SCLM contains higher crude protein content (242.1 g/kg) and crude
fibre (185.3 g/kg) contents relative to those of DORB (155.3 g/kg
and 148.0 g/kg, respectively). The concentrations of phytate, tannins

TA B L E 2 Forward and reverse primer used in real-time gene expression study

Amplicon size Annealing

Gene Accession No. Primer sequence (5’−3’) (bp) temperature (°C)

IGF-I KX455870.1 F CGGCATCGTGGACGAATGC 120 61

R GGTGTCTGTGTGCCGTTCC
IGF-BPI KX065091.1 F GCGCTCTGAAGAGAGGAGAC 138 60
R CCGTTCCAGGATGACACACA
β-actin EU184877.1 F GCCGAGAGGGAAATTGTCCGTGAC 150 60
R TTGCCAATGGTGATGACCTGTCCG
822 | OLUDE et al.

and HCN in cassava leaf meal were 5.57 ± 0.23 g/kg, 0.12 ± 0.01 g/ 2.82 ± 0.77–3.47 ± 0.30, 3.20 ± 0.01–3.34 ± 0.07 and 3.26 ± 0.15–
kg and 0.46 ± 0.02 g/kg, respectively (Table 1). The analysed crude 3.63 ± 0.48, respectively.
protein showed that the diets were isonitrogenous and isoener-
getic with value range of 297.0–304.3 g/kg and 18.15–18.53 MJ/kg,
respectively. 3.4 | IGF-I and IGF-BPI gene expression

The expression of IGF-I and IGF-BPI mRNA in the liver of L. rohita

3.2 | Growth, nutrient utilization, somatic
indices and survival
The growth and nutrient utilization data showed that complete
replacement of DORB with cassava leaf (diet 4 fed group) elic-
ited significantly (p < 0.05) lower growth performance relative
to diet 1 (control) and diet 2 fed groups in terms of percentage
weight gain (98.80 ± 4.11), specific growth rate (1.23 ± 0.04%/day)
and feed conversion ratio (2.51 ± 0.06); these values were, how-
ever, similar (p > 0.05) to those of diet 3 (Table 1). The best PWG
(119.20 ± 6.74%), SGR (1.40 ± 0.05%/day) and FCR (2.20 ± 0.04)
observed in diet 2 fed group were similar (p > 0.05) to those of
diet 1 and diet 3 fed groups (Table 3). Protein efficiency ratio
(PER) was similar (p > 0.05) across the treatments and ranged from
1.34 ± 0.03 in diet 4 to 1.49 ± 0.06 in diet 2 fed group. Similar trend
was also observed in hepatosomatic and intestinal somatic indices,
which ranged between 1.19 ± 0.10–1.38 ± 0.08 and 4.19 ± 0.53–
4.65 ± 0.40, respectively. Treatment did not significantly (p > 0.05)
affect survival among the dietary groups.
3.3 | Proximate composition of carcass
Proximate body composition of L. rohita was not significantly
(p > 0.05) influenced by the dietary treatment; moisture, crude
protein, ether extract total ash and total carbohydrate ranged
from 74.89 ± 0.85–75.33 ± 0.83, 14.95 ± 0.58–15.14 ± 0.11,
fed the experimental diets showed an inverse relationship and was
non-differential (p > 0.05) across the dietary groups. The second-
order polynomial regression analyses for the expression of IGF-I (y
= −3E-06x 2 + 0.0008x + 1.628, R 2 = 0.9774) and IGF-BPI (y = 9E-
06x 2 - 0.003x + 0.7463, R 2 = 0.9839) are shown in Figures 1 and 2.
The maximum value of expression of IGF-I corresponded with SCLM
supplementation level of 133.19 g/kg, while the minimum value of
the expression of IGF-BPI corresponded with SCLM supplementa-
tion level of 166.5 g/kg.
3.5 | Digestive, metabolic and stress
enzyme activities
The intestinal digestive enzyme activities did not vary significantly
(p > 0.05) among the treated experimental fish in terms of amyl-
ase and protease enzyme activities (Table 5). Lowest activities of
amylase (5.08 ± 0.96 U/g protein) and protease (0.28 ± 0.02 U/mg
protein) were observed in the group fed diet 4, while their highest
activities were observed in diet 2 fed group. Hepatic LDH (Table 6)
significantly (p < 0.05) increased in the groups reared on diets 3 and
4 when compared to those reared on diets 1 and 2, while treatment
did not exert any significant (p > 0.05) influence on muscle LDH.
Total replacement of DORB with SCLM (diet 4) resulted in signif-
icantly (p < 0.05) higher level of liver MDH (0.54 ± 0.04) relative
to the control treatment; the value was, however, similar (p > 0.05)
to those obtained with the groups reared on diets 2 and 3. Muscle

TA B L E 3 Growth performance, somatic

Parameter Diet 1 Diet 2 Diet 3 Diet 4
indices and survival of Labeo rohita fed
PWG1 (%) 116.63 ± 3.38a,b 119.20 ± 6.74a,b 106.38 ± 4.41a,b 98.80 ± 4.11a,b sundried cassava leaf meal
SGR 2 (%/day) 1.38 ± 0.03a,b 1.40 ± 0.05a,b 1.29 ± 0.04a,b 1.23 ± 0.04a,b
Feed intake (g) 5.26 ± 0.33 5.31 ± 0.19 5.13 ± 0.16 5.03 ± 0.22
3 a,b a,b a,b
FCR 2.24 ± 0.04 2.20 ± 0.04 2.38 ± 0.08 2.51 ± 0.06a,b
4
PER 1.47 ± 0.03 1.49 ± 0.06 1.39 ± 0.05 1.34 ± 0.03
Survival 97.22 ± 2.78 97.22 ± 2.78 94.44 ± 2.78 97.22 ± 2.78
HSI5 1.38 ± 0.08 1.33 ± 0.09 1.36 ± 0.06 1.19 ± 0.10
6
ISI 4.65 ± 0.40 4.19 ± 0.53 4.30 ± 0.75 4.41 ± 0.90
1
PWG, percentage weight gain.
2
SGR, specific growth rate.
3
FCR, feed conversion ratio.
4
PER, protein efficiency ratio.
5
HSI, hepatosomatic index.
6
ISI, intestinal somatic index; data are expressed as mean±SE.
a,bwithin a row, means with the same letter are not significantly different (p > 0.05).
OLUDE et al. | 823

F I G U R E 1 The expression of IGF-I mRNA in liver of rohu fed graded levels of sundried cassava leaf meal. Data are presented as mean±SE
(n = 3)

F I G U R E 2 The expression of IGF-BPI mRNA in liver of rohu fed graded levels of sundried cassava leaf meal. Data are presented as
mean±SE (n = 3)

MDH followed trend similar to that of liver MDH. The activities of
the liver and muscle AST and ALT were similar (p > 0.05) across treat-
ments. The hepatic antioxidative enzyme activities (Table 5) of the
experimental fish showed increases in the activities SOD and cata-
lase with the increase in inclusion of SCLM. Catalase activity was,
however, similar across treatments, while SOD of L. rohita fed with
diet 1 was significantly lower (p < 0.05) than those fed with diets 3
and 4 but similar (p > 0.05) to the group that received diet 2.
4 | DISCUSSION
The crude protein content (24.2%) of SCLM used in the present
study is within the wide range of the values previously reported for
cassava leaf meal (16–39.9%, Morgan & Choct, 2016) but consid-
erably short of crude protein contents of commonly used protein
ingredients such as groundnut oilcake and soybean meal; thus, it
could only practically be assessed as a substitute to DORB. Beyond
824 | OLUDE et al.

TA B L E 4 Carcass proximate
Diet 1 Diet 2 Diet 3 Diet 4
composition of Labeo rohita (% wet
Moisture 74.89 ± 0.85 74.93 ± 0.05 75.09 ± 0.81 75.33 ± 0.83 weight) fed sundried cassava leaf meal
Crude protein 15.09 ± 0.49 15.14 ± 0.11 15.09 ± 0.56 14.95 ± 0.58
Ether extract 3.16 ± 0.37 3.47 ± 0.30 3.01 ± 0.23 2.82 ± 0.77
Total ash 3.34 ± 0.07 3.20 ± 0.01 3.30 ± 0.20 3.28 ± 0.03
Total CHO 3.51 ± 0.90 3.26 ± 0.15 3.52 ± 0.23 3.63 ± 0.48

Notes:: Data are expressed as mean±SE; CHO, carbohydrate.

consideration of nutrient composition of alternative ingredients, a
major limiting factor is that of their antinutritive contents. Tannins,
phytate and cyanide were observed in the SCLM used in the present
investigation. Tannins are polyphenolic compounds generally found
in most plant leaves (Ghosh & Ray, 2011). They are known to confer
bitter astringent taste on ingredients and thereby limit feed intake
by the animal. They also impair protein digestibility by attacking pro-
teases and by forming complex with proteins (Maitra & Ray, 2003),
ultimately leading to reduced nutrient utilization and growth per-
formance. The observed tannin concentration (0.12 g/kg) of SCLM
under current investigation was very low compared with the levels
(21.2 g/kg) reported by Madalla et al. (2016) who deployed similar
processing technique (grinding and sundrying) on cassava leaf meal.
Cassava leaf tannins are known to vary with cultivars and reduce
considerably with sundrying as a result of fixing of tannins to other
cell polymers during drying, thus reducing the total assayable tannin
(Ravindran, 1993). The statistically poorer growth performance in
terms of percentage weight gain and specific growth rate at com-
plete replacement of DORB with SCLM relative to the groups reared
on diets 1 and 2 is unlikely the result of SCLM tannin. This is be-
cause the total tannin contributed by SCLM at 100% supplemen-
tation was only 0.05 g/kg, which was considerably lower than the
reported quantity of tannin tolerable to L. rohita. Prusty et al. (2007)
had earlier reported that as high as 20 g/kg hydrolysable tannin did
not elicit growth or health compromise in the diet of L. rohita. More
so, feed intake and protease enzyme activity in the present study
were not impaired as observed in the values recorded for these pa-
rameters across treatment. Becker and Makkar (1999) associated a
reduced feed intake in common carp to dietary tannin content of
20 g/kg; Omnes et al. (2017) recently studied the tolerable threshold
of tannins in European Sea bass juveniles and concluded that 10 g/
kg dietary tannin decreased protein digestibility and levels above
20 g/kg inhibited growth performance.
The antinutritive effects of phytates in fish diets have long been
recognized and are well-detailed, for which reason its reduction
in plant-derived ingredients has been the focus of many research.
These effects include the formation of stable complexes with min-
erals, thereby lowering their bioavailability, non-selective formation
of complex with proteins and inhibition of digestive enzymes, result-
ing in impaired nutrient digestibility among others (Dersjant-Li et al.,
2015; Kumar et al., 2011). The level of phytate observed in SCLM in
the present study was 5.57 g/kg, reaching 2.17 g/kg (0.22%) in diet
4. Phytic acid has been reported to impair growth based on its quan-
tity in the diets of agastric fishes; 1% phytic acid lowered growth
performance in L. rohita and C. mrigala (Alvi, 1994), while as low as
0.5% led to similar growth retardation in Cyprinus carpio (Hossain &
Jauncey, 1993). The data relating to intestinal digestive enzyme ac-
tivity suggest that the quantity of phytic acid present under current
investigation did not elicit any significant negative role.
A major scare associated with the use of products from cassava
plant is their content of hydrogen cyanide, which has been reported
to be more in leaf than tubers (Jackson & Chiwona-Karltun, 2018).
The observed hydrogen cyanide content of SCLM under current in-
vestigation was 0.46 g/kg. This value is slightly higher than 0.39 g/
kg reported by Meshram et al. (2018) for sweet potato leaf meal
and lower than the range (0.8–3.2 g/kg dry matter basis) reported
for cassava leaves by Ravindran (1993). Considerably lower values
of hydrogen cyanide, sometimes as low as 0.01 g/kg, have been
reported for cassava leaf by other investigators employing differ-
ent processing methods such as ensiling, sundrying with or with-
out chopping and/or pounding (Bradbury & Denton, 2011, 2014;
Phuc et al., 2000). The levels of hydrocyanic acid in cassava leaf are

TA B L E 5 Digestive and antioxidant

Catalase
enzyme activities of Labeo rohita
Protease Amylase SOD (liver) (liver)
fingerlings fed cassava leaf meal
Diet 1 0.35 ± 0.02 5.64 ± 1.14 11.30 ± 0.54a,b,c 2.55 ± 0.39
a,b,c
Diet 2 0.38 ± 0.06 6.68 ± 1.03 12.44 ± 0.95 2.74 ± 0.18
Diet 3 0.30 ± 0.01 6.10 ± 1.56 14.92 ± 1.53a,b,c 2.96 ± 0.50
a,b,c
Diet 4 0.28 ± 0.02 5.08 ± 0.96 16.11 ± 0.05 3.30 ± 0.70

Notes:: Data are expressed as mean±SE.

a,b,cwithin a column, means with the same letter are not significantly different (p > 0.05). Protease
was expressed as millimole of tyrosine released/min/mg protein; amylase as micromole of maltose
released/min/g protein; SOD, superoxide dismutase as micromoles/mg protein /min; catalase as
nanomoles H2O2 decomposed/min/mg of protein.
OLUDE et al.
TA B L E 6 Metabolic enzyme activities of liver and muscle of Labeo rohita fingerlings fed sundried cassava leaf meal
LDH(L) LDH(M) MDH(L)
a,b,c a,b,c
Diet 1 1.43 ± 0.02 9.90 ± 1.34 0.33 ± 0.04
a,b,c a,b,c
Diet 2 1.28 ± 0.16 8.64 ± 0.94 0.49 ± 0.10
Diet 3 2.23 ± 0.13a,b,c 10.15 ± 1.04 0.47 ± 0.02a,b,c
a,b,c a,b,c
Diet 4 2.44 ± 0.18 10.21 ± 1.22 0.54 ± 0.04
Notes:: Data are expressed as mean±SE.
L, liver; M, muscle.
a,b,cwithin a row, means with the same letter are not significantly different (p > 0.05); specific activities of LDH (lactate dehydrogenase) were
expressed as unit min-1 mg protein-1 at 370C; specific activities of MDH (malate dehydrogenase) were expressed as unit min-1 mg protein-1 at 370c;
specific activities of AST (aspartate aminotransferase) were expressed as nanomoles of oxaloacetate released/min/mg protein at 37 °C; and specific
activities of ALT (alanine aminotransferase) were expressed as nanomoles of sodium pyruvate released/min/mg protein at 37 °C.
known to vary with strain or variety, agricultural practice, maturity
of plants, environmental conditions, nutritional status of the plants
and processing methods after harvest (Montagnac et al., 2009; Ngiki
et al., 2014). At the highest level of SCLM supplementation in the
diet of rohu in the present study, 0.14 g/kg HCN was recorded.
Although the dosage of hydrocyanic acid most fish species can tol-
erate has not been firmly established, Lukuyu et al. (2014) suggested
that monogastrics generally could cope satisfactorily, without im-
pairing growth and other production traits, with HCN levels below
0.1 g/kg in their diets. Under severe conditions, cyanide is known to
induce asphyxiation and preclude tissue utilization of oxygen by in-
hibiting cellular respiratory enzyme, cytochrome oxidase, leading to
rapid mortalities in animals (Egekeze & Oehme, 1980). The observed
mortalities under current investigation were not high, non-differ-
ential, recorded at different time during the feeding trial and did
not follow trend that could be associated with dietary inclusion of
SCLM. Thus, there is no acute dietary cyanide toxicity in the present
study and the slight mortality recorded could have been the result
of handling stress. In a chronic scenario, dietary cyanide could result
in growth depression as a result of amino acid imbalance created
during cyanide detoxification, a process in which cyanide reacts
with thiosulphate to form thiocyanate using methionine as a sulphur
donor (Madalla et al., 2016; Oke, 1978; Ravindran, 1993). Although
it has been established by several authors that cassava leaf meal is
deficient in methionine (Ravindran, 1993; Morgan & Choct, 2016), a
situation that can further aggravate the imbalance of amino acid in
diets supplemented with cassava leaf meal, it is unclear whether the
observed growth depression at the highest level of SCLM supple-
mentation was as a result cyanide. This is because SCLM in the pres-
ent study served as carbohydrate rather than protein source and all
the treatment contained similar quantity of defatted soybean meal.
Further, Suprayudi et al. (2015) observed a growth performance
comparable to the control diet when they fed defatted rubber
seed meal containing 4.5 g/kg cyanide to Cyprinus carpio juvenile.
Similarly, Meshram et al. (2018) reported a growth performance and
nutrient utilization comparable to the control diet in the group of L.
rohita reared on diets in which unprocessed sweet potato meal, con-
taining as much as 0.12 g/kg cyanide, replaced DORB.
| 825
MDH(M) AST(L) AST(M) ALT(L) ALT(M)
a,b,c
0.81 ± 0.01 9.25 ± 0.66 35.54 ± 4.23 7.94 ± 1.01 32.36 ± 4.52
a,b,c
0.94 ± 0.01 9.56 ± 0.50 33.32 ± 2.61 7.66 ± 1.42 34.97 ± 2.82
1.20 ± 0.03a,b,c 9.54 ± 1.02 34.94 ± 3.60 7.63 ± 0.10 34.51 ± 4.28
a,b,c
1.40 ± 0.19 9.88 ± 1.01 33.63 ± 0.77 7.53 ± 1.46 35.31 ± 3.40
IGF-I is an evolutionarily ancient growth factor whose expression
is profoundly affected by nutritional status (Duan, 1998; Kumar et al.
2018; Meshram et al., 2018). Many studies have shown the lower ex-
pression of IGF-I in food-deprived or food-restricted fish (Duan, 1998;
Peterson & Waldbieser, 2009). Moreover, incorporation of novel ingre-
dients, which serves as alternatives to the conventional ones, especially
those that are plant-derived, has been implicated in the downregulation
of IGF-I. For instance, Sheikhlar et al. (2018) observed a lowered ex-
pression of IGF-I when they replaced 26% or more of fish meal with
fenugreek seed meal in the diets of Clarias gariepinus fingerlings. Also,
Kumar et al. (2016) reported a decreased growth performance, which
corresponded to a lowered IGF-I expression when fish meal was com-
pletely replaced with either soybean meal or processed animal protein
in the diets for European catfish, Silirus glanis. IGF-BPI, on the other
hand, is a negative regulator of growth in teleosts that is often upreg-
ulated as a result of nutrient deprivation and/or amino acid deficiency
(Garcia de la Serrana & Macqueen, 2018). They are induced under
conditions of food deprivation, malnutrition, protein restriction and
hypoxia among other stressful conditions (Kajimura and Duan, 2007).
The expression of IGF-I in the liver of L. rohita in the present study fol-
lowed the pattern of the growth performance data, which showed a
trend of decrease at higher inclusion (diets 3 and 4) of SCLM; albeit,
the decrease observed was insignificant. Similarly, the expression of
IGF-BPI was non-differential and was inversely related to the growth
performance data. However, the second-order polynomial regression
analysis of the expression of IGF-I and IGF-BPI suggests that the levels
of supplementation of SCLM beyond 166.5 g/kg in the diets of rohu
are suboptimal. The results of this study are in agreement with the ob-
servation of Meshram et al. (2018), which showed similar expression
in IGF-I of L. rohita fed DORB control and diet in which the DORB was
completely replaced with unprocessed sweet potato leaf meal.
The results of carcass crude protein and ether extract also showed
insignificant variations with the increase in inclusion of SCLM. Previous
studies incorporating novel ingredients and those assessing dietary ef-
fects of antinutrients have associated significant decreases in carcass
crude protein and body fat deposition to poor dietary utilization of
these nutrients with concomitant depletion of lipid store and liver gly-
cogen, leading to reduced HSI (Fawole et al., 2016; Omnes et al., 2017).
826 | OLUDE et al.
Activities of metabolic enzymes may provide information
about the ability of an organism to utilize and cope with novel in-
gredients. Increased activities of LDH and MDH are usually the
consequence of some form of stressful conditions such as hypoxia,
starvation, malnutrition, suboptimal temperature, over-stock-
ing and other suboptimal rearing conditions (Fawole et al., 2016;
Shamna et al., 2015). Higher inclusion of SCLM (diets 3 and 4) sig-
nificantly increased hepatic LDH and MDH and muscle MDH rel-
ative to the group that received the control diet. This could have
been the result of stress caused by residual dietary cyanide. Dube
et al. (2013) reported a significantly elevated LDH in liver, muscle
and gill of L. rohita exposed to sublethal concentrations of cya-
nide. They attributed the increased tissue LDH to a switchover of
metabolic pathways towards compensatory mechanisms, a situa-
tion that cannot be ruled out under current investigation. The liver
and muscle transaminases (AST and ALT) were not significantly
influenced by the dietary treatments. This result is consistent with
that of protein efficiency ratio, which showed similarity across
treatments in the present study. The result suggests that protein
metabolism was not impaired by dietary SCLM. It is a well-docu-
mented fact that transaminases are found in the liver and mus-
cle tissues where they catalyse the reversible reaction between
amino groups and α-keto acids; their reduced activities usually
suggest dietary deficiency of key amino acids (Kumar et al., 2016;
Lin & Luo, 2011).
Catalase and SOD are primary antioxidant enzymes that act
dependently in the removal of reactive oxygen species and as such
are good indicators of oxidative stress (Olsvik et al., 2011). In the
present study, activities of catalase and SOD of the liver tend to
increase with increase in dietary inclusion of SCLM. However, the
increase observed in catalase activity was not significant, whereas
diet 4 significantly increased the SOD activity relative to diet 1.
Increased antioxidant enzyme activity has previously been re-
ported by many investigators assessing the suitability of many
plant-derived alternative ingredients in aquafeed. For instance,
Shamna et al. (2017) reported significant increase in the activi-
ties of catalase and SOD as a result of feeding 200 g/kg jatropha
protein concentrate to L. rohita. They attributed the increase to
phorbol ester content of the concentrate. Similarly, Kokou et al.
(2015) reported a significant increase in hepatic antioxidant en-
zyme activity of Sparus aurata fed soybean protein as a replace-
ment to fishmeal. The observed increase in SOD and catalase in
the present study might be a compensatory response to remove
reactive oxygen species induced by toxic principles present in
SCLM and thus prevent the fish from oxidative stress as previously
elucidated by Livingstone (2001).
5 | CO N C LU S I O N
The results of the present study showed a significant compromise in
growth performance when SCLM (390 g/kg) was incorporated as a
replacement for DORB in the diets of L. rohita fingerlings. Although
the activities of intestinal digestive enzymes and liver and muscle
transaminases of Labeo rohita fingerlings were not significantly influ-
enced by feeding graded levels of SCLM as substitute for DORB, the
inclusion levels of 260 g/kg (diet 3) and 390 g/kg (diet 4) remarkably
elicited cellular and oxidative stress. This was observed in the signifi-
cantly elevated activities of glycolytic enzymes (LDH and MDH) and
SOD in those groups reared on diets 3 and 4. The stress could have
resulted from the residual cyanide content of the SCLM, pointing to
the importance of adequate detoxification of cassava leaf meal before
they are incorporated in aquafeed. In this regard, it is gratifying to note
that many cassava varieties with minimal quantities of cyanide have
already been developed (Oresegun et al. 2016) and currently enjoying
wide acceptance among cassava farmers. Based on the second-order
polynomial regression analysis on IGF-I and IGF-BPI, it was concluded
that up to 166.5 g/kg SCLM can be incorporated as a substitute for
DORB for optimal growth of L. rohita fingerlings.
AC K N OW L E D G E M E N T S
The first author gratefully acknowledges the Department of
Biotechnology, India, and The World Academy of Sciences (DBT-
TWAS) for postdoctoral research fellowship and the management
of the University of Lagos, Nigeria, for granting study leave. The au-
thors gratefully acknowledge the Director of ICAR-CIFE for provid-
ing the support necessary for the completion of this research work.
DATA AVA I L A B I L I T Y S TAT E M E N T
The data supporting the findings of this study are available upon
reasonable request from the corresponding author.
ORCID
Oluwagbenga Olanrewaju Olude https://orcid.
org/0000-0002-1618-4989
Pallath Muhammed Nuzaiba https://orcid.
org/0000-0001-5653-9652
REFERENCES
Adewusi, S. R. A., & Bradbury, J. H. (1993). Carotenoids in cassava:
Comparison of open-column and HPLC methods of analysis. Journal
of the Science of Food and Agriculture, 62, 375–383.
Alvi, A. S. (1994). Adventitious toxins in plant origin feedstuffs:
Quantification and tolerance level in fish. [Masters Dissertation].
Aligarh Muslim University, , p. 325.
AOAC, Association of Official Analytical Chemist. (1990). Official meth-
ods of analysis of AOAC. K. Helrich (Ed.), (15th edn, Vol. 1, p. 1094). .
AOAC, Association of Official Analytical Chemist. (1995). Official meth-
ods of analysis of AOAC. 16th edn No. 915.03. .
Becker, K., & Makkar, H. P. S. (1999). Effects of dietary tannic acid and
quebracho tannin on growth performance and metabolic rates of
common carp (Cyprinus carpio L.). Aquaculture, 175, 327–335.
Béné, C., Arthur, R., Norbury, H., Allison, E. H., Beveridge, M., Bush, S.,
… Williams, M. (2016). Contribution of fisheries and aquaculture
to food security and poverty reduction: Assessing the current evi-
dence. World Development, 79, 177–196.
Bradbury, J. H., & Denton, I. C. (2011). Mild methods of processing cas-
sava leaves to remove cyanogens and conserve key nutrients. Food
Chemistry, 127, 1755–1759.
OLUDE et al.
Bradbury, J. H., & Denton, I. C. (2014). Mild method for removal of cy-
anogens from cassava leaves with retention of vitamins and pro-
tein. Food Chemistry, 158, 417–420.
Dersjant-Li, Y., Awati, A., Schulze, H., & Partridge, G. (2015). Phytase in
non-ruminant animal nutrition: A critical review on phytase activi-
ties in the gastrointestinal tract and influencing factors. Journal of
the Science of Food and Agriculture, 95(5), 878–896.
Drapeau, G. (1974). Protease from Staphylococcus aureus. In B. L. Lorand
(Ed.), Methods in enzymology, Vol. 45B (p. 469). Academic Press.
Duan, C. (1998). Nutritional and developmental regulation of insulin-like
growth factors in fish. Journal of Nutrition, 128, 306S–314S.
Dube, P. N., Shwetha, A., & Hosetti, B. B. (2013). Effect of exposure to
sublethal concentrations of sodium cyanide on the carbohydrate
metabolism of the Indian Major Carp Labeoro hita (Hamilton, 1822).
Pesqui Vet Bras, 33(7), 914–919.
Egekeze, J. O., & Oehme, F. W. (1980). Cyanides and their toxicity: A lit-
erature review. The Veterinary Quarterly, 2, 104–111.
FAO. (2013). Save and grow: Cassava – A guide to sustainable production
intensification. .
FAO. (2017). Food outlook - Biannual report on global food markets. .
FAO. (2018). The state of world fisheries and aquaculture 2018 - meeting the
sustainable development goals. .
Fawole, F. J., Sahu, N. P., Jain, K. K., Gupta, S., Shamna, N., Phulia,
V., & Prabu, D. L. (2016). Nutritional evaluation of protein isolate
from rubber seed in the diet of Labeo rohita: effects on growth
performance, nutrient utilization, whole body composition and
metabolic enzymes activity. Animal Feed Science and Technology,
219, 189–199.
Garcia de la Serrana, D. & Macqueen, D. J. (2018). Insulin-like growth
factor-binding proteins of teleost fishes. Frontiers in Endocrinology,
9, 80. https://doi.org/10.3389/fendo.2018.00080
Ghosh, K., & Ray, A. K. (2011). Tannins in plant feed ingredients: facts
and probable consequences in fish nutrition. In G. K. Petridis (Ed.),
Tannins: Types, foods containing, and nutrition (pp. 265–280). Nova
Science Publishers Inc.
Hossain, M. A., & Jauncey, K. (1993). The effects of varying dietary
phytic acid, calcium and magnesium levels on the nutrition of com-
mon carp, Cyprinus carpio. In INRA (Ed.), Fish nutrition in practice,
IV international symposium on fish nutrition and feeding (705–715). .
Jackson, J., & Chiwona-Karltun, L. (2018). Cassava production, process-
ing and nutrition. Handbook of Vegetables and Vegetable Processing,
609–632. https://doi.org/10.1002/97811​19098​935.ch26
Kajımura, S., & Duan, C. (2007). Insulin-like growth factor-binding pro-
tein-1: An evolutionarily conserved fine tuner of insulin-like growth
factor action under catabolic and stressful conditions. Journal of
Fish Biology, 71, 309–325.
Kokou, F., Sarropoulou, E., Cotou, E., Rigos, G., Henry, M., Alexis, M., &
Kentouri, M. (2015). Effects of fish meal replacement by a soybean
protein on growth, histology, selected immune and oxidative sta-
tus markers of gilthead sea bream. Journal of the World Aquaculture
Society, 46, 115–128.
Kumar, S., Sahu, N. P., Shamna, N., & Ranjan, A. (2018). Feeding higher
level of de-oiled rice bran causes stress to Labeo rohita fingerlings.
Aquaculture, 484, 184–190.
Kumar, S., SándorZs, J., Nagy, Z., Fazekas, G., Havasi, M., Sinha, A. K.,
& Gál, D. (2016). Potential of processed animal protein versus
soybean meal to replace fish meal in practical diets for European
catfish (Silurus glanis): Growth response and liver gene expression.
Aquaculture Nutrition, 23, 1179–1189. https://doi.org/10.1111/
anu.12487
Kumar, V., Sinha, A. K., Makkar, H. P. S., De Boeck, G., & Becker, K. (2011).
Phytate and phytase in fish nutrition. Journal of Animal Physiology
and Animal Nutrition, 96, 335–364.
Latta, M., & Eskin, M. (1980). A simple and rapid colorimetric determi-
nation of phytate determination. Journal of Agriculture and Food
Chemistry, 28, 1313–1315.
| 827
Lin, S., & Luo, L. (2011). Effects of different levels of soybean meal in-
clusion in replacement for fish meal on growth, digestive enzymes
and transaminase activities in practical diets for juvenile tilapia,
Oreochromis niloticus × O. aureus. Animal Feed Science and Technology,
168, 80–87. https://doi.org/10.1016/j.anife​edsci.2011.03.012
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expres-
sion data using realtime quantitative PCR and the 2(-Delta Delta
C(T)) method. Methods, 25, 402–408.
Livingstone, D. R. (2001). Contaminant-stimulated reactive oxygen spe-
cies production and oxidative damage in aquatic organisms. Marine
Pollution Bulletin, 42(8), 656–666, ISSN 0025–326X.
Lowry, O. H., Rosebrough, N. J., Farr, A. L., & Randall, R. J. (1951).
Protein measurement with the Folin phenol reagent. The Journal of
Biological Chemistry, 193(1), 265–275.
Lukuyu, B., Okike, I., Duncan, A., Beveridge, M., & Blümmel, M. (2014).
Use of cassava in livestock and aquaculture feeding programs. ILRI
Discussion Paper 25. : International Livestock Research Institute.
Madalla, N., Agbo, N. W., & Jauncey, K. (2016). Evaluation of ground
- sundried cassava leaf meal as protein source for Nile Tilapia
Oreochromis niloticus (L) Juvenile’s diet Tanzania. Journal of
Agricultural Sciences, 15(1), 1–12.
Maiti, M. K., Sahu, N. P., Sardar, P., Shamna, N., Deo, A. D., Gopan, A.,
& Sahoo, S. (2019). Optimum utilization of hygrophila spinosa
leaf meal in the diet of Labeo rohita (Hamilton, 1822) fingerlings.
Aquaculture Reports, 15, 100213.
Maitra, S., & Ray, A. K. (2003). Inhibition of digestive enzymes in rohu,
Labeo rohita (Hamilton) fingerlings by tannin, an in vitro study.
Aquaculture Research, 34, 93–95.
Makkar, H. P. S., Siddhuraju, P., & Becker, K. (2007). Tannins. In Plant
secondary metabolites. Methods in molecular biology (Vol. 393, pp.
67–82). : Humana Press Inc.
Meshram, S., Deo, A. D., Kumar, S., Aklakur, M., & Sahu, N. P. (2018).
Replacement of de-oiled rice bran by soaked and fermented sweet
potato leaf meal: effect on growth performance, body composi-
tion and expression of insulin-like growth factor 1 in Labeo rohita
(Hamilton), fingerlings. Aquaculture Research, 49(8), 2741–2750.
Montagnac, J. A., Davis, C. R., & Tanumihardjo, S. A. (2009). Processing
techniques to reduce toxicity and antinutrients of cassava for use
as a staple food. Comprehensive Reviews in Food Science and Food
Safety, 8(1), 17–27.
Morgan, N. K., & Choct, M. (2016). Cassava: nutrient composition and
nutritive value in poultry diets. Animal Nutrition, 2(4), 253–261.
Ng, W. K., & Wee, K. L. (1989). The nutritive value of cassava leaf meal in
pelleted feed for Nile tilapia. Aquaculture, 83(1–2), 45–58.
Ngiki, Y. U., Igwebuike, J. U., & Moruppa, S. M. (2014). Utilization of cas-
sava products for poultry feeding: A review. International Journal of
Science and Technology, 2(6), 48–59.
Nhassico, D., Muquingue, H., Cliff, J., Cumbana, A., & Bradbury, J. H.
(2008). Rising African cassava production, diseases due to high cy-
anide intake and control measures. Journal of the Science of Food and
Agriculture, 88, 2043–2049.
Ochoa, S. (1955). Methods of enzymology. In S. P. Colowick, & N. O.
Kapalan (Eds.), (Vol. 1, p. 735). Academic press Inc.
Oke, O. L. (1978). Problems in the use of cassava as animal feed. Animal
Feed Science and Technology, 3, 345–380.
Olsvik, P. A., Torstensen, B. E., Hemre, G. I., Sanden, M., & WaagbØ, R.
(2011). Hepatic oxidative stress in Atlantic salmon (Salmo salar L.)
transferred from a diet based on marine feed ingredients to a diet
based on plant ingredients. Aquaculture Nutrition, 17, e424–e436.
Omnes, M. H., Le Goasduff, J., Le Delliou, H., Le Bayon, N., Quazuguel,
P., & Robin, J. H. (2017). Effects of dietary tannin on growth, feed
utilization and digestibility, and carcass composition in juvenile
European seabass (Dicentrarchuslabrax L.). Aquaculture Reports, 6,
21–27.
Oresegun, A., Fagbenro, O. A., Ilona, P., & Bernard, E. (2016). Nutritional
and anti-nutritional composition of cassava leaf protein concentrate
828 | OLUDE et al.
from six cassava varieties for use in aqua feed. Cogent Food &
Agriculture, 2, 1147323.
Peterson, B. C., & Waldbieser, G. C. (2009). Effects of fasting on IGF-I,
IGF-II, and IGF binding protein mRNA concentrations in channel
catfish (Ictalurus punctatus). Domestic Animal Endocrinology, 37,
74–83.
Phuc, B., Ogle, B., & Lindberg, J. (2000). Effect of replacing soybean pro-
tein with cassava leaf protein in cassava root meal based diets for
growing pigs on digestibility and N retention. Animal Feed Science
and Technology, 83, 223–235.
Prusty, A. K., Sahu, N. P., Pal, A. K., Reddy, A. K., & Kumar, S. (2007).
Effect of dietary tannin on growth and haemato-immunological pa-
rameters of Labeo rohita (Hamilton) fingerlings. Animal Feed Science
and Technology, 136, 96–108.
Ramakrishna, R., Shipton, T. A., & Hasan, M. R. (2013). Feeding and feed
management of Indian major carps in Andhra Pradesh, India. FAO
Fisheries and Aquaculture Technical Paper No. 578. , FAO. 90 pp.
Ravindran, V. (1991). Preparation of cassava leaf products and their use
as animal feeds. Roots, Tubers, plantain and bananas in animal feed-
ing, vol. 95, Food and Agriculture Organisation, , pp. 111–125.
Ravindran, V. (1993). Cassava leaves as animal feed: Potential and lim-
itation. Journal of the Science of Food and Agriculture, 61, 141–150.
Rick, W., & Stegbauer, H. P. (1974). Amylase measurement of reducing
groups. In H. V. Bergmeyer (Ed.), Methods of Enzymatic Analysis, Vol.
2, 2nd ed. (pp. 885–889). Academic Press.
Shamna, N., Sardar, P., Sahu, N. P., Pal, A. K., Jain, K. K., & Phulia, V. (2015).
Nutritional evaluation of fermented Jatropha protein concentrate
in Labeo rohita fingerlings. Aquaculture Nutrition, 21(1), 33–42.
Shamna, N., Sardar, P., Sahu, N. P., Phulia, V., Rajesh, M., Fawole, F. J.,
& Angel, G. (2017). Haemato-immunological and physiological re-
sponses of Labeo rohita fingerlings to dietary fermented Jatropha
curcas protein concentrate. Animal Feed Science and Technology,
232, 198–206. https://doi.org/10.1016/j.anife​edsci.2016.10.020
Sheikhlar, A., Goh, Y. M., Ebrahimi, M., Romano, N., Webster, C. D.,
Alimon, A. R., … Javanmard, A. (2018). Replacement of dietary fish-
meal for fenugreek seed meal on the growth, body composition,
innate immunological responses and gene expression of hepatic
insulin-like growth factors in African catfish (Clarias gariepinus).
Aquaculture Nutrition, 24(6), 1718–1728.
Suprayudi, M. A., Inara, C., Ekasari, J., Priyoutomo, N., Haga, Y., Takeuchi,
T., & Satoh, S. (2015). Preliminary nutritional evaluation of rubber
seed and defatted rubber seed meals as plant protein sources for
common carp Cyprinus carpio L. juvenile diet. Aquaculture Research,
46, 2972–2981. https://doi.org/10.1111/are.12452
Takahara, S., Hamilton, H. B., Neel, J. V., Kobara, T. Y., Ogura, Y., &
Nishimura, E. T. (1960). Hypocatalasemia, a new genetic carrier
state. Journal of Clinical Investigation, 39, 610–619.
Wooten, I. J. P. (1964). Microanalysis in medical biochemistry. J and A
Churchill Ltd.
Wroblewski, F., & Laude, J. S. (1955). Lactate dehydrogenase activity
in blood. Proceedings of the Society for Experimental Biology and
Medicine, 90, 210–213.
Younas, A., Bhatti, M. S., Ahmed, A., & Randhawa, M. A. (2011). Effect
of rice bran supplementation on cookie baking quality. Pakistan
Journal of Agriculture Science, 48(2), 129–134.
How to cite this article: Olude OO, Sahu NP, Nuzaiba PM,
Krishna G. Feeding sundried cassava leaf meal as a
replacement for de-oiled rice bran in the diets of rohu, Labeo
rohita, fingerlings: effect on growth, enzyme activities and
gene expression of igf-i and igf-bpi. Aquacult Nutr.
2021;27:817–828. https://doi.org/10.1111/anu.13226